Advertisement
JBC

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Ghahremani, M. H.
Right arrow Articles by Albert, P. R.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Ghahremani, M. H.
Right arrow Articles by Albert, P. R.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

J Biol Chem, Vol. 274, Issue 14, 9238-9245, April 2, 1999


Distinct Roles for Galpha i2, Galpha i3, and Gbeta gamma in Modulation of Forskolin- or Gs-mediated cAMP Accumulation and Calcium Mobilization by Dopamine D2S Receptors*

Mohammad H. GhahremaniDagger §, Peihua Cheng, Paola M. C. LemboDagger , and Paul R. Albertparallel

From the Dagger  Department of Pharmacology and Therapeutics, McGill University, Montreal H3G 1Y6, Canada and the  Neuroscience Research Institute, University of Ottawa, Ottawa K1H 8M5, Canada

    ABSTRACT
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

Previous studies have shown that a single G protein-coupled receptor can regulate different effector systems by signaling through multiple subtypes of heterotrimeric G proteins. In LD2S fibroblast cells, the dopamine D2S receptor couples to pertussis toxin (PTX)-sensitive Gi/Go proteins to inhibit forskolin- or prostaglandin E1-stimulated cAMP production and to stimulate calcium mobilization. To analyze the role of distinct Galpha i/o protein subtypes, LD2S cells were stably transfected with a series of PTX-insensitive Galpha i/o protein Cys right-arrow Ser point mutants and assayed for D2S receptor signaling after PTX treatment. The level of expression of the transfected Galpha mutant subunits was similar to the endogenous level of the most abundant Galpha i/o proteins (Galpha o, Galpha i3). D2S receptor-mediated inhibition of forskolin-stimulated cAMP production was retained only in clones expressing mutant Galpha i2. In contrast, the D2S receptor utilized Galpha i3 to inhibit PGE1-induced (Gs-coupled) enhancement of cAMP production. Following stable or transient transfection, no single or pair set of mutant Galpha i/o subtypes rescued the D2S-mediated calcium response following PTX pretreatment. On the other hand, in LD2S cells stably transfected with GRK-CT, a receptor kinase fragment that specifically antagonizes Gbeta gamma subunit activity, D2S receptor-mediated calcium mobilization was blocked. The observed specificity of Galpha i2 and Galpha i3 for different states of adenylyl cyclase activation suggests a higher level of specificity for interaction of Galpha i subunits with forskolin- versus Gs-activated states of adenylyl cyclase than has been previously appreciated.

    INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

A wide variety of physiological functions and pathological conditions are regulated by hormones and neurotransmitters which transduce intracellular signals by coupling to heterotrimeric guanine nucleotide-binding proteins (G proteins).1 Upon receptor activation, G proteins dissociate into Galpha and Gbeta gamma subunits which in turn regulate the activity of effector molecules (1-3). The family of Galpha subunits is divided into structural and functional homologues, for example, Galpha s proteins couple positively to AC to increase intracellular production of cAMP; Galpha i/o proteins couple negatively to AC and are inactivated by PTX; and Galpha q proteins couple to PLC-beta subtypes to increase [Ca2+]i and are insensitive to PTX. The Gbeta gamma subunits of G proteins couple to a variety of cell-specific effectors including AC types II and IV, PLC-beta 2 and PLC-beta 3, inwardly rectifying potassium channels, and N-type calcium channels (4, 5). In addition, G protein-coupled receptors appear to utilize particular combinations of subunits to initiate specific types of responses (6).

The dopamine D2S receptor couples to PTX-sensitive G proteins (Gi/o) to initiate multiple signaling pathways (7, 8). In cells of neuroendocrine origin the D2S couples to "inhibitory" pathways, including inhibition of adenylyl cyclase, activation of potassium channels to hyperpolarize the cell membrane, and inhibition of L-type calcium channels (9-12), which in concert mediate inhibition of hormone secretion and gene transcription, and inhibition of cell proliferation (13-18). By contrast, when expressed in cells of mesenchymal lineage (e.g. Ltk- fibroblast or Chinese hamster ovary cells), the same receptor mediates stimulation of phospholipase C activity to induce calcium mobilization, and activation of the mitogen-activated protein kinase cascade leading to enhanced gene transcription and cell proliferation (8, 14, 17, 19-23). These findings suggest that the same receptor mediates different cellular responses depending on the repertoire of cell-specific effectors that are expressed. To address the pathways that underlie cell-specific signaling we have studied the G protein specificity of D2S receptor coupling, based on the hypothesis that different G protein subunits mediate receptor coupling to inhibitory versus stimulatory signaling events.

PTX acts to uncouple Galpha i/o proteins by ADP-ribosylating these subunits at a conserved carboxyl-terminal domain cysteine (Cys) residue (24). By mutating the conserved Cys residue in Galpha i1, Galpha i2, Galpha i3, and Galpha o to a ribosylation-resistant serine (Ser) residue we have generated a series of PTX-insensitive mutants of Galpha i/o protein (G-PTX). Because the Cys right-arrow Ser mutation is a structurally conservative change, the mutant G proteins remain functional following PTX pretreatment (25-28). We have assessed the contribution of individual or specific combinations of G protein subunits to D2S-mediated signaling. The D2S receptor utilizes distinct single Galpha subunits to inhibit cAMP accumulation depending on the method of AC activation. In contrast, calcium mobilization induced by the D2S receptor is not reconstituted with single or combinations of Galpha subunits, but is blocked by inhibiting Gbeta gamma function. These results indicate a strong dependence on Galpha i subtype for D2S-mediated inhibition of AC that is not observed for stimulation of calcium mobilization.

    EXPERIMENTAL PROCEDURES
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

Materials-- Apomorphine, dopamine, EGTA, forskolin, PGE1, isobutylmethylxanthine, and PTX were from Sigma. Fura 2-AM was purchased from Molecular Probes (Eugene, OR) and hygromycin B from Calbiochem. 125I-Succinyl cAMP and polyvinylpyrrolidone membrane were from NEN Life Science Products Inc. and [alpha -32P]dCTP and ECL Western blot detection kits were from Amersham Corp. Sera, media, and Geneticin (G418) were obtained from Life Technologies, Inc. Plasmids pY3 and pCMV-LacZ II were obtained from the American Type Culture Collection (Manassas, VA). Endonucleases and DNA polymerase were purchased from New England Biolabs (Mississauga, Ontario, Canada). Taq polymerase has been purchased from Pharmacia Biotech Inc. (Baie d'Urfe, QB). The cDNAs encoding wild-type rat Galpha o, Galpha i1, Galpha i2, and Galpha i3 were generously provided by Dr. Randall Reed, Johns Hopkins University, Baltimore, MD. The Galpha o antibody was from Santa Cruz Biotechnology Inc. (Santa Cruz, CA) and anti-Galpha i1-2 and anti-Galpha i3 were obtained from Calbiochem (San Diego, CA). Anti-RGS-His6 was purchased from Qiagen (Santa Clarita, CA).

Cell Culture-- Murine Ltk- cells stably transfected with rat dopamine D2S receptor (LD2S) (13) were maintained in minimum Eagle's medium (MEM) with 10% FBS in a humidified atmosphere of 5% CO2, 95% air at 37 °C. The cells were routinely passaged using 0.05% trypsin, 0.02% EDTA in HBBS. For PTX treatment, the cells were treated with 50 ng/ml PTX for 16 h prior to experimentation.

