Advertisement
JBC

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Perrella, M. A.
Right arrow Articles by Lee, M.-E.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Perrella, M. A.
Right arrow Articles by Lee, M.-E.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

J Biol Chem, Vol. 274, Issue 13, 9045-9052, March 26, 1999


High Mobility Group-I(Y) Protein Facilitates Nuclear Factor-kappa B Binding and Transactivation of the Inducible Nitric-oxide Synthase Promoter/Enhancer*

Mark A. PerrellaDagger §parallel **, Andrea PellacaniDagger parallel , Philippe WieselDagger , Michael T. ChinDagger §Dagger Dagger , Lauren C. FosterDagger , Maureen IbanezDagger , Chung-Ming HsiehDagger , Raymond Reeves§§, Shaw-Fang YetDagger , and Mu-En LeeDagger §Dagger Dagger

From the Dagger  Cardiovascular Biology Laboratory, Harvard School of Public Health, Boston, Massachusetts 02115, the § Department of Medicine, Harvard Medical School, Boston, Massachusetts 02115, the Dagger Dagger  Cardiovascular and  Pulmonary and Critical Care Divisions, Brigham and Women's Hospital, Boston, Massachusetts 02115, and the §§ Department of Biochemistry and Biophysics, Washington State University, Pullman, Washington 99164

    ABSTRACT
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

Nitric oxide (NO), a free radical gas whose production is catalyzed by the enzyme NO synthase, participates in the regulation of multiple organ systems. The inducible isoform of NO synthase (iNOS) is transcriptionally up-regulated by inflammatory stimuli; a critical mediator of this process is nuclear factor (NF)-kappa B. Our objective was to determine which regulatory elements other than NF-kappa B binding sites are important for activation of the iNOS promoter/enhancer. We also wanted to identify transcription factors that may be functioning in conjunction with NF-kappa B (subunits p50 and p65) to drive iNOS transcription. Deletion analysis of the iNOS promoter/enhancer revealed that an AT-rich sequence (-61 to -54) downstream of the NF-kappa B site (-85 to -76) in the 5'-flanking sequence was important for iNOS induction by interleukin-1beta and endotoxin in vascular smooth muscle cells. This AT-rich sequence, corresponding to an octamer (Oct) binding site, bound the architectural transcription factor high mobility group (HMG)-I(Y) protein. Electrophoretic mobility shift assays showed that HMG-I(Y) and NF-kappa B subunit p50 bound to the iNOS promoter/enhancer to form a ternary complex. The formation of this complex required HMG-I(Y) binding at the Oct site. The location of an HMG-I(Y) binding site typically overlaps that of a recruited transcription factor. In the iNOS promoter/enhancer, however, HMG-I(Y) formed a complex with p50 while binding downstream of the NF-kappa B site. Furthermore, overexpression of HMG-I(Y) potentiated iNOS promoter/enhancer activity by p50 and p65 in transfection experiments, suggesting that HMG-I(Y) contributes to the transactivation of iNOS by NF-kappa B.

    INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

Nitric oxide (NO) is a free radical gas that participates in the physiologic or pathophysiologic regulation of multiple organ systems (1-3). Production of NO from its substrate, L-arginine, is catalyzed by NO synthase (NOS)1 (4, 5). Three isoforms of NOS (NOS 1-3) are present in mammalian cells, each encoded by a unique gene. The high output pathway of NO production is catalyzed by NOS2, a transcriptionally regulated gene that is induced after immunologic or inflammatory stimuli. We refer to this inducible NOS2 isoform as iNOS. Although iNOS was originally identified and characterized in macrophages (6-8), it is present in numerous cell types including vascular smooth muscle cells (9-11).

Much of the initial evaluation of the mouse iNOS gene focused on its transcriptional regulation in macrophages after lipopolysaccharide (LPS) and interferon (IFN)-gamma stimulation (12, 13). Dissection of the iNOS promoter/enhancer revealed that a downstream nuclear factor (NF)-kappa B site (-85 to -76, NF-kappa Bd) is critical for activation of iNOS by LPS in macrophages. In the presence of LPS, c-Rel or Rel A (p65) binds with p50 to form heterodimers on the iNOS promoter/enhancer, in conjunction with additional unidentified proteins (14). Further studies revealed that a more upstream region of the iNOS promoter/enhancer (-951 to -911) is responsible for the synergistic induction of iNOS by IFN-gamma and LPS. IFN regulatory factor (IRF)-1 binding to an IRF binding site (IRF-E) (15) and Stat1alpha binding to an IFN-gamma -activated site (16) contribute to optimal induction of iNOS by IFN-gamma and LPS.

Interleukin (IL)-1beta and tumor necrosis factor-alpha (important pro-inflammatory cytokines generated after LPS stimulation in vivo; Refs. 17 and 18) are potent activators of iNOS transcription in vascular smooth muscle cells (10, 11, 19). We have shown that the downstream NF-kappa Bd site (-85 to -76) is important for proinflammatory cytokine induction of the iNOS promoter/enhancer in vascular smooth muscle cells (20). However, elements other than this NF-kappa Bd site in the downstream portion of the iNOS 5'-flanking sequence (-234 to +31) also appear to be crucial for full activation of iNOS (20). We designed the present study to further elucidate the important regulatory elements in region -234 to +31 responsible for iNOS induction in vascular smooth muscle cells by the proinflammatory cytokine IL-1beta .

Goldring and colleagues (21) demonstrated by in vivo footprint analysis in macrophages that, in addition to the NF-kappa B sites, nuclear protein binding occurred after LPS stimulation at NF-IL6 (-150 to -142) and octamer (Oct) (-61 to -54) sites of the iNOS promoter/enhancer (21). Their report revealed potential binding sites in region -234 to +31 of the iNOS promoter/enhancer but lacked a detailed functional analysis of these sites. Until our present study, the functional importance of these sites in vascular smooth muscle cells had not been elucidated. Furthermore, there had been no identification of nuclear proteins (binding in the downstream region of the iNOS promoter/enhancer) that facilitate iNOS transactivation by NF-kappa B.

Nuclear proteins that interact with members of the NF-kappa B family include the nonhistone chromosomal proteins of the high mobility group (HMG)-I(Y) family (22). HMG-I(Y) proteins play a role in the transcriptional regulation of certain mammalian genes whose promoter/enhancer regions contain AT-rich sequences (22-24).

HMG-I(Y) refers to two proteins, HMG-I and HMG-Y, that are alternatively spliced products of the same gene (25). HMG-I(Y) binds to AT-rich regions in the minor groove of DNA (26), and it is known to bind Oct sequence motifs (27). HMG-I(Y) facilitates the assembly of functional nucleoprotein complexes (enhanceosomes) by modifying DNA conformation and by recruiting nuclear proteins to an enhancer (28, 29). The role of HMG-I(Y) in enhanceosome assembly has been studied extensively in the IFN-beta gene after viral stimulation (28-33). HMG-I(Y) has been shown to enhance the binding of transcription factors, such as NF-kappa B and activating transcription factor-2, to their binding sites by DNA-protein and protein-protein interactions (28-33). Because of the aforementioned properties of HMG-I(Y), we determined whether this protein bound to the iNOS promoter/enhancer and interacted with NF-kappa B subunits to regulate iNOS gene transcription. We also determined whether the site of HMG-I(Y) binding overlapped a binding site for NF-kappa B (as occurs with IFN-beta ), or if HMG-I(Y) bound at a site different from NF-kappa B.

    EXPERIMENTAL PROCEDURES
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

Materials-- Salmonella typhosa LPS (Sigma) was dissolved in 0.9% saline and stored at -20 °C. Recombinant human IL-1beta (Collaborative Biomedical, Bedford, MA) was stored at -80 °C until use. Recombinant human NF-kappa B subunit p50 (Promega Corp., Madison, WI) was also stored at -80 °C until use. A goat polyclonal antibody to p50 (Santa Cruz Biotechnology, Santa Cruz, CA) was used for supershift experiments.

Cell Culture-- Rat aortic smooth muscle cells (RASMC) were harvested from male Sprague-Dawley rats (200-250 g) by enzymatic dissociation according to the method of Gunther et al. (34). The cells were cultured in Dulbecco's modified Eagle's medium (JRH Biosciences, Lenexa, KS) supplemented with 10% heat-inactivated fetal bovine serum (FBS, HyClone, Logan, UT), penicillin (100 units/ml), streptomycin (100 µg/ml), and 25 mM HEPES (pH 7.4) (Sigma) in a humidified incubator at 37 °C. RASMC were passaged every 4-5 days, and experiments were performed on cells 4-6 passages from primary culture. Rat alveolar macrophage cell line NR8383 (35) was grown in RPMI 1640 medium (JRH Biosciences) supplemented with 2% heat-inactivated FBS (HyClone), penicillin (100 units/ml), and streptomycin (100 µg/ml) (Sigma) in a humidified incubator at 37 °C. Drosophila SL2 cells (ATCC, Rockville, MD) (36) were maintained at 23 °C in Schneider's insect medium (Sigma) supplemented with 12% heat-inactivated FBS and gentamycin (50 µg/ml).

Plasmids-- Plasmid pGL2-Basic contained the firefly luciferase gene without any promoter (Promega, Madison, WI). Reporter constructs containing fragments of the mouse iNOS 5'-flanking sequence were named according to the location of the fragment from the transcription start site in the 5' and 3' directions. A 1516-base pair (bp) fragment amplified from mouse genomic DNA, containing 1485 bp of the 5'-flanking region and the first 31 bp after the transcription start site, was named iNOS(-1485/+31), as described (20). A shorter fragment, iNOS(-234/+31), was generated by polymerase chain reaction from iNOS(-1485/+31) as described (20). The downstream NF-kappa Bd site was mutated (-85 to -83, GGG to CTC) in the -1485 to +31 fragment by using a site-directed mutagenesis technique (20), and this construct was named iNOS(-1485/+31 NF-kappa Bm).

To localize binding elements other than NF-kappa Bd that may be important for IL-1beta or LPS induction of iNOS, we used iNOS(-1485/+31 NF-kappa Bm) as a template to generate a series of truncated iNOS 5'-flanking fragments by polymerase chain reaction. Constructs containing these 5'-deletion fragments were named iNOS(-331/+31 NF-kappa Bm), iNOS(-208/+31 NF-kappa Bm), iNOS(-141/+31 NF-kappa Bm), iNOS(-97/+31 NF-kappa Bm), and iNOS(-69/+31). We also used iNOS(-1485/+31) or iNOS(-1485/+31 NF-kappa Bm) as a template to mutate the downstream Oct site (-61 to -54, ATGCAAAA to CGTACCCC) by a site-directed technique (20). The new constructs were named iNOS(-331/+31 OCTm) and iNOS(-331/+31 NF/OCTm). All constructs were inserted into pGL2-Basic and sequenced by the dideoxy nucleotide chain termination method (37) to confirm the insert's orientation and sequence. Plasmid pOPRSVI-CAT contained the prokaryotic chloramphenicol acetyltransferase (CAT) gene (Stratagene, La Jolla, CA) driven by a Rous sarcoma virus-long terminal repeat promoter. Plasmid pPAC was described elsewhere (29, 38). NF-kappa B subunit p50 and p65 expression constructs were made by inserting cDNAs coding for the subunits into the BamHI site of pPAC (39). Expression vectors phsp82LacZ and pPACHMGI were described elsewhere (29).

Transfections-- RASMC were transfected by a DEAE-dextran method (20). In brief, 500,000 cells were plated onto 100-mm tissue culture dishes and allowed to grow for 48-72 h (until 80-90% confluent). Then iNOS luciferase constructs and pOPRSVI-CAT (to correct for differences in transfection efficiency) were added (5 µg each) to the RASMC in a solution containing 500 µg/ml DEAE-dextran. RASMC were subsequently shocked with 5% dimethyl sulfoxide solution for 1 min and then allowed to recover in medium containing 10% heat-inactivated FBS. Twelve hours after transfection, RASMC were placed in 2% FBS. RASMC were then stimulated with vehicle, human recombinant IL-1beta (10 ng/ml), or LPS (1 µg/ml) for 48 h. The doses of IL-1beta and LPS, and the duration of stimulation, were chosen on the basis of pilot experiments (data not shown).

Rat alveolar macrophages (NR8383) were also transfected by the same DEAE-dextran method (20), with the exception that they were treated in a floating suspension (the RASMC were attached to culture dishes). Twelve hours after transfection, the macrophages were stimulated with LPS (1 µg/ml) for 48 h. In both the RASMC and macrophage transfection experiments, cell extracts were prepared by detergent lysis (Promega), and luciferase activity was measured with an AutoLumat LB953 luminometer (EG&G, Gaithersburg, MD) and the Promega luciferase assay system. To evaluate the efficiency of transfection, we performed a CAT assay by a modified two-phase fluor diffusion method as described (40, 41). The ratio of luciferase to CAT activity in each sample served as a measure of normalized luciferase activity.

SL2 cells were transfected by the calcium-phosphate method according to Di Nocera and Dawid (42). In brief, SL2 cells were plated in six-well tissue culture dishes (Costar Corp, Cambridge, MA) 24 h before transfection. Transfection was then performed in six separate wells for each condition. iNOS plasmids were added at 1 µg/well. Plasmids p50-pPAC, p65-pPAC, and phsp82LacZ were added at 100 ng/well. Plasmid pPACHMGI was added at 1 µg/well, alone or in combination with p50-pPAC or p65-pPAC (or both). The expression plasmid doses were chosen on the basis of pilot experiments (data not shown). Forty-eight hours after the initial transfection, extracts from the SL2 cells were prepared and luciferase activity was measured as described for RASMC. beta -Galactosidase assays were performed as described elsewhere (43). The ratio of luciferase activity to beta -galactosidase activity in each sample served as a measure of normalized luciferase activity.

Protein Expression and Purification-- The prokaryotic expression plasmid for mouse HMG-I(Y), pRSETHMG-I(Y), was prepared as described (44). Plasmid pRSETHMG-I(Y) (containing the HMG-I(Y) protein, a vector-derived polyhistidine tag, and an enterokinase cleavage site) was transferred into Escherichia coli strain BL21(DE3)pLysS. Expression was induced in culture (mid-log phase) by the addition of 1 mM isopropyl-1-thio-beta -D-galactopyranoside. Three hours after induction of expression, the bacteria were lysed and HMG-I(Y) was purified by cobalt affinity chromatography under denaturing conditions according to the instructions of the manufacturer (CLONTECH). Proteins were renatured by dialysis overnight against 20 mM HEPES (pH 7.8), 20 mM KCl, and 0.2% Tween 20 at 4 °C. The dialysate was stored at -80 °C until use.

Electrophoretic Mobility Shift Assays (EMSA)-- EMSA were performed with double-stranded oligonucleotide probes encoding region -87 to -52 of the iNOS 5'-flanking sequence (TGGGGACTCTCCCTTTGGGAACAGTTATGCAAAATA).

Probes were also generated with mutations in the -85 to -76 NF-kappa Bd site (TGCTCCAGAGGGCTTTGGGAACAGTTATGCAAAATA) and the -61 to -54 Oct site (TGGGGACTCTCCCTTTGGGAACAGTTCGTACCCCTA). Prior to annealing, polynucleotide kinase (Boehringer Mannheim) was used to label the oligonucleotides with [gamma -32P]ATP. A typical binding reaction contained 20,000 cpm DNA probe, 10 mM Tris-HCl (pH 7.5), 50 mM KCl, 0.1 mM EDTA, 250 µg/ml acetylated bovine serum albumin, 1 mM dithiothreitol, 5% glycerol, 500 ng of poly(dG-dC·dG-dC), and recombinant HMG-I(Y) and/or p50 protein in a final volume of 25 µl. The reaction mixture was allowed to incubate for 20 min at room temperature. The DNA-protein complexes were then fractionated on a 5% native polyacrylamide electrophoretic gel in a 0.25× Tris borate-EDTA recirculating buffer system at 4 °C.

Statistics-- Data from the SL2 cell transfection experiments were subjected to analysis of variance followed by Scheffe's test. Significance was assumed at p < 0.05.

    RESULTS
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

A Downstream Oct Binding Site Is Pivotal to Induction of the iNOS Promoter/Enhancer by IL-1beta and LPS in Vascular Smooth Muscle Cells-- We have demonstrated elsewhere that the IL-1beta -responsive elements in iNOS reside between bp -234 and +31 of the 5'-flanking sequence (20). Our previous data also suggested that elements other than NF-kappa Bd in this downstream region contributed to activation of the iNOS promoter/enhancer by IL-1beta in vascular smooth muscle cells. To reveal these other IL-1beta -responsive elements in the iNOS 5'-flanking sequence, we generated deletion constructs containing a mutated NF-kappa Bd site. This approach ensured that any induction of iNOS promoter/enhancer activity after transfection of the constructs into vascular smooth muscle cells would not be the result of nuclear protein binding to the NF-kappa Bd site. Beyond a decrease in iNOS promoter/enhancer activity after mutation of the NF-kappa Bd site (Fig. 1), no further reduction in IL-1beta responsiveness occurred, even after the iNOS 5'-flanking sequence had been reduced to a construct containing bases -69 to +31 of the downstream promoter. Other than the TATA box, an AT-rich Oct site (-61 to -54) remained in this portion of the iNOS 5'-flanking sequence.


View larger version (16K):
[in this window]
[in a new window]
 
Fig. 1.   Deletion analysis of iNOS promoter/enhancer activity in response to IL-1beta stimulation. Plasmids containing variable lengths of the mouse iNOS 5'-flanking sequence and a luciferase reporter gene were transfected into RASMC. The white bar (n = 10) represents the promoter/enhancer activity of a construct containing an intact 5'-flanking sequence (bp -1485 to +31) of the iNOS gene. The black bars (n = 4 in each group) represent deletion constructs containing a mutated NF-kappa Bd site (as marked by X) and a construct truncated past the NF-kappa Bd site (construct -69 to +31). All constructs were cotransfected with pOPRSVI-CAT to correct for differences in transfection efficiency. Luciferase activity is expressed as the percentage increase produced by IL-1beta (mean ± S.E.). Asterisks indicate significant differences (p < 0.05) in comparison with iNOS(-1485/+31) (white bar).

Using site-directed mutagenesis, we generated constructs of the downstream iNOS 5'-flanking sequence that contained no mutations (iNOS(-234/+31)), a mutation at the NF-kappa Bd site (iNOS(-331/+31 NF-kappa Bm)), a mutation at the Oct site (iNOS(-331/+31 OCTm)), or mutations at both sites (iNOS(-331/+31 NF/OCTm)). These constructs were transfected into RASMC and stimulated with vehicle or IL-1beta . Mutation of the NF-kappa Bd site produced a 69% reduction in iNOS promoter/enhancer activity after stimulation with IL-1beta (Fig. 2). Furthermore, mutation of the Oct site led to an even greater reduction (90%) in iNOS activity after IL-1beta stimulation. Mutating both sites did not cause iNOS promoter/enhancer activity to fall below the level obtained by mutating the Oct site alone. Taken together, the data in Fig. 2 suggest that the Oct binding site (-61 to -54) is critical for induction of iNOS promoter/enhancer activity by IL-1beta in vascular smooth muscle cells. The absence of a further reduction in iNOS promoter/enhancer activity after mutation of both sites suggests that there may be an interaction between nuclear proteins that bind at the Oct site and nuclear proteins that bind at the NF-kappa Bd site. There were no significant differences in promoter/enhancer activity among iNOS constructs that received vehicle alone.


View larger version (24K):
[in this window]
[in a new window]
 
Fig. 2.   Response of the NF-kappa Bd and Oct sites in the iNOS promoter/enhancer to IL-1beta stimulation. Plasmids containing no mutation (iNOS(-234/+31)), a mutation at the NF-kappa Bd site (iNOS(-331/+31 NF-kappa Bm)), a mutation at the Oct site (iNOS(-331/+31 OCTm)), or mutations at both sites (iNOS(-331/+31 NF/OCTm)) were transfected into RASMC in the presence (+, black bars) or absence (-, white bars) of IL-1beta . Mutations are marked by X. All constructs were cotransfected with pOPRSVI-CAT to correct for differences in transfection efficiency. Luciferase activity is expressed as a percentage of the value for iNOS(-234/+31) in the absence of IL-1beta (mean ± S.E., n = 5 in each group). Asterisks indicate significant differences (p < 0.05) in comparison with iNOS(-234/+31) in the presence of IL-1beta . Crosses indicate significant differences (p < 0.05) in comparison with iNOS(-331/+31 NF-kappa Bm) in the presence of IL-1beta .

To determine if this Oct site was important for iNOS induction by inflammatory stimuli other than IL-1beta , we transfected constructs iNOS(-234/+31), iNOS(-331/+31 NF-kappa Bm), iNOS(-331/+31 OCTm), and iNOS(-331/+31 NF/OCTm) into RASMC and stimulated the cells with LPS. LPS and IL-1beta had an almost identical effect on iNOS promoter/enhancer activity. Mutation of the NF-kappa Bd site caused a significant reduction (72%) in iNOS promoter/enhancer activity after LPS stimulation; activity was reduced even further (87%) in the construct containing a mutated Oct site (Fig. 3A). Again, activity after mutation of both sites was not different from activity after mutation of the Oct site alone. We also transfected these constructs into alveolar macrophages and stimulated the cells with LPS. In comparison with iNOS promoter/enhancer activity in vascular smooth muscle cells, mutation of the NF-kappa Bd site produced a more dramatic reduction in macrophages (85%) after LPS stimulation (Fig. 3B). Mutation of the Oct site again caused a dramatic reduction (92%) in iNOS promoter/enhancer activity after LPS stimulation. These experiments demonstrate that binding of nuclear proteins at the downstream Oct site is important for activation of the iNOS promoter/enhancer in both vascular smooth muscle cells and macrophages, and that this site is important for iNOS activation after stimulation with two mediators of inflammation, IL-1beta and LPS.


View larger version (17K):
[in this window]
[in a new window]
 
Fig. 3.   Response of the NF-kappa Bd and Oct sites in the iNOS promoter/enhancer to LPS stimulation in vascular smooth muscle cells and macrophages. The same plasmids described for Fig. 2 were transfected into RASMC (A) or macrophages (B) in the presence (+, black bars) or absence (-, white bars) of LPS. Mutations are marked by X. All constructs were cotransfected with pOPRSVI-CAT to correct for differences in transfection efficiency. Luciferase activity is expressed as a percentage of the value for iNOS(-234/+31) in the absence of LPS (mean ± S.E., n = 5 in each group). Asterisks indicate significant differences (p < 0.05) in comparison with iNOS(-234/+31) in the presence of LPS. Crosses indicate significant differences (p < 0.05) in comparison with iNOS(-331/+31 NF-kappa Bm) in the presence of LPS.

HMG-I(Y) Binds to the iNOS 5'-Flanking Sequence at the Downstream Oct Binding Site-- To determine if HMG-I(Y) could bind to the iNOS promoter/enhancer region containing the NF-kappa Bd and Oct sites, we performed EMSA with a radiolabeled probe encoding region -87 to -52 of the iNOS 5'-flanking sequence. Incubation of recombinant HMG-I(Y) with the probe containing intact NF-kappa Bd and Oct sites resulted in a DNA-protein complex (Fig. 4A). This complex was specific because a 500-fold molar excess of unlabeled identical oligonucleotide, but not unrelated oligonucleotide, competed for HMG-I(Y) binding and abolished the DNA-protein complex. To localize the site of HMG-I(Y) binding, we incubated recombinant HMG-I(Y) with a radiolabeled probe containing intact NF-kappa Bd and Oct sites, a mutated NF-kappa Bd site, or a mutated Oct site. Like the wild-type probe containing intact binding sites, the probe containing a mutated NF-kappa Bd site was able to bind to HMG-I(Y) (Fig. 4B). Mutation of the AT-rich Oct site, however, resulted in a marked reduction in HMG-I(Y) binding. In addition, a probe containing a mutated region between the NF-kappa Bd and Oct sites did not disrupt HMG-I(Y) binding (data not shown). These data suggest that binding of HMG-I(Y) within region -87 to -52 of the iNOS promoter/enhancer occurs at the Oct binding site.


View larger version (53K):
[in this window]
[in a new window]
 
Fig. 4.   HMG-I(Y) binding to the iNOS 5'-flanking sequence by EMSA. A, oligonucleotides containing bp -87 to -52 of the iNOS promoter/enhancer were radiolabeled and incubated with recombinant HMG-I(Y) (100 ng). Unlabeled competitors were added at a 500-fold molar excess as indicated. I, identical competitor; NI, non-identical competitor. B, EMSA were performed with radiolabeled oligonucleotides encoding bp -87 to -52 of the iNOS promoter/enhancer. The oligonucleotides contained the wild-type sequence (iNOS WT), a mutated NF-kappa B site (NF-kappa B mut), or a mutated Oct site (Oct mut). The radiolabeled probes were incubated in the presence (+) or absence (-) of recombinant HMG-I(Y) (100 ng).

HMG-I(Y) and NF-kappa B Subunit p50 Bind to the iNOS Promoter/Enhancer and Form a Ternary Complex-- EMSA were performed with a radiolabeled probe encoding region -87 to -52 of the iNOS 5'-flanking sequence (containing intact NF-kappa Bd and Oct sites) and recombinant p50 (an important DNA binding subunit of NF-kappa B; Refs. 45 and 46), in the absence or presence of recombinant HMG-I(Y). Incubating the probe with p50 resulted in a slowly migrating DNA-protein complex whose intensity increased with increasing concentrations of p50 (Fig. 5). A polyclonal antibody to p50 completely supershifted this DNA-protein complex. Incubation with HMG-I(Y) caused the probe to form a more rapidly migrating DNA-protein complex than did incubation with p50. When the probe and increasing concentrations of p50 were incubated in the presence of HMG-I(Y), the DNA-protein complex was more intense and migrated more slowly than did the complex formed with p50 alone (Fig. 5). As this upper DNA-protein complex formed, the intensity of the HMG-I(Y) band decreased, suggesting that HMG-I(Y) was being incorporated into a ternary complex. The addition of a polyclonal antibody to p50 supershifted all components.


View larger version (63K):
[in this window]
[in a new window]
 
Fig. 5.   HMG-I(Y) and NF-kappa B subunit p50 bind to the iNOS promoter/enhancer and form a ternary DNA-protein complex. EMSA were performed with a radiolabeled oligonucleotide encoding bp -87 to -52 of the iNOS promoter/enhancer. Increasing concentrations of p50 were incubated with the radiolabeled probe in the presence (+) or absence (-) of recombinant HMG-I(Y) (100 ng). Antibody to p50 (p50 Ab, 1 µg) was used to verify the presence of p50 in the slowly migrating DNA-protein complexes (supershift).

We have shown recently that IL-1beta and LPS are able to induce HMG-I(Y) in vitro and in vivo, respectively (47). Thus, to determine if HMG-I(Y) had a dose-dependent effect on formation of this ternary complex, we incubated the same radiolabeled probe with p50 in the presence of increasing concentrations of HMG-I(Y). The intensity of the ternary complex increased as the concentration of HMG-I(Y) increased (Fig. 6). Addition of the p50 antibody resulted in a complete supershift of this upper, ternary complex. These data suggest that HMG-I(Y) and NF-kappa B subunit p50 bind to the iNOS promoter/enhancer and that HMG-I(Y) assists in the formation of a ternary complex.


View larger version (56K):
[in this window]
[in a new window]
 
Fig. 6.   Increasing concentrations of HMG-I(Y) facilitate the formation of a ternary DNA-protein complex with NF-kappa B subunit p50. EMSA were performed with a radiolabeled oligonucleotide encoding bp -87 to -52 of the iNOS promoter/enhancer. Increasing concentrations of HMG-I(Y) were incubated with the radiolabeled probe in the presence (+) or absence (-) of recombinant p50 (50 ng). Antibody to p50 (p50 Ab, 1 µg) was used to verify the presence of p50 in the slowly migrating DNA-protein complexes (supershift).

For HMG-I(Y) to recruit transcription factors to their DNA binding sites, it must usually bind to DNA. However, recent studies have revealed that HMG-I(Y) mutants incapable of binding to DNA were still able to enhance serum response factor binding to DNA (44). Therefore, we performed further studies to determine if HMG-I(Y) binding to DNA was necessary for recruitment of NF-kappa B subunit p50 to the iNOS promoter/enhancer and formation of a ternary complex. A radiolabeled probe encoding region -87 to -52 of the iNOS 5'-flanking sequence and containing a mutated Oct site was incubated with p50 in the absence or presence of HMG-I(Y). Incubation of p50 alone with the probe containing the Oct site mutation resulted in a slowly migrating DNA-protein complex, and this complex was supershifted by a polyclonal antibody to p50 (Fig. 7). Incubation of this probe with HMG-I(Y) resulted in no DNA-protein complex formation and thus no HMG-I(Y) binding. Also, incubation of this probe with p50 in the presence of HMG-I(Y) resulted in no ternary complex formation (Fig. 7). These data suggest that HMG-I(Y) must bind to DNA at the Oct site to facilitate the formation of a ternary complex between HMG-I(Y), p50, and the iNOS promoter/enhancer.


View larger version (52K):
[in this window]
[in a new window]
 
Fig. 7.   Binding of HMG-I(Y) to the Oct site of the iNOS promoter/enhancer is necessary for ternary complex formation with NF-kappa B subunit p50. EMSA were performed with a radiolabeled oligonucleotide that encoded bp -87 to -52 of the iNOS promoter/enhancer and contained a mutated Oct site. Recombinant p50 (50 ng) was incubated with the radiolabeled probe in the presence (+) or absence (-) of recombinant HMG-I(Y) (50 ng). Antibody to p50 (p50 Ab, 1 µg) was used to verify the presence of p50 in the DNA-protein complexes (supershift).

HMG-I(Y) Potentiates Transactivation of the iNOS Promoter/Enhancer by NF-kappa B Subunits p50 and p65-- Recently, we have shown that, in the presence of p50 and p65, HMG-I(Y) was able to increase iNOS promoter/enhancer activity in a dose-dependent manner (47). To extend these studies, we cotransfected the iNOS(-1485/+31) promoter/enhancer construct with expression plasmids for p50, p65, or a combination of p50 and p65 in the absence or presence of an expression plasmid for HMG-I(Y). The transfections were performed in Drosophila SL2 because they contain far less endogenous HMG-I(Y) than do mammalian cells (29). This experiment allowed us to determine which members of a nucleoprotein complex (containing HMG-I(Y) and NF-kappa B subunits) would be necessary to drive iNOS transcription most efficiently. p65 alone or in combination with p50 increased iNOS reporter activity, but the most potent effect was in the presence of both plasmids (Fig. 8). HMG-I(Y) alone did not significantly increase iNOS promoter/enhancer activity. When HMG-I(Y) was transfected in conjunction with p50 alone or p65 alone, however, iNOS reporter activity increased further in comparison with transfections lacking HMG-I(Y). Transfection of HMG-I(Y) in conjunction with both p50 and p65 resulted in a potentiated increase in iNOS promoter/enhancer activity in comparison with transfections lacking HMG-I(Y) (Fig. 8). These data suggest that HMG-I(Y) can use either p50 or p65 to drive iNOS transcription; however, the most dramatic effect on transactivation of the iNOS promoter/enhancer occurs when HMG-I(Y) is coexpressed with both NF-kappa B subunits.


View larger version (14K):
[in this window]
[in a new window]
 
Fig. 8.   HMG-I(Y) potentiates transactivation of the iNOS promoter/enhancer by NF-kappa B subunits p50 and p65. Drosophila SL2 cells were transfected transiently with iNOS promoter/enhancer construct iNOS(-1485/+31) (1 µg/well) and expression plasmids encoding p50, p65, or both p50 and p65 (100 ng/well each). The cells were transfected in the presence (+, black bars) or absence (-, white bars) of an expression plasmid encoding HMG-I(Y) (1 µg/well). Normalized luciferase activity was plotted as the -fold induction from the activity in cells expressing no (-) HMG-I(Y) and no (-) p50 or p65. Values represent the mean ± S.E. (n = 6). Asterisks indicate significant differences (p < 0.05) in comparison with the value obtained with the same amount of p50 or p65 but no (-) HMG-I(Y). Cross indicates a significant difference (p < 0.05) in comparison with all other groups.

Because the most important IL-1beta -responsive elements are located within the -234 to +31 region of the iNOS 5'-flanking sequence, we transfected construct iNOS(-234/+31) into the SL2 cells. As in the transfections with iNOS(-1485/+31), HMG-I(Y) potentiated iNOS(-234/+31) transactivation by p50 and p65 (Fig. 9A). In addition to iNOS(-234/+31), we also transfected construct iNOS(-331/+31 NF-kappa Bm) into the SL2 cells. The construct was cotransfected with expression plasmids p50, p65, and HMG-I(Y). Mutation of the NF-kappa Bd site disrupted the ability of HMG-I(Y) to potentiate iNOS transactivation. This same disruption also occurred when the NF-kappa Bd site was mutated in the construct containing region -1485 to +31 of the iNOS promoter/enhancer (data not shown). These data suggest that enhanced transactivation of the iNOS promoter/enhancer by HMG-I(Y) requires an intact NF-kappa Bd site in the downstream region of the iNOS 5'-flanking sequence.


View larger version (11K):
[in this window]
[in a new window]
 
Fig. 9.   HMG-I(Y) requires an intact downstream NF-kappa B site to enhance iNOS promoter/enhancer activity. A, Drosophila SL2 cells were transfected transiently with iNOS promoter/enhancer construct iNOS(-234/+31) (1 µg/well) and expression plasmids encoding no protein, HMG-I(Y) alone (1 µg/well), p50 and p65 alone (100 ng/well each), or HMG-I(Y) plus p50 and p65. B, cells were transfected with construct iNOS(-234/+31) and HMG-I(Y) alone or HMG-I(Y) plus p50 and p65 (black bars). The cells were also transfected with an iNOS construct encoding a mutated NF-kappa Bd site (iNOS(-331/+31 NF-kappa Bm), striped bar) in the presence of HMG-I(Y) plus p50 and p65. In both A and B, normalized luciferase activity is plotted as the -fold induction from the activity of cells containing no (-) HMG-I(Y) and no (-) p50 and p65. Values represent the mean ± S.E. (n = 6). In A, asterisks indicate significant differences (p < 0.05) in comparison with the value obtained with no (-) HMG-I(Y) and no (-) p50 and p65. In A and B, cross indicates a significant difference (p < 0.05) in comparison with all other groups.


    DISCUSSION
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

The high output pathway of NO production is catalyzed by the inducible isoform of NOS. iNOS induction can be regulated in some cells by posttranscriptional mechanisms (48) and by the availability of cofactors such as heme and tetrahydrobiopterin (49-51). In most cells, however, the induction of iNOS by inflammatory stimuli is tightly regulated at the level of gene transcription (5, 11-13, 20). Activation of NF-kappa B is a critical component of the transcriptional induction of iNOS by inflammatory stimuli (14). We have observed elsewhere that elements other than an NF-kappa Bd binding site, in the downstream portion of the iNOS promoter/enhancer, may be involved in iNOS induction after IL-1beta stimulation in vascular smooth muscle cells (20).

The present analysis of the iNOS promoter/enhancer revealed that an AT-rich region (bases -61 to -54) downstream of the NF-kappa Bd site is essential for full induction of iNOS by IL-1beta in vascular smooth muscle cells (Fig. 2). The importance of this AT-rich region was not limited to IL-1beta stimulation, as induction of iNOS by LPS in vascular smooth muscle cells (Fig. 3A) and by LPS in macrophages (Fig. 3B) required an intact -61 to -54 site. By in vivo footprint analysis in macrophages, Goldring et al. showed that nuclear proteins bind to this AT-rich region, corresponding to an Oct site, after LPS stimulation (21).

Two recent studies in macrophages have suggested that the downstream Oct site may be important for iNOS activation by LPS (52) and IL-6 (53). Xie (52) demonstrated that an LPS-responsive element, termed LREAA, resides within the downstream Oct site. Xie suggested that Oct-1-like proteins, but not other POU domain proteins (Oct-2 or Pit 1) (54), are contained in a complex that binds at the LREAA site. Sawada and colleagues investigated the importance of the downstream Oct site in the activation of iNOS by IL-6 (53). They demonstrated that Oct-2-related proteins bind at this site during IL-6-induced macrophage differentiation, and that this Oct site is essential for induction of iNOS by IL-6. The binding activity of Oct-1-related proteins appeared to decrease after IL-6 stimulation. Although these studies showed that Oct-1-like proteins and Oct-2 proteins are components of the DNA-protein complexes that bind at the downstream Oct site in macrophages, their specific roles in iNOS activation and their ability to work in conjunction with, or independently of, NF-kappa B were not investigated.

Because the downstream Oct site is rich in A and T residues, we became interested in the potential role of HMG-I(Y) as a mediator of iNOS activation. HMG-I(Y) is an architectural transcription factor that binds to AT-rich regions in the minor groove of DNA (26). HMG-I(Y) by itself is not a transcriptional activator; instead, HMG-I(Y) facilitates the assembly and stability of stereospecific DNA-protein complexes that drive efficient gene transcription (22, 31). HMG-I(Y) performs this task by modifying DNA conformation and by recruiting nuclear proteins (such as subunits of NF-kappa B) to an enhanceosome complex (28, 29). Our data revealed that HMG-I(Y) bound specifically in region -87 to -52 of the iNOS promoter/enhancer (Fig. 4A), and that this binding occurred at the AT-rich Oct site, not at the NF-kappa Bd site (Fig. 4B). HMG-I(Y) assisted in the formation of a ternary complex containing itself, p50, and the iNOS promoter/enhancer (Figs. 5 and 6). The formation of this complex required the binding of HMG-I(Y) to the downstream Oct site (Fig. 7). Although HMG-I(Y) alone had no significant effect on iNOS reporter activity, HMG-I(Y) did increase iNOS activity in the presence of p50 or p65. Moreover, the most dramatic increase in iNOS transactivation occurred when HMG-I(Y) was coexpressed with both p50 and p65 (Fig. 8). These data suggest that HMG-I(Y) works in conjunction with subunits of NF-kappa B to drive transcription of the iNOS promoter/enhancer. Deletion of an upstream NF-kappa B site (-971 to -962) had no effect on HMG-I(Y)'s ability to potentiate iNOS transactivation by p50 and p65 (Fig. 9A); however, mutation of the downstream NF-kappa Bd site (-85 to -76) disrupted this HMG-I(Y) response (Fig. 9B). Thus, binding of HMG-I(Y) at the Oct site (-61 to -54) in conjunction with binding of NF-kappa B subunits at the NF-kappa Bd site (-85 to -76) appears to be essential for the most potent activation of the iNOS promoter/enhancer.

Previous studies have shown that binding sites for HMG-I(Y) partially or fully overlap binding sites for transcription factors that are incorporated into an enhanceosome complex (31). By binding to DNA in the minor groove, HMG-I(Y) is able to recruit transcription factors to the major groove. This scenario does not appear to apply to the iNOS promoter/enhancer. The AT-rich Oct site, the location of HMG-I(Y) binding in the iNOS promoter/enhancer, resides 15 bp downstream of the NF-kappa Bd site. Our experiments show that NF-kappa B subunits p50 and p65 drive iNOS transcription most efficiently in the presence of HMG-I(Y), even though the binding sites for these factors do not overlap. Future studies will focus on additional transcription factors that may interact with NF-kappa B and HMG-I(Y) to form an enhanceosome complex and drive iNOS transcription. Because HMG-I(Y) binds at the AT-rich Oct site in the iNOS promoter/enhancer and HMG-I(Y) is known to interact with POU domain proteins (55), we will initially concentrate on transcription factors that preferentially bind to AT-rich sequences and POU domain proteins.

    ACKNOWLEDGEMENTS

We are grateful to the late Dr. Edgar Haber for his helpful suggestions and support of our work, Bonna Ith for technical assistance, and Thomas McVarish for editorial assistance. Plasmids for p50 and p65 were kindly provided by Dr. James Liao, with permission from Dr. Gary Nabel. We also thank Dr. Tom Maniatis for the Drosophila expression plasmids pPACHMGI, pPAC, and phsp82LacZ. NR8383 cells were kindly provided by Dr. Joseph Paulauskis.

    FOOTNOTES

* This work was supported in part by National Institutes of Health Grants HL03194 and HL60788 (to M. A. P.), HL03745 (to M. T. C.), and GM53249 (to M.-E. L.); by an American Heart Association grant-in-aid (to M. A. P.); by a grant from Novartis and the SICPA Foundation (to P. W.); and by a grant from the Bristol-Myers Squibb Pharmaceutical Research Institute.The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

parallel These authors contributed equally to this study.

** To whom correspondence should be addressed: Cardiovascular Biology Laboratory, Harvard School of Public Health, 677 Huntington Ave., Boston, MA 02115. Tel.: 617-432-2273; Fax: 617-432-2980; E-mail: perrella{at}cvlab.harvard.edu.

    ABBREVIATIONS

The abbreviations used are: NOS, nitric-oxide synthase; HMG, high mobility group; NF, nuclear factor; Oct, octamer; iNOS (or NOS2), inducible isoform of NO synthase; IL, interleukin; LPS, lipopolysaccharide; RASMC, rat aortic smooth muscle cells; CAT, chloramphenicol acetyltransferase; IFN, interferon; bp, base pair(s); FBS, fetal bovine serum; IRF, IFN regulatory factor; EMSA, electrophoretic mobility shift assay.

    REFERENCES
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES
  1. Moncada, S., Palmer, R. M., and Higgs, E. A. (1991) Pharmacol. Rev. 43, 109-142[Medline] [Order article via Infotrieve]
  2. Nathan, C. (1992) FASEB J. 6, 3051-3064[Abstract]
  3. Nathan, C. (1998) J. Clin. Invest. 100, 2417-2423[Medline] [Order article via Infotrieve]
  4. Ignarro, J. J. (1990) Annu. Rev. Pharmacol. Toxicol. 30, 535-560[CrossRef][Medline] [Order article via Infotrieve]
  5. Nathan, C., and Xie, Q.-w. (1994) Cell 78, 915-918[CrossRef][Medline] [Order article via Infotrieve]
  6. Xie, Q.-w., Cho, H. J., Calaycay, J., Mumford, R. A., Swiderek, K. M., Lee, T. D., Ding, A., Troso, T., and Nathan, C. (1992) Science 256, 225-228[Abstract/Free Full Text]
  7. Lowenstein, C. J., Glatt, C. S., Bredt, D. S., and Snyder, S. H. (1992) Proc. Natl. Acad. Sci. U. S. A. 89, 6711-6715[Abstract/Free Full Text]
  8. Lyons, C. R., Orloff, G. J., and Cunningham, J. M. (1992) J. Biol. Chem. 267, 6370-6374[Abstract/Free Full Text]
  9. Nunokawa, Y., Ishida, N., and Tanaka, S. (1993) Biochem. Biophys. Res. Commun. 191, 89-94[CrossRef][Medline] [Order article via Infotrieve]
  10. Koide, M., Kawahara, Y., Tsuda, T., and Yokoyama, M. (1993) FEBS Lett. 318, 213-217[CrossRef][Medline] [Order article via Infotrieve]
  11. Perrella, M. A., Yoshizumi, M., Fen, Z., Tsai, J.-C., Hsieh, C.-M., Kourembanas, S., and Lee, M.-E. (1994) J. Biol. Chem. 269, 14595-14600[Abstract/Free Full Text]
  12. Xie, Q.-w., Whisnant, R., and Nathan, C. (1993) J. Exp. Med. 177, 1779-1784[Abstract/Free Full Text]
  13. Lowenstein, C. J., Alley, E. W., Raval, P., Snowman, A. M., Snyder, S. H., Russell, S. W., and Murphy, W. J. (1993) Proc. Natl. Acad. Sci. U. S. A. 90, 9730-9734[Abstract/Free Full Text]
  14. Xie, Q.-w., Kashiwabara, Y., and Nathan, C. (1994) J. Biol. Chem. 269, 4705-4708[Abstract/Free Full Text]
  15. Martin, E., Nathan, C., and Xie, Q.-w. (1994) J. Exp. Med. 180, 977-984[Abstract/Free Full Text]
  16. Gao, J., Morrison, D. C., Parmely, T. J., Russell, S. W., and Murphy, W. J. (1997) J. Biol. Chem. 272, 1226-1230[Abstract/Free Full Text]
  17. Bone, R. C. (1991) Ann. Intern. Med. 115, 457-469
  18. Parrillo, J. E. (1993) N. Engl. J. Med. 328, 1471-1477[Free Full Text]
  19. Beasley, D., and Eldridge, M. (1994) Am. J. Physiol. 266, R1197-R1203[Abstract/Free Full Text]
  20. Perrella, M. A., Patterson, C., Tan, L., Yet, S.-F., Hsieh, C.-M., Yoshizumi, M., and Lee, M.-E. (1996) J. Biol. Chem. 271, 13776-13780[Abstract/Free Full Text]
  21. Goldring, C. E. P., Reveneau, S., Algarte, M., and Jeannin, J.-F. (1996) Nucleic Acids Res. 24, 1682-1687[Abstract/Free Full Text]
  22. Bustin, M., and Reeves, R. (1996) Prog. Nucleic Acids Res. Mol. Biol. 54, 35-100[Medline] [Order article via Infotrieve]
  23. Bustin, M., Lehn, D. A., and Landsman, D. (1990) Biochim. Biophys. Acta 1049, 231-243[Medline] [Order article via Infotrieve]
  24. Grosschedl, R., Giese, K., and Pagel, J. (1994) Trends Genet. 10, 94-100[CrossRef][Medline] [Order article via Infotrieve]
  25. Johnson, K. R., Lehn, D. A., Elton, T. S., Barr, P. J., and Reeves, R. (1988) J. Biol. Chem. 263, 18338-18342[Abstract/Free Full Text]
  26. Reeves, R., and Nissen, M. S. (1990) J. Biol. Chem. 265, 8573-8582[Abstract/Free Full Text]
  27. Eckner, R., and Birnstiel, M. L. (1989) Nucleic Acids Res. 17, 5947-59[Abstract/Free Full Text]
  28. Falvo, J. V., Thanos, D., and Maniatis, T. (1995) Cell 83, 1101-1111[CrossRef][Medline] [Order article via Infotrieve]
  29. Thanos, D., and Maniatis, T. (1995) Cell 83, 1091-1100[CrossRef][Medline] [Order article via Infotrieve]
  30. Thanos, D., and Maniatis, T. (1992) Cell 71, 777-789[CrossRef][Medline] [Order article via Infotrieve]
  31. Du, W., Thanos, D., and Maniatis, T. (1993) Cell 74, 887-898[CrossRef][Medline] [Order article via Infotrieve]
  32. Thanos, D., and Maniatis, T. (1995) Mol. Cell. Biol. 15, 152-164[Abstract]
  33. Kim, T. K., and Maniatis, T. (1997) Mol. Cell 1, 119-129[CrossRef][Medline] [Order article via Infotrieve]
  34. Gunther, S., Alexander, R. W., Atkinson, W. J., and Gimbrone, M. A., Jr. (1982) J. Cell Biol. 92, 289-298[Abstract/Free Full Text]
  35. Helmke, R. J., Boyd, R. L., German, V. F., and Mangos, J. A. (1987) In Vitro Cell. Dev. Biol. 23, 567-574[Medline] [Order article via Infotrieve]
  36. Schneider, I. (1972) J. Embryol. Exp. Morphol. 27, 353-365[Medline] [Order article via Infotrieve]
  37. Sambrook, J., Fritsh, E. F., and Maniatis, T. (1989) Molecular Cloning: A Laboratory Manual, 2nd Ed., Cold Spring Harbor Laboratory Press, Plainview, NY
  38. Courey, A. J., and Tjian, R. (1988) Cell 55, 887-898[CrossRef][Medline] [Order article via Infotrieve]
  39. Krasnow, M. A., Saffman, E. E., Kornfeld, K., and Hogness, D. S. (1989) Cell 57, 1031-1043[CrossRef][Medline] [Order article via Infotrieve]
  40. Lee, M.-E., Bloch, K. D., Clifford, J. A., and Quertermous, T. (1990) J. Biol. Chem. 265, 10446-10450[Abstract/Free Full Text]
  41. Fen, Z., Dhadly, M. S., Yoshizumi, M., Hilkert, R. J., Quertermous, T., Eddy, R. L., Shows, T. B., and Lee, M.-E. (1993) Biochemistry 32, 7932-7938[CrossRef][Medline] [Order article via Infotrieve]
  42. Di Nocera, P. P., and Dawid, I. B. (1983) Proc. Natl. Acad. Sci. U. S. A. 80, 7095-7098[Abstract/Free Full Text]
  43. Yoshizumi, M., Hsieh, C.-M., Zhou, F., Tsai, J.-C., Patterson, C., Perrella, M. A., and Lee, M.-E. (1995) Mol. Cell. Biol. 15, 3266-3272[Abstract]
  44. Chin, M. T., Pellacani, A., Wang, H., Lin, S. S. J., Jain, M. K., Perrella, M. A., and Lee, M.-E. (1998) J. Biol. Chem. 273, 9755-9760[Abstract/Free Full Text]
  45. Fujita, T., Nolan, G. P., Ghosh, S., and Baltimore, D. (1992) Genes Dev. 6, 775-787[Abstract/Free Full Text]
  46. Baeuerle, P. A. (1991) Biochim. Biophys. Acta 1072, 63-80[Medline] [Order article via Infotrieve]
  47. Pellacani, A., Chin, M. T., Wiesel, P., Ibanez, M., Patel, A., Yet, S.-F., Hsieh, C.-M., Paulauskis, J. D., Reeves, R., Lee, M.-E., and Perrella, M. A. (1999) J. Biol. Chem. 274, 1525-1532[Abstract/Free Full Text]
  48. Vodovotz, Y., Bogdan, C., Paik, J., Xie, Q.-w., and Nathan, C. (1993) J. Exp. Med. 178, 605-613[Abstract/Free Full Text]
  49. Tzeng, E., Billiar, T. R., Robbins, P. D., Loftus, M., and Stuehr, D. J. (1995) Proc. Natl. Acad. Sci. U. S. A. 92, 11771-11775[Abstract/Free Full Text]
  50. Albakri, Q. A., and Stuehr, D. J. (1996) J. Biol. Chem. 271, 5414-5421[Abstract/Free Full Text]
  51. MacMicking, J., Xie, Q.-w., and Nathan, C. (1997) Annu. Rev. Immunol. 15, 323-350[CrossRef][Medline] [Order article via Infotrieve]
  52. Xie, Q.-w. (1997) J. Biol. Chem. 272, 14867-14872[Abstract/Free Full Text]
  53. Sawada, T., Falk, L. A., Rao, P., Murphy, W. J., and Pluznik, D. H. (1997) J. Immunol. 158, 5267-5276[Abstract]
  54. Ryan, A. K., and Rosenfeld, M. G. (1997) Genes Dev. 11, 1207-1225[Free Full Text]
  55. Leger, H., Sock, E., Renner, K., Grummt, F., and Wegner, M. (1995) Mol. Cell. Biol. 15, 3738-3747[Abstract]


Copyright © 1999 by The American Society for Biochemistry and Molecular Biology, Inc.
Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
J. Biol. Chem.Home page
J. L. Kopp, P. J. Wilder, M. Desler, L. Kinarsky, and A. Rizzino
Different Domains of the Transcription Factor ELF3 Are Required in a Promoter-specific Manner and Multiple Domains Control Its Binding to DNA
J. Biol. Chem., February 2, 2007; 282(5): 3027 - 3041.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
P. O. Hassa, S. S. Haenni, C. Buerki, N. I. Meier, W. S. Lane, H. Owen, M. Gersbach, R. Imhof, and M. O. Hottiger
Acetylation of Poly(ADP-ribose) Polymerase-1 by p300/CREB-binding Protein Regulates Coactivation of NF-{kappa}B-dependent Transcription
J. Biol. Chem., December 9, 2005; 280(49): 40450 - 40464.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
Z. Yu and B. C. Kone
Hypermethylation of the Inducible Nitric-oxide Synthase Gene Promoter Inhibits Its Transcription
J. Biol. Chem., November 5, 2004; 279(45): 46954 - 46961.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
S. Giri, R. Rattan, A. K. Singh, and I. Singh
The 15-Deoxy-{delta}12,14-Prostaglandin J2 Inhibits the Inflammatory Response in Primary Rat Astrocytes via Down-Regulating Multiple Steps in Phosphatidylinositol 3-Kinase-Akt-NF-{kappa}B-p300 Pathway Independent of Peroxisome Proliferator-Activated Receptor {gamma}
J. Immunol., October 15, 2004; 173(8): 5196 - 5208.
[Abstract] [Full Text] [PDF]


Home page
J. Cell Sci.Home page
C. J. Lowenstein and E. Padalko
iNOS (NOS2) at a glance
J. Cell Sci., June 15, 2004; 117(14): 2865 - 2867.
[Full Text] [PDF]


Home page
J. Biol. Chem.Home page
A. Chantome, A. Pance, N. Gauthier, D. Vandroux, J. Chenu, E. Solary, J.-F. Jeannin, and S. Reveneau
Casein Kinase II-mediated Phosphorylation of NF-{kappa}B p65 Subunit Enhances Inducible Nitric-oxide Synthase Gene Transcription in Vivo
J. Biol. Chem., June 4, 2004; 279(23): 23953 - 23960.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
M. I. Darville, S. Terryn, and D. L. Eizirik
An Octamer Motif Is Required for Activation of the Inducible Nitric Oxide Synthase Promoter in Pancreatic {beta}-Cells
Endocrinology, March 1, 2004; 145(3): 1130 - 1136.
[Abstract] [Full Text] [PDF]


Home page
Cancer Epidemiol. Biomarkers Prev.Home page
X. Chen, J. Lechago, A. Ertan, G. Ergun, R. Verm, M. Bridges, C. Johnson, K. Woods, F. Meriano, M. Chirala, et al.
Expression of the High Mobility Group Proteins HMGI(Y) Correlates with Malignant Progression in Barrett's Metaplasia
Cancer Epidemiol. Biomarkers Prev., January 1, 2004; 13(1): 30 - 33.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
W. Cao, C. Bao, and C. J. Lowenstein
Inducible nitric oxide synthase expression inhibition by adenovirus E1A
PNAS, June 24, 2003; 100(13): 7773 - 7778.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
J. H. Kwon, S. Keates, S. Simeonidis, F. Grall, T. A. Libermann, and A. C. Keates
ESE-1, an Enterocyte-specific Ets Transcription Factor, Regulates MIP-3alpha Gene Expression in Caco-2 Human Colonic Epithelial Cells
J. Biol. Chem., January 3, 2003; 278(2): 875 - 884.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
A. Henderson, M. Bunce, N. Siddon, R. Reeves, and D. J. Tremethick
High-Mobility-Group Protein I Can Modulate Binding of Transcription Factors to the U5 Region of the Human Immunodeficiency Virus Type 1 Proviral Promoter
J. Virol., November 15, 2000; 74(22): 10523 - 10534.
[Abstract] [Full Text]


Home page
FASEB J.Home page
L. C. FOSTER, P. WIESEL, G. S. HUGGINS, R. PAÑARES, M. T. CHIN, A. PELLACANI, and M. A. PERRELLA
Role of activating protein-1 and high mobility group-I(Y) protein in the induction of CD44 gene expression by interleukin-1{beta} in vascular smooth muscle cells
FASEB J, February 1, 2000; 14(2): 368 - 378.
[Abstract] [Full Text]


Home page
J. Biol. Chem.Home page
S. Rudders, J. Gaspar, R. Madore, C. Voland, F. Grall, A. Patel, A. Pellacani, M. A. Perrella, T. A. Libermann, and P. Oettgen
ESE-1 Is a Novel Transcriptional Mediator of Inflammation That Interacts with NF-kappa B to Regulate the Inducible Nitric-oxide Synthase Gene
J. Biol. Chem., January 26, 2001; 276(5): 3302 - 3309.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
A. Pellacani, P. Wiesel, S. Razavi, V. Vasilj, M. W. Feinberg, M. T. Chin, R. Reeves, and M. A. Perrella
Down-regulation of High Mobility Group-I(Y) Protein Contributes to the Inhibition of Nitric-oxide Synthase 2 by Transforming Growth Factor-beta 1
J. Biol. Chem., January 5, 2001; 276(2): 1653 - 1659.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Perrella, M. A.
Right arrow Articles by Lee, M.-E.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Perrella, M. A.
Right arrow Articles by Lee, M.-E.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 All ASBMB Journals   Molecular and Cellular Proteomics 
 Journal of Lipid Research   ASBMB Today 
Copyright © 1999 by the American Society for Biochemistry and Molecular Biology.
Advertisement
spacer
Advertisement
Advertisement