|
|
|
|||||||
|
|||||||||
J Biol Chem, Vol. 274, Issue 13, 9045-9052, March 26, 1999
From the Nitric oxide (NO), a free radical gas whose
production is catalyzed by the enzyme NO synthase, participates in the
regulation of multiple organ systems. The inducible isoform of NO
synthase (iNOS) is transcriptionally up-regulated by inflammatory
stimuli; a critical mediator of this process is nuclear factor
(NF)- Nitric oxide (NO) is a free radical gas that participates in the
physiologic or pathophysiologic regulation of multiple organ systems
(1-3). Production of NO from its substrate, L-arginine, is
catalyzed by NO synthase
(NOS)1 (4, 5). Three isoforms
of NOS (NOS 1-3) are present in mammalian cells, each encoded by a
unique gene. The high output pathway of NO production is catalyzed by
NOS2, a transcriptionally regulated gene that is induced
after immunologic or inflammatory stimuli. We refer to this inducible
NOS2 isoform as iNOS. Although iNOS was originally identified and
characterized in macrophages (6-8), it is present in numerous cell
types including vascular smooth muscle cells (9-11).
Much of the initial evaluation of the mouse iNOS gene focused on its
transcriptional regulation in macrophages after lipopolysaccharide (LPS) and interferon (IFN)- Interleukin (IL)-1 Goldring and colleagues (21) demonstrated by in vivo
footprint analysis in macrophages that, in addition to the NF- Nuclear proteins that interact with members of the NF- HMG-I(Y) refers to two proteins, HMG-I and HMG-Y, that are
alternatively spliced products of the same gene (25). HMG-I(Y) binds to
AT-rich regions in the minor groove of DNA (26), and it is known to
bind Oct sequence motifs (27). HMG-I(Y) facilitates the assembly of
functional nucleoprotein complexes (enhanceosomes) by modifying DNA
conformation and by recruiting nuclear proteins to an enhancer (28,
29). The role of HMG-I(Y) in enhanceosome assembly has been studied
extensively in the IFN- Materials--
Salmonella typhosa LPS (Sigma) was
dissolved in 0.9% saline and stored at Cell Culture--
Rat aortic smooth muscle cells (RASMC) were
harvested from male Sprague-Dawley rats (200-250 g) by enzymatic
dissociation according to the method of Gunther et al. (34).
The cells were cultured in Dulbecco's modified Eagle's medium (JRH
Biosciences, Lenexa, KS) supplemented with 10% heat-inactivated fetal
bovine serum (FBS, HyClone, Logan, UT), penicillin (100 units/ml),
streptomycin (100 µg/ml), and 25 mM HEPES (pH 7.4)
(Sigma) in a humidified incubator at 37 °C. RASMC were passaged
every 4-5 days, and experiments were performed on cells 4-6 passages
from primary culture. Rat alveolar macrophage cell line NR8383 (35) was
grown in RPMI 1640 medium (JRH Biosciences) supplemented with 2%
heat-inactivated FBS (HyClone), penicillin (100 units/ml), and
streptomycin (100 µg/ml) (Sigma) in a humidified incubator at
37 °C. Drosophila SL2 cells (ATCC, Rockville, MD) (36)
were maintained at 23 °C in Schneider's insect medium (Sigma)
supplemented with 12% heat-inactivated FBS and gentamycin (50 µg/ml).
Plasmids--
Plasmid pGL2-Basic contained the firefly
luciferase gene without any promoter (Promega, Madison, WI). Reporter
constructs containing fragments of the mouse iNOS 5'-flanking sequence
were named according to the location of the fragment from the
transcription start site in the 5' and 3' directions. A 1516-base pair
(bp) fragment amplified from mouse genomic DNA, containing 1485 bp of
the 5'-flanking region and the first 31 bp after the transcription start site, was named iNOS(
To localize binding elements other than NF- Transfections--
RASMC were transfected by a DEAE-dextran
method (20). In brief, 500,000 cells were plated onto 100-mm tissue
culture dishes and allowed to grow for 48-72 h (until 80-90%
confluent). Then iNOS luciferase constructs and pOPRSVI-CAT (to correct
for differences in transfection efficiency) were added (5 µg each) to
the RASMC in a solution containing 500 µg/ml DEAE-dextran. RASMC were
subsequently shocked with 5% dimethyl sulfoxide solution for 1 min and
then allowed to recover in medium containing 10% heat-inactivated FBS. Twelve hours after transfection, RASMC were placed in 2% FBS. RASMC
were then stimulated with vehicle, human recombinant IL-1
Rat alveolar macrophages (NR8383) were also transfected by the same
DEAE-dextran method (20), with the exception that they were treated in
a floating suspension (the RASMC were attached to culture dishes).
Twelve hours after transfection, the macrophages were stimulated with
LPS (1 µg/ml) for 48 h. In both the RASMC and macrophage
transfection experiments, cell extracts were prepared by detergent
lysis (Promega), and luciferase activity was measured with an AutoLumat
LB953 luminometer (EG&G, Gaithersburg, MD) and the Promega luciferase
assay system. To evaluate the efficiency of transfection, we performed
a CAT assay by a modified two-phase fluor diffusion method as described
(40, 41). The ratio of luciferase to CAT activity in each sample served
as a measure of normalized luciferase activity.
SL2 cells were transfected by the calcium-phosphate method according to
Di Nocera and Dawid (42). In brief, SL2 cells were plated in six-well
tissue culture dishes (Costar Corp, Cambridge, MA) 24 h before
transfection. Transfection was then performed in six separate wells for
each condition. iNOS plasmids were added at 1 µg/well. Plasmids
p50-pPAC, p65-pPAC, and phsp82LacZ were added at 100 ng/well. Plasmid
pPACHMGI was added at 1 µg/well, alone or in combination with
p50-pPAC or p65-pPAC (or both). The expression plasmid doses were
chosen on the basis of pilot experiments (data not shown). Forty-eight
hours after the initial transfection, extracts from the SL2 cells were
prepared and luciferase activity was measured as described for RASMC.
Protein Expression and Purification--
The prokaryotic
expression plasmid for mouse HMG-I(Y), pRSETHMG-I(Y), was prepared as
described (44). Plasmid pRSETHMG-I(Y) (containing the HMG-I(Y) protein,
a vector-derived polyhistidine tag, and an enterokinase cleavage site)
was transferred into Escherichia coli strain BL21(DE3)pLysS.
Expression was induced in culture (mid-log phase) by the addition of 1 mM isopropyl-1-thio- Electrophoretic Mobility Shift Assays (EMSA)--
EMSA were
performed with double-stranded oligonucleotide probes encoding
region
Probes were also generated with mutations in the Statistics--
Data from the SL2 cell transfection experiments
were subjected to analysis of variance followed by Scheffe's test.
Significance was assumed at p < 0.05.
A Downstream Oct Binding Site Is Pivotal to Induction of the iNOS
Promoter/Enhancer by IL-1
Using site-directed mutagenesis, we generated constructs of the
downstream iNOS 5'-flanking sequence that contained no mutations (iNOS(
To determine if this Oct site was important for iNOS induction by
inflammatory stimuli other than IL-1 HMG-I(Y) Binds to the iNOS 5'-Flanking Sequence at the Downstream
Oct Binding Site--
To determine if HMG-I(Y) could bind to the iNOS
promoter/enhancer region containing the NF- HMG-I(Y) and NF-
We have shown recently that IL-1
For HMG-I(Y) to recruit transcription factors to their DNA binding
sites, it must usually bind to DNA. However, recent studies have
revealed that HMG-I(Y) mutants incapable of binding to DNA were still
able to enhance serum response factor binding to DNA (44). Therefore,
we performed further studies to determine if HMG-I(Y) binding to DNA
was necessary for recruitment of NF- HMG-I(Y) Potentiates Transactivation of the iNOS Promoter/Enhancer
by NF-
Because the most important IL-1 The high output pathway of NO production is catalyzed by the
inducible isoform of NOS. iNOS induction can be regulated in some cells
by posttranscriptional mechanisms (48) and by the availability of
cofactors such as heme and tetrahydrobiopterin (49-51). In most
cells, however, the induction of iNOS by inflammatory stimuli is
tightly regulated at the level of gene transcription (5, 11-13, 20).
Activation of NF- The present analysis of the iNOS promoter/enhancer revealed that an
AT-rich region (bases Two recent studies in macrophages have suggested that the downstream
Oct site may be important for iNOS activation by LPS (52) and IL-6
(53). Xie (52) demonstrated that an LPS-responsive element, termed
LREAA, resides within the downstream Oct site. Xie
suggested that Oct-1-like proteins, but not other POU domain proteins
(Oct-2 or Pit 1) (54), are contained in a complex that binds at the
LREAA site. Sawada and colleagues investigated the importance of the downstream Oct site in the activation of iNOS by IL-6
(53). They demonstrated that Oct-2-related proteins bind at this site
during IL-6-induced macrophage differentiation, and that this Oct site
is essential for induction of iNOS by IL-6. The binding activity of
Oct-1-related proteins appeared to decrease after IL-6 stimulation.
Although these studies showed that Oct-1-like proteins and Oct-2
proteins are components of the DNA-protein complexes that bind at the
downstream Oct site in macrophages, their specific roles in iNOS
activation and their ability to work in conjunction with, or
independently of, NF- Because the downstream Oct site is rich in A and T residues, we became
interested in the potential role of HMG-I(Y) as a mediator of iNOS
activation. HMG-I(Y) is an architectural transcription factor that
binds to AT-rich regions in the minor groove of DNA (26). HMG-I(Y) by
itself is not a transcriptional activator; instead, HMG-I(Y)
facilitates the assembly and stability of stereospecific DNA-protein
complexes that drive efficient gene transcription (22, 31). HMG-I(Y)
performs this task by modifying DNA conformation and by recruiting
nuclear proteins (such as subunits of NF- Previous studies have shown that binding sites for HMG-I(Y) partially
or fully overlap binding sites for transcription factors that are
incorporated into an enhanceosome complex (31). By binding to DNA in
the minor groove, HMG-I(Y) is able to recruit transcription factors to
the major groove. This scenario does not appear to apply to the iNOS
promoter/enhancer. The AT-rich Oct site, the location of HMG-I(Y)
binding in the iNOS promoter/enhancer, resides 15 bp downstream of the
NF- We are grateful to the late Dr. Edgar Haber
for his helpful suggestions and support of our work, Bonna Ith for
technical assistance, and Thomas McVarish for editorial assistance.
Plasmids for p50 and p65 were kindly provided by Dr. James Liao, with
permission from Dr. Gary Nabel. We also thank Dr. Tom Maniatis for the
Drosophila expression plasmids pPACHMGI, pPAC, and
phsp82LacZ. NR8383 cells were kindly provided by Dr. Joseph Paulauskis.
*
This work was supported in part by National Institutes of
Health Grants HL03194 and HL60788 (to M. A. P.), HL03745 (to
M. T. C.), and GM53249 (to M.-E. L.); by an American
Heart Association grant-in-aid (to M. A. P.); by a grant from
Novartis and the SICPA Foundation (to P. W.); and by a grant from
the Bristol-Myers Squibb Pharmaceutical Research Institute.The costs of publication of this
article were defrayed in part by the
payment of page charges. The article
must therefore be hereby marked
"advertisement" in accordance with 18 U.S.C. Section
1734 solely to indicate this fact.
**
To whom correspondence should be addressed: Cardiovascular Biology
Laboratory, Harvard School of Public Health, 677 Huntington Ave.,
Boston, MA 02115. Tel.: 617-432-2273; Fax: 617-432-2980; E-mail:
perrella{at}cvlab.harvard.edu.
The abbreviations used are:
NOS, nitric-oxide
synthase;
HMG, high mobility group;
NF, nuclear factor;
Oct, octamer;
iNOS (or NOS2), inducible isoform of NO synthase;
IL, interleukin;
LPS, lipopolysaccharide;
RASMC, rat aortic smooth muscle cells;
CAT, chloramphenicol acetyltransferase;
IFN, interferon;
bp, base pair(s);
FBS, fetal bovine serum;
IRF, IFN regulatory factor;
EMSA, electrophoretic mobility shift assay.
High Mobility Group-I(Y) Protein Facilitates Nuclear Factor-
B
Binding and Transactivation of the Inducible Nitric-oxide Synthase
Promoter/Enhancer*
§¶
**,,,§,,,,, and§
Cardiovascular Biology Laboratory, Harvard
School of Public Health, Boston, Massachusetts 02115, the
§ Department of Medicine, Harvard Medical School, Boston,
Massachusetts 02115, the Cardiovascular and
¶ Pulmonary and Critical Care Divisions, Brigham and Women's
Hospital, Boston, Massachusetts 02115, and the
§§ Department of Biochemistry and Biophysics,
Washington State University, Pullman, Washington 99164
ABSTRACT
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES
B. Our objective was to determine which regulatory elements
other than NF-B binding sites are important for activation of the
iNOS promoter/enhancer. We also wanted to identify transcription
factors that may be functioning in conjunction with NF-B (subunits
p50 and p65) to drive iNOS transcription. Deletion analysis of the iNOS
promoter/enhancer revealed that an AT-rich sequence (
61 to 54)
downstream of the NF-B site (85 to 76) in the 5'-flanking sequence was important for iNOS induction by interleukin-1
and endotoxin in vascular smooth muscle cells. This AT-rich sequence, corresponding to an octamer (Oct) binding site, bound the architectural transcription factor high mobility group (HMG)-I(Y) protein.
Electrophoretic mobility shift assays showed that HMG-I(Y) and NF-B
subunit p50 bound to the iNOS promoter/enhancer to form a ternary
complex. The formation of this complex required HMG-I(Y) binding at the Oct site. The location of an HMG-I(Y) binding site typically overlaps that of a recruited transcription factor. In the iNOS
promoter/enhancer, however, HMG-I(Y) formed a complex with p50 while
binding downstream of the NF-B site. Furthermore, overexpression of
HMG-I(Y) potentiated iNOS promoter/enhancer activity by p50 and p65 in
transfection experiments, suggesting that HMG-I(Y) contributes to the
transactivation of iNOS by NF-B.
INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES
stimulation (12, 13). Dissection of the iNOS promoter/enhancer revealed that a downstream nuclear factor (NF)-B site (85 to 76,
NF-Bd) is critical for activation of iNOS by LPS in
macrophages. In the presence of LPS, c-Rel or Rel A (p65) binds with
p50 to form heterodimers on the iNOS promoter/enhancer, in conjunction
with additional unidentified proteins (14). Further studies revealed
that a more upstream region of the iNOS promoter/enhancer (951 to
911) is responsible for the synergistic induction of iNOS by
IFN- and LPS. IFN regulatory factor (IRF)-1 binding to an
IRF binding site (IRF-E) (15) and Stat1
binding to an
IFN--activated site (16) contribute to optimal induction
of iNOS by IFN- and LPS.
and tumor necrosis factor- (important
pro-inflammatory cytokines generated after LPS stimulation in
vivo; Refs. 17 and 18) are potent activators of iNOS transcription in vascular smooth muscle cells (10, 11, 19). We have shown that the
downstream NF-Bd site (85 to 76) is important for
proinflammatory cytokine induction of the iNOS promoter/enhancer in
vascular smooth muscle cells (20). However, elements other than this
NF-Bd site in the downstream portion of the iNOS
5'-flanking sequence (234 to +31) also appear to be crucial for full
activation of iNOS (20). We designed the present study to further
elucidate the important regulatory elements in region 234 to +31
responsible for iNOS induction in vascular smooth muscle cells by the
proinflammatory cytokine IL-1.
B
sites, nuclear protein binding occurred after LPS stimulation at NF-IL6 (150 to 142) and octamer (Oct) (61 to 54) sites of the iNOS promoter/enhancer (21). Their report revealed potential binding sites
in region 234 to +31 of the iNOS promoter/enhancer but lacked a
detailed functional analysis of these sites. Until our present study,
the functional importance of these sites in vascular smooth muscle
cells had not been elucidated. Furthermore, there had been no
identification of nuclear proteins (binding in the downstream region of
the iNOS promoter/enhancer) that facilitate iNOS transactivation by
NF-B.
B
family include the nonhistone chromosomal proteins of the high mobility
group (HMG)-I(Y) family (22). HMG-I(Y) proteins play a role in the
transcriptional regulation of certain mammalian genes whose
promoter/enhancer regions contain AT-rich sequences (22-24).
gene after viral stimulation (28-33).
HMG-I(Y) has been shown to enhance the binding of transcription
factors, such as NF-B and activating transcription
factor-2, to their binding sites by DNA-protein and protein-protein
interactions (28-33). Because of the aforementioned properties of
HMG-I(Y), we determined whether this protein bound to the iNOS
promoter/enhancer and interacted with NF-B subunits to
regulate iNOS gene transcription. We also determined whether the site
of HMG-I(Y) binding overlapped a binding site for NF-B
(as occurs with IFN-), or if HMG-I(Y) bound at a site different from
NF-B.
EXPERIMENTAL PROCEDURES
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES
20 °C. Recombinant human
IL-1 (Collaborative Biomedical, Bedford, MA) was stored at
80 °C until use. Recombinant human NF-B subunit p50
(Promega Corp., Madison, WI) was also stored at 80 °C until use. A
goat polyclonal antibody to p50 (Santa Cruz Biotechnology, Santa Cruz,
CA) was used for supershift experiments.
1485/+31), as described (20). A shorter
fragment, iNOS(234/+31), was generated by polymerase chain reaction
from iNOS(1485/+31) as described (20). The downstream NF-Bd site was mutated (85 to 83, GGG to CTC) in the 1485 to +31 fragment by using a site-directed mutagenesis technique (20), and this construct was named iNOS(1485/+31
NF-Bm).
Bd that may be
important for IL-1 or LPS induction of iNOS, we used iNOS(1485/+31 NF-Bm) as a template to generate a series of truncated iNOS 5'-flanking fragments by polymerase chain reaction. Constructs containing these 5'-deletion fragments were named iNOS(331/+31 NF-Bm), iNOS(208/+31 NF-Bm),
iNOS(141/+31 NF-Bm), iNOS(97/+31
NF-Bm), and iNOS(69/+31). We also used iNOS(1485/+31) or iNOS(1485/+31 NF-Bm) as a template to mutate the
downstream Oct site (61 to 54, ATGCAAAA to CGTACCCC) by a
site-directed technique (20). The new constructs were named
iNOS(331/+31 OCTm) and iNOS(331/+31 NF/OCTm). All constructs were
inserted into pGL2-Basic and sequenced by the dideoxy nucleotide chain termination method (37) to confirm the insert's orientation and
sequence. Plasmid pOPRSVI-CAT contained the prokaryotic chloramphenicol acetyltransferase (CAT) gene (Stratagene, La Jolla, CA) driven by a
Rous sarcoma virus-long terminal repeat promoter. Plasmid pPAC was
described elsewhere (29, 38). NF-B subunit p50 and p65
expression constructs were made by inserting cDNAs coding for the
subunits into the BamHI site of pPAC (39). Expression vectors phsp82LacZ and pPACHMGI were described elsewhere (29).
(10 ng/ml), or LPS (1 µg/ml) for 48 h. The doses of IL-1 and LPS,
and the duration of stimulation, were chosen on the basis of pilot
experiments (data not shown).
-Galactosidase assays were performed as described elsewhere (43).
The ratio of luciferase activity to -galactosidase activity in each
sample served as a measure of normalized luciferase activity.
-D-galactopyranoside. Three hours after induction of expression, the bacteria were lysed and
HMG-I(Y) was purified by cobalt affinity chromatography under denaturing conditions according to the instructions of the manufacturer (CLONTECH). Proteins were renatured by dialysis
overnight against 20 mM HEPES (pH 7.8), 20 mM
KCl, and 0.2% Tween 20 at 4 °C. The dialysate was stored at
80 °C until use.
87 to 52 of the iNOS 5'-flanking sequence (TGGGGACTCTCCCTTTGGGAACAGTTATGCAAAATA).
85 to 76
NF-Bd site
(TGCTCCAGAGGGCTTTGGGAACAGTTATGCAAAATA) and the 61 to 54
Oct site (TGGGGACTCTCCCTTTGGGAACAGTTCGTACCCCTA). Prior to
annealing, polynucleotide kinase (Boehringer Mannheim) was used to
label the oligonucleotides with [-32P]ATP. A typical
binding reaction contained 20,000 cpm DNA probe, 10 mM
Tris-HCl (pH 7.5), 50 mM KCl, 0.1 mM EDTA, 250 µg/ml acetylated bovine serum albumin, 1 mM
dithiothreitol, 5% glycerol, 500 ng of poly(dG-dC·dG-dC), and
recombinant HMG-I(Y) and/or p50 protein in a final volume of 25 µl.
The reaction mixture was allowed to incubate for 20 min at room
temperature. The DNA-protein complexes were then fractionated on a 5%
native polyacrylamide electrophoretic gel in a 0.25× Tris borate-EDTA
recirculating buffer system at 4 °C.
RESULTS
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES
and LPS in Vascular Smooth Muscle
Cells--
We have demonstrated elsewhere that the IL-1-responsive
elements in iNOS reside between bp 234 and +31 of the 5'-flanking sequence (20). Our previous data also suggested that elements other
than NF-Bd in this downstream region contributed to
activation of the iNOS promoter/enhancer by IL-1 in vascular smooth
muscle cells. To reveal these other IL-1-responsive elements in the
iNOS 5'-flanking sequence, we generated deletion constructs containing
a mutated NF-Bd site. This approach ensured that any
induction of iNOS promoter/enhancer activity after transfection of the
constructs into vascular smooth muscle cells would not be the result of
nuclear protein binding to the NF-Bd site. Beyond a
decrease in iNOS promoter/enhancer activity after mutation of the
NF-Bd site (Fig. 1), no
further reduction in IL-1 responsiveness occurred, even after the
iNOS 5'-flanking sequence had been reduced to a construct containing
bases 69 to +31 of the downstream promoter. Other than the TATA box,
an AT-rich Oct site (61 to 54) remained in this portion of the iNOS
5'-flanking sequence.
View larger version (16K):
[in a new window]
Fig. 1.
Deletion analysis of iNOS promoter/enhancer
activity in response to IL-1 stimulation.
Plasmids containing variable lengths of the mouse iNOS 5'-flanking
sequence and a luciferase reporter gene were transfected into RASMC.
The white bar (n = 10) represents
the promoter/enhancer activity of a construct containing an intact
5'-flanking sequence (bp 1485 to +31) of the iNOS gene. The
black bars (n = 4 in each group)
represent deletion constructs containing a mutated NF-Bd
site (as marked by X) and a construct truncated past the
NF-Bd site (construct 69 to +31). All constructs were
cotransfected with pOPRSVI-CAT to correct for differences in
transfection efficiency. Luciferase activity is expressed as the
percentage increase produced by IL-1 (mean ± S.E.).
Asterisks indicate significant differences
(p < 0.05) in comparison with iNOS(1485/+31) (white
bar).
234/+31)), a mutation at the NF-Bd site
(iNOS(331/+31 NF-Bm)), a mutation at the Oct site
(iNOS(331/+31 OCTm)), or mutations at both sites (iNOS(331/+31
NF/OCTm)). These constructs were transfected into RASMC and stimulated
with vehicle or IL-1. Mutation of the NF-Bd site
produced a 69% reduction in iNOS promoter/enhancer activity after
stimulation with IL-1 (Fig. 2).
Furthermore, mutation of the Oct site led to an even greater reduction
(90%) in iNOS activity after IL-1 stimulation. Mutating both sites
did not cause iNOS promoter/enhancer activity to fall below the level
obtained by mutating the Oct site alone. Taken together, the data in
Fig. 2 suggest that the Oct binding site (61 to 54) is critical for
induction of iNOS promoter/enhancer activity by IL-1 in vascular
smooth muscle cells. The absence of a further reduction in iNOS
promoter/enhancer activity after mutation of both sites suggests that
there may be an interaction between nuclear proteins that bind at the
Oct site and nuclear proteins that bind at the NF-Bd
site. There were no significant differences in promoter/enhancer
activity among iNOS constructs that received vehicle alone.
View larger version (24K):
[in a new window]
Fig. 2.
Response of the
NF- Bd and Oct sites in the iNOS
promoter/enhancer to IL-1 stimulation.
Plasmids containing no mutation (iNOS(234/+31)), a mutation at the
NF-Bd site (iNOS(331/+31 NF-Bm)), a
mutation at the Oct site (iNOS(331/+31 OCTm)), or mutations at both
sites (iNOS(331/+31 NF/OCTm)) were transfected into RASMC in the
presence (+, black bars) or absence (,
white bars) of IL-1. Mutations are marked by
X. All constructs were cotransfected with pOPRSVI-CAT to
correct for differences in transfection efficiency. Luciferase activity
is expressed as a percentage of the value for iNOS(234/+31) in the
absence of IL-1 (mean ± S.E., n = 5 in each
group). Asterisks indicate significant differences
(p < 0.05) in comparison with iNOS(234/+31) in the
presence of IL-1. Crosses indicate significant
differences (p < 0.05) in comparison with
iNOS(331/+31 NF-Bm) in the presence of IL-1.
, we transfected constructs iNOS(234/+31), iNOS(331/+31 NF-Bm), iNOS(331/+31
OCTm), and iNOS(331/+31 NF/OCTm) into RASMC and stimulated the cells with LPS. LPS and IL-1 had an almost identical effect on iNOS promoter/enhancer activity. Mutation of the NF-Bd site caused a significant reduction (72%) in iNOS promoter/enhancer activity after LPS stimulation; activity was reduced even further (87%) in the construct containing a mutated Oct site (Fig.
3A). Again, activity after
mutation of both sites was not different from activity after mutation
of the Oct site alone. We also transfected these constructs into
alveolar macrophages and stimulated the cells with LPS. In comparison
with iNOS promoter/enhancer activity in vascular smooth muscle cells,
mutation of the NF-Bd site produced a more dramatic
reduction in macrophages (85%) after LPS stimulation (Fig.
3B). Mutation of the Oct site again caused a dramatic
reduction (92%) in iNOS promoter/enhancer activity after LPS
stimulation. These experiments demonstrate that binding of nuclear
proteins at the downstream Oct site is important for activation of the
iNOS promoter/enhancer in both vascular smooth muscle cells and
macrophages, and that this site is important for iNOS activation after
stimulation with two mediators of inflammation, IL-1 and LPS.
View larger version (17K):
[in a new window]
Fig. 3.
Response of the
NF- Bd and Oct sites in the iNOS
promoter/enhancer to LPS stimulation in vascular smooth muscle cells
and macrophages. The same plasmids described for Fig. 2 were
transfected into RASMC (A) or macrophages (B) in
the presence (+, black bars) or absence (,
white bars) of LPS. Mutations are marked by
X. All constructs were cotransfected with pOPRSVI-CAT to
correct for differences in transfection efficiency. Luciferase activity
is expressed as a percentage of the value for iNOS(234/+31) in the
absence of LPS (mean ± S.E., n = 5 in each
group). Asterisks indicate significant differences
(p < 0.05) in comparison with iNOS(234/+31) in the
presence of LPS. Crosses indicate significant differences
(p < 0.05) in comparison with iNOS(331/+31
NF-Bm) in the presence of LPS.
Bd and Oct
sites, we performed EMSA with a radiolabeled probe encoding region 87
to 52 of the iNOS 5'-flanking sequence. Incubation of recombinant
HMG-I(Y) with the probe containing intact NF-Bd and Oct
sites resulted in a DNA-protein complex (Fig.
4A). This complex was specific because a 500-fold molar excess of unlabeled identical oligonucleotide, but not unrelated oligonucleotide, competed for HMG-I(Y) binding and
abolished the DNA-protein complex. To localize the site of HMG-I(Y)
binding, we incubated recombinant HMG-I(Y) with a radiolabeled probe
containing intact NF-Bd and Oct sites, a mutated NF-Bd site, or a mutated Oct site. Like the wild-type probe containing intact binding sites, the probe containing a mutated
NF-Bd site was able to bind to HMG-I(Y) (Fig. 4B). Mutation of the AT-rich Oct site, however, resulted in
a marked reduction in HMG-I(Y) binding. In addition, a probe containing a mutated region between the NF-Bd and Oct sites did not disrupt HMG-I(Y) binding (data not shown). These data suggest that
binding of HMG-I(Y) within region 87 to 52 of the iNOS promoter/enhancer occurs at the Oct binding site.
View larger version (53K):
[in a new window]
Fig. 4.
HMG-I(Y) binding to the iNOS 5'-flanking
sequence by EMSA. A, oligonucleotides containing bp
87 to 52 of the iNOS promoter/enhancer were radiolabeled and
incubated with recombinant HMG-I(Y) (100 ng). Unlabeled competitors
were added at a 500-fold molar excess as indicated. I,
identical competitor; NI, non-identical competitor.
B, EMSA were performed with radiolabeled
oligonucleotides encoding bp 87 to 52 of the iNOS
promoter/enhancer. The oligonucleotides contained the wild-type
sequence (iNOS WT), a mutated NF-B site
(NF-B mut), or a mutated Oct site (Oct
mut). The radiolabeled probes were incubated in the presence (+)
or absence () of recombinant HMG-I(Y) (100 ng).
B Subunit p50 Bind to the iNOS Promoter/Enhancer
and Form a Ternary Complex--
EMSA were performed with a
radiolabeled probe encoding region 87 to 52 of the iNOS 5'-flanking
sequence (containing intact NF-Bd and Oct sites) and
recombinant p50 (an important DNA binding subunit of
NF-B; Refs. 45 and 46), in the absence or presence of
recombinant HMG-I(Y). Incubating the probe with p50 resulted in a
slowly migrating DNA-protein complex whose intensity increased with
increasing concentrations of p50 (Fig.
5). A polyclonal antibody to p50
completely supershifted this DNA-protein complex. Incubation with
HMG-I(Y) caused the probe to form a more rapidly migrating DNA-protein
complex than did incubation with p50. When the probe and increasing
concentrations of p50 were incubated in the presence of HMG-I(Y), the
DNA-protein complex was more intense and migrated more slowly than did
the complex formed with p50 alone (Fig. 5). As this upper DNA-protein complex formed, the intensity of the HMG-I(Y) band decreased, suggesting that HMG-I(Y) was being incorporated into a ternary complex.
The addition of a polyclonal antibody to p50 supershifted all
components.
View larger version (63K):
[in a new window]
Fig. 5.
HMG-I(Y) and NF- B
subunit p50 bind to the iNOS promoter/enhancer and form a ternary
DNA-protein complex. EMSA were performed with a
radiolabeled oligonucleotide encoding bp 87 to 52 of the iNOS
promoter/enhancer. Increasing concentrations of p50 were incubated with
the radiolabeled probe in the presence (+) or absence () of
recombinant HMG-I(Y) (100 ng). Antibody to p50 (p50
Ab, 1 µg) was used to verify the presence of p50 in the slowly
migrating DNA-protein complexes (supershift).
and LPS are able to induce HMG-I(Y)
in vitro and in vivo, respectively (47). Thus, to determine if HMG-I(Y) had a dose-dependent effect on
formation of this ternary complex, we incubated the same radiolabeled
probe with p50 in the presence of increasing concentrations of
HMG-I(Y). The intensity of the ternary complex increased as the
concentration of HMG-I(Y) increased (Fig.
6). Addition of the p50 antibody resulted in a complete supershift of this upper, ternary complex. These data
suggest that HMG-I(Y) and NF-B subunit p50 bind to the
iNOS promoter/enhancer and that HMG-I(Y) assists in the formation of a
ternary complex.
View larger version (56K):
[in a new window]
Fig. 6.
Increasing concentrations of HMG-I(Y)
facilitate the formation of a ternary DNA-protein complex with
NF- B subunit p50. EMSA were performed
with a radiolabeled oligonucleotide encoding bp 87 to 52 of the
iNOS promoter/enhancer. Increasing concentrations of HMG-I(Y) were
incubated with the radiolabeled probe in the presence (+) or absence
() of recombinant p50 (50 ng). Antibody to p50 (p50
Ab, 1 µg) was used to verify the presence of p50 in the
slowly migrating DNA-protein complexes
(supershift).
B subunit p50 to the
iNOS promoter/enhancer and formation of a ternary complex. A
radiolabeled probe encoding region 87 to 52 of the iNOS 5'-flanking
sequence and containing a mutated Oct site was incubated with p50 in
the absence or presence of HMG-I(Y). Incubation of p50 alone with the
probe containing the Oct site mutation resulted in a slowly migrating
DNA-protein complex, and this complex was supershifted by a polyclonal
antibody to p50 (Fig. 7). Incubation of
this probe with HMG-I(Y) resulted in no DNA-protein complex formation
and thus no HMG-I(Y) binding. Also, incubation of this probe with p50
in the presence of HMG-I(Y) resulted in no ternary complex formation
(Fig. 7). These data suggest that HMG-I(Y) must bind to DNA at the Oct
site to facilitate the formation of a ternary complex between HMG-I(Y),
p50, and the iNOS promoter/enhancer.
View larger version (52K):
[in a new window]
Fig. 7.
Binding of HMG-I(Y) to the Oct site of the
iNOS promoter/enhancer is necessary for ternary complex formation with
NF- B subunit p50. EMSA were performed
with a radiolabeled oligonucleotide that encoded bp 87 to 52 of the
iNOS promoter/enhancer and contained a mutated Oct site. Recombinant
p50 (50 ng) was incubated with the radiolabeled probe in the presence
(+) or absence () of recombinant HMG-I(Y) (50 ng). Antibody to p50
(p50 Ab, 1 µg) was used to verify the presence
of p50 in the DNA-protein complexes (supershift).
B Subunits p50 and p65--
Recently, we have shown that, in
the presence of p50 and p65, HMG-I(Y) was able to increase iNOS
promoter/enhancer activity in a dose-dependent manner (47).
To extend these studies, we cotransfected the iNOS(1485/+31)
promoter/enhancer construct with expression plasmids for p50, p65, or a
combination of p50 and p65 in the absence or presence of an expression
plasmid for HMG-I(Y). The transfections were performed in
Drosophila SL2 because they contain far less endogenous
HMG-I(Y) than do mammalian cells (29). This experiment allowed us to
determine which members of a nucleoprotein complex (containing HMG-I(Y)
and NF-B subunits) would be necessary to drive iNOS
transcription most efficiently. p65 alone or in combination with p50
increased iNOS reporter activity, but the most potent effect was in the
presence of both plasmids (Fig. 8).
HMG-I(Y) alone did not significantly increase iNOS promoter/enhancer
activity. When HMG-I(Y) was transfected in conjunction with p50 alone
or p65 alone, however, iNOS reporter activity increased further in
comparison with transfections lacking HMG-I(Y). Transfection of
HMG-I(Y) in conjunction with both p50 and p65 resulted in a potentiated
increase in iNOS promoter/enhancer activity in comparison with
transfections lacking HMG-I(Y) (Fig. 8). These data suggest that
HMG-I(Y) can use either p50 or p65 to drive iNOS transcription;
however, the most dramatic effect on transactivation of the iNOS
promoter/enhancer occurs when HMG-I(Y) is coexpressed with both
NF-B subunits.
View larger version (14K):
[in a new window]
Fig. 8.
HMG-I(Y) potentiates transactivation of the
iNOS promoter/enhancer by NF- B subunits p50
and p65. Drosophila SL2 cells were transfected
transiently with iNOS promoter/enhancer construct iNOS(1485/+31) (1 µg/well) and expression plasmids encoding p50, p65, or both p50 and
p65 (100 ng/well each). The cells were transfected in the presence (+,
black bars) or absence (, white
bars) of an expression plasmid encoding HMG-I(Y) (1 µg/well). Normalized luciferase activity was plotted as the -fold
induction from the activity in cells expressing no () HMG-I(Y) and no
() p50 or p65. Values represent the mean ± S.E.
(n = 6). Asterisks indicate significant
differences (p < 0.05) in comparison with the value
obtained with the same amount of p50 or p65 but no () HMG-I(Y).
Cross indicates a significant difference (p < 0.05) in comparison with all other groups.
-responsive elements are located
within the 234 to +31 region of the iNOS 5'-flanking sequence, we
transfected construct iNOS(234/+31) into the SL2 cells. As in the
transfections with iNOS(1485/+31), HMG-I(Y) potentiated iNOS(234/+31) transactivation by p50 and p65 (Fig.
9A). In addition to
iNOS(234/+31), we also transfected construct iNOS(331/+31 NF-Bm) into the SL2 cells. The construct was
cotransfected with expression plasmids p50, p65, and HMG-I(Y). Mutation
of the NF-Bd site disrupted the ability of HMG-I(Y) to
potentiate iNOS transactivation. This same disruption also occurred
when the NF-Bd site was mutated in the construct
containing region 1485 to +31 of the iNOS promoter/enhancer (data not
shown). These data suggest that enhanced transactivation of the iNOS
promoter/enhancer by HMG-I(Y) requires an intact NF-Bd
site in the downstream region of the iNOS 5'-flanking sequence.
View larger version (11K):
[in a new window]
Fig. 9.
HMG-I(Y) requires an intact downstream
NF- B site to enhance iNOS promoter/enhancer
activity. A, Drosophila SL2 cells were
transfected transiently with iNOS promoter/enhancer construct
iNOS(234/+31) (1 µg/well) and expression plasmids encoding no
protein, HMG-I(Y) alone (1 µg/well), p50 and p65 alone (100 ng/well
each), or HMG-I(Y) plus p50 and p65. B, cells were
transfected with construct iNOS(234/+31) and HMG-I(Y) alone or
HMG-I(Y) plus p50 and p65 (black bars). The cells
were also transfected with an iNOS construct encoding a mutated
NF-Bd site (iNOS(331/+31 NF-Bm),
striped bar) in the presence of HMG-I(Y) plus p50
and p65. In both A and B, normalized luciferase
activity is plotted as the -fold induction from the activity of cells
containing no () HMG-I(Y) and no () p50 and p65. Values represent
the mean ± S.E. (n = 6). In A,
asterisks indicate significant differences
(p < 0.05) in comparison with the value obtained with
no () HMG-I(Y) and no () p50 and p65. In A and
B, cross indicates a significant difference
(p < 0.05) in comparison with all other groups.
DISCUSSION
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES
B is a critical component of the
transcriptional induction of iNOS by inflammatory stimuli (14). We have
observed elsewhere that elements other than an NF-Bd
binding site, in the downstream portion of the iNOS promoter/enhancer,
may be involved in iNOS induction after IL-1 stimulation in vascular
smooth muscle cells (20).
61 to 54) downstream of the
NF-Bd site is essential for full induction of iNOS by
IL-1 in vascular smooth muscle cells (Fig. 2). The importance of
this AT-rich region was not limited to IL-1 stimulation, as
induction of iNOS by LPS in vascular smooth muscle cells (Fig.
3A) and by LPS in macrophages (Fig. 3B) required
an intact 61 to 54 site. By in vivo footprint analysis
in macrophages, Goldring et al. showed that nuclear proteins bind to this AT-rich region, corresponding to an Oct site, after LPS
stimulation (21).
B were not investigated.
B) to an
enhanceosome complex (28, 29). Our data revealed that HMG-I(Y) bound
specifically in region 87 to 52 of the iNOS promoter/enhancer (Fig.
4A), and that this binding occurred at the AT-rich Oct site, not at the NF-Bd site (Fig. 4B). HMG-I(Y)
assisted in the formation of a ternary complex containing itself, p50,
and the iNOS promoter/enhancer (Figs. 5 and 6). The formation of this complex required the binding of HMG-I(Y) to the downstream Oct site
(Fig. 7). Although HMG-I(Y) alone had no significant effect on iNOS
reporter activity, HMG-I(Y) did increase iNOS activity in the presence
of p50 or p65. Moreover, the most dramatic increase in iNOS
transactivation occurred when HMG-I(Y) was coexpressed with both p50
and p65 (Fig. 8). These data suggest that HMG-I(Y) works in conjunction
with subunits of NF-B to drive transcription of the iNOS
promoter/enhancer. Deletion of an upstream NF-B site
(971 to 962) had no effect on HMG-I(Y)'s ability to potentiate iNOS transactivation by p50 and p65 (Fig. 9A); however,
mutation of the downstream NF-Bd site (85 to 76)
disrupted this HMG-I(Y) response (Fig. 9B). Thus, binding of
HMG-I(Y) at the Oct site (61 to 54) in conjunction with binding of
NF-B subunits at the NF-Bd site (85 to
76) appears to be essential for the most potent activation of the
iNOS promoter/enhancer.
Bd site. Our experiments show that NF-B
subunits p50 and p65 drive iNOS transcription most efficiently in the
presence of HMG-I(Y), even though the binding sites for these factors
do not overlap. Future studies will focus on additional transcription
factors that may interact with NF-B and HMG-I(Y) to form
an enhanceosome complex and drive iNOS transcription. Because HMG-I(Y)
binds at the AT-rich Oct site in the iNOS promoter/enhancer and
HMG-I(Y) is known to interact with POU domain proteins (55), we will
initially concentrate on transcription factors that preferentially bind
to AT-rich sequences and POU domain proteins.
ACKNOWLEDGEMENTS
FOOTNOTES
These authors contributed equally to this study.
ABBREVIATIONS
REFERENCES
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES
Copyright © 1999 by The American Society for Biochemistry and Molecular Biology, Inc.
CiteULike 
Complore 
Connotea 
Del.icio.us 
Digg 
Reddit 
Technorati What's this?
This article has been cited by other articles:
|
|
 |
|
  J. L. Kopp, P. J. Wilder, M. Desler, L. Kinarsky, and A. Rizzino Different Domains of the Transcription Factor ELF3 Are Required in a Promoter-specific Manner and Multiple Domains Control Its Binding to DNA J. Biol. Chem., February 2, 2007; 282(5): 3027 - 3041. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
P. O. Hassa, S. S. Haenni, C. Buerki, N. I. Meier, W. S. Lane, H. Owen, M. Gersbach, R. Imhof, and M. O. Hottiger Acetylation of Poly(ADP-ribose) Polymerase-1 by p300/CREB-binding Protein Regulates Coactivation of NF-{kappa}B-dependent Transcription J. Biol. Chem., December 9, 2005; 280(49): 40450 - 40464. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
Z. Yu and B. C. Kone Hypermethylation of the Inducible Nitric-oxide Synthase Gene Promoter Inhibits Its Transcription J. Biol. Chem., November 5, 2004; 279(45): 46954 - 46961. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 S. Giri, R. Rattan, A. K. Singh, and I. Singh The 15-Deoxy-{delta}12,14-Prostaglandin J2 Inhibits the Inflammatory Response in Primary Rat Astrocytes via Down-Regulating Multiple Steps in Phosphatidylinositol 3-Kinase-Akt-NF-{kappa}B-p300 Pathway Independent of Peroxisome Proliferator-Activated Receptor {gamma} J. Immunol., October 15, 2004; 173(8): 5196 - 5208. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 C. J. Lowenstein and E. Padalko iNOS (NOS2) at a glance J. Cell Sci., June 15, 2004; 117(14): 2865 - 2867. [Full Text] [PDF]
|
|
|
|
|
|
A. Chantome, A. Pance, N. Gauthier, D. Vandroux, J. Chenu, E. Solary, J.-F. Jeannin, and S. Reveneau Casein Kinase II-mediated Phosphorylation of NF-{kappa}B p65 Subunit Enhances Inducible Nitric-oxide Synthase Gene Transcription in Vivo J. Biol. Chem., June 4, 2004; 279(23): 23953 - 23960. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. I. Darville, S. Terryn, and D. L. Eizirik An Octamer Motif Is Required for Activation of the Inducible Nitric Oxide Synthase Promoter in Pancreatic {beta}-Cells Endocrinology, March 1, 2004; 145(3): 1130 - 1136. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 X. Chen, J. Lechago, A. Ertan, G. Ergun, R. Verm, M. Bridges, C. Johnson, K. Woods, F. Meriano, M. Chirala, et al. Expression of the High Mobility Group Proteins HMGI(Y) Correlates with Malignant Progression in Barrett's Metaplasia Cancer Epidemiol. Biomarkers Prev., January 1, 2004; 13(1): 30 - 33. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 W. Cao, C. Bao, and C. J. Lowenstein Inducible nitric oxide synthase expression inhibition by adenovirus E1A PNAS, June 24, 2003; 100(13): 7773 - 7778. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. H. Kwon, S. Keates, S. Simeonidis, F. Grall, T. A. Libermann, and A. C. Keates ESE-1, an Enterocyte-specific Ets Transcription Factor, Regulates MIP-3alpha Gene Expression in Caco-2 Human Colonic Epithelial Cells J. Biol. Chem., January 3, 2003; 278(2): 875 - 884. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 A. Henderson, M. Bunce, N. Siddon, R. Reeves, and D. J. Tremethick High-Mobility-Group Protein I Can Modulate Binding of Transcription Factors to the U5 Region of the Human Immunodeficiency Virus Type 1 Proviral Promoter J. Virol., November 15, 2000; 74(22): 10523 - 10534. [Abstract] [Full Text]
|
|
|
|
 |
|
 L. C. FOSTER, P. WIESEL, G. S. HUGGINS, R. PAÑARES, M. T. CHIN, A. PELLACANI, and M. A. PERRELLA Role of activating protein-1 and high mobility group-I(Y) protein in the induction of CD44 gene expression by interleukin-1{beta} in vascular smooth muscle cells FASEB J, February 1, 2000; 14(2): 368 - 378. [Abstract] [Full Text]
|
|
|
|
|
|
S. Rudders, J. Gaspar, R. Madore, C. Voland, F. Grall, A. Patel, A. Pellacani, M. A. Perrella, T. A. Libermann, and P. Oettgen ESE-1 Is a Novel Transcriptional Mediator of Inflammation That Interacts with NF-kappa B to Regulate the Inducible Nitric-oxide Synthase Gene J. Biol. Chem., January 26, 2001; 276(5): 3302 - 3309. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. Pellacani, P. Wiesel, S. Razavi, V. Vasilj, M. W. Feinberg, M. T. Chin, R. Reeves, and M. A. Perrella Down-regulation of High Mobility Group-I(Y) Protein Contributes to the Inhibition of Nitric-oxide Synthase 2 by Transforming Growth Factor-beta 1 J. Biol. Chem., January 5, 2001; 276(2): 1653 - 1659. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| All ASBMB Journals | Molecular and Cellular Proteomics |
| Journal of Lipid Research | ASBMB Today |