Site-directed Mutagenesis-- Site-directed mutagenesis was performed using the Altered Sites IITM system (Promega). PTX-insensitive Galpha i/o mutants were generated using rat cDNAs (29) encoding Galpha o, Galpha i1, Galpha i2, and Galpha i3 subunits. The cysteine 351 codon (352 for Galpha i2), i.e. TGT, was mutated to TCT in order to encode serine using the following oligonucleotides: Galpha o-PTX, TCCGGGGCTCTGGCTTGTA; Galpha i1-PTX, AACCTAAAAGACTCTGGTC; Galpha i2-PTX, ACAACCTGAAGGACTCTGGC, and Galpha i3-PTX, AAGGAATCTGGGCTTTACT. The mutation was confirmed by endonuclease restriction analysis and Sanger dide- oxynucleotide sequencing. The mutant cDNAs were then subcloned into the EcoRI site of the pcDNA3 (Invitrogen) mammalian expression vector under control of the cytomegalovirus promoter.

His-GRK-CT Construct-- The OK-GRK2 cDNA (30) was partially digested with BbsI and EcoRI endonuclease and the 1506-bp fragment encoding the COOH-terminal domain starting from Thr493 was isolated and used for the construct (GRK-CT). The His-tag was incorporated using the following complementary oligonucleotides: 5'-CACCATGCGAGGTAGTCACCACCACCACCACCACAC-3' and 5'-CTTTGTGTGGTGGTGGTGGTGGTGACTACCTCGCATGGTGGTAC-3'. The two oligonucleotides were designed to encode Met-Arg-Gly-Ser-His6 with a Kozak sequence (31) in the NH2-terminal and cohesive KpnI site at the 5' end and a BbsI site at the 3' end. The oligonucleotides were annealed and ligated to GRK-CT fragment using BbsI-cohesive end (His-GRK-CT) and the His-GRK-CT fragment was cloned in pcDNA3 mammalian expression vector in KpnI/EcoRI site. The structure of the His-GRK-CT construct was confirmed by DNA sequencing.

Stable Transfection-- LD2S cells plated at 50% confluence were co-transfected with 30 µg each of the mutant Galpha subunit constructs (Go-PTX, Gi1-PTX, Gi2-PTX, and Gi3-PTX) and 2 µg of pY3 using the calcium phosphate co-precipitation method (32) and cultured in MEM, 10% FBS containing 400 µg/ml hygromycin-B for 2-3 weeks. Antibiotic-resistant clones of each transfection were picked (24 clones/transfection) and tested for the expression of corresponding Galpha proteins using Northern blot analysis.

Transient Transfection-- Ltk- cells were plated at 30-40% confluent on 15-cm plates with MEM + 10% FBS. The cells were co-transfected with D2S-pcDNA3 using individual Galpha subunit (Go-PTX, Gi1-PTX, Gi2-PTX, and Gi3-PTX) mutant constructs (30 or 60 µg) or the combination of two G proteins (Go/Gi1, Go/Gi2, Go/Gi3, Gi1/Gi2, Gi1/Gi3, and Gi2/Gi3; 30 µg/construct) and pCMV-LacZII (2 µg) using DEAE-dextran (33). Briefly, 1 volume (40 µl) of DNA in TBS was added dropwise to 2 volumes of DEAE-dextran (10 mg/ml) in TBS with agitation. The mixture was added dropwise to plates containing 12 ml of MEM + 1% FBS and the plates were incubated for 4 h at 37 °C, 5% CO2. The medium was aspirated and the cells were incubated in phosphate-buffered saline (136 mM NaCl, 2.68 mM KCl, 0.01 mM Na2HPO4, 1.78 µM KH2PO4, pH 7.4) with 10% dimethyl sulfoxide for 1 min. The plates were rinsed with phosphate-buffered saline and incubated in MEM + 10% FBS. After 36-48 h, the transfected cells were assayed for intracellular free calcium and beta -galactosidase activity.

beta -Galactosidase Measurement-- A 100-µl portion (10%) of the transfected cells was resuspended in 100 µl of Reporter Lysis Buffer (Promega), incubated for 15 min at room temperature, centrifuged (14,000 rpm, 20 s) and the supernatant recovered. Equal volumes (30 µl each) of cell extract and substrate (0.3 µM 4-methylumbelliferyl beta -D-galactoside, 15 mM Tris, pH 8.8) were mixed and incubated in the dark at 37 °C for 15 min. The reaction was terminated by addition of 50 µl of Stop solution (300 mM glycine, 15 mM EDTA, pH 11.2). Samples were transferred to 2 ml of Z buffer (60 mM Na2HPO4, 40 mM NaH2PO4, 10 mM KCl, 1 mM MgSO4) and fluorescence was measured at lambda EX = 350 nm, lambda EM = 450 nm in a Perkin-Elmer LS-50 spectrofluorometer (Buckinghamshire, United Kingdom). The transfection efficiencies differed by <10%.

Western Blot Analysis-- Cells (107/10-cm plate) were harvested and resuspended in 200 µl of RIPA-L buffer (10 mM Tris, pH 8, 1.5 mM MgCl2, 5 mM KCl, 0.5 mM dithiothreitol, 0.5 mM phenylmethylsulfonyl fluoride, 1% Nonidet P-40, 1% sodium lauryl sulfate, 0.5% sodium deoxycholate, 5 µg/ml leupeptin) on ice. The cell lysate was then passed through a G-25 needle three times to shear genomic DNA and incubated on ice. After 30 min, the lysate was centrifuged (10,000 × g, 10 min, 4 °C) and the supernatant recovered and assayed for protein content by the bicinchonic acid protein assay kit (Pierce). Lysates (100 µg/lane) were electrophoresed on sodium lauryl sulfate-containing 12% polyacrylamide gels at 100 V, 40 mA for 1 h, blotted on polyvinylpyrrolidone membranes for 1 h at 250 mA at 4 °C. Blots were incubated overnight in 5% nonfat dry milk in TBS-T (10 mM Tris, 150 mM NaCl, pH 8.0, 0.05% Tween 20) at 4 °C. The blots were then incubated for 1 h with primary antibody, followed by a 30-min incubation with horseradish peroxidase-conjugated secondary antibody at room temperature in TBS-T, and the peroxidase product was developed using the ECL for Western blot protocol.

Reverse Transcriptase PCR-- Total RNA was extracted from mouse brain tissue and LD2S cells using guanidium acetate and reverse-transcribed using SuperScript II RNase H- reverse transcriptase (Life Technologies Inc., Burlington, ON) and random hexamer primers (50 ng). The cDNAs were subjected to PCR with the following primer pairs (2 pmol/µl) designed using Primer Select program (DNASTAR Inc.) to amplify specific fragments of different AC subtypes (AC I-VI) with the indicated sizes (bp): ACI (444), 5'-CTGCGGGCGTGCGATGAGGA-GTTC and 5'-GCGCACGGGCAGCAGGGCATAG; ACII (425), 5'-GCTGGCGTCATAGGGGCTCAAAA and 5'-GGCACGCGCAGACACCAAACAGTA; ACIII (418), 5'-GGACGCCCTTCACCCACAACCAA and 5'-AGACCACCGCGCACATCACTACCA; ACIV (454), 5'-CACGGCCGGGATTGCGAGTAGC and 5'-TGCCGAGCCAGGACGAGGAGTGT; ACV (412), 5'-GAGCCCCAATGACCCCAGCCACTA and 5'-CGGGAGCGGCGCAATGATGAACT; ACVI (362), 5'-CCTGGCGGAAGCTGTGTCGGTTAC and 5'-GCGGTCAGTGGCCTTGGGGTTTG. The PCR reaction was performed with different concentrations of cDNA (0.1, 0.5, and 1 µg/reaction) and repeated at least 2 times. The amplified DNA fragment was subcloned into pGEM-T Easy vector (Promega) and sequenced by the Sanger dideoxynucleotide chain termination using modified T7 DNA polymerase (Pharmacia Biotech Inc.).

cAMP Measurement-- Equivalent numbers of cells were plated in 6-well plates and grown to 70-80% confluence. After rinsing with HBBS buffer (118 mM NaCl, 4.6 mM KCl, 1.0 mM CaCl2, 10 mM D-glucose, and 20 mM Hepes, pH 7.2) the cells were incubated with or without experimental compounds in 1 ml/well of HBBS + 100 µM isobutylmethylxanthine at 37 °C. After 20 min the media were recovered and stored at -20 °C. Samples were analyzed by specific radioimmunoassay to detect cAMP (34). Percent inhibition was calculated using the following formula: % inhibition = 100 - [100(D-C)/(S-C)], where D = cAMP in dopamine-treated cells; C = control or nontreated cells (basal cAMP); S = stimulated cAMP in forskolin- or PGE1-treated cells.

Measurement of [Ca2+]i-- Cells were grown to 80% confluence, harvested with trypsin/EDTA, resuspended in 1 ml of HBBS with 2 µM Fura-2 AM and incubated at 37 °C for 45 min with shaking (100 rpm). The cells were washed twice with HBBS, resuspended in 2 ml of HBBS, and subjected to fluorometric measurement. The fluorescence ratio of Fura-2 was monitored in a Perkin-Elmer LS-50 spectrofluorometer at lambda EX = 340/380 nm and lambda EM = 510 nm. Calibration was done using 0.1% Triton X-100 and 20 mM Tris base to determine Rmax and 10 mM EGTA (pH > 8) to obtain Rmin (34) and the fluorescence ratio was converted to [Ca2+]i based on a Kd of 227 nM for the Fura 2-calcium complex. Experimental compounds were added directly to cuvette from 100-fold concentrated solutions at the times indicated in the figures.

Statistical Analysis-- The data are presented as mean ± S.E. of at least three independent experiments. The data were analyzed by repeated measure using ANOVA for each set of experiments. The percent inhibition data was analyzed with repeated measure using ANOVA and the data from G-PTX expressing clones were compared with LD2S cell (wild type) using Bonferroni multiple comparison post-test.

    RESULTS
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

Expression of Mutant Galpha i/o Subtypes in LD2S Cells-- In order to investigate the importance of individual Galpha subtypes in dopamine-mediated responses, PTX-insensitive mutants of Galpha i/o were generated and stably transfected into LD2S cells (Ltk- cells stably transfected with the rat D2S receptor cDNA). Transfected clones expressing the highest levels of individual mutant Galpha i/o RNA were identified by Northern blot analysis (data not shown) and were named RGo, RGi1, RGi2, and RGi3 for clones expressing Galpha o-PTX, Galpha i1-PTX, Galpha i2-PTX, and Galpha i3-PTX, respectively. Cell extracts from clones of interest were subjected to Western blot analysis to assess at the protein level the overexpression of Galpha proteins (Fig. 1). Wild-type LD2S cells expressed all four Galpha i/o subunits, although Galpha o and Galpha i3 appeared to be the most abundant based on densitometric analysis. Comparison of Galpha o and Galpha i3 expression in each transfectant to LD2S (wild type) indicates that transfectant cell lines expressed approximately 2-fold more than the corresponding endogenous Galpha subunit. This indicates that approximately equal amounts of mutant and wild-type protein were produced in the transfected cell lines.


View larger version (28K):
[in this window]
[in a new window]
 
Fig. 1.   Galpha i/o expression in LD2S cells transfected with PTX-insensitive mutant Galpha i/o constructs. Cell extracts (100 µg) of LD2S cells (wt) and LD2S cells expressing: A, Galpha o-PTX (RGo-1, RGo-21); B, Galpha i1-PTX (RGi1-5, RGi1-10); C, Galpha i2-PTX (RGi2-4, RGi2-3); and D, Galpha i3-PTX (RGi3-2) were subjected to Western blot analysis as described under "Experimental Procedures." The blots were probed with: A, anti-Galpha o; B and C, anti-Galpha i1-2; and D, anti-Galpha i3 antibodies.

Galpha i2-PTX Mediates D2S-induced Inhibition of Forskolin-stimulated cAMP Accumulation-- In LD2S cells, dopamine did not alter the basal cAMP production (21). Upon addition of forskolin (10 µM), cAMP levels were increased by 4.5-fold compared with basal (2.22 ± 0.17 versus 0.50 ± 0.04 pmol/ml) (Fig. 2A). Dopamine (10 µM) inhibited forskolin-stimulated cAMP accumulation in these cells by 84.5 ± 12.2% (n = 5), an action that was mimicked by apomorphine (1 µM, not shown) and was largely reversed by pretreatment with PTX (Fig. 2A), indicating the involvement of Gi/o proteins. PGE1 has been shown to induce a concentration-dependent increase in cAMP production indicating the presence of endogenous Gs-coupled PGE1 receptors (30). In LD2S cells, PGE1 (1 µM) increased cAMP accumulation by 7-8-fold basal cAMP (1.65 ± 0.25 versus 0.196 ± 0.002 pmol/ml) (Fig. 2B). The greater effect of PGE1 may be related to the specific isoforms of adenylyl cyclase present in LD2S cells. Activation of D2S receptors with apomorphine (1 µM) inhibited PGE1-induced cAMP production by 66.3 ± 7.3% (Fig. 2B) and this action of apomorphine was largely reversed after PTX treatment, implicating Galpha i/o proteins.


View larger version (27K):
[in this window]
[in a new window]
 
Fig. 2.   PTX-sensitive inhibition of forskolin and PGE1-induced cAMP accumulation in LD2S cells. A, inhibition of forskolin action. B, inhibition of PGE1 action. Cells were treated with or without PTX (50 ng/ml, 16 h) and incubated for 20 min with: A, no drugs (Control), forskolin (10 µM), dopamine (10 µM) or both; or B, no drugs (Control), PGE1 (1 µM), apomorphine (10 µM, Apo), or both. The level of cAMP was measured as described under "Experimental Procedures." The data are expressed as mean ± S.E. of triplicate determinations.

The PTX sensitivity of dopamine-mediated inhibition of forskolin-induced cAMP production was examined in wild-type LD2S and stable clones expressing the mutant Galpha subunits. Dopamine inhibited forskolin-stimulated cAMP accumulation in all clones expressing mutant Galpha i/o proteins, as observed in LD2S cells (wild type). However, PTX blocked dopamine action in all clones except for those clones which express the mutant Gi2-PTX. In multiple experiments, the percent inhibition by dopamine of forskolin-stimulated cAMP accumulation was unaltered by PTX in only RGi2-3 and RGi2-4 clones, whereas in other clones a significant attenuation of dopamine action by PTX was observed (Fig. 3). These results indicate that the PTX-insensitive mutant of Galpha i2 is functional and that Galpha i2 is the only subunit required for D2S-mediated inhibition of forskolin-induced cAMP production in LD2S cells.


View larger version (39K):
[in this window]
[in a new window]
 
Fig. 3.   PTX-resistant inhibition of forskolin-induced cAMP accumulation in LD2S cells expressing the Galpha i2 mutant. Dopamine D2S receptor-induced inhibition of cAMP accumulation in LD2S cells expressing PTX-insensitive Galpha i/o mutants was calculated as: % inhibition = 100 - [100(D-C)/(S-C)], where D = cAMP level in dopamine/forskolin-treated cells; C, cAMP level in control, nontreated cells; S, cAMP level in cells stimulated by forskolin. Percent inhibition of dopamine action with or without PTX treatment from four independent experiments (n = 4) are summarized. The data are expressed as mean ± S.E., and were analyzed by repeated measures using ANOVA with Bonferroni multiple comparison. In all clones, basal and forskolin-induced cAMP levels were not significantly different from levels in non-transfected LD2S cells. LD2S cells, parent cell line; RGo-1, LD2S cells expressing Go-PTX; RGi1-5 and RGi1-10, expressing Gi1-PTX; RGi2-3 and RGi2-4, expressing Gi2-PTX; RGi3-2, expressing Gi3-PTX.

Galpha i3-PTX Mediates D2S Inhibition of PGE1-stimulated cAMP Production-- The ability of D2S receptor activation to inhibit Gs-coupled stimulation of cAMP accumulation was tested in the LD2S clones expressing PTX-insensitive G proteins. In these clones PGE1 (1 µM) induced a 7-8-fold increase in basal cAMP and apomorphine inhibited PGE1-stimulated cAMP production by 60-70%, comparable to wild-type LD2S cells. Upon pretreatment with PTX, apomorphine-mediated inhibition was completely reversed in RGo, RGi1, and RGi2 clones. In contrast, PTX treatment of the RGi3-2 clone did not block apomorphine-mediated inhibition of the PGE1 response. In multiple experiments, clone RGi3-2 retained significantly higher dopamine inhibitory activity following PTX treatment than any of the other clones (Fig. 4). Thus, the inhibitory action of the D2S receptor on Gs-coupled enhancement of cAMP is mediated through the Galpha i3 subunit, rather than the Galpha i2 subunit as observed for forskolin-induced cAMP accumulation. These results show that the D2S receptor utilizes distinct Galpha i subtypes to inhibit forskolin- or Gs-stimulated adenylyl cyclase activity.


View larger version (28K):
[in this window]
[in a new window]
 
Fig. 4.   PTX-resistant inhibition of PGE1-induced cAMP accumulation in LD2S cells expressing the Galpha i3 mutant. Dopamine D2S receptor-induced inhibition of cAMP accumulation in LD2S cells expressing PTX-insensitive Galpha i/o mutants was calculated as: % inhibition = 100 - [100(D-C)/(S-C)], where D, cAMP level in apomorphine/PGE1-treated cells; C, cAMP level in control, nontreated cells; S, cAMP level in cells stimulated by PGE1. Percent inhibition of apomorphine effect with or without PTX treatment from four independent experiments (n = 4) is summarized. The data are expressed as mean ± S.E., and were analyzed by repeated measures using ANOVA with Bonferroni multiple comparison. LD2S cells, parent cell line; RGo-1 and RGo-21, LD2S cells expressing Go-PTX; RGi1-5 and RGi1-10, expressing Gi1-PTX; RGi2-3 and RGi2-4, expressing Gi2-PTX; RGi3-2, expressing Gi3-PTX. In these clones, the PGE1-induced cAMP level was not significantly different from non-transfected LD2S cells.

Adenylyl Cyclase Expression in LD2S Cells-- To further investigate the role of AC expression in LD2S cells, we performed semi-quantitative reverse transcriptase-PCR to determine the relative expression of AC subtypes I-VI, since their regulation has been well characterized compare with other subtypes (VII-X) (21, 35-37). The PCR was performed with different concentrations of cDNA (0.1, 0.5, and 1.0 µg/reaction) and repeated at least twice for each concentration. Each PCR reaction amplified a single, specific product with the predicted sized for each AC subtypes, and the sequence was confirmed by sequencing the subcloned fragment. The specificity of the primers used was not altered with change in cDNA concentration, but the intensity of the product increased with concentration (Table I). Mouse brain RNA was used as positive control and was found to express all the subtypes of AC (data not shown). In LD2S cells, RNA for AC I and VI was expressed more abundantly than AC III, AC IV, and AC II (ACI = ACVI > ACIII > ACIV > ACII) and AC V RNA was not detected in these cells (Table I). These results indicate that LD2S cells express AC subtypes at different levels, which may direct the specificity of signaling through AC in these cells.

                              
View this table:
[in this window]
[in a new window]
 
Table I
Expression of different adenylyl cyclase subtypes in LD2S cells

Gi/o Protein Subtypes Involved in Calcium Mobilization in LD2S Cells-- In LD2S cells, the D2S receptor couples to PI turnover to induce mobilization of calcium from ionomycin-sensitive intracellular stores (8). In LD2S cells dopamine induced a 2-2.5-fold increase in [Ca2+]i (Fig. 5) which was blocked by the D2 receptor antagonist spiperone and was not observed in D2 receptor-negative Ltk- cells (data not shown), indicating that this effect is mediated by the D2S receptor. The increase in [Ca2+]i induced by dopamine was completely inhibited by PTX pretreatment, suggesting mediation via Gi/o proteins.


View larger version (19K):
[in this window]
[in a new window]
 
Fig. 5.   PTX blocks D2S-induced calcium mobilization in LD2S cells expressing PTX-insensitive single Galpha i/o-PTX mutants. Ltk- cells expressing D2S receptor (LD2S, A) and LD2S cells expressing Go-PTX (RGo-1, B), Gi1-PTX (RGi1-10, C), Gi2-PTX (RGi2-4, D), and Gi3-PTX (RGi3-2, E) mutant G proteins were treated without (solid line) or with (dash line) PTX (50 ng/ml, 16 h) and changes in intracellular [Ca2+]i in response to dopamine (10 µM) or ATP (10 µM) were measured.

Each of the clones expressing mutant G proteins responded to dopamine with a 2-2.5-fold increase in [Ca2+]i (Fig. 6). Following pretreatment with PTX, none of the mutant G protein transfectants exhibited a D2S-mediated calcium response (Fig. 6). In order to test whether more than one G protein could rescue the calcium response, Ltk- cells were transfected with different pairs of the four G-PTX mutant constructs along with D2S receptor and assayed for [Ca2+]i. In all sets dopamine increased [Ca2+]i by 1.6-fold (Fig. 6), similar to that in LD2S cells (33). This indicates that the Ltk- cells express sufficient levels of transiently transfected cDNAs to mediate a full functional response. However, after PTX treatment, none of the mutant combinations rescued the dopamine response (Fig. 6). In these experiments, the increase of [Ca2+]i induced by 100 µM ATP served as a positive control for cellular responsiveness and was unchanged following PTX pretreatment, since the ATP response is mediated through a Gq-coupled P2-purinergic receptor. Similarly, in LD2S cells transiently transfected with pairs of G-PTX plasmids, PTX pretreatment blocked completely the dopamine-mediated calcium responses for all combinations (data not shown). The dopamine response was also tested in another series of transfections in which a double dose (60 µg) of single G-PTX plasmid was transiently transfected in LD2S cells. As for the stable LD2S clones (see above), the single G-PTX did not mediate the D2S calcium response in these transfections (data not shown). The protein level of the Galpha i1 and Galpha i2 was increased by more than 2-fold in Ltk- cells transiently transfected by both of these proteins (Fig. 6, inset). Based on these results, none of the Galpha i/o subunits, alone or in combination, mediated calcium mobilization induced by dopamine in LD2S cells.


View larger version (18K):
[in this window]
[in a new window]
 
Fig. 6.   Calcium mobilization in LD2S cells expressing pairs of Galpha i/o-PTX mutants. Ltk- cells were transiently co-transfected with pairs of Galpha i/o-PTX mutant proteins and D2S receptor. The arrows indicate addition of 10 µM dopamine and 10 µM ATP to cells pretreated with PTX (50 ng/ml, 16 h). Cells were transfected with: A, Go-PTX/Gi1-PTX, Go-PTX/Gi2-PTX, or Go-PTX/Gi3-PTX; B, Gi1-PTX/Gi2-PTX, Gi1-PTX/Gi3-PTX, or Gi1-PTX/Gi3-PTX. Inset, Western blot an- alysis of Galpha i1-2 protein expression. Ltk- cells were transiently transfected with Gi1-PTX, Gi2-PTX, or Gi1-PTX/Gi2-PTX. Cell extracts (200 µg/lane) from non-transfected (Ltk-) and transfected cells were subjected to SDS-polyacrylamide gel electrophoresis and the Galpha i1-2 protein was detected using Galpha i1-2 antibody.

Gbeta gamma Subunits Mediate D2S-induced Calcium Mobilization in LD2S Cells-- In order to investigate the role of Gbeta gamma subunit of Gi/Go proteins in D2S-mediated increase in [Ca2+]i, LD2S cells were stably transfected with the His6-tagged carboxyl-terminal of GRK-2 (GRK-CT), which contains a pleckstrin homology domain that is known to bind and inactivate free Gbeta gamma subunits (38). The relative level of His-GRK-CT protein in clones expressing His-GRK-CT was determined by Western blot using an antibody against the His epitope (Fig. 7, inset). As shown in Fig. 7, the dopamine-induced increase in [Ca2+]i was reduced by 80% compared with LD2S cells in the clone expressing His-GRK-CT (RD-21). In contrast, dopamine mediated inhibition of forskolin- and PGE1-stimulated cAMP accumulation was not significantly different between LD2S and RD-21 cells (data not shown). In another clone expressing lower levels (20%) of His-GRK-CT than RD-21, the increase in [Ca2+]i induced by dopamine was reduced by only 30% (data not shown). These results suggest that D2S-mediated stimulation of [Ca2+]i is mediated by Gbeta gamma subunits and is more dependent on Gbeta gamma subunits than particular Galpha subunits.


View larger version (14K):
[in this window]
[in a new window]
 
Fig. 7.   Inhibition of calcium mobilization in LD2S cells expressing His-GRK-CT protein. Change in [Ca2+]i was measured in LD2S cells (wt) and LD2S cells stably transfected with His-GRK-CT protein (RD-21). The arrows indicate the addition of dopamine (10 µM) or ATP (10 µM). Inset, Western blot analysis of LD2S and RD-21 cells. Cell extracts (100 µg/lane) from LD2S and RD-21 cells were subjected to SDS-polyacrylamide gel electrophoresis and recombinent protein were detected using an anti-RGS-His6 antibody. The arrow indicates the 24-kDa recombinant His-GRK-CT protein.


    DISCUSSION
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

State-dependent Modulation of Adenylyl Cyclase via Distinct G Proteins-- The dopamine-D2S receptor is coupled to inhibition of adenylyl cyclase in a wide variety of cell types (13, 14, 39-41). Indeed, inhibition of adenylyl cyclase by receptors that couple to Galpha i/o appears to be a ubiquitous pathway (2, 5, 6). In intact cells, adenylyl cyclase can exist in at least three states: basal, forskolin-stimulated, or Galpha s-stimulated (36). In Ltk- cells, the D2S receptor inhibits cAMP production stimulated by either forskolin or PGE1, but does not inhibit the basal level of cAMP level (Fig. 2, (21)). By contrast, in pituitary cells the D2S receptor inhibits all three states, i.e. basal, forskolin-stimulated, and vasoactive intestinal peptide-stimulated cAMP accumulation (13, 14, 39). The basal levels of cAMP are at least 5-fold lower in Ltk- fibroblast cells as compared with GH4C1 pituitary cells (34), and perhaps it is already at a minimum level. Furthermore, our results show that Ltk- cells have an undetectable level of ACV, and ACII and IV are weakly expressed (Table I). This could explain why D2S receptor activation induced no change in basal cAMP production in LD2S cells. For example, the dopamine-D3 receptor appears to couple exclusively to ACV (42).

To address the G protein specificity of D2S receptor signaling, LD2S cells were transfected stably with individual PTX-insensitive mutants of Galpha i/o subtypes and treated with PTX to inactivate endogenous Gi/o proteins. When stimulated by forskolin, inhibition of cAMP accumulation by D2S receptor activation is mediated exclusively through the Galpha i2 subtype (Fig. 3). This agrees with findings in pituitary cells. Using antibodies to Galpha i/o subunits, Izenwasser and Cote (43) have reported that inhibition of cAMP accumulation by D2 receptors in pituitary tumor cells utilizes Galpha i1 and/or Galpha i2, since their antibody detects both subtypes equally. Furthermore, using PTX-insensitive mutants, Senogles (39) has shown that in GH4C1 cells expressing D2S receptor, D2S inhibition of forskolin-induced adenylyl cyclase is routed through Galpha i2. Our results indicate that in Ltk- fibroblast cells, the D2S receptor couples preferentially to the Galpha i2 subtype to inhibit activation of adenylyl cyclase by forskolin.

On the other hand, inhibition of PGE1-stimulated cAMP accumulation, a Galpha s-coupled AC pathway, by D2S receptor activation was mediated through Galpha i3 in the LD2S cells, and not by Galpha i2 as for forskolin (Fig. 4). This indicates that D2S receptor utilizes distinct Galpha i proteins to mediate inhibition of AC depending on the pathway of activation of AC. This is consistent with previous findings in GH4C1 pituitary cells, in which antisense depletion of Galpha i2 only marginally reduced D2S-mediated inhibition of vasoactive intestinal peptide-stimulated cAMP levels (Gs-coupled), but completely blocked D2S-mediated inhibition of basal cAMP level (14). Interestingly, the coupling of other receptor subtypes (e.g. somatostatin or muscarinic-M4) to inhibition of vasoactive intestinal peptide-induced cAMP was completely blocked by depletion of Galpha i2. Thus, Galpha i2 plays an important role in D2S coupling to both basal and forskolin-induced AC, but not in coupling to Gs-stimulated AC in both transfected GH4C1 and Ltk- cells. In contrast, Galpha i3 mediates inhibition of Gs-stimulated AC activity in LD2S cells. Taken together, these findings provide evidence for a precise regulation of AC activity that is dependent on specific interactions between different activation states of AC and distinct Gai subtypes.

One explanation for the state-dependent specificity of inhibition of AC by Galpha i is that different subtypes of AC are recruited for forskolin- versus Gs-mediated activation pathways. Sutkowski and co-workers (37) have shown that Galpha s activates ACII more efficaciously than ACI, ACV, or ACVI, whereas forskolin preferentially activates ACI over ACII, ACV, or ACVI. Furthermore, it has been shown that Galpha i1 inhibits ACV more efficiently than ACI (44). By this interpretation, our results would be consistent with Galpha i2 having greater activity to inhibit ACI, and Galpha i3 inhibiting ACII. However, specific interactions between different Galpha i and AC subtypes have not been reported. Another possibility is the state-dependent modulation of individual AC subtypes by distinct Galpha i proteins. When expressed in Sf9 cells, Galpha i1 did not inhibit Galpha s-mediated stimulation of ACI (44). However, when ACI was stimulated by calmodulin or forskolin, Galpha i1 mediated inhibition of ACI. This indicates that the extent of inhibition of a particular AC subtype (ACI) by Galpha i1 is dependent on the activation pathway. Following D2S receptor activation, Galpha i2 may also preferentially inhibit the forskolin-activated state in AC subtypes that predominate in Ltk- cells, whereas Galpha i3 preferentially inhibits the Gs-activated state. Distinct conformational changes in AC upon interaction with forskolin or Gs could explain the selective inhibition of Galpha i subtypes. The crystal structure of the catalytic domain of ACII reveals that forskolin binds to two symetric sites to prevent hydration and enhance dimerization of the C1-C2 domains (45). The binding site for Galpha i/o has not been determined, but it may bind to the a2/a3 region of C1a, which is close to the catalytic domain, on the opposite site of the Galpha s site (46). In this case, Galpha i/o protein could alter the preferable alignment by blocking the "counterclockwise" rotation of C1 (47). In the forskolin-bound conformation, AC may preferentially recognize specific Galpha i/o protein subtypes distinct from those recognized by the Gs-bound conformation of AC. Further structural studies may reveal the molecular basis for state-dependent Gi protein selectivity in inhibition of AC.

Gbeta gamma and Calcium Mobilization-- In LD2S cells transfected with single or pairs of PTX-insensitive Gi/o proteins cDNAs to yield a greater than 2-fold protein expression, dopamine failed to induce calcium mobilization after PTX treatment, suggesting that Galpha subunits plays a minor or secondary role in this pathway. On the other hand, inhibition of Gbeta gamma signaling in LD2S cells expressing GRK-CT correlated with an inhibition of D2S-induced calcium mobilization, indicating that this process is mediated through Gbeta gamma subunits rather than the Galpha subunit. This result is consistent with the fact that Gbeta gamma subunits of Gi/o proteins can activate PLC-beta 2 and PLC-beta 3 (5). Recent results indicate that the D2S receptor increases calcium mobilization in LD2S cells via activation of PLC-beta 2 (33), implicating Gbeta gamma -signaling in the calcium mobilization pathway. The lack of activity of individual Galpha subunits to mediate calcium mobilization was partly unexpected. In NG108-15 neuroblastoma cells, PTX-insensitive Galpha o did mediate coupling to inhibition of calcium channel activation (25), a Gbeta gamma -mediated response (5). It has been estimated that a 10-fold higher amount of Gbeta gamma is required to activate PLC-beta 2 in vitro than is required for Galpha i-mediated activation of AC (48). It may be that multiple Gi/Go subtypes, rather than a single subtype, must be activated to release sufficient Gbeta gamma subunits to induce calcium mobilization in LD2S cells.

Conclusion-- The dopamine D2S receptor couples to Galpha i2 to inhibit forskolin-induced cAMP production. On the other hand, when AC is activated by a Gs-coupled receptor (PGE1 receptor), dopamine-induced inhibition is mediated by Galpha i3. Furthermore, D2S-induced increase in [Ca2+]i in LD2S cells is not dependent on any particular Galpha i/o subtype, but is dependent on mobilization of Gbeta gamma subunit. Therefore, the dopamine D2S receptor utilizes different Gi/o protein subunits to regulate a diversity of effector functions within the cell. Moreover, this study shows that the PTX-insensitive Gi/o mutants provide useful tools for the dissection of G protein coupling to receptors.

    ACKNOWLEDGEMENTS

We thank Christine Forget for excellent technical assistance with cAMP assays. We also acknowledge the helpful editorial comments of Dr. Maribeth Lazzaro.

    FOOTNOTES

* This work was supported in part by grants from the Medical Research Council of Canada (to P. R. A.) and National Cancer Institute of Canada (to P. R. A).The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

§ Supported by the Ministry of Health of Iran and Schizophrenia Society of Canada.

parallel Novartis/MRC/Michael Smith Chair in Neurosciences. To whom correspondence should be addressed: Neuroscience Research Institute, 451 Smyth Rd., Rm. 2464, Ottawa K1H 8M5, Canada. Tel.: 613-562-5800 (ext. 8307); Fax: 613-562-5403; E-mail: palbert{at}uottawa.ca.

    ABBREVIATIONS

The abbreviations used are: G protein, guanine nucleotide-binding protein; AC, adenylyl cyclase; [Ca2+]i, intracellular calcium concentration; FBS, fetal bovine serum; PTX, pertussis toxin; G-PTX, G protein insensitive to PTX; HBBS, Hepes-buffered balanced salt solution; MEM, minimum Eagles's medium; PLC, phospholipase C; PCR, polymerase chain reaction; PGE1, prostaglandin E1.

    REFERENCES
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES
  1. Neer, E. J. (1995) Cell 80, 249-257[CrossRef][Medline] [Order article via Infotrieve]
  2. Bourne, H. R. (1997) Curr. Opin. Cell Biol. 9, 134-142[CrossRef][Medline] [Order article via Infotrieve]
  3. Raymond, J. R. (1995) Am. J. Physiol. 38, F141-F158
  4. Birnbaumer, L. (1992) Cell 71, 1069-1072[CrossRef][Medline] [Order article via Infotrieve]
  5. Clapham, D. E., and Neer, E. J. (1997) Annu. Rev. Pharmacol. Toxicol. 37, 167-203[CrossRef][Medline] [Order article via Infotrieve]
  6. Gudermann, T., Kalkbrenner, F., and Schultz, G. (1996) Annu. Rev. Pharmacol. Toxicol. 36, 429-459[Medline] [Order article via Infotrieve]
  7. Civelli, O., Bunzow, J. R., and Grandy, D. K. (1993) Annu. Rev. Pharmacol. Toxicol. 33, 281-307[CrossRef][Medline] [Order article via Infotrieve]
  8. Albert, P. R. (1994) Vitam. Horm. 48, 59-109[Medline] [Order article via Infotrieve]
  9. Castellano, M. A., Liu, L. X., Monsma, F. J., Sibley, D. R., Kapatos, G., and Chiodo, L. A. (1993) Mol. Pharmacol. 44, 649-656[Abstract]
  10. Einhorn, L. C., Gregerson, K. A., and Oxford, G. S. (1991) J. Neurosci. 11, 3727-3737[Abstract]
  11. Lledo, P. M., Homburger, V., Bockaert, J., and Vincent, J. D. (1992) Neuron 8, 455-463[CrossRef][Medline] [Order article via Infotrieve]
  12. Memo, M., Pizzi, M., Belloni, M., Benarese, M., and Spano, P. (1992) J. Neurochem. 59, 1829-1835[CrossRef][Medline] [Order article via Infotrieve]
  13. Albert, P. R., Neve, K. A., Bunzow, J. R., and Civelli, O. (1990) J. Biol. Chem. 265, 2098-2104[Abstract/Free Full Text]
  14. Liu, Y. F., Jakobs, K. H., Rasenick, M. M., and Albert, P. R. (1994) J. Biol. Chem. 269, 13880-13886[Abstract/Free Full Text]
  15. Senogles, S. E. (1994) Endocrinology 134, 783-789[Abstract/Free Full Text]
  16. Vallar, L., Muca, C., Magni, M., Albert, P., Bunzow, J., Meldolesi, J., and Civelli, O. (1990) J. Biol. Chem. 265, 10320-10326[Abstract/Free Full Text]
  17. Lew, A. M., and Elsholtz, H. P. (1995) J. Biol. Chem. 270, 7156-7160[Abstract/Free Full Text]
  18. Elsholtz, H. P., Lew, A. M., Albert, P. R., and Sundmark, V. C. (1991) J. Biol. Chem. 266, 22919-22925[Abstract/Free Full Text]
  19. Huff, R. M., and Lajiness, M. E. (1994) J. Cell. Biochem. 18B, 220
  20. Lajiness, M. E., Chio, C. L., and Huff, R. M. (1993) J. Pharmacol. Exp. Therap. 267, 1573-1581[Abstract/Free Full Text]
  21. Liu, Y. F., Civelli, O., Grandy, D. K., and Albert, P. R. (1992) J. Neurochem. 59, 2311-2317[Medline] [Order article via Infotrieve]
  22. Hayes, G., Biden, T. J., Selbie, L. A., and Shine, J. (1992) Mol. Endocrinol. 6, 920-926[Abstract/Free Full Text]
  23. Tang, L., Todd, R. D., Heller, A., and O'Malley, K. L. (1994) J. Pharmacol. Exp. Therap. 268, 495-502[Abstract/Free Full Text]
  24. Yamane, H. K., and Fung, B. K. (1993) Annu. Rev. Pharmacol. Toxicol. 33, 201-241[CrossRef][Medline] [Order article via Infotrieve]
  25. Taussig, R., Sanchez, S., RIfo, M., Gilma, A. G., and Belardeti, F. (1992) Neuron 8, 799-809[CrossRef][Medline] [Order article via Infotrieve]
  26. Chuprun, J. K., Raymond, J. R., and Blackshear, P. J. (1997) J. Biol. Chem. 272, 773-781[Abstract/Free Full Text]
  27. Ghahremani, M. H., and Albert, P. R. (1995) Proceeding of the Society for Neuroscience, Vol. 21, p. 1863, Society for Neuroscience, San Diego
  28. Hunt, T. W., Carroll, R. C., and Peralta, E. G. (1994) J. Biol. Chem. 269, 29565-29570[Abstract/Free Full Text]
  29. Jones, D. T., and Reed, R. R. (1987) J. Biol. Chem. 262, 14241-14249[Abstract/Free Full Text]
  30. Lembo, P. M. C., Ghahremani, M. H., and Albert, P. R. (1999) Mol. Endocrinol. 13, 138-147[Abstract/Free Full Text]
  31. Kozak, M. (1986) Cell 44, 383-292
  32. Sambrook, J., Fritsch, E. F., and Maniatis, T. (1989) Molecular Cloning: A Laboratory Manual, 2nd Ed., Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY
  33. Morris, S. J., Kriz, R., and Albert, P. R. (1996) Proceeding of the Society for Neuroscience, Vol. 22, Society for Neuroscience, Washington, D. C.
  34. Liu, Y. F., and Albert, P. R. (1991) J. Biol. Chem. 266, 23689-23697[Abstract/Free Full Text]
  35. Nevo, I., Avidorreiss, T., Levy, R., Bayewitch, M., Heldman, E., and Vogel, Z. (1998) Mol. Pharmacol. 54, 419-426[Abstract/Free Full Text]
  36. Sunahara, R. K., Dessauer, C. W., and Gilman, A. G. (1996) Annu. Rev. Pharmacol. Toxicol. 36, 461-480[CrossRef][Medline] [Order article via Infotrieve]
  37. Sutkowski, E. M., Tang, W. J., Broome, C. W., Robbins, J. D., and Seamon, K. B. (1994) Biochemistry 33, 12852-12859[CrossRef][Medline] [Order article via Infotrieve]
  38. Koch, W. J., Hawes, B. E., Inglese, J., Luttrell, L. M., and Lefkowitz, R. J. (1994) J. Biol. Chem. 269, 6193-6197[Abstract/Free Full Text]
  39. Senogles, S. E. (1994) J. Biol. Chem. 269, 23120-23127[Abstract/Free Full Text]
  40. Montmayeur, J. P., Guiramand, J., and Borrelli, E. (1993) Mol. Endocrinol. 7, 161-170[Abstract/Free Full Text]
  41. Malek, D., Munch, G., and Palm, D. (1993) FEBS Lett. 325, 215-219[CrossRef][Medline] [Order article via Infotrieve]
  42. Robinson, S. W., and Caron, M. G. (1997) Mol. Pharmacol. 52, 508-514[Abstract/Free Full Text]
  43. Izenwasser, S., and Cote, T. E. (1995) J. Neurochem. 64, 1614-1621[Medline] [Order article via Infotrieve]
  44. Taussig, R., Iniguez-Lluhi, J. A., and Gilman, A. G. (1993) Science 261, 218-221[Abstract/Free Full Text]
  45. Zhang, G., Liu, Y., Ruoho, A. E., and Hurley, J. H. (1997) Nature 386, 247-253[CrossRef][Medline] [Order article via Infotrieve]
  46. Yan, S. Z., Hahn, D., Huang, Z. H., and Tang, W. J. (1996) J. Biol. Chem. 271, 10941-10945[Abstract/Free Full Text]
  47. Tang, W. J., and Hurley, J. H. (1998) Mol. Pharmacol. 54, 231-240[Free Full Text]
  48. Camps, M., Hou, C., Sidiropoulos, D., Stock, J. B., and Jakobs, K. H. (1992) Eur. J. Biochem. 206, 23066-23075


Copyright © 1999 by The American Society for Biochemistry and Molecular Biology, Inc.
Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
J. Pharmacol. Exp. Ther.Home page
J. R. Lane, B. Powney, A. Wise, S. Rees, and G. Milligan
G Protein Coupling and Ligand Selectivity of the D2L and D3 Dopamine Receptors
J. Pharmacol. Exp. Ther., April 1, 2008; 325(1): 319 - 330.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
A. Rogaeva, X.-M. Ou, H. Jafar-Nejad, S. Lemonde, and P. R. Albert
Differential Repression by Freud-1/CC2D1A at a Polymorphic Site in the Dopamine-D2 Receptor Gene
J. Biol. Chem., July 20, 2007; 282(29): 20897 - 20905.
[Abstract] [Full Text] [PDF]


Home page
Mol. Pharmacol.Home page
J. R. Lane, B. Powney, A. Wise, S. Rees, and G. Milligan
Protean Agonism at the Dopamine D2 Receptor: (S)-3-(3-Hydroxyphenyl)-N-propylpiperidine Is an Agonist for Activation of Go1 but an Antagonist/Inverse Agonist for Gi1,Gi2, and Gi3
Mol. Pharmacol., May 1, 2007; 71(5): 1349 - 1359.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
H. Mao, Q. Zhao, M. Daigle, M. H. Ghahremani, P. Chidiac, and P. R. Albert
RGS17/RGSZ2, a Novel Regulator of Gi/o, Gz, and Gq Signaling
J. Biol. Chem., June 18, 2004; 279(25): 26314 - 26322.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
S. E. Senogles, T. L. Heimert, E. R. Odife, and M. W. Quasney
A Region of the Third Intracellular Loop of the Short Form of the D2 Dopamine Receptor Dictates Gi Coupling Specificity
J. Biol. Chem., January 16, 2004; 279(3): 1601 - 1606.
[Abstract] [Full Text] [PDF]


Home page
Endocr. Rev.Home page
T. M. Cabrera-Vera, J. Vanhauwe, T. O. Thomas, M. Medkova, A. Preininger, M. R. Mazzoni, and H. E. Hamm
Insights into G Protein Structure, Function, and Regulation
Endocr. Rev., December 1, 2003; 24(6): 765 - 781.
[Abstract] [Full Text] [PDF]


Home page
J. Neurosci.Home page
X.-M. Ou, S. Lemonde, H. Jafar-Nejad, C. D. Bown, A. Goto, A. Rogaeva, and P. R. Albert
Freud-1: A Neuronal Calcium-Regulated Repressor of the 5-HT1A Receptor Gene
J. Neurosci., August 13, 2003; 23(19): 7415 - 7425.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Cell Physiol.Home page
G. Liu, M. H. Ghahremani, B. Banihashemi, and P. R. Albert
Diacylglycerol and ceramide formation induced by dopamine D2S receptors via Gbeta gamma -subunits in Balb/c-3T3 cells
Am J Physiol Cell Physiol, March 1, 2003; 284(3): C640 - C648.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
G. Liu, L. Robillard, B. Banihashemi, and P. R. Albert
Growth Hormone-induced Diacylglycerol and Ceramide Formation via Galpha i3 and Gbeta gamma in GH4 Pituitary Cells. POTENTIATION BY DOPAMINE-D2 RECEPTOR ACTIVATION
J. Biol. Chem., December 6, 2002; 277(50): 48427 - 48433.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
B. Banihashemi and P. R. Albert
Dopamine-D2S Receptor Inhibition of Calcium Influx, Adenylyl Cyclase, and Mitogen-Activated Protein Kinase in Pituitary Cells: Distinct G{alpha} and G{beta}{gamma} Requirements
Mol. Endocrinol., October 1, 2002; 16(10): 2393 - 2404.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
P. R. Albert
G Protein Preferences for Dopamine D2 Inhibition of Prolactin Secretion and DNA Synthesis in GH4 Pituitary Cells
Mol. Endocrinol., August 1, 2002; 16(8): 1903 - 1911.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
P. R. Albert
Editorial: Dopamine-D2-Mediated Inhibition of TRH-Induced PLC Activation in Pituitary Cells--Direct or Indirect?
Endocrinology, March 1, 2002; 143(3): 744 - 746.
[Full Text] [PDF]


Home page
J. Pharmacol. Exp. Ther.Home page
K. L. J. Evans, J. D. Cropper, K. A. Berg, and W. P. Clarke
Mechanisms of Regulation of Agonist Efficacy at the 5-HT1A Receptor by Phospholipid-Derived Signaling Components
J. Pharmacol. Exp. Ther., June 1, 2001; 297(3): 1025 - 1035.
[Abstract] [Full Text]


Home page
J. Pharmacol. Exp. Ther.Home page
P. J. Pauwels, F. Finana, S. Tardif, T. Wurch, and F. C. Colpaert
Dynamic Dopamine-Antagonist Interactions at Recombinant Human Dopamine D2short Receptor: Dopamine-Bound versus Antagonist-Bound Receptor States
J. Pharmacol. Exp. Ther., April 1, 2001; 297(1): 133 - 140.
[Abstract] [Full Text]


Home page
EndocrinologyHome page
B. Y. Ho, A. Stadnicka, P. L. Prather, A. R. Buckley, L. L. Current, Z. J. Bosnjak, and W.-M. Kwok
Cannabinoid CB1 Receptor-Mediated Inhibition of Prolactin Release and Signaling Mechanisms in GH4C1 Cells
Endocrinology, May 1, 2000; 141(5): 1675 - 1685.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
M. H. Ghahremani, C. Forget, and P. R. Albert
Distinct Roles for Galpha i2 and Gbeta gamma in Signaling to DNA Synthesis and Galpha i3 in Cellular Transformation by Dopamine D2S Receptor Activation in BALB/c 3T3 Cells
Mol. Cell. Biol., March 1, 2000; 20(5): 1497 - 1506.
[Abstract] [Full Text]


Home page
J. Biol. Chem.Home page
P. R. Albert, N. Sajedi, S. Lemonde, and M. H. Ghahremani
Constitutive Gi2-dependent Activation of Adenylyl Cyclase Type II by the 5-HT1A Receptor. INHIBITION BY ANXIOLYTIC PARTIAL AGONISTS
J. Biol. Chem., December 10, 1999; 274(50): 35469 - 35474.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
Y. F. Liu, M. H. Ghahremani, M. M. Rasenick, K. H. Jakobs, and P. R. Albert
Stimulation of cAMP Synthesis by Gi-coupled Receptors upon Ablation of Distinct Galpha i Protein Expression. Gi SUBTYPE SPECIFICITY OF THE 5-HT1A RECEPTOR
J. Biol. Chem., June 4, 1999; 274(23): 16444 - 16450.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
X.-M. Ou, J. M. Storring, N. Kushwaha, and P. R. Albert
Heterodimerization of Mineralocorticoid and Glucocorticoid Receptors at a Novel Negative Response Element of the 5-HT1A Receptor Gene
J. Biol. Chem., April 20, 2001; 276(17): 14299 - 14307.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
Y. Cordeaux, S. A. Nickolls, L. A. Flood, S. G. Graber, and P. G. Strange
Agonist Regulation of D2 Dopamine Receptor/G Protein Interaction. EVIDENCE FOR AGONIST SELECTION OF G PROTEIN SUBTYPE
J. Biol. Chem., July 27, 2001; 276(31): 28667 - 28675.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
J. L. Leaney and A. Tinker
The role of members of the pertussis toxin-sensitive family of G proteins in coupling receptors to the activation of the G protein-gated inwardly rectifying potassium channel
PNAS, May 9, 2000; 97(10): 5651 - 5656.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Ghahremani, M. H.
Right arrow Articles by Albert, P. R.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Ghahremani, M. H.
Right arrow Articles by Albert, P. R.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 All ASBMB Journals   Molecular and Cellular Proteomics 
 Journal of Lipid Research   ASBMB Today 
Copyright © 1999 by the American Society for Biochemistry and Molecular Biology.
Advertisement
spacer
Advertisement
Advertisement