|
J Biol Chem, Vol. 274, Issue 14, 9409-9420, April 2, 1999
A Region in IVS5 of the Human Cardiac L-type Calcium Channel
Is Required for the Use-dependent Block by
Phenylalkylamines and Benzothiazepines*
Howard K.
Motoike §,
Ilona
Bodi ,
Hitoshi
Nakayama¶,
Arnold
Schwartz, and
Gyula
Varadi
From the Institute of Molecular Pharmacology and Biophysics,
University of Cincinnati College of Medicine,
Cincinnati, Ohio 45267-0828 and ¶ Faculty of Pharmaceutical
Sciences, Kumamoto University, Kumamoto 862, Japan
 |
ABSTRACT |
Mutations in motif IVS5 and IVS6 of the human
cardiac calcium channel were made using homologous residues from the
rat brain sodium channel 2a. [3H]PN200-110 and
allosteric binding assays revealed that the dihydropyridine and
benzothiazepine receptor sites maintained normal coupling in the
chimeric mutant channels. Whole cell voltage clamp recording from
Xenopus oocytes showed a dramatically slowed inactivation and a complete loss of use-dependent block for mutations in
the cytoplasmic connecting link to IVS5 (HHT-5371) and in IVS5
transmembrane segment (HHT-5411) with both diltiazem and verapamil.
However, the use-dependent block by isradipine was retained
by these two mutants. For mutants HHT-5411 and HHT-5371, the residual
current appeared associated with a loss of voltage dependence in the
rate of inactivation indicating a destabilization of the inactivated state. Furthermore, both HHT-5371 and -5411 recovered from inactivation significantly faster after drug block than that of the wild type channel. Our data demonstrate that accelerated recovery of HHT-5371 and
HHT-5411 decreased accumulation of these channels in inactivation during pulse trains and suggest a close link between inactivation gating of the channel and use-dependent block by
phenylalkylamines and benzothiazepines and provide evidence of a
role for the transmembrane and cytoplasmic regions of IVS5 in the
use-dependent block by diltiazem and verapamil.
 |
INTRODUCTION |
Voltage-dependent calcium channels mediate calcium
influx in response to membrane depolarization and play a critical role in cellular activities such as excitation-contraction coupling, neurotransmitter release, and hormone secretion (1, 2). L-type voltage-dependent calcium channels are
characterized pharmacologically by high sensitivity to the calcium
blocking drugs that include dihydropyridines
(DHP),1 phenylalkylamines
(PAA), and benzothiazepines (BZT) (3, 4). Photolabeling studies of the
purified 1 subunit and identification of the proteolyzed
fragments by site-directed antibodies demonstrate that the
1 subunit harbors all three classes of binding sites (3). The results from these studies provide substantial evidence that
motifs IIIS6 and IVS6 contain the major binding regions for these drugs.
In more recent studies, the molecular identification of the binding
sites on the 1 subunit for PAA (5-8), BZT (9, 10), and
DHPs (7, 11-14) were revealed. The region YMAI in IVS6 is a common
binding site for both BZT (9) and PAA (7, 15). A part of this region in
addition to amino acid residues within IIIS5 (16, 17) and IIIS6 (8)
contribute to the DHP pocket (18, 19). When the YMAI region was mutated
to the corresponding amino acids in the DHP-insensitive channel
1A, the resultant channel was still sensitive to PAAs
and BZTs (20). Thus, the high affinity binding site YMAI, however, is
not the minimal requirement for drug binding.
Less detailed structural information is known regarding the mechanism
of use-dependent block, a feature that is critical to the
therapeutically useful calcium antagonists. These drugs preferentially inhibit channels during high electric activity as observed in certain
cardiac arrhythmias and diseases such as ischemic heart disease. During
repetitive depolarizations, block by PAA and BZT accumulates in a
frequency- and voltage-dependent manner as a result of
additional drug binding during each depolarization that fails to
dissociate at the resting potential between depolarizations.
Recent studies have demonstrated the role of inactivation in the
mechanism of use-dependent calcium block by
phenylalkylamines (21). These results have established that
Phe1164 and Val1165 contribute to the
BZT-binding site resulting in a decrease in block by diltiazem (22).
The Ba2+ currents from these channels also exhibited a
slowed inactivation rate when these residues were replaced by alanine
(22). However, according to the guarded receptor hypothesis (23), the
molecular elements responsible for this effect may be distinct from the structures that specify simple or tonic binding.
In order to determine the structural features of the calcium channel
responsible for use-dependent block, we introduced
mutations in motif IVS5 of the human heart 1C calcium
channel utilizing homologous regions of the rat brain sodium channel
2a. Two of these mutations lost the characteristic
use-dependent block by PAA and BZT, whereas the
use-dependent block by isradipine was fully retained. These
results demonstrate a differential loss of use-dependent
block with BZT and PAA but not for isradipine and implicate for the
first time a role for motif IVS5 in this phenomenon.
 |
EXPERIMENTAL PROCEDURES |
Construction of 1C cDNA Clones in
pBluescript--
The wild type and mutant human 1C
calcium channel cDNAs were first constructed in pBluescript for
expression in Xenopus oocytes and then subsequently placed
into pAGS-3 (24) either as the full-length channel or as a channel
deleted at the carboxyl-terminal glycine 1633 (25-27). This cellular
strategy was designed to utilize the higher expression level of the
carboxyl-terminal truncated form of the channel. Site-directed
mutations were introduced by incorporating a two-step polymerase chain
reaction (PCR) protocol. Mutant oligonucleotides of IVS5 (except for
HHT-5658) were synthesized in the sense direction as follows:
HHT-5371,
CTGTGACCTCACATGTCCTTGCCGGCCCTGTTCGATATGGGCCTCCTGAG; HHT-5411, GTGGCCCTGCTCTTCCTGGTGATGTTCATCTACGCG; and
HHT-5432, TGTTCTTCACTACCGTCTTCGGGATGTCGAACTTTGCGTACATTGCCCTGAATG
(the mutations are underlined). In the first reaction,
mutant primers were amplified using an antisense oligonucleotide that
harbors the BclI restriction site (GGTTGATGATCAGGAAGGCAC)
and the wild type 1C as the template. The resultant
300-base pair PCR product was isolated and purified for use in the
second round of PCR. In this second step, the antisense oligonucleotide
carrying the mutant sequence (mega-primer) was extended using a forward
primer harboring the AatII restriction site
(GCATAATTGACGTCATTCTCA). Each PCR reaction proceeded for 20-30 cycles
in which the primers were denatured at 94 °C for 1 min followed by
annealing at 55 °C for 30 s and a final extension at 72 °C
for 30 s. The last cycle consisted of a final 10-min extension at
72 °C. After the second round of PCR, the newly synthesized 500-base
pair oligonucleotide containing the mutant sequence and harboring
both the AatII and BclI restriction sites was
gel-purified and subcloned into the EcoRV site of
pBluescript. In the construction of HHT-5658, the antisense
oligonucleotide
GATGATCAGGAAGAACTATGATGACTGACAAGAAGAAGATACCAACGCTGCTACCACGGTG that contains the BclI site was used with a sense
oligonucleotide primer that harbors the BstbI restriction
site (CCACCTTCGAAGGGTGGC) for the first step in the PCR reaction. The
1000 base pair product was then isolated and subcloned into
pBluescript as described above. The restriction sites and
mutations were sequence-verified by the dideoxynucleotide chain
termination method.
The wild type human 1C channel was prepared by
linearization with BclI followed by partial digestion with
AatII in which the 8.5-kilobase fragment was isolated. The
sequence-verified IVS5 mutants were digested first with BclI
followed by AatII to completion. This mutant oligonucleotide
was ligated into the partially digested wild type 1C
channel. The full-length channel containing the mutant sequence was
again sequence-verified.
Ligation of IVS5 Mutants into pAGS-3--
Both the mutant
1C channel and the full-length channel in pAGS-3 (24)
were digested to completion with SalI and
HindIII. A 4.8-kilobase band of pAGS-3 was ligated to the
6-kilobase band of the mutant 1C channel.
Ligation of IVS5 Mutants into pAGS-3 as a 1633
Carboxyl-terminal Deletion--
We previously constructed a
carboxyl-terminal deletion after glycine 1633 (27). In order to ligate
the mutations into the truncated channel, the 1633 pAGS-3 was
digested to completion using HindIII and
Sse8387I, and the 4.8-kilobase fragment was isolated. The
mutant channels in pBluescript were also digested to completion using
HindIII and XbaI. The product from this digestion was partially digested using Sse8387I, and the resultant
4.8-kilobase band was isolated. The final step was the ligation of the
two 4.8-kilobase bands to complete the 1633 pAGS-3 incorporating the
IVS5 mutations.
Expression of Calcium Channels in Xenopus
Oocytes--
Expression of the wild type and mutant calcium channels
was done as described previously (26). In vitro synthesized
cRNA was made using the mMessage mMachine synthesis kit (Ambion).
Xenopus oocyte isolation and cRNA injection was performed as
published elsewhere (11). Briefly, female Xenopus laevis
(purchased from Xenopus I, Ann Arbor, MI) frogs were
anesthetized by exposing them for 15-20 min to 0.15% methanesulfonate
salt of 3-aminobenzoic acid ethyl ester (MS-222; Sigma) solution before
pieces of the ovary were removed. The follicular layers of the oocytes
were digested with 2.0 mg/ml collagenase (Type IA; Sigma) dissolved in
OR-2 medium (in mM): 82.5 NaCl, 1 KCl, 1 MgCl2,
5 HEPES, pH 7.5. Stage V-VI oocytes were incubