|
J Biol Chem, Vol. 274, Issue 13, 8561-8569, March 26, 1999
Oxidation Regulates the Inflammatory Properties of the Murine
S100 Protein S100A8*
Craig A.
Harrison ,
Mark J.
Raftery ,
John
Walsh ,
Paul
Alewood§,
Siiri E.
Iismaa ¶,
Soula
Thliveris , and
Carolyn L.
Geczy
From the Cytokine Research Unit, School of Pathology,
The University of New South Wales, Kensington, New South Wales 2052 and the § Centre for Drug Design and Development, The
University of Queensland, St. Lucia, Queensland 4072, Australia
 |
ABSTRACT |
The myeloid cell-derived calcium-binding murine
protein, S100A8, is secreted to act as a chemotactic factor at
picomolar concentrations, stimulating recruitment of myeloid cells to
inflammatory sites. S100A8 may be exposed to oxygen metabolites,
particularly hypochlorite, the major oxidant generated by activated
neutrophils at inflammatory sites. Here we show that hypochlorite
oxidizes the single Cys residue (Cys41) of S100A8.
Electrospray mass spectrometry and SDS-polyacrylamide gel
electrophoresis analysis indicated that low concentrations of
hypochlorite (40 µM) converted 70-80% of S100A8 to the
disulfide-linked homodimer. The mass was 20,707 Da, 92 Da more than
expected, indicating additional oxidation of susceptible amino acids
(possibly methionine). Phorbol 12-myristate 13-acetate activation of
differentiated HL-60 granulocytic cells generated an oxidative burst
that was sufficient to efficiently oxidize exogenous S100A8 within 10 min, and results implicate involvement of the myeloperoxidase system.
Moreover, disulfide-linked dimer was identified in lung lavage fluid of mice with endotoxin-induced pulmonary injury. S100A8 dimer was inactive
in chemotaxis and failed to recruit leukocytes in vivo. Positive chemotactic activity of recombinant Ala41S100A8
indicated that Cys41 was not essential for function and
suggested that covalent dimerization may structurally modify
accessibility of the chemotactic hinge domain.
Disulfide-dependent dimerization may be a physiologically significant regulatory mechanism controlling S100A8-provoked leukocyte recruitment.
 |
INTRODUCTION |
Murine S100A8, also known as CP-10 (chemotactic protein, 10 kDa),
myeloid-related protein 8, and calgranulin A (1), is a small acidic
protein containing two Ca2+-binding EF hands belonging to
the highly conserved S100 protein family (2). Most S100 proteins appear
to function as intracellular calcium-modulated proteins that may
regulate diverse functions including cell growth, differentiation,
energy metabolism, cytoskeletal-membrane interactions, and kinase
activities (1, 3). Extracellular activities have been ascribed to at
least five family members, and since our description of the chemotactic
activity of S100A8, similar functions for S100A2 (S100L, chemotactic
for guinea pig eosinophils) and S100A7 (psoriasin, chemotactic for
human CD4+ T lymphocytes and neutrophils) have been
reported (4, 5). S100B is an extracellular neurotrophic factor, and
mitogen (6) and human S100A8 and S100A9 are antimicrobial and
cytostatic (7) and have been associated with inflammatory pathologies
(reviewed in Ref. 8).
S100A8 is constitutively expressed with S100A9 in neutrophils. It is
up-regulated by bacterial lipopolysaccharide
(LPS)1 and interleukin 1 in
macrophages (9) and microvascular endothelial cells (10) and has been
associated with neutrophil recruitment in abscess formation (11) and
bleomycin lung (12). Our recent experiments also indicate an important
role for S100A8 in embryogenesis where it is expressed by migrating
trophoblasts, and deletion of the gene was lethal at
mid-gestation.2 We recently
demonstrated S100A8 secretion from LPS-activated murine macrophages
(9), and in the absence of a secretion signal sequence, Rammes et
al. (13) proposed a novel tubulin-dependent pathway
for S100A8/A9 release from activated human monocytes which may provide
a paradigm for the secretion of other S100 proteins.
S100A8 was isolated as a soluble product of activated murine spleen
cells (14) and in the picomolar range stimulates myeloid cell
chemotaxis in vitro (15) and a sustained leukocyte
recruitment, with mononuclear cell infiltration following an early
influx of neutrophils, in vivo (15, 16). Together with
TGF- , it is one of the most potent chemotactic factors described. In
contrast to the classical chemoattractants such as fMet-Leu-Phe, C5a,
and the chemokines, S100A8 and TGF- affect cytoskeletal actin
polymerization and cell migration without causing degranulation and
activation (17).
ApoS100 proteins form antiparallel, noncovalently linked dimers in
solution (18, 19), and at physiological concentrations in reducing
environments, S100B would most likely exist as a non-covalent homodimer
(20). In contrast, the extracellular neurotrophic and mitogenic
activities of S100B are dependent on redox status and inter- or
intrachain disulfide bond formation (6, 21). Although there is no
structural information, disulfide-mediated dimerization may also
regulate some extracellular functions of other S100 proteins (19).
Noncovalent heteromeric complexes of human S100A8 and S100A9
(also known as myeloid-related protein 14 and calgranulin B (1)) have
been characterized (22) and are thought to represent the functional
form, even though these proteins are not always coordinately expressed
(23). Our recent experiments confirm the propensity of murine S100A8 to
form non-covalent dimers in solution, and this property is independent
of calcium and covalent disulfide bond formation (24). Murine S100A8
comprises 88 amino acids with a single cysteine residue at position 41 (14). Here we show that the monomeric (non-covalent dimeric) form of
S100A8 was functional, whereas the oxidized homodimer was
chemotactically inactive. S100A8 was readily oxidized by hypochlorite,
a myeloperoxidase product generated by activated neutrophils and
macrophages and implicated in the pathogenesis of inflammation and
atherogenesis (25, 26). The efficiency by which stimulated neutrophils
oxidized exogenous S100A8 suggests that the redox status of
Cys41 of S100A8 may represent a physiologically relevant
regulatory mechanism controlling S100A8-provoked leukocyte recruitment
in vivo.
 |
EXPERIMENTAL PROCEDURES |
Materials
RPMI 1640 and fetal bovine serum were purchased from Life
Technologies, Inc. Hanks' balanced salt solution (HBSS), HBSS (without CaCl2 and MgCl2), bovine serum albumin, sodium
hypochlorite, dimethyl sulfoxide (Me2SO), phorbol
12-myristate 13-acetate (PMA), N-ethylmaleimide (NEM), and
Triton X-100 were purchased from Sigma. T4 DNA ligase, restriction
enzymes, and Complete protease inhibitors were obtained from Boehringer
Mannheim (Mannheim, Germany), and thioglycollate was from Difco.
S100A8 Analogues
Preparation and isolation of recombinant (r)S100A8 is described
in detail (27, 28). Synthetic S100A8 and the -aminobutyric acid
derivative (Aba41S100A8) will be described
elsewhere.3 All S100A8
preparations were homogeneous by SDS-PAGE and ESI-MS analysis.
Recombinant proteins differed from their synthetic and native
counterparts by an additional dipeptide, Gly-Ser, at the N terminus
(27), and these residues were designated as positions 2 and 1.
For Ala41S100A8 the oligonucleotide-directed mutagenesis
was performed using the double take double-stranded mutagenesis kit from Stratagene (La Jolla, CA). Briefly, plasmid pS100A8-9 containing a
286-base pair BamHI fragment encoding the S100A8 cDNA
(27) was linearized at the unique ScaI restriction enzyme
site in the ampicillin resistance gene, biotinylated at the 3' ends
with terminal deoxynucleotidyl transferase, purified from free
biotinylated nucleotide using avidin-coated beads, and separated into
single strands by alkali denaturation. A ScaI extension
primer complementary to the terminal 18 bases of the 3' end of the
template strand (5'-ACTCACCAGTCACAGAAA-3') and the Ala mutagenic primer
complementary to the same strand and containing base changes that alter
codon specificity from Cys41 to Ala41
(5'ACAAACTGAGGAGCCTCAGT AGTGAC-3') were annealed to the
captured template strand and extended with T7 DNA polymerase and T4 DNA ligase. The strands were denatured using NaOH, and the mutant strand
was collected in the supernatant. A ScaI bridging primer containing 18 bases complementary to the ScaI extension
primer and 6 bases complementary to the first 6 bases on the other side of the ScaI site (5'-TTTCTGTGACTGGTGAGTACTCAA-3') was
annealed to the mutant strand thereby recircularizing the strand and
extended with T7 DNA polymerase and T4 DNA ligase. The double-stranded closed circular molecules incorporating the mutation in both strands were transformed into XL-1 Blue Escherichia coli
(Stratagene). The sequence of the mutated cDNA insert of one such
recombinant, designated pS100A8-9.1, was verified by the chain
termination method of DNA sequencing prior to subcloning into the
BamHI site of the Glutagene pGEX2T bacterial expression
vector (AMRAD Pharmacia Biotech, Melbourne, Australia) to produce the
recombinant expression plasmid pAla41S100A8.
High Performance Liquid Chromatography (HPLC)
All liquid chromatographic separations were performed using a
non-metallic LC 625 HPLC system and UV absorbance monitored at 214 and
280 nm with a Waters 490 UV/visible detector. Samples were analyzed by
C4 RP-HPLC using a Vydac 300 Å, 5 µm, 250 × 4.6 mm, C4 reverse
phase column and gradient of 25-70% acetonitrile (0.1%
trifluoroacetic acid) at 1 ml/min over 30 min. Fractions with major
A214 nm were collected manually.
Mass Spectrometry
Electrospray ionization (ESI)-mass spectra were acquired using a
single quadrupole mass spectrometer equipped with an electrospray ionization source (Platform, VG-Fisons Instruments, Manchester, UK).
Samples (~50 pmol, 10 µl) were injected into a moving solvent (10 µl/min; 50:50 water:acetonitrile, 0.05% trifluoroacetic acid) using
a Phoenix 40 HPLC pump (VG-Fisons Instruments) coupled directly to the
ionization source via a fused silica capillary (50 µm × 40 cm).
The source temperature was 50 °C, and nitrogen was used as the
nebulizer and drying gas. Sample droplets were ionized at a positive
potential of approximately 3 kV and transferred to the mass analyzer
with a cone voltage (sample cone to skimmer lens voltage) of 50 V. The
peak width at half-height was 1 Da. Spectra were acquired in
multi-channel acquisition mode over the mass range 700 to 1800 Da in
5 s and then calibrated with horse heart myoglobin (Sigma). Some
spectra were recorded using a HP LC/MSD 1100 mass spectrometer
(Hewlett-Packard, Palo Alto, CA) using similar conditions.
Oxidation of S100A8
Hypochlorite Oxidation--
Recombinant S100A8,
Ala41S100A8, S100A9, hS100A8 (purified from human
PMN)4 and bovine S100B
(Sigma) were used. Generally, 100 µg of S100 protein was
reconstituted with 1 ml of PBS, pH 7.5 (final concentration 10 5 M). Hypochlorite, from a stock solution
of 45 mM (determined as described previously (40)) was
diluted in PBS, pH 7.5, to working solutions of 200 µM
to 20 mM. S100 proteins were treated with
increasing concentrations of hypochlorite (10-100 µM)
for 15 min on ice before an equal volume of 2 × SDS-PAGE sample
mixture (±100 mM DTT) was added, and samples were heated
(100 °C, 3 min) and analyzed by 10% SDS-PAGE and silver staining or
Western blotting using anti-S100A8. Alternatively, after 15 min,
samples were fractionated by RP-HPLC and the eluted peaks analyzed by
mass spectrometry.
Copper Oxidation--
Recombinant S100A8 (100 µl of 1 mg/ml)
purified from C4 RP-HPLC (29) was reduced in volume by two-thirds
(Speedvac; Savant, Farmingdale, NY). An equal volume of ammonium
bicarbonate (0.1 M) was added prior to the addition of
copper sulfate (50 mM) to a final concentration of 2 mM. After 30 min at room temperature S100A8 homodimer was
separated from residual monomer by C4 RP-HPLC.
PMA-induced Oxidation of S100A8 by Myeloid Cells--
The human
promyelocytic cell line, HL-60, was differentiated to the granulocytic
lineage with Me2SO (1.25%) for 5 days as described (30).
dHL-60 cells were washed twice in HBSS or Ca2+-free HBSS
and resuspended (107 cells/ml) in the same solutions.
Alternatively, murine PMN (107 cells/ml) elicited 6 h
after intraperitoneal injection of thioglycollate as described (31)
were used. Recombinant S100A8 (final concentration 10 5 or
5 × 10 7 M) was added to cell
suspensions (106 cells) that were subsequently activated
with PMA (1 µg/ml) and incubated for 20 min at 37 °C. The rate of
PMA-induced oxidation of S100A8 was measured by incubating dHL-60 cells
with PMA (1 µg/ml) for 1-30 min. After incubation, an equal volume
of 2× SDS-PAGE sample mixture was added, and samples were analyzed by
10% non-reducing SDS-PAGE and silver staining or Western blot analysis
using anti-S100A8. In some experiments sodium azide (10 nM
to 100 µM) was included. All results shown
are representative of at least three experiments.
Induction of LPS-induced Pulmonary Injury
Male Quakenbush Swiss mice, aged 8 weeks, were from the Animal
Breeding and Holding Unit, University of New South Wales and experimental procedures complied with the requirements of the University's Animal Care and Ethics Committee (reference number 96/124).
Lipopolysaccharide (LPS; Difco, E. coli 055:B5), 10 µg/60
µl, was placed on the nares and introduced into the lung by
inhalation according to the method of Szarka et al. (52).
Control mice received 60 µl of PBS, pH 7.2. Each group comprised four
mice. Animals were killed by exsanguination after an overdose of
pentobarbital at 48 h after intranasal instillation. The lungs
were perfused with 0.9% saline under a pressure of 40 cm of
H2O for 60 s to remove blood from the capillary bed.
The trachea was then cannulated with a blunted 19-gauge needle and
lungs lavaged. Bronchoalveolar lavage fluid was obtained by washing the
lungs three times repeatedly with 1 ml of PBS containing 10 mM N-ethylmaleimide (NEM). NEM was included to
prevent artifactual formation of disulfide-linked S100A8 during
isolation. Cells were pelleted (4 °C, 1200 rpm, 10 min), and in
agreement with earlier studies (52), this procedure yielded
150-250-fold increases in neutrophil numbers after 48 h.
Supernatants were processed by SDS-PAGE and Western blot analysis.
Chemotaxis Assay
S100A8 analogues (10 µg) lyophilized (Speedvac) with glycerol
(5 µl) were stored at 80 °C. Reconstitution was with 10 µl of
0.1% trifluoroacetic acid and 990 µl RPMI 1640 to give a
10 6 M stock solution that was serially
diluted in RPMI 1640, 0.1% bovine serum albumin immediately before
use. The murine monocytoid cell line WEHI 265 was used as responding
cell (27), and chemotaxis was performed in a 48-well microchemotaxis
Boyden chamber (Neuro Probe Inc., Bethesda, MD) as described (15).
Endotoxin-activated mouse serum (EAMS, 5%) was used as a positive
control. Coomassie Blue/crystal violet was used to stain the membranes
and migrating cells quantitated (10× objective) using planimetry
measurements obtained from image analysis (Wild-Leitz, Lane Cove,
Australia). Data were analyzed using the Student's t test
(* p < 0.01 versus controls).
Leukocyte Recruitment in Vivo
S100A8 analogues (30 µg) were reconstituted in 10 µl of
0.1% trifluoroacetic acid, neutralized to pH 6.5 with 0.1 M sodium phosphate, and made to 1 ml with phenol red-free
HBSS (PRF-HBSS) containing 0.1% ovalbumin (5× crystalline,
Calbiochem). S100A8 solutions were held overnight at 4 °C and
subsequently diluted with 2 ml of PRF-HBSS, 0.1% ovalbumin (S100A8
final concentration 10 6 M). Specific
pathogen-free female Balb/c mice (6-8 weeks) were injected
intraperitoneally with 1 ml of S100A8 (final concentration 10 µg per
mouse), or analogues, or vehicle control solution, sacrificed after
16 h (maximal leukocyte recruitment occurred between 16 and
24 h (32)), and cells harvested by peritoneal lavage with 5 ml
HBSS, 0.38% citrate, washed twice, and counted.
 |
RESULTS |
Hypochlorite Oxidation of S100 Proteins--
Hypochlorite
(OCl ) is a major oxidant produced by neutrophils in an
inflammatory response (25), and the susceptibility of recombinant
murine S100A8 (10 µM) to oxidation by hypochlorite was
tested. Fig. 1A shows SDS-PAGE
separation of rS100A8 samples treated with increasing concentrations of
OCl (lanes 2-4). In contrast to the untreated
monomeric form (lane 1), which migrated with an apparent
Mr of 10,000, as little as 10 µM
OCl converted approximately 20% of the S100A8 monomer to
a higher molecular weight species (lane 2), and this
increased to 70-80% with 40 µM OCl
(lane 3). The higher molecular weight band
(Mr 20,000) reacted with anti-S100A8 IgG in
Western blot analysis and corresponded to disulfide-bonded S100A8 dimer
(data not shown). No obvious higher molecular weight complexes were
evident in any of the samples (lanes 2-4). At higher
OCl concentrations (100 µM, lane
4) there was an apparent loss of protein detected by silver
staining. Hypochlorite-induced dimerization of S100A8 occurred
consistently in 10 separate experiments. Reduction of
OCl -oxidized samples with 100 mM DTT prior to
electrophoresis resolved mainly components of Mr
10,000 (Fig. 1A, lanes 6-8) with a minor amount
of the 20-kDa species remaining in the sample treated with the highest
concentration of OCl (lane 8), indicating the
formation of a disulfide bond in the OCl -induced S100A8
dimer. The resistance of Ala41S100A8 (a mutated form in
which Ala41 was substituted for Cys41) to
OCl -mediated dimerization (Fig. 1B,
lanes 1-4), even at high OCl concentrations
(100 µM, lane 4), confirmed the formation of
disulfide-linked dimers in the native form. The native human S100A8
responded to OCl in a similar manner (Fig. 1B,
lanes 5-8). Higher molecular weight components were apparent in
oxidized (Fig. 1B, lanes 6-8) and non-oxidized (Fig.
1B, lane 5) samples, and these represent minor contaminants
in the native preparation as levels did not change with
OCl treatment.

View larger version (42K):
[in this window]
[in a new window]
|
Fig. 1.
Hypochlorite oxidizes S100A8 to the covalent
dimer. A, recombinant murine S100A8 (10 µM) was either untreated (lanes 1 and
5) or treated with increasing concentrations of
hypochlorite. Proteins were separated on SDS-PAGE in the absence
(lanes 1-4) or presence (lanes 5-8) of 100 mM DTT prior to silver staining. B,
Ala41S100A8 (10 µM, lanes 1-4) or
human S100A8 (10 µM, lanes 5-8) were treated
identically to murine S100A8 and proteins separated on SDS-PAGE in the
absence of reducing agents. Relative positions of molecular mass
markers, in kDa, are shown in both gels.
|
|
Murine S100A9 forms a non-covalent heterodimer with S100A8 (34) and
contains a free Cys residue at position 110 (29). In contrast to
S100A8, OCl treatment of murine S100A9 failed to form
covalent dimers of the expected mass (~28 kDa). Instead, stepwise
increases in apparent molecular weight were evident with increasing
concentrations of OCl (up to ~1 kDa at 40 µM and ~2 kDa at 250 µM, Fig.
2A). Silver staining indicated
no apparent loss of S100A9 when OCl concentrations >100
µM were used (Fig. 2A, lane 5).

View larger version (49K):
[in this window]
[in a new window]
|
Fig. 2.
Murine S100A9 fails to form disulfide-linked
homodimers following hypochlorite oxidation. A, S100A9
(10 µM) was either untreated (lane 1) or
treated with increasing concentrations of hypochlorite. Proteins were
separated on SDS-PAGE in the absence of reducing agents prior to silver
staining. B, equal concentrations of S100A8 and S100A9 (5 µM) were mixed and either untreated (lane 1)
or treated with increasing concentrations of hypochlorite. Proteins
were separated on SDS-PAGE in the absence of DTT. Molecular weight
markers for both gels are shown. To better identify the molecular
species in B, Western blot analyses using anti-S100A8
(C) and anti-S100A9 (D) antibodies were
performed.
|
|
When low amounts of OCl were added to equimolar mixtures
of S100A8 and S100A9 (Fig. 2B) only low levels (<5%) of
the disulfide-linked heterodimer (24 kDa) were formed. Silver staining
indicated that S100A8 was predominantly oxidized to the 20-kDa
homodimer and oxidation was almost complete with 40 µM
OCl . In contrast, S100A9 was principally converted to a
higher molecular weight (~16 kDa), monomeric form (see Fig.
2A, lane 5). Western blot analysis with
anti-S100A8 confirmed preferential formation of disulfide-linked S100A8
homodimer after oxidation with OCl (Fig. 2C).
Anti-S100A8 also reacted with the heterodimer even though this
represented <5% of the reaction product (Fig. 2B). Anti-S100A9 recognized the oxidized monomeric forms of S100A9 (Fig.
2D, lanes 2-4) and reacted well with the low
levels of heterodimer (24 kDa) and homodimer (28 kDa) generated after
oxidation with OCl .
Characterization of OCl -oxidized S100A8--
The
concentration of OCl required to convert murine S100A8
monomer (retention time 19.2 min by C4 RP-HPLC) to predominantly dimer
was specific. With 10 µM S100A8 and 10 µM
OCl in the assay, a small amount of product with a
retention time of 19.8 min was evident by HPLC analysis (Fig.
3A). SDS-PAGE analysis indicated that this species had an apparent Mr
of 20,000 and reacted with anti-S100A8 IgG by Western blotting (not
shown). Approximately 70-80% of S100A8 was converted to the higher
molecular weight form by 40 µM OCl (Fig.
3B). Small amounts of apparently monomeric S100A8 (19.2 min)
and other reaction products (18.4-19.0 min) were evident. Higher
concentrations of OCl (100 µM) produced
multiple oxidation species (Fig. 3C), and total protein
recovery was reduced by ~75%.

View larger version (11K):
[in this window]
[in a new window]
|
Fig. 3.
Comparison of C4 RP-HPLC elution profiles of
S100A8 oxidized by hypochlorite. rS100A8 (10 µM) was
oxidized with 10 µM (A), 40 µM
(B), and 100 µM (C) hypochlorite
for 15 min and fractionated by C4 RP-HPLC. The elution profile of
untreated rS100A8 from C4 RP-HPLC is shown by the dashed
line.
|
|
Table I compares the masses determined by
ESI-MS of rS100A8 derivatives isolated after OCl (40 µM) treatment with those determined previously for S100A8 monomer (29). Hypochlorite oxidation generated both modified monomeric
and dimeric species. The monomeric form (retention time 19.2 min., Fig.
3B) had an additional 46 Da associated with it, and the
addition of three oxygens (mass 48 Da) may account for this increased
mass. The main oxidation product (retention time 19.8 min, Fig.
3B) had a mass of 20,707 Da confirming that, at 40 µM OCl , disulfide bond formation was the
most likely outcome. The additional 92 Da associated with this product
presumably represents the dimeric form of the modified monomer.
Characterization of these modifications are in progress.
View this table:
[in this window]
[in a new window]
|
Table I
ESI mass spectrometry of hypochlorite-treated rS100A8 derivatives
Untreated rS100A8 (10 µM) or that treated with 40 µM OCl (see Fig. 3B) were subjected to mass
spectrometry as described. ND, not determined.
|
|
A major aim of this study was to assess the activity of the murine
S100A8 dimer in vivo and in vitro. Although
OCl oxidation of S100A8 generated a dimeric species,
RP-HPLC profiles and mass spectrometry data suggested that formation of
a disulfide bond was not the only modification. Screening of other
potential agents indicated that Cu2+ oxidized S100A8 more
efficiently than OCl and produced a more homogeneous
product. Fig. 4 shows that
Cu2+ converted approximately 85% of S100A8 monomer to a
single oxidative product with retention time of 19.80 min and mass of
20,615 ± 2 Da (inset). The mass was identical to the
predicted mass (20,615 Da) of the disulfide-linked form, and reduction
with DTT totally converted the dimer to monomer of mass 10,308 Da.

View larger version (17K):
[in this window]
[in a new window]
|
Fig. 4.
S100A8 is susceptible to copper
oxidation. Elution profile of rS100A8 (20 µg) from C4 RP-HPLC
(dashed line) and after treatment with 2 mM
CuSO4 for 30 min is shown. S100A8 homodimer, elution
time 19.8 min (solid line), was separated from residual
monomer by RP-HPLC. Inset, ESI mass spectrum of
copper-oxidized S100A8 homodimer.
|
|
PMA-activated HL-60 Granulocytic Cells Oxidize S100A8--
To
determine whether murine S100A8 could be oxidized as a consequence of
neutrophil activation, differentiated (d)HL-60 granulocytic cells were
activated with PMA using defined conditions that generate an oxidative
burst by these cells (30). Generation of oxygen metabolites was
confirmed by reduction of nitro blue tetrazolium in our experiments.
Fig. 5A shows a time course of
PMA-induced dHL-60 oxidation of exogenous S100A8 (10 µM).
Unstimulated cells (lane 1) did not convert S100A8 to dimer
over 30 min, whereas PMA (1 µg/ml) triggered the rapid oxidation of
monomer to dimer, evident after 1 min (lane 2) and with 95%
conversion within 10 min (lane 6). Using this concentration
of PMA, no loss of S100A8 was evident during the time course. It is
noteworthy that no additional major oxidation products were
evident under these experimental conditions and that cell-induced
dimers were reduced by DTT. Thioglycollate-elicited murine PMN oxidized
S100A8 in the same manner in response to PMA activation (not
shown).

View larger version (63K):
[in this window]
[in a new window]
|
Fig. 5.
PMA-induced dHL-60 cellular oxidation of
rS100A8. A, time course of PMA-induced dHL-60 oxidation
of S100A8. S100A8 (10 µM) was added to unstimulated
(lane 1) or PMA-stimulated (1 µg/ml, lanes
2-9) dHL-60 cells, and the reaction was allowed to proceed for
various times. Proteins were separated on SDS-PAGE in the absence of
reducing agent and silver stained. B, at more physiological
concentrations of S100A8, Western blot analysis was required to
visualize protein. S100A8 (500 nM) was added to
unstimulated (lane 1) or PMA-stimulated (1 µg/ml,
lanes 2-6) dHL-60 cells, and samples were analyzed as
described above. C, S100A8 (10 µM) was added
to unstimulated (lane 1) or PMA-stimulated (1 µg/ml PMA,
lanes 2-8) dHL-60 cells for 30 min at 37 °C in the
absence (lane 2) or presence of increasing sodium azide
concentrations. Following incubation samples were analyzed by 10%
SDS-PAGE and silver staining. Relative positions of molecular weight
markers are shown.
|
|
Similarly, levels of S100A8 identified in inflammatory conditions such
as rheumatoid plasma (~600 nM) (53) and cystic fibrosis plasma (~200 nM) (54), when added to PMA-activated dHL-60
cells, were also oxidized to the disulfide-linked homodimer. Western blot analysis shows that monomer (Fig. 5B, lane
1) to dimer (lane 6) conversion of 500 nM
S100A8 occurred 30 min after neutrophil activation. Anti-S100A8 reacted
somewhat more strongly with the homodimer than the monomer.
The susceptibility of S100A8 to OCl -induced oxidation
suggested the involvement of the
myeloperoxidase-H2O2-halide system in the
cellular oxidation of S100A8. This was supported by the inhibitory
effects of the myeloperoxidase inhibitor sodium azide on S100A8
oxidation. Fig. 5C shows that PMA-activated dHL-60 cells, in
the absence of sodium azide, converted all S100A8 to the dimer in 30 min (lane 2). At low azide concentrations (10-100
nM, lanes 3 and 4) no inhibition
occurred, whereas higher concentrations reduced dimer formation (1-10
µM, lanes 5 and 6), and oxidation was abolished at azide concentrations exceeding 100 µM
(lanes 7 and 8).
S100A8 Homodimer Formation at the Site of LPS-induced Pulmonary
Injury--
Bronchoalveolar lavage fluid obtained from mice after LPS
inhalation contained significantly more neutrophils than from
PBS-treated controls. Protein levels in the extracellular fluid were
higher (Fig. 6, lane 2) in the
treated group and components migrating at 10 and 20 kDa
(arrows) were increased. Western blot analysis (Fig. 6,
lane 4) confirmed S100A8 monomer and homodimer in
LPS-induced fluid. No S100A8/A9 covalent complex was observed. A 70-kDa
protein also reacted with anti-S100A8 and may represent a high
molecular weight complex of S100A8. This component and the dimer were
reduced by DTT (Fig. 6, lane 5) indicating disulfide bond
formation.

View larger version (60K):
[in this window]
[in a new window]
|
Fig. 6.
S100A8 dimer formation at the site of
LPS-induced pulmonary injury. Total protein present in BAL fluid
of PBS control animals (lane 1) was compared with BAL fluid
from LPS-treated animals (lane 2) by silver staining. The
positions of 10- and 20-kDa proteins up-regulated in response to LPS
are indicated (arrows). The same samples were analyzed by
Western blotting using anti-S100A8 (PBS control, lane 3;
LPS-treated, lane 4). The LPS-treated lung lavage sample was
also reduced with 100 mM DTT (lane 5). The
relative positions of molecular weight markers are shown.
|
|
Chemotactic Activity of S100A8 and Analogues--
S100A8 and
analogues were tested for their chemotactic activity in
vitro. Fig. 7 shows that WEHI
monocytoid cells had little spontaneous migration (45 ± 24 cells/field) but responded to increasing dilutions of rS100A8 in a
characteristic bell-shaped profile (27), with optimal activity at
10 11 M (226 ± 32 cells/field). The
recombinant mutant, Ala41S100A8, was also active with a
dose response similar to that of the unmodified recombinant protein
(200 ± 34 cells/field) although potency at higher
(>10 10 M) and lower (<10 12
M) concentrations was consistently less than that of the
unmodified form. Checkerboard analysis, performed as described (15),
confirmed chemotactic rather than chemokinetic activity for
Ala41S100A8. Table II
compares the chemotactic activity of all available murine S100A8
analogues at their optimal chemotactic concentrations.

View larger version (15K):
[in this window]
[in a new window]
|
Fig. 7.
The covalent S100A8 homodimer is not
chemotactic. The chemotactic response of WEHI 265 cells toward
rS100A8 ( ), Ala41S100A8 ( ), and S100A8 homodimer
(×). Migration in the absence of a chemotactic stimulus is given
(solid line). Data represent the mean ± S.E. of
results obtained from three separate experiments in which four to five
grid fields of triplicate determinations were quantitated.
|
|
View this table:
[in this window]
[in a new window]
|
Table II
Chemotactic responses provoked by S100A8 and analogues
The chemotactic potential of S100A8 and analogues were tested in
chemotaxis assays using WEHI 265 as indicator cells. Data represent the
mean ± S.E. of results obtained from three separate experiments
in which cells migrated in five grid fields in triplicate
determinations were quantitated. BSA, bovine serum albumin.
|
|
Native S100A8, synthetic, and Aba41S100A8 all had optimal
activities of 10 12 M and were of similar
potencies. Aba41S100A8 recruited somewhat greater numbers
of cells, although differences between the preparations were not
statistically significant. Furthermore, potencies of these analogues
were similar to the positive control, 5% EAMS (contains C5a). In
agreement with our earlier report demonstrating the chemotactic
potential of rS100A8 (27), the optimal activities of rS100A8 and
Ala41S100A8 were some 10-fold less (10 11
M) than the native and synthetic forms, but similar numbers
of cells were recruited. In marked contrast, Cu2+-oxidized
S100A8 homodimer recruited 66 ± 20 cells when tested at
10 11 and 72 ± 31 with 10 12
M, and although these values were consistently higher,
recruitment was not significantly different (p < 0.5)
from control values (45 ± 24 cells/field). No migration above
control values was evident at other concentrations tested (Fig. 7). The
OCl -oxidized dimeric form of S100A8 also failed to
recruit WEHI cells (not shown).
Leukocyte Recruitment in Vivo--
Table
III shows that intraperitoneal injection
of the monomeric forms of S100A8, including the Cys to Ala/Aba mutants,
stimulated leukocyte recruitment after 16 h. As described earlier
for S100A842-55 (15), infiltrates consisted of mixtures of
neutrophils and monocytes at this time. Although responses were
variable between different batches of mice, they were greater than
controls (p < 0.01), and no differences were obvious
between preparations. In contrast, little leukocyte infiltration
occurred in the buffer-injected controls (1.2 ± 0.5 × 106 cells) or in mice injected with disulfide-linked dimer
(1.5 ± 0.8 × 106 cells) prepared by
Cu2+ oxidation. Dose-response curves indicated that 5-10
µg of the S100A8 analogues (5 × 10 7-10 6 M) provoked optimal
responses.
View this table:
[in this window]
[in a new window]
|
Table III
Leukocyte recruitment in response to S100A8 analogues in vivo
S100A8 analogues (10 µg in 1 ml of HBSS, 0.1% ovalbumin) or diluent
(control) were injected intraperitoneally into Balb/c mice as described
under "Experimental Procedures." The leukocyte infiltrate was
harvested by peritoneal lavage 16 h later, and total cells were
quantitated. Data represent the mean ± S.E. of results obtained
from four or five experiments in which a minimum of three
mice/experiment were injected.
|
|
 |
DISCUSSION |
Intracellular S100 proteins exist mainly as non-covalent homo- or
heterodimers with free reduced sulfhydryl groups. However, the
demonstration that disulfide formation (whether inter- or intrachain)
is required for the extracellular neurotrophic and mitogenic activities
of S100B (6, 21) suggests that S100 proteins contain specific amino
acids that are prone to oxidation, and that this reaction may
selectively regulate bioactivity (35). In view of the sensitivity of
cysteine residues to oxidation, and of their potentially important
functional role in defining target protein-binding sites in S100
proteins (36, 37), our strategy was to determine whether oxidation of
the single Cys residue at position 41 modified murine S100A8 function.
PMNs secrete granular enzymes and oxygen metabolites following exposure
to activating agents such as PMA and to classical chemoattractants
(38). The two-electron (non-radical) oxidant hypochlorite is a major
product of stimulated neutrophils that produce superoxide radicals
which dismute to H2O2 and are then converted
into hypohalous acids by myeloperoxidase in the presence of halides
(25). Hypochlorite-modified proteins are implicated in inflammatory
processes. For example, human 1-proteinase inhibitor contains a critical methionine (position 358) in its reactive center,
which is susceptible to OCl oxidation (39), rendering it
an ineffective inhibitor of neutrophil elastase (39).
Hypochlorite-oxidized proteins have also been identified in human
atherosclerotic lesions (26), and OCl can transform
lipoprotein into a high uptake form without significant lipid
oxidation. ApoB-100, the single major protein associated with low
density lipoprotein, is the main target for this oxidant (40) which
becomes aggregated and cross-linked.
S100A8 and S100A9 are constitutive cytoplasmic proteins in neutrophils
and are released in high concentrations at inflammatory sites (11, 12,
41) making them potential candidates for OCl -mediated
oxidation. Indeed, S100A8 oxidation to the disulfide-linked dimer
increased from 20% in the presence of 10 µM hypochlorite to 70-80% with 40 µM hypochlorite (Fig. 1A).
The physiological significance of this mechanism is highlighted by the
observation that activated neutrophils (106) can generate
as much as 124 µM hypochlorite within 2 h of
stimulation (42). Covalent disulfide bond formation in response to
OCl was confirmed by mass spectral analysis (Table I), by
reduction of dimer to monomer with 100 mM DTT (Fig.
1A), and by the failure of Ala41S100A8 to
dimerize, even at high concentrations of oxidant (Fig. 1B).
In keeping with its high structural similarity to the murine protein
(14), the response of human S100A8 to OCl was similar
(1B). Cys42 of human S100A8 and
Cys41 of murine S100A8 are in the -helix immediately
preceding the hinge region (a 13-amino acid domain separating the two
calcium-binding EF hand domains), and similar responses were not
unexpected. Nitric oxide, another important product of activated
myeloid cells, reacts readily with free radicals such as superoxide
anion (O 2) to form peroxynitrite (ONOO ), and NO
and its oxidation products can modify thiols to yield biologically
active reaction products (33). The NO donor SIN-1 and peroxynitrite
anion oxidized S100A8 to the disulfide-linked dimer, but neither was as
effective as OCl (not shown).
In contrast to S100A8, OCl failed to convert murine
S100A9 into disulfide-linked homodimers (Fig. 2A) although
it decreased its apparent electrophoretic mobility, possibly by
oxidizing susceptible amino acids, including the Cys at position 110 and the 7 Met residues, resulting in changes in conformation or net
charge. The propensity for S100A8 and S100A9 to form disulfide-linked
dimers in solution has not been characterized. To examine this,
equimolar mixtures of the proteins were treated with OCl ,
but no significant amounts of covalent heterodimer were detected (Fig.
2B). In support of these findings, a model of the putative human S100A8-S100A9 complex by Hunter and Chazin (43) predicted that
the distance between Cys42 in S100A8 and Cys3
in S100A9 would make disulfide bond formation in the heterodimer highly
unlikely. Our results indicate that although the free Cys (Cys110) of murine S100A9 occurs in the extended C-terminal
domain, disulfide heterodimerization was similarly unlikely (Fig.
2B).
Relative peak areas (RP-HPLC) after oxidation with hypochlorite (40 µM; Fig. 3B) showed approximately 75%
conversion of S100A8 monomer to homodimer. Mass spectrometry indicated
a mass of 20,707 ± 2 Da (Table I), some 92 Da greater than the
Cu2+-oxidized dimer. Thus, even at OCl
concentrations lower than those likely to occur in an inflammatory response, modifications of amino acids, in addition to that at Cys41, are indicated. These probably include incorporation
of oxygen atoms at Met36 and Met73.
Interestingly, the potent chemoattractants, fMet-Leu-Phe and human C5a
are inactivated by the myeloperoxidase-halide system by conversion of
methionine to the sulfoxide (44). The ability of stimulated neutrophils
to chemically modify chemoattractants may be one means of limiting
excess accumulation of leukocytes and terminating the progression of
acute inflammation. We are currently investigating whether specific
oxidation of Met residues in S100A8 affect chemotactic activity.
At higher OCl concentrations (>100 µM),
oxidation of S100A8 was less specific. C4 RP-HPLC indicated a
heterogeneous assortment of products (Fig. 3C), and SDS-PAGE
analysis confirmed multiple monomeric and dimeric species suggesting a
variety of modifications of susceptible amino acids. Moreover, the
large reduction in recovered protein (~75%) suggested that
precipitation and/or aggregation had occurred (Figs. 1A and
3C). Similarly, OCl aggregates and cross-links
low density lipoprotein (40) and H2O2 oxidation
of albumin at molar ratios >30:1 causes precipitation, presumably due
to the formation of polymeric albumin derivatives, and precipitation is
proportional to the amount of peroxide added (46).
The physiological relevance of oxidation of murine S100A8 by
OCl was highlighted by the ability of PMA-activated
neutrophils to totally convert exogenous S100A8 to the covalent dimer
(Fig. 5A). The myeloperoxidase inhibitor sodium azide
totally inhibited the cell-mediated oxidation of S100A8 (Fig.
5B). With the presumption that sodium azide is solely an
inhibitor of myeloperoxidase, we conclude from these data that
myeloperoxidase products are responsible for the majority of
cell-mediated S100A8 oxidation (47). Oxidation by 106
activated dHL-60 cells was rapid, with approximately 90% conversion of
1 µg of S100A8 to the dimer within 10 min (Fig. 4A).
Similar results were obtained with elicited murine neutrophils
activated in the same manner. No loss/aggregation of S100A8 was evident during the cellular activation process. Furthermore, disulfide-linked homodimer, but not heterodimer, was detected in bronchoalveolar lavage
fluid of endotoxin-treated mice, confirming the limited heterodimer
conversion observed in Fig. 2. A higher molecular weight form, possibly
corresponding to components formed by aggregation (see Fig. 3), was
also detected.
In marked contrast to the potent chemotactic activity of recombinant,
synthetic, and native S100A8, disulfide-linked S100A8 homodimer was
inactive in vitro (Fig. 7 and Table II). Moreover, these
S100A8 preparations recruited between 4.8- (sS100A8) and 6.5-fold
(rS100A8) more leukocytes than the disulfide-linked dimer following
intraperitoneal injection (Table III), suggesting that availability of
unmodified Cys41 might be functionally important.
Site-directed mutagenesis studies of S100B indicated that
Cys68 and Cys84 were essential for
extracellular neurotrophic and mitogenic activities (52). However, the
Cys mutant forms of S100A8, recombinant Ala41S100A8 and
synthetic Aba41S100A8, recruited similar numbers of
leukocytes to their unmodified recombinant or synthetic counterparts
in vitro and in vivo (Table III and Fig. 7)
indicating that Cys41 was not essential for recruitment.
This extends our earlier studies demonstrating chemotactic activity of
the hinge region peptide of S100A8 (S100A842-55), although
the potency of the peptide was somewhat less than the full-length form
(14). These experiments indicate alternate mechanisms for inactivation
of S100A8 bioactivity whereby disulfide interactions involving
Cys41 may sterically hinder and/or structurally alter
exposure of the chemotactic hinge domain to restrict cellular target recognition.
Inactivation of the chemotactic activity of S100A8 by hypochlorite
oxidation may provide a mechanism for limiting excess accumulation of
leukocytes and terminating the progression of acute inflammation. Recruitment of neutrophils from the vascular lumen into the pulmonary airspace of LPS-treated mice begins within hours of intranasal instillation, and these cells accumulate in the airways within 24-48 h
(52). Although time course experiments are warranted, Fig. 6 indicates
that S100A8 was oxidized to the homodimer and higher aggregates
in vivo at the time that the inflammatory response entered
the resolution phase.
The efficiency of OCl oxidation of S100A8 may have
additional implications. Approximately 20% of cytoplasmic protein of
neutrophils is S100A8 (48), and necrotic neutrophils have the potential to release large amounts following an inflammatory stimulus (11, 12,
41). Activated monocytes (13) and macrophages (9) also release the
protein. Even in the presence of equimolar amounts of S100A9, high
concentrations of S100A8 may be a preferential target of oxygen
metabolites (OCl , NO), thereby protecting other tissue
proteins from excessive oxidative damage. This may represent an
important function of human S100A8 which, unlike the murine protein, is
not chemotactic (15). Murine S100A8 may therefore have pro- or
anti-inflammatory activity, depending on its extracellular
concentration and circumstance of release. This may be particularly
relevant at sites of Gram-negative infection. In support of an
anti-inflammatory role, recent experiments in our
laboratory5 have demonstrated
glucocorticoid-mediated up-regulation of S100A8 mRNA and protein in
macrophages stimulated with LPS. Glucocorticoids released via the
neuroendocrine-immune network during stress have an immunomodulatory
function during infection and tissue invasion (49). The apparently
opposing activities of promoting and modulating inflammation are not
unique to S100A8. Transforming growth factor 1 (TGF- ) is
implicated in embryogenesis, development, and immune and inflammatory
processes and shares this paradoxical behavior (50). S100A8 is also
implicated in embryogenesis and development (51), and TGF- is also
chemotactic for myeloid cells at picomolar concentrations (17). The
studies presented here provide a novel mechanism of regulation of the
chemotactic activity of S100A8 by the myeloperoxidase system in
neutrophils and suggest that release of this abundant protein by dying
neutrophils at acute inflammatory sites may have a protective role.
 |
ACKNOWLEDGEMENTS |
We thank C. Cornish, T. Nilsson, and T. Tao
for assistance in chemotaxis assays; S. Thomas and R. Stocker for
discussions in the early stages of this work; members of the Biomedical
Mass Spectrometry Unit (UNSW) for access to the HP MSD/1100; and R. Kumar for performing lung lavage.
 |
FOOTNOTES |
*
This work was supported in part by grants from the National
Health and Medical Research Council of Australia.The costs of publication of this
article were defrayed in part by the
payment of page charges. The article
must therefore be hereby marked
"advertisement" in
accordance with 18 U.S.C. Section
1734 solely to indicate this fact.
¶
Present address: Victor Chang Cardiac Research Institute,
Sydney, New South Wales 2010, Australia.
To whom correspondence should be addressed: Cytokine Research
Unit, School of Pathology, The University of New South Wales, Kensington, New South Wales 2052, Australia. Tel.: 61-2-9385-1599; Fax:
61-2-9385-1389.
2
R. J. Passey, E. Williams, C. Wells, A. M. Lichanska, C. L. Geczy, S. Hu, M. H. Little, and D. A. Hume, submitted
for publication.
3
P. Alewood, manuscript in preparation.
4
M. J. Raftery and C. L. Geczy,
submitted for publication.
5
R. J. Passey, Z. Yang, T. Yen, K. Ku, S. Hu, and
C. L. Geczy, manuscript in preparation.
 |
ABBREVIATIONS |
The abbreviations used are:
LPS, lipopolysaccharide;
TGF, transforming growth factor;
C5a, complement
factor 5;
Me2SO, dimethyl sulfoxide;
PMA, phorbol
12-myristate 13-acetate;
EAMS, endotoxin-activated mouse serum;
OCl , hypochlorite;
DTT, dithiothreitol;
PAGE, polyacrylamide gel electrophoresis;
ESI-MS, electrospray
ionization-mass spectra;
HBSS, Hanks' balanced salt solution;
RP-HPLC, reverse phase-high pressure liquid chromatography;
PMN, polymorphonuclear;
PBS, phosphate-buffered saline;
NEM, N-ethylmaleimide;
dHL-60, differentiated HL-60.
 |
REFERENCES |
-
Schafer, B. W.,
and Heizmann, C. W.
(1996)
Trends Biochem. Sci.
21,
134-140[CrossRef][Medline]
[Order article via Infotrieve]
-
Kligman, D.,
and Hilt, D. C.
(1988)
Trends Biochem. Sci.
13,
437-443[CrossRef][Medline]
[Order article via Infotrieve]
-
Zimmer, D. B.,
Cornwall, E. H.,
Landar, A.,
and Song, W.
(1995)
Brain Res. Bull.
37,
417-429[CrossRef][Medline]
[Order article via Infotrieve]
-
Komada, T.,
Araki, R.,
Nakatani, K.,
Yada, I.,
Naka, M.,
and Tanaka, T.
(1996)
Biochem. Biophys. Res. Commun.
220,
871-874[CrossRef][Medline]
[Order article via Infotrieve]
-
Jinquan, T.,
Vorum, H.,
Larsen, C.,
Madsen, P.,
Eamussen, H.,
Gesser, B.,
Etzerodt, M.,
Honore, B.,
Celis, J.,
and Thestrup-Pederson, K.
(1996)
J. Invest. Dermatol.
107,
5-10[CrossRef][Medline]
[Order article via Infotrieve]
-
Barger, S. W.,
Wolchok, S. R.,
and Van Eldik, L.
(1992)
Biochim. Biophys. Acta
1160,
105-112[CrossRef][Medline]
[Order article via Infotrieve]
-
Sohnle, P.,
Collins-Lech, C.,
and Weissner, J.
(1991)
J. Infect. Dis.
163,
187-192[Medline]
[Order article via Infotrieve]
-
Johne, B.,
Fagerhol, M. K.,
Lyberg, T.,
Prydz, H.,
Brandtzaeg, P.,
Naess-Andresen, C. F.,
and Dale, I.
(1997)
Mol. Pathol.
50,
113-123[Free Full Text]
-
Hu, S. P.,
Harrison, C.,
Xu, K.,
Cornish, C. J.,
and Geczy, C. L.
(1996)
Blood
87,
3919-3928[Abstract/Free Full Text]
-
Yen, T.,
Harrison, C.,
Devery, J.,
Leong, S.,
Iismaa, S.,
Yoshimura, T.,
and Geczy, C.
(1997)
Blood
90,
4812-4821[Abstract/Free Full Text]
-
Kocher, M.,
Kenny, P. A.,
Farram, E.,
Abdul, M. K.,
Finlay, J. J.,
and Geczy, C. L.
(1996)
Infect. Immun.
64,
1342-1350[Abstract]
-
Kumar, R. K.,
Harrison, C. A.,
Cornish, C. J.,
Kocher, M.,
and Geczy, C. L.
(1998)
Pathology
30,
51-56[CrossRef][Medline]
[Order article via Infotrieve]
-
Rammes, A.,
Roth, J.,
Goebeler, M.,
Klempt, M.,
Hartmann, M.,
and Sorg, C.
(1997)
J. Biol. Chem.
272,
9496-9502[Abstract/Free Full Text]
-
Lackmann, M.,
Cornish, C. J.,
Simpson, R. J.,
Moritz, R. L.,
and Geczy, C. L.
(1992)
J. Biol. Chem.
267,
7499-7504[Abstract/Free Full Text]
-
Lackmann, M.,
Rajasekariah, P.,
Iismaa, S. E.,
Jones, G.,
Cornish, C. J.,
Hu, S.,
Simpson, R. J.,
Moritz, R. L.,
and Geczy, C. L.
(1993)
J. Immunol.
150,
2981-2991[Abstract]
-
Devery, J. M.,
King, N. J.,
and Geczy, C. L.
(1994)
J. Immunol.
152,
1888-1897[Abstract]
-
Cornish, C. J.,
Devery, J. M.,
Poronnik, P.,
Lackmann, M.,
Cook, D. I.,
and Geczy, C. L.
(1996)
J. Cell. Physiol.
166,
427-437[CrossRef][Medline]
[Order article via Infotrieve]
-
Kilby, P. M.,
Van Eldik, L. J.,
and Roberts, G.
(1996)
Structure
4,
1041-1052[Medline]
[Order article via Infotrieve]
-
Potts, B.,
Smith, J.,
Akke, M.,
Macke, T. J.,
Okazaki, K.,
Hidaka, H.,
Case, D. A.,
and Chazin, W. J.
(1995)
Nat. Struct. Biol.
2,
790-796[CrossRef][Medline]
[Order article via Infotrieve]
-
Drohat, A. C.,
Nenortas, E.,
Beckett, D.,
and Weber, D. J.
(1997)
Protein Sci.
6,
1577-1582[Abstract]
-
Scotto, C.,
Mely, Y.,
Oshima, H.,
Garin, J.,
Cochet, C.,
Chambaz, E.,
and Baudier, J.
(1998)
J. Biol. Chem.
273,
3901-3908[Abstract/Free Full Text]
-
Teigelkamp, S.,
Bhardwaj, R.,
Roth, J.,
Meinardus-Hager, G.,
Karas, M.,
and Sorg, C.
(1991)
J. Biol. Chem.
266,
13462-13467[Abstract/Free Full Text]
-
Goebeler, M.,
Roth, J.,
Burwinkel, F.,
Vollmer, E.,
Bocker, W.,
and Sorg, C.
(1994)
Transplantation
58,
355-361[Medline]
[Order article via Infotrieve]
-
Raftery, M. J.,
and Geczy, C. L.
(1998)
J. Am. Soc. Mass Spectrom.
9,
533-539[CrossRef][Medline]
[Order article via Infotrieve]
-
Dean, R.,
Fu, S.,
Stocker, R.,
and Davies, M.
(1997)
Biochem. J.
324,
1-18
-
Hazell, L. J.,
Arnold, L.,
Flowers, D.,
Waeg, G.,
Malle, E.,
and Stocker, R.
(1996)
J. Clin. Invest.
97,
1535-1544
|