|
J Biol Chem, Vol. 274, Issue 14, 9238-9245, April 2, 1999
Distinct Roles for G i2, G i3, and
G in Modulation of Forskolin- or Gs-mediated cAMP
Accumulation and Calcium Mobilization by Dopamine D2S Receptors*
Mohammad H.
Ghahremani §,
Peihua
Cheng¶,
Paola M. C.
Lembo , and
Paul R.
Albert¶
From the Department of Pharmacology and Therapeutics,
McGill University, Montreal H3G 1Y6, Canada and the ¶ Neuroscience
Research Institute, University of Ottawa, Ottawa K1H 8M5, Canada
 |
ABSTRACT |
Previous studies have shown that a single G
protein-coupled receptor can regulate different effector systems by
signaling through multiple subtypes of heterotrimeric G proteins.
In LD2S fibroblast cells, the dopamine D2S receptor couples to
pertussis toxin (PTX)-sensitive Gi/Go
proteins to inhibit forskolin- or prostaglandin
E1-stimulated cAMP production and to stimulate calcium mobilization. To analyze the role of distinct G i/o
protein subtypes, LD2S cells were stably transfected with a series of
PTX-insensitive G i/o protein Cys Ser point mutants
and assayed for D2S receptor signaling after PTX treatment. The level
of expression of the transfected G mutant subunits was similar to
the endogenous level of the most abundant G i/o proteins
(G o, G i3). D2S receptor-mediated inhibition of forskolin-stimulated cAMP production was retained only in
clones expressing mutant G i2. In contrast, the D2S
receptor utilized G i3 to inhibit
PGE1-induced (Gs-coupled) enhancement of cAMP
production. Following stable or transient transfection, no single or
pair set of mutant G i/o subtypes rescued the
D2S-mediated calcium response following PTX pretreatment. On the other
hand, in LD2S cells stably transfected with GRK-CT, a receptor kinase fragment that specifically antagonizes G subunit activity, D2S receptor-mediated calcium mobilization was blocked. The observed specificity of G i2 and G i3 for different
states of adenylyl cyclase activation suggests a higher level of
specificity for interaction of G i subunits with
forskolin- versus Gs-activated states of
adenylyl cyclase than has been previously appreciated.
 |
INTRODUCTION |
A wide variety of physiological functions and pathological
conditions are regulated by hormones and neurotransmitters which transduce intracellular signals by coupling to heterotrimeric guanine
nucleotide-binding proteins (G
proteins).1 Upon receptor
activation, G proteins dissociate into G and G subunits which
in turn regulate the activity of effector molecules (1-3). The family
of G subunits is divided into structural and functional homologues,
for example, G s proteins couple positively to AC to
increase intracellular production of cAMP; G i/o proteins couple negatively to AC and are inactivated by PTX; and
G q proteins couple to PLC- subtypes to increase
[Ca2+]i and are insensitive to PTX. The G
subunits of G proteins couple to a variety of cell-specific effectors
including AC types II and IV, PLC- 2 and PLC- 3, inwardly
rectifying potassium channels, and N-type calcium channels (4, 5). In
addition, G protein-coupled receptors appear to utilize particular
combinations of subunits to initiate specific types of
responses (6).
The dopamine D2S receptor couples to PTX-sensitive G proteins
(Gi/o) to initiate multiple signaling pathways (7, 8). In
cells of neuroendocrine origin the D2S couples to "inhibitory" pathways, including inhibition of adenylyl cyclase, activation of
potassium channels to hyperpolarize the cell membrane, and inhibition
of L-type calcium channels (9-12), which in concert mediate inhibition of hormone secretion and gene transcription, and
inhibition of cell proliferation (13-18). By contrast, when expressed
in cells of mesenchymal lineage (e.g. Ltk fibroblast or
Chinese hamster ovary cells), the same receptor mediates stimulation of
phospholipase C activity to induce calcium mobilization, and activation
of the mitogen-activated protein kinase cascade leading to enhanced
gene transcription and cell proliferation (8, 14, 17, 19-23). These
findings suggest that the same receptor mediates different cellular
responses depending on the repertoire of cell-specific effectors that
are expressed. To address the pathways that underlie cell-specific
signaling we have studied the G protein specificity of D2S receptor
coupling, based on the hypothesis that different G protein subunits
mediate receptor coupling to inhibitory versus stimulatory
signaling events.
PTX acts to uncouple G i/o proteins by ADP-ribosylating
these subunits at a conserved carboxyl-terminal domain cysteine (Cys) residue (24). By mutating the conserved Cys residue in
G i1, G i2, G i3, and
G o to a ribosylation-resistant serine (Ser) residue we
have generated a series of PTX-insensitive mutants of
G i/o protein (G-PTX). Because the Cys Ser mutation
is a structurally conservative change, the mutant G proteins remain
functional following PTX pretreatment (25-28). We have assessed the
contribution of individual or specific combinations of G protein
subunits to D2S-mediated signaling. The D2S receptor utilizes distinct
single G subunits to inhibit cAMP accumulation depending on the
method of AC activation. In contrast, calcium mobilization induced by
the D2S receptor is not reconstituted with single or combinations of
G subunits, but is blocked by inhibiting G function. These
results indicate a strong dependence on G i subtype for
D2S-mediated inhibition of AC that is not observed for stimulation of
calcium mobilization.
 |
EXPERIMENTAL PROCEDURES |
Materials--
Apomorphine, dopamine, EGTA, forskolin,
PGE1, isobutylmethylxanthine, and PTX were from Sigma. Fura
2-AM was purchased from Molecular Probes (Eugene, OR) and hygromycin B
from Calbiochem. 125I-Succinyl cAMP and
polyvinylpyrrolidone membrane were from NEN Life Science Products Inc.
and [ -32P]dCTP and ECL Western blot detection kits
were from Amersham Corp. Sera, media, and Geneticin (G418) were
obtained from Life Technologies, Inc. Plasmids pY3 and pCMV-LacZ II
were obtained from the American Type Culture Collection (Manassas, VA).
Endonucleases and DNA polymerase were purchased from New England
Biolabs (Mississauga, Ontario, Canada). Taq polymerase has
been purchased from Pharmacia Biotech Inc. (Baie d'Urfe, QB). The
cDNAs encoding wild-type rat G o, G i1,
G i2, and G i3 were generously provided by
Dr. Randall Reed, Johns Hopkins University, Baltimore, MD. The
G o antibody was from Santa Cruz Biotechnology Inc.
(Santa Cruz, CA) and anti-G i1-2 and
anti-G i3 were obtained from Calbiochem (San Diego, CA).
Anti-RGS-His6 was purchased from Qiagen (Santa Clarita, CA).
Cell Culture--
Murine Ltk cells stably transfected with rat
dopamine D2S receptor (LD2S) (13) were maintained in minimum
Eagle's medium (MEM) with 10% FBS in a humidified atmosphere of 5%
CO2, 95% air at 37 °C. The cells were routinely
passaged using 0.05% trypsin, 0.02% EDTA in HBBS. For PTX treatment,
the cells were treated with 50 ng/ml PTX for 16 h prior to experimentation.
Site-directed Mutagenesis--
Site-directed mutagenesis was
performed using the Altered Sites IITM system (Promega).
PTX-insensitive G i/o mutants were generated using rat
cDNAs (29) encoding G o, G i1,
G i2, and G i3 subunits. The cysteine 351 codon (352 for G i2), i.e. TGT,
was mutated to TCT in order to encode serine using the
following oligonucleotides: G o-PTX,
TCCGGGGCTCTGGCTTGTA; G i1-PTX,
AACCTAAAAGACTCTGGTC; G i2-PTX, ACAACCTGAAGGACTCTGGC, and G i3-PTX,
AAGGAATCTGGGCTTTACT. The mutation was confirmed by
endonuclease restriction analysis and Sanger dide- oxynucleotide
sequencing. The mutant cDNAs were then subcloned into the
EcoRI site of the pcDNA3 (Invitrogen) mammalian
expression vector under control of the cytomegalovirus promoter.
His-GRK-CT Construct--
The OK-GRK2 cDNA (30) was
partially digested with BbsI and EcoRI
endonuclease and the 1506-bp fragment encoding the COOH-terminal domain
starting from Thr493 was isolated and used for the
construct (GRK-CT). The His-tag was incorporated using the following
complementary oligonucleotides: 5'-CACCATGCGAGGTAGTCACCACCACCACCACCACAC-3' and
5'-CTTTGTGTGGTGGTGGTGGTGGTGACTACCTCGCATGGTGGTAC-3'. The two
oligonucleotides were designed to encode
Met-Arg-Gly-Ser-His6 with a Kozak sequence (31) in the
NH2-terminal and cohesive KpnI site at the 5'
end and a BbsI site at the 3' end. The oligonucleotides were
annealed and ligated to GRK-CT fragment using BbsI-cohesive end (His-GRK-CT) and the His-GRK-CT fragment was cloned in pcDNA3 mammalian expression vector in KpnI/EcoRI site.
The structure of the His-GRK-CT construct was confirmed by DNA sequencing.
Stable Transfection--
LD2S cells plated at 50% confluence
were co-transfected with 30 µg each of the mutant G subunit
constructs (Go-PTX, Gi1-PTX, Gi2-PTX, and Gi3-PTX) and 2 µg of pY3 using
the calcium phosphate co-precipitation method (32) and cultured in MEM,
10% FBS containing 400 µg/ml hygromycin-B for 2-3 weeks.
Antibiotic-resistant clones of each transfection were picked (24 clones/transfection) and tested for the expression of corresponding
G proteins using Northern blot analysis.
Transient Transfection--
Ltk cells were plated at 30-40%
confluent on 15-cm plates with MEM + 10% FBS. The cells were
co-transfected with D2S-pcDNA3 using individual G subunit
(Go-PTX, Gi1-PTX, Gi2-PTX, and
Gi3-PTX) mutant constructs (30 or 60 µg) or the
combination of two G proteins (Go/Gi1,
Go/Gi2, Go/Gi3,
Gi1/Gi2, Gi1/Gi3, and
Gi2/Gi3; 30 µg/construct) and pCMV-LacZII (2 µg) using DEAE-dextran (33). Briefly, 1 volume (40 µl) of DNA in
TBS was added dropwise to 2 volumes of DEAE-dextran (10 mg/ml) in TBS
with agitation. The mixture was added dropwise to plates containing 12 ml of MEM + 1% FBS and the plates were incubated for 4 h at
37 °C, 5% CO2. The medium was aspirated and the cells
were incubated in phosphate-buffered saline (136 mM NaCl,
2.68 mM KCl, 0.01 mM
Na2HPO4, 1.78 µM
KH2PO4, pH 7.4) with 10% dimethyl sulfoxide
for 1 min. The plates were rinsed with phosphate-buffered saline and
incubated in MEM + 10% FBS. After 36-48 h, the transfected cells were
assayed for intracellular free calcium and -galactosidase activity.
-Galactosidase Measurement--
A 100-µl portion (10%) of
the transfected cells was resuspended in 100 µl of Reporter Lysis
Buffer (Promega), incubated for 15 min at room temperature, centrifuged
(14,000 rpm, 20 s) and the supernatant recovered. Equal volumes
(30 µl each) of cell extract and substrate (0.3 µM
4-methylumbelliferyl -D-galactoside, 15 mM
Tris, pH 8.8) were mixed and incubated in the dark at 37 °C for 15 min. The reaction was terminated by addition of 50 µl of Stop
solution (300 mM glycine, 15 mM EDTA, pH 11.2).
Samples were transferred to 2 ml of Z buffer (60 mM
Na2HPO4, 40 mM
NaH2PO4, 10 mM KCl, 1 mM MgSO4) and fluorescence was measured at
EX = 350 nm, EM = 450 nm in a
Perkin-Elmer LS-50 spectrofluorometer (Buckinghamshire, United
Kingdom). The transfection efficiencies differed by <10%.
Western Blot Analysis--
Cells (107/10-cm plate)
were harvested and resuspended in 200 µl of RIPA-L buffer (10 mM Tris, pH 8, 1.5 mM MgCl2, 5 mM KCl, 0.5 mM dithiothreitol, 0.5 mM phenylmethylsulfonyl fluoride, 1% Nonidet P-40, 1%
sodium lauryl sulfate, 0.5% sodium deoxycholate, 5 µg/ml leupeptin)
on ice. The cell lysate was then passed through a G-25 needle three
times to shear genomic DNA and incubated on ice. After 30 min, the
lysate was centrifuged (10,000 × g, 10 min, 4 °C)
and the supernatant recovered and assayed for protein content by the
bicinchonic acid protein assay kit (Pierce). Lysates (100 µg/lane)
were electrophoresed on sodium lauryl sulfate-containing 12%
polyacrylamide gels at 100 V, 40 mA for 1 h, blotted on
polyvinylpyrrolidone membranes for 1 h at 250 mA at 4 °C. Blots
were incubated overnight in 5% nonfat dry milk in TBS-T (10 mM
Tris, 150 mM NaCl, pH 8.0, 0.05% Tween 20) at
4 °C. The blots were then incubated for 1 h with primary
antibody, followed by a 30-min incubation with horseradish peroxidase-conjugated secondary antibody at room temperature in TBS-T,
and the peroxidase product was developed using the ECL for Western blot protocol.
Reverse Transcriptase PCR--
Total RNA was extracted from
mouse brain tissue and LD2S cells using guanidium acetate and
reverse-transcribed using SuperScript II RNase H reverse
transcriptase (Life Technologies Inc., Burlington, ON) and random
hexamer primers (50 ng). The cDNAs were subjected to PCR with the
following primer pairs (2 pmol/µl) designed using Primer Select
program (DNASTAR Inc.) to amplify specific fragments of different AC
subtypes (AC I-VI) with the indicated sizes (bp): ACI (444),
5'-CTGCGGGCGTGCGATGAGGA-GTTC and 5'-GCGCACGGGCAGCAGGGCATAG; ACII
(425), 5'-GCTGGCGTCATAGGGGCTCAAAA and 5'-GGCACGCGCAGACACCAAACAGTA; ACIII (418), 5'-GGACGCCCTTCACCCACAACCAA and
5'-AGACCACCGCGCACATCACTACCA; ACIV (454),
5'-CACGGCCGGGATTGCGAGTAGC and 5'-TGCCGAGCCAGGACGAGGAGTGT; ACV (412),
5'-GAGCCCCAATGACCCCAGCCACTA and 5'-CGGGAGCGGCGCAATGATGAACT; ACVI (362),
5'-CCTGGCGGAAGCTGTGTCGGTTAC and 5'-GCGGTCAGTGGCCTTGGGGTTTG. The PCR
reaction was performed with different concentrations of cDNA (0.1, 0.5, and 1 µg/reaction) and repeated at least 2 times. The amplified
DNA fragment was subcloned into pGEM-T Easy vector (Promega) and
sequenced by the Sanger dideoxynucleotide chain termination using
modified T7 DNA polymerase (Pharmacia Biotech Inc.).
cAMP Measurement--
Equivalent numbers of cells were plated in
6-well plates and grown to 70-80% confluence. After rinsing with HBBS
buffer (118 mM NaCl, 4.6 mM KCl, 1.0 mM CaCl2, 10 mM
D-glucose, and 20 mM Hepes, pH 7.2) the cells
were incubated with or without experimental compounds in 1 ml/well of
HBBS + 100 µM isobutylmethylxanthine at 37 °C. After
20 min the media were recovered and stored at 20 °C. Samples were
analyzed by specific radioimmunoassay to detect cAMP (34). Percent
inhibition was calculated using the following formula: % inhibition = 100 [100(D-C)/(S-C)],
where D = cAMP in dopamine-treated cells; C = control or nontreated cells (basal cAMP); S = stimulated cAMP in forskolin- or PGE1-treated cells.
Measurement of [Ca2+]i--
Cells were
grown to 80% confluence, harvested with trypsin/EDTA, resuspended in 1 ml of HBBS with 2 µM Fura-2 AM and incubated at 37 °C
for 45 min with shaking (100 rpm). The cells were washed twice with
HBBS, resuspended in 2 ml of HBBS, and subjected to fluorometric
measurement. The fluorescence ratio of Fura-2 was monitored in a
Perkin-Elmer LS-50 spectrofluorometer at EX = 340/380 nm
and EM = 510 nm. Calibration was done using 0.1% Triton X-100 and 20 mM Tris base to determine
Rmax and 10 mM EGTA (pH > 8)
to obtain Rmin (34) and the fluorescence ratio
was converted to [Ca2+]i based on a
Kd of 227 nM for the Fura 2-calcium complex. Experimental compounds were added directly to cuvette from
100-fold concentrated solutions at the times indicated in the figures.
Statistical Analysis--
The data are presented as mean ± S.E. of at least three independent experiments. The data were analyzed
by repeated measure using ANOVA for each set of experiments. The
percent inhibition data was analyzed with repeated measure using ANOVA
and the data from G-PTX expressing clones were compared with LD2S cell
(wild type) using Bonferroni multiple comparison post-test.
 |
RESULTS |
Expression of Mutant G i/o Subtypes in LD2S
Cells--
In order to investigate the importance of individual G
subtypes in dopamine-mediated responses, PTX-insensitive mutants of G i/o were generated and stably transfected into LD2S
cells (Ltk cells stably transfected with the rat D2S receptor
cDNA). Transfected clones expressing the highest levels of
individual mutant G i/o RNA were identified by Northern
blot analysis (data not shown) and were named RGo,
RGi1, RGi2, and RGi3 for clones
expressing G o-PTX, G i1-PTX,
G i2-PTX, and G i3-PTX, respectively. Cell extracts from clones of interest were subjected to Western blot analysis to assess at the protein level the overexpression of G
proteins (Fig. 1). Wild-type LD2S cells
expressed all four G i/o subunits, although
G o and G i3 appeared to be the most abundant based on densitometric analysis. Comparison of
G o and G i3 expression in each
transfectant to LD2S (wild type) indicates that transfectant cell lines
expressed approximately 2-fold more than the corresponding endogenous
G subunit. This indicates that approximately equal amounts of mutant
and wild-type protein were produced in the transfected cell lines.

View larger version (28K):
[in this window]
[in a new window]
|
Fig. 1.
G i/o
expression in LD2S cells transfected with PTX-insensitive mutant
G i/o constructs. Cell
extracts (100 µg) of LD2S cells (wt) and LD2S cells expressing:
A, G o-PTX (RGo-1,
RGo-21); B, G i1-PTX
(RGi1-5, RGi1-10); C,
G i2-PTX (RGi2-4, RGi2-3); and
D, G i3-PTX (RGi3-2) were
subjected to Western blot analysis as described under "Experimental
Procedures." The blots were probed with: A,
anti-G o; B and C,
anti-G i1-2; and D, anti-G i3
antibodies.
|
|
G i2-PTX Mediates D2S-induced Inhibition of
Forskolin-stimulated cAMP Accumulation--
In LD2S cells, dopamine
did not alter the basal cAMP production (21). Upon addition of
forskolin (10 µM), cAMP levels were increased by 4.5-fold
compared with basal (2.22 ± 0.17 versus 0.50 ± 0.04 pmol/ml) (Fig. 2A).
Dopamine (10 µM) inhibited forskolin-stimulated cAMP
accumulation in these cells by 84.5 ± 12.2% (n = 5), an action that was mimicked by apomorphine (1 µM, not
shown) and was largely reversed by pretreatment with PTX (Fig.
2A), indicating the involvement of Gi/o
proteins. PGE1 has been shown to induce a
concentration-dependent increase in cAMP production
indicating the presence of endogenous Gs-coupled
PGE1 receptors (30). In LD2S cells, PGE1 (1 µM) increased cAMP accumulation by 7-8-fold basal cAMP
(1.65 ± 0.25 versus 0.196 ± 0.002 pmol/ml) (Fig.
2B). The greater effect of PGE1 may be related
to the specific isoforms of adenylyl cyclase present in LD2S cells.
Activation of D2S receptors with apomorphine (1 µM) inhibited PGE1-induced cAMP production by 66.3 ± 7.3% (Fig. 2B) and this action of apomorphine was largely
reversed after PTX treatment, implicating G i/o
proteins.

View larger version (27K):
[in this window]
[in a new window]
|
Fig. 2.
PTX-sensitive inhibition of forskolin and
PGE1-induced cAMP accumulation in LD2S cells.
A, inhibition of forskolin action. B, inhibition
of PGE1 action. Cells were treated with or without PTX (50 ng/ml, 16 h) and incubated for 20 min with: A, no drugs
(Control), forskolin (10 µM), dopamine (10 µM) or both; or B, no drugs
(Control), PGE1 (1 µM),
apomorphine (10 µM, Apo), or both. The level of cAMP was
measured as described under "Experimental Procedures." The data are
expressed as mean ± S.E. of triplicate determinations.
|
|
The PTX sensitivity of dopamine-mediated inhibition of
forskolin-induced cAMP production was examined in wild-type LD2S and stable clones expressing the mutant G subunits. Dopamine inhibited forskolin-stimulated cAMP accumulation in all clones expressing mutant
G i/o proteins, as observed in LD2S cells (wild type). However, PTX blocked dopamine action in all clones except for those
clones which express the mutant Gi2-PTX. In multiple
experiments, the percent inhibition by dopamine of forskolin-stimulated
cAMP accumulation was unaltered by PTX in only RGi2-3 and
RGi2-4 clones, whereas in other clones a significant
attenuation of dopamine action by PTX was observed (Fig.
3). These results indicate that the
PTX-insensitive mutant of G i2 is functional and that
G i2 is the only subunit required for D2S-mediated
inhibition of forskolin-induced cAMP production in LD2S cells.

View larger version (39K):
[in this window]
[in a new window]
|
Fig. 3.
PTX-resistant inhibition of forskolin-induced
cAMP accumulation in LD2S cells expressing the
G i2 mutant. Dopamine D2S
receptor-induced inhibition of cAMP accumulation in LD2S cells
expressing PTX-insensitive G i/o mutants was calculated
as: % inhibition = 100 [100(D-C)/(S-C)], where D = cAMP level in dopamine/forskolin-treated cells; C, cAMP
level in control, nontreated cells; S, cAMP level in cells
stimulated by forskolin. Percent inhibition of dopamine action with or
without PTX treatment from four independent experiments
(n = 4) are summarized. The data are expressed as
mean ± S.E., and were analyzed by repeated measures using ANOVA
with Bonferroni multiple comparison. In all clones, basal and
forskolin-induced cAMP levels were not significantly different from
levels in non-transfected LD2S cells. LD2S cells, parent cell line;
RGo-1, LD2S cells expressing Go-PTX;
RGi1-5 and RGi1-10, expressing
Gi1-PTX; RGi2-3 and RGi2-4,
expressing Gi2-PTX; RGi3-2, expressing
Gi3-PTX.
|
|
G i3-PTX Mediates D2S Inhibition of
PGE1-stimulated cAMP Production--
The ability of
D2S receptor activation to inhibit Gs-coupled stimulation
of cAMP accumulation was tested in the LD2S clones expressing
PTX-insensitive G proteins. In these clones PGE1 (1 µM) induced a 7-8-fold increase in basal cAMP and
apomorphine inhibited PGE1-stimulated cAMP production by
60-70%, comparable to wild-type LD2S cells. Upon pretreatment with
PTX, apomorphine-mediated inhibition was completely reversed in
RGo, RGi1, and RGi2 clones. In
contrast, PTX treatment of the RGi3-2 clone did not block
apomorphine-mediated inhibition of the PGE1 response. In
multiple experiments, clone RGi3-2 retained significantly
higher dopamine inhibitory activity following PTX treatment than any of
the other clones (Fig. 4). Thus, the
inhibitory action of the D2S receptor on Gs-coupled enhancement of cAMP is mediated through the G i3 subunit,
rather than the G i2 subunit as observed for
forskolin-induced cAMP accumulation. These results show that the D2S
receptor utilizes distinct G i subtypes to inhibit
forskolin- or Gs-stimulated adenylyl cyclase activity.

View larger version (28K):
[in this window]
[in a new window]
|
Fig. 4.
PTX-resistant inhibition of
PGE1-induced cAMP accumulation in LD2S cells expressing the
G i3 mutant. Dopamine D2S
receptor-induced inhibition of cAMP accumulation in LD2S cells
expressing PTX-insensitive G i/o mutants was calculated
as: % inhibition = 100 [100(D-C)/(S-C)], where D, cAMP
level in apomorphine/PGE1-treated cells; C, cAMP
level in control, nontreated cells; S, cAMP level in cells
stimulated by PGE1. Percent inhibition of apomorphine
effect with or without PTX treatment from four independent experiments
(n = 4) is summarized. The data are expressed as
mean ± S.E., and were analyzed by repeated measures using ANOVA
with Bonferroni multiple comparison. LD2S cells, parent cell line;
RGo-1 and RGo-21, LD2S cells expressing
Go-PTX; RGi1-5 and RGi1-10,
expressing Gi1-PTX; RGi2-3 and
RGi2-4, expressing Gi2-PTX;
RGi3-2, expressing Gi3-PTX. In these clones,
the PGE1-induced cAMP level was not significantly different
from non-transfected LD2S cells.
|
|
Adenylyl Cyclase Expression in LD2S Cells--
To further
investigate the role of AC expression in LD2S cells, we performed
semi-quantitative reverse transcriptase-PCR to determine the relative
expression of AC subtypes I-VI, since their regulation has been well
characterized compare with other subtypes (VII-X) (21, 35-37). The PCR
was performed with different concentrations of cDNA (0.1, 0.5, and
1.0 µg/reaction) and repeated at least twice for each concentration.
Each PCR reaction amplified a single, specific product with the
predicted sized for each AC subtypes, and the sequence was confirmed by
sequencing the subcloned fragment. The specificity of the primers used
was not altered with change in cDNA concentration, but the
intensity of the product increased with concentration (Table
I). Mouse brain RNA was used as positive control and was found to express all the subtypes of AC (data not
shown). In LD2S cells, RNA for AC I and VI was expressed more abundantly than AC III, AC IV, and AC II (ACI = ACVI > ACIII > ACIV > ACII) and AC V RNA was not detected in these
cells (Table I). These results indicate that LD2S cells express AC
subtypes at different levels, which may direct the specificity of
signaling through AC in these cells.
Gi/o Protein Subtypes Involved in Calcium Mobilization
in LD2S Cells--
In LD2S cells, the D2S receptor couples to PI
turnover to induce mobilization of calcium from ionomycin-sensitive
intracellular stores (8). In LD2S cells dopamine induced a 2-2.5-fold
increase in [Ca2+]i (Fig.
5) which was blocked by the D2 receptor
antagonist spiperone and was not observed in D2 receptor-negative Ltk
cells (data not shown), indicating that this effect is mediated by the D2S receptor. The increase in [Ca2+]i induced by
dopamine was completely inhibited by PTX pretreatment, suggesting
mediation via Gi/o proteins.

View larger version (19K):
[in this window]
[in a new window]
|
Fig. 5.
PTX blocks D2S-induced calcium mobilization
in LD2S cells expressing PTX-insensitive single
G i/o-PTX mutants. Ltk cells
expressing D2S receptor (LD2S, A) and LD2S cells expressing
Go-PTX (RGo-1, B),
Gi1-PTX (RGi1-10, C),
Gi2-PTX (RGi2-4, D), and
Gi3-PTX (RGi3-2, E) mutant G
proteins were treated without (solid line) or with
(dash line) PTX (50 ng/ml, 16 h) and changes in
intracellular [Ca2+]i in response to dopamine (10 µM) or ATP (10 µM) were measured.
|
|
Each of the clones expressing mutant G proteins responded to dopamine
with a 2-2.5-fold increase in [Ca2+]i (Fig.
6). Following pretreatment with PTX, none
of the mutant G protein transfectants exhibited a D2S-mediated calcium response (Fig. 6). In order to test whether more than one G protein could rescue the calcium response, Ltk cells were transfected with
different pairs of the four G-PTX mutant constructs along with D2S
receptor and assayed for [Ca2+]i. In all sets
dopamine increased [Ca2+]i by 1.6-fold (Fig. 6),
similar to that in LD2S cells (33). This indicates that the Ltk cells
express sufficient levels of transiently transfected cDNAs to
mediate a full functional response. However, after PTX treatment, none
of the mutant combinations rescued the dopamine response (Fig. 6). In
these experiments, the increase of [Ca2+]i
induced by 100 µM ATP served as a positive control for
cellular responsiveness and was unchanged following PTX pretreatment, since the ATP response is mediated through a Gq-coupled
P2-purinergic receptor. Similarly, in LD2S cells transiently
transfected with pairs of G-PTX plasmids, PTX pretreatment blocked
completely the dopamine-mediated calcium responses for all combinations
(data not shown). The dopamine response was also tested in another
series of transfections in which a double dose (60 µg) of single
G-PTX plasmid was transiently transfected in LD2S cells. As for the stable LD2S clones (see above), the single G-PTX did not mediate the
D2S calcium response in these transfections (data not shown). The
protein level of the G i1 and G i2 was
increased by more than 2-fold in Ltk cells transiently transfected by
both of these proteins (Fig. 6, inset). Based on these
results, none of the G i/o subunits, alone or in
combination, mediated calcium mobilization induced by dopamine in LD2S
cells.

View larger version (18K):
[in this window]
[in a new window]
|
Fig. 6.
Calcium mobilization in LD2S cells expressing
pairs of G i/o-PTX mutants.
Ltk cells were transiently co-transfected with pairs of
G i/o-PTX mutant proteins and D2S receptor. The
arrows indicate addition of 10 µM dopamine and
10 µM ATP to cells pretreated with PTX (50 ng/ml, 16 h). Cells were transfected with: A,
Go-PTX/Gi1-PTX,
Go-PTX/Gi2-PTX, or
Go-PTX/Gi3-PTX; B,
Gi1-PTX/Gi2-PTX,
Gi1-PTX/Gi3-PTX, or
Gi1-PTX/Gi3-PTX. Inset, Western blot
an- alysis of G i1-2 protein expression. Ltk cells
were transiently transfected with Gi1-PTX,
Gi2-PTX, or Gi1-PTX/Gi2-PTX. Cell
extracts (200 µg/lane) from non-transfected (Ltk ) and transfected
cells were subjected to SDS-polyacrylamide gel electrophoresis and the
G i1-2 protein was detected using G i1-2
antibody.
|
|
G Subunits Mediate D2S-induced Calcium Mobilization in LD2S
Cells--
In order to investigate the role of G subunit of
Gi/Go proteins in D2S-mediated increase in
[Ca2+]i, LD2S cells were stably transfected with
the His6-tagged carboxyl-terminal of GRK-2 (GRK-CT), which
contains a pleckstrin homology domain that is known to bind and
inactivate free G subunits (38). The relative level of His-GRK-CT
protein in clones expressing His-GRK-CT was determined by Western blot
using an antibody against the His epitope (Fig.
7, inset). As shown in Fig. 7,
the dopamine-induced increase in [Ca2+]i was
reduced by 80% compared with LD2S cells in the clone expressing
His-GRK-CT (RD-21). In contrast, dopamine mediated inhibition of
forskolin- and PGE1-stimulated cAMP accumulation was not
significantly different between LD2S and RD-21 cells (data not shown).
In another clone expressing lower levels (20%) of His-GRK-CT than
RD-21, the increase in [Ca2+]i induced by
dopamine was reduced by only 30% (data not shown). These results
suggest that D2S-mediated stimulation of [Ca2+]i
is mediated by G subunits and is more dependent on G
subunits than particular G subunits.

View larger version (14K):
[in this window]
[in a new window]
|
Fig. 7.
Inhibition of calcium mobilization in LD2S
cells expressing His-GRK-CT protein. Change in
[Ca2+]i was measured in LD2S cells (wt) and LD2S
cells stably transfected with His-GRK-CT protein (RD-21). The
arrows indicate the addition of dopamine (10 µM) or ATP (10 µM). Inset,
Western blot analysis of LD2S and RD-21 cells. Cell extracts (100 µg/lane) from LD2S and RD-21 cells were subjected to
SDS-polyacrylamide gel electrophoresis and recombinent protein were
detected using an anti-RGS-His6 antibody. The
arrow indicates the 24-kDa recombinant His-GRK-CT
protein.
|
|
 |
DISCUSSION |
State-dependent Modulation of Adenylyl Cyclase via
Distinct G Proteins--
The dopamine-D2S receptor is coupled to
inhibition of adenylyl cyclase in a wide variety of cell types (13, 14,
39-41). Indeed, inhibition of adenylyl cyclase by receptors that
couple to G i/o appears to be a ubiquitous pathway (2, 5,
6). In intact cells, adenylyl cyclase can exist in at least three states: basal, forskolin-stimulated, or G s-stimulated
(36). In Ltk cells, the D2S receptor inhibits cAMP production
stimulated by either forskolin or PGE1, but does not
inhibit the basal level of cAMP level (Fig. 2, (21)). By contrast, in
pituitary cells the D2S receptor inhibits all three states,
i.e. basal, forskolin-stimulated, and vasoactive intestinal
peptide-stimulated cAMP accumulation (13, 14, 39). The basal levels of
cAMP are at least 5-fold lower in Ltk fibroblast cells as compared
with GH4C1 pituitary cells (34), and perhaps it is already at a minimum
level. Furthermore, our results show that Ltk cells have an
undetectable level of ACV, and ACII and IV are weakly expressed (Table
I). This could explain why D2S receptor activation induced no change in
basal cAMP production in LD2S cells. For example, the dopamine-D3
receptor appears to couple exclusively to ACV (42).
To address the G protein specificity of D2S receptor signaling, LD2S
cells were transfected stably with individual PTX-insensitive mutants
of G i/o subtypes and treated with PTX to inactivate
endogenous Gi/o proteins. When stimulated by forskolin,
inhibition of cAMP accumulation by D2S receptor activation is mediated
exclusively through the G i2 subtype (Fig. 3). This
agrees with findings in pituitary cells. Using antibodies to
G i/o subunits, Izenwasser and Cote (43) have reported
that inhibition of cAMP accumulation by D2 receptors in pituitary tumor
cells utilizes G i1 and/or G i2, since
their antibody detects both subtypes equally. Furthermore, using
PTX-insensitive mutants, Senogles (39) has shown that in GH4C1 cells
expressing D2S receptor, D2S inhibition of forskolin-induced adenylyl
cyclase is routed through G i2. Our results indicate that
in Ltk fibroblast cells, the D2S receptor couples preferentially to
the G i2 subtype to inhibit activation of adenylyl
cyclase by forskolin.
On the other hand, inhibition of PGE1-stimulated cAMP
accumulation, a G s-coupled AC pathway, by D2S receptor
activation was mediated through G i3 in the LD2S cells,
and not by G i2 as for forskolin (Fig. 4). This indicates
that D2S receptor utilizes distinct G i proteins to
mediate inhibition of AC depending on the pathway of activation of AC.
This is consistent with previous findings in GH4C1 pituitary cells, in
which antisense depletion of G i2 only marginally reduced
D2S-mediated inhibition of vasoactive intestinal peptide-stimulated
cAMP levels (Gs-coupled), but completely blocked
D2S-mediated inhibition of basal cAMP level (14). Interestingly, the
coupling of other receptor subtypes (e.g. somatostatin or muscarinic-M4) to inhibition of vasoactive intestinal peptide-induced cAMP was completely blocked by depletion of G i2. Thus,
G i2 plays an important role in D2S coupling to both
basal and forskolin-induced AC, but not in coupling to
Gs-stimulated AC in both transfected GH4C1 and Ltk cells.
In contrast, G i3 mediates inhibition of Gs-stimulated AC activity in LD2S cells. Taken together,
these findings provide evidence for a precise regulation of AC activity that is dependent on specific interactions between different activation states of AC and distinct Gai subtypes.
One explanation for the state-dependent specificity of
inhibition of AC by G i is that different subtypes of AC
are recruited for forskolin- versus Gs-mediated
activation pathways. Sutkowski and co-workers (37) have shown that
G s activates ACII more efficaciously than ACI, ACV, or
ACVI, whereas forskolin preferentially activates ACI over ACII, ACV, or
ACVI. Furthermore, it has been shown that G i1 inhibits
ACV more efficiently than ACI (44). By this interpretation, our results
would be consistent with G i2 having greater activity to
inhibit ACI, and G i3 inhibiting ACII. However, specific
interactions between different G i and AC subtypes have
not been reported. Another possibility is the
state-dependent modulation of individual AC subtypes by
distinct G i proteins. When expressed in Sf9
cells, G i1 did not inhibit G s-mediated stimulation of ACI (44). However, when ACI was stimulated by calmodulin
or forskolin, G i1 mediated inhibition of ACI. This indicates that the extent of inhibition of a particular AC subtype (ACI) by G i1 is dependent on the activation pathway.
Following D2S receptor activation, G i2 may also
preferentially inhibit the forskolin-activated state in AC subtypes
that predominate in Ltk cells, whereas G i3
preferentially inhibits the Gs-activated state. Distinct
conformational changes in AC upon interaction with forskolin or
Gs could explain the selective inhibition of G i subtypes. The crystal structure of the catalytic
domain of ACII reveals that forskolin binds to two symetric sites to
prevent hydration and enhance dimerization of the C1-C2 domains (45). The binding site for G i/o has not been determined, but
it may bind to the a2/a3 region of C1a, which is close to the catalytic domain, on the opposite site of the G s site (46). In
this case, G i/o protein could alter the preferable
alignment by blocking the "counterclockwise" rotation of C1 (47).
In the forskolin-bound conformation, AC may preferentially recognize
specific G i/o protein subtypes distinct from those
recognized by the Gs-bound conformation of AC. Further
structural studies may reveal the molecular basis for
state-dependent Gi protein selectivity in
inhibition of AC.
G and Calcium Mobilization--
In LD2S cells transfected
with single or pairs of PTX-insensitive Gi/o proteins
cDNAs to yield a greater than 2-fold protein expression, dopamine
failed to induce calcium mobilization after PTX treatment, suggesting
that G subunits plays a minor or secondary role in this pathway. On
the other hand, inhibition of G signaling in LD2S cells
expressing GRK-CT correlated with an inhibition of D2S-induced calcium
mobilization, indicating that this process is mediated through G
subunits rather than the G subunit. This result is consistent with
the fact that G subunits of Gi/o proteins can
activate PLC- 2 and PLC- 3 (5). Recent results indicate that the
D2S receptor increases calcium mobilization in LD2S cells via
activation of PLC- 2 (33), implicating G -signaling in the
calcium mobilization pathway. The lack of activity of individual G
subunits to mediate calcium mobilization was partly unexpected. In
NG108-15 neuroblastoma cells, PTX-insensitive G o did
mediate coupling to inhibition of calcium channel activation (25), a G -mediated response (5). It has been estimated that a 10-fold higher amount of G is required to activate PLC- 2 in
vitro than is required for G i-mediated activation
of AC (48). It may be that multiple Gi/Go
subtypes, rather than a single subtype, must be activated to release
sufficient G subunits to induce calcium mobilization in LD2S cells.
Conclusion--
The dopamine D2S receptor couples to
G i2 to inhibit forskolin-induced cAMP production. On the
other hand, when AC is activated by a Gs-coupled receptor
(PGE1 receptor), dopamine-induced inhibition is mediated by
G i3. Furthermore, D2S-induced increase in
[Ca2+]i in LD2S cells is not dependent on any
particular G i/o subtype, but is dependent on
mobilization of G subunit. Therefore, the dopamine D2S receptor
utilizes different Gi/o protein subunits to regulate a
diversity of effector functions within the cell. Moreover, this study
shows that the PTX-insensitive Gi/o mutants provide useful
tools for the dissection of G protein coupling to receptors.
 |
ACKNOWLEDGEMENTS |
We thank Christine Forget for excellent
technical assistance with cAMP assays. We also acknowledge the helpful
editorial comments of Dr. Maribeth Lazzaro.
 |
FOOTNOTES |
*
This work was supported in part by grants from the Medical
Research Council of Canada (to P. R. A.) and National Cancer
Institute of Canada (to P. R. A).The costs of publication of this
article were defrayed in part by the
payment of page charges. The article must therefore be hereby marked
"advertisement" in
accordance with 18 U.S.C. Section
1734 solely to indicate this fact.
§
Supported by the Ministry of Health of Iran and Schizophrenia
Society of Canada.
Novartis/MRC/Michael Smith Chair in Neurosciences. To whom
correspondence should be addressed: Neuroscience Research Institute, 451 Smyth Rd., Rm. 2464, Ottawa K1H 8M5, Canada. Tel.: 613-562-5800 (ext. 8307); Fax: 613-562-5403; E-mail: palbert{at}uottawa.ca.
 |
ABBREVIATIONS |
The abbreviations used are:
G protein, guanine
nucleotide-binding protein;
AC, adenylyl cyclase;
[Ca2+]i, intracellular calcium
concentration;
FBS, fetal bovine serum;
PTX, pertussis toxin;
G-PTX, G
protein insensitive to PTX;
HBBS, Hepes-buffered balanced salt
solution;
MEM, minimum Eagles's medium;
PLC, phospholipase C;
PCR, polymerase chain reaction;
PGE1, prostaglandin
E1.
 |
REFERENCES |
-
Neer, E. J.
(1995)
Cell
80,
249-257[CrossRef][Medline]
[Order article via Infotrieve]
-
Bourne, H. R.
(1997)
Curr. Opin. Cell Biol.
9,
134-142[CrossRef][Medline]
[Order article via Infotrieve]
-
Raymond, J. R.
(1995)
Am. J. Physiol.
38,
F141-F158
-
Birnbaumer, L.
(1992)
Cell
71,
1069-1072[CrossRef][Medline]
[Order article via Infotrieve]
-
Clapham, D. E.,
and Neer, E. J.
(1997)
Annu. Rev. Pharmacol. Toxicol.
37,
167-203[CrossRef][Medline]
[Order article via Infotrieve]
-
Gudermann, T.,
Kalkbrenner, F.,
and Schultz, G.
(1996)
Annu. Rev. Pharmacol. Toxicol.
36,
429-459[Medline]
[Order article via Infotrieve]
-
Civelli, O.,
Bunzow, J. R.,
and Grandy, D. K.
(1993)
Annu. Rev. Pharmacol. Toxicol.
33,
281-307[CrossRef][Medline]
[Order article via Infotrieve]
-
Albert, P. R.
(1994)
Vitam. Horm.
48,
59-109[Medline]
[Order article via Infotrieve]
-
Castellano, M. A.,
Liu, L. X.,
Monsma, F. J.,
Sibley, D. R.,
Kapatos, G.,
and Chiodo, L. A.
(1993)
Mol. Pharmacol.
44,
649-656[Abstract]
-
Einhorn, L. C.,
Gregerson, K. A.,
and Oxford, G. S.
(1991)
J. Neurosci.
11,
3727-3737[Abstract]
-
Lledo, P. M.,
Homburger, V.,
Bockaert, J.,
and Vincent, J. D.
(1992)
Neuron
8,
455-463[CrossRef][Medline]
[Order article via Infotrieve]
-
Memo, M.,
Pizzi, M.,
Belloni, M.,
Benarese, M.,
and Spano, P.
(1992)
J. Neurochem.
59,
1829-1835[CrossRef][Medline]
[Order article via Infotrieve]
-
Albert, P. R.,
Neve, K. A.,
Bunzow, J. R.,
and Civelli, O.
(1990)
J. Biol. Chem.
265,
2098-2104[Abstract/Free Full Text]
-
Liu, Y. F.,
Jakobs, K. H.,
Rasenick, M. M.,
and Albert, P. R.
(1994)
J. Biol. Chem.
269,
13880-13886[Abstract/Free Full Text]
-
Senogles, S. E.
(1994)
Endocrinology
134,
783-789[Abstract/Free Full Text]
-
Vallar, L.,
Muca, C.,
Magni, M.,
Albert, P.,
Bunzow, J.,
Meldolesi, J.,
and Civelli, O.
(1990)
J. Biol. Chem.
265,
10320-10326[Abstract/Free Full Text]
-
Lew, A. M.,
and Elsholtz, H. P.
(1995)
J. Biol. Chem.
270,
7156-7160[Abstract/Free Full Text]
-
Elsholtz, H. P.,
Lew, A. M.,
Albert, P. R.,
and Sundmark, V. C.
(1991)
J. Biol. Chem.
266,
22919-22925[Abstract/Free Full Text]
-
Huff, R. M.,
and Lajiness, M. E.
(1994)
J. Cell. Biochem.
18B,
220
-
Lajiness, M. E.,
Chio, C. L.,
and Huff, R. M.
(1993)
J. Pharmacol. Exp. Therap.
267,
1573-1581[Abstract/Free Full Text]
-
Liu, Y. F.,
Civelli, O.,
Grandy, D. K.,
and Albert, P. R.
(1992)
J. Neurochem.
59,
2311-2317[Medline]
[Order article via Infotrieve]
-
Hayes, G.,
Biden, T. J.,
Selbie, L. A.,
and Shine, J.
(1992)
Mol. Endocrinol.
6,
920-926[Abstract/Free Full Text]
-
Tang, L.,
Todd, R. D.,
Heller, A.,
and O'Malley, K. L.
(1994)
J. Pharmacol. Exp. Therap.
268,
495-502[Abstract/Free Full Text]
-
Yamane, H. K.,
and Fung, B. K.
(1993)
Annu. Rev. Pharmacol. Toxicol.
33,
201-241[CrossRef][Medline]
[Order article via Infotrieve]
-
Taussig, R.,
Sanchez, S.,
RIfo, M.,
Gilma, A. G.,
and Belardeti, F.
(1992)
Neuron
8,
799-809[CrossRef][Medline]
[Order article via Infotrieve]
-
Chuprun, J. K.,
Raymond, J. R.,
and Blackshear, P. J.
(1997)
J. Biol. Chem.
272,
773-781[Abstract/Free Full Text]
-
Ghahremani, M. H.,
and Albert, P. R.
(1995)
Proceeding of the Society for Neuroscience, Vol. 21, p. 1863, Society for Neuroscience, San Diego
-
Hunt, T. W.,
Carroll, R. C.,
and Peralta, E. G.
(1994)
J. Biol. Chem.
269,
29565-29570[Abstract/Free Full Text]
-
Jones, D. T.,
and Reed, R. R.
(1987)
J. Biol. Chem.
262,
14241-14249[Abstract/Free Full Text]
-
Lembo, P. M. C.,
Ghahremani, M. H.,
and Albert, P. R.
(1999)
Mol. Endocrinol.
13,
138-147[Abstract/Free Full Text]
-
Kozak, M.
(1986)
Cell
44,
383-292
-
Sambrook, J.,
Fritsch, E. F.,
and Maniatis, T.
(1989)
Molecular Cloning: A Laboratory Manual, 2nd Ed., Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY
-
Morris, S. J.,
Kriz, R.,
and Albert, P. R.
(1996)
Proceeding of the Society for Neuroscience, Vol. 22, Society for Neuroscience, Washington, D. C.
-
Liu, Y. F.,
and Albert, P. R.
(1991)
J. Biol. Chem.
266,
23689-23697[Abstract/Free Full Text]
-
Nevo, I.,
Avidorreiss, T.,
Levy, R.,
Bayewitch, M.,
Heldman, E.,
and Vogel, Z.
(1998)
Mol. Pharmacol.
54,
419-426[Abstract/Free Full Text]
-
Sunahara, R. K.,
Dessauer, C. W.,
and Gilman, A. G.
(1996)
Annu. Rev. Pharmacol. Toxicol.
36,
461-480[CrossRef][Medline]
[Order article via Infotrieve]
-
Sutkowski, E. M.,
Tang, W. J.,
Broome, C. W.,
Robbins, J. D.,
and Seamon, K. B.
(1994)
Biochemistry
33,
12852-12859[CrossRef][Medline]
[Order article via Infotrieve]
-
Koch, W. J.,
Hawes, B. E.,
Inglese, J.,
Luttrell, L. M.,
and Lefkowitz, R. J.
(1994)
J. Biol. Chem.
269,
6193-6197[Abstract/Free Full Text]
-
Senogles, S. E.
(1994)
J. Biol. Chem.
269,
23120-23127[Abstract/Free Full Text]
-
Montmayeur, J. P.,
Guiramand, J.,
and Borrelli, E.
(1993)
Mol. Endocrinol.
7,
161-170[Abstract/Free Full Text]
-
Malek, D.,
Munch, G.,
and Palm, D.
(1993)
FEBS Lett.
325,
215-219[CrossRef][Medline]
[Order article via Infotrieve]
-
Robinson, S. W.,
and Caron, M. G.
(1997)
Mol. Pharmacol.
52,
508-514[Abstract/Free Full Text]
-
Izenwasser, S.,
and Cote, T. E.
(1995)
J. Neurochem.
64,
1614-1621[Medline]
[Order article via Infotrieve]
-
Taussig, R.,
Iniguez-Lluhi, J. A.,
and Gilman, A. G.
(1993)
Science
261,
218-221[Abstract/Free Full Text]
-
Zhang, G.,
Liu, Y.,
Ruoho, A. E.,
and Hurley, J. H.
(1997)
Nature
386,
247-253[CrossRef][Medline]
[Order article via Infotrieve]
-
Yan, S. Z.,
Hahn, D.,
Huang, Z. H.,
and Tang, W. J.
(1996)
J. Biol. Chem.
271,
10941-10945[Abstract/Free Full Text]
-
Tang, W. J.,
and Hurley, J. H.
(1998)
Mol. Pharmacol.
54,
231-240[Free Full Text]
-
Camps, M.,
Hou, C.,
Sidiropoulos, D.,
Stock, J. B.,
and Jakobs, K. H.
(1992)
Eur. J. Biochem.
206,
23066-23075
Copyright © 1999 by The American Society for Biochemistry and Molecular Biology, Inc.

CiteULike Complore Connotea Del.icio.us Digg Reddit Technorati What's this?
This article has been cited by other articles:

|
 |

|
 |
 
J. R. Lane, B. Powney, A. Wise, S. Rees, and G. Milligan
G Protein Coupling and Ligand Selectivity of the D2L and D3 Dopamine Receptors
J. Pharmacol. Exp. Ther.,
April 1, 2008;
325(1):
319 - 330.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. Rogaeva, X.-M. Ou, H. Jafar-Nejad, S. Lemonde, and P. R. Albert
Differential Repression by Freud-1/CC2D1A at a Polymorphic Site in the Dopamine-D2 Receptor Gene
J. Biol. Chem.,
July 20, 2007;
282(29):
20897 - 20905.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. R. Lane, B. Powney, A. Wise, S. Rees, and G. Milligan
Protean Agonism at the Dopamine D2 Receptor: (S)-3-(3-Hydroxyphenyl)-N-propylpiperidine Is an Agonist for Activation of Go1 but an Antagonist/Inverse Agonist for Gi1,Gi2, and Gi3
Mol. Pharmacol.,
May 1, 2007;
71(5):
1349 - 1359.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
H. Mao, Q. Zhao, M. Daigle, M. H. Ghahremani, P. Chidiac, and P. R. Albert
RGS17/RGSZ2, a Novel Regulator of Gi/o, Gz, and Gq Signaling
J. Biol. Chem.,
June 18, 2004;
279(25):
26314 - 26322.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. E. Senogles, T. L. Heimert, E. R. Odife, and M. W. Quasney
A Region of the Third Intracellular Loop of the Short Form of the D2 Dopamine Receptor Dictates Gi Coupling Specificity
J. Biol. Chem.,
January 16, 2004;
279(3):
1601 - 1606.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
T. M. Cabrera-Vera, J. Vanhauwe, T. O. Thomas, M. Medkova, A. Preininger, M. R. Mazzoni, and H. E. Hamm
Insights into G Protein Structure, Function, and Regulation
Endocr. Rev.,
December 1, 2003;
24(6):
765 - 781.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
X.-M. Ou, S. Lemonde, H. Jafar-Nejad, C. D. Bown, A. Goto, A. Rogaeva, and P. R. Albert
Freud-1: A Neuronal Calcium-Regulated Repressor of the 5-HT1A Receptor Gene
J. Neurosci.,
August 13, 2003;
23(19):
7415 - 7425.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
G. Liu, M. H. Ghahremani, B. Banihashemi, and P. R. Albert
Diacylglycerol and ceramide formation induced by dopamine D2S receptors via Gbeta gamma -subunits in Balb/c-3T3 cells
Am J Physiol Cell Physiol,
March 1, 2003;
284(3):
C640 - C648.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
G. Liu, L. Robillard, B. Banihashemi, and P. R. Albert
Growth Hormone-induced Diacylglycerol and Ceramide Formation via Galpha i3 and Gbeta gamma in GH4 Pituitary Cells. POTENTIATION BY DOPAMINE-D2 RECEPTOR ACTIVATION
J. Biol. Chem.,
December 6, 2002;
277(50):
48427 - 48433.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
B. Banihashemi and P. R. Albert
Dopamine-D2S Receptor Inhibition of Calcium Influx, Adenylyl Cyclase, and Mitogen-Activated Protein Kinase in Pituitary Cells: Distinct G{alpha} and G{beta}{gamma} Requirements
Mol. Endocrinol.,
October 1, 2002;
16(10):
2393 - 2404.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
P. R. Albert
G Protein Preferences for Dopamine D2 Inhibition of Prolactin Secretion and DNA Synthesis in GH4 Pituitary Cells
Mol. Endocrinol.,
August 1, 2002;
16(8):
1903 - 1911.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
P. R. Albert
Editorial: Dopamine-D2-Mediated Inhibition of TRH-Induced PLC Activation in Pituitary Cells--Direct or Indirect?
Endocrinology,
March 1, 2002;
143(3):
744 - 746.
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
K. L. J. Evans, J. D. Cropper, K. A. Berg, and W. P. Clarke
Mechanisms of Regulation of Agonist Efficacy at the 5-HT1A Receptor by Phospholipid-Derived Signaling Components
J. Pharmacol. Exp. Ther.,
June 1, 2001;
297(3):
1025 - 1035.
[Abstract]
[Full Text]
|
 |
|

|
 |

|
 |
 
P. J. Pauwels, F. Finana, S. Tardif, T. Wurch, and F. C. Colpaert
Dynamic Dopamine-Antagonist Interactions at Recombinant Human Dopamine D2short Receptor: Dopamine-Bound versus Antagonist-Bound Receptor States
J. Pharmacol. Exp. Ther.,
April 1, 2001;
297(1):
133 - 140.
[Abstract]
[Full Text]
|
 |
|

|
 |

|
 |
 
B. Y. Ho, A. Stadnicka, P. L. Prather, A. R. Buckley, L. L. Current, Z. J. Bosnjak, and W.-M. Kwok
Cannabinoid CB1 Receptor-Mediated Inhibition of Prolactin Release and Signaling Mechanisms in GH4C1 Cells
Endocrinology,
May 1, 2000;
141(5):
1675 - 1685.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. H. Ghahremani, C. Forget, and P. R. Albert
Distinct Roles for Galpha i2 and Gbeta gamma in Signaling to DNA Synthesis and Galpha i3 in Cellular Transformation by Dopamine D2S Receptor Activation in BALB/c 3T3 Cells
Mol. Cell. Biol.,
March 1, 2000;
20(5):
1497 - 1506.
[Abstract]
[Full Text]
|
 |
|

|
 |

|
 |
 
P. R. Albert, N. Sajedi, S. Lemonde, and M. H. Ghahremani
Constitutive Gi2-dependent Activation of Adenylyl Cyclase Type II by the 5-HT1A Receptor. INHIBITION BY ANXIOLYTIC PARTIAL AGONISTS
J. Biol. Chem.,
December 10, 1999;
274(50):
35469 - 35474.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
Y. F. Liu, M. H. Ghahremani, M. M. Rasenick, K. H. Jakobs, and P. R. Albert
Stimulation of cAMP Synthesis by Gi-coupled Receptors upon Ablation of Distinct Galpha i Protein Expression. Gi SUBTYPE SPECIFICITY OF THE 5-HT1A RECEPTOR
J. Biol. Chem.,
June 4, 1999;
274(23):
16444 - 16450.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
X.-M. Ou, J. M. Storring, N. Kushwaha, and P. R. Albert
Heterodimerization of Mineralocorticoid and Glucocorticoid Receptors at a Novel Negative Response Element of the 5-HT1A Receptor Gene
J. Biol. Chem.,
April 20, 2001;
276(17):
14299 - 14307.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
Y. Cordeaux, S. A. Nickolls, L. A. Flood, S. G. Graber, and P. G. Strange
Agonist Regulation of D2 Dopamine Receptor/G Protein Interaction. EVIDENCE FOR AGONIST SELECTION OF G PROTEIN SUBTYPE
J. Biol. Chem.,
July 27, 2001;
276(31):
28667 - 28675.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. L. Leaney and A. Tinker
The role of members of the pertussis toxin-sensitive family of G proteins in coupling receptors to the activation of the G protein-gated inwardly rectifying potassium channel
PNAS,
May 9, 2000;
97(10):
5651 - 5656.
[Abstract]
[Full Text]
[PDF]
|
 |
|
Copyright © 1999 by the American Society for Biochemistry and Molecular Biology.
|
Advertisement
Advertisement
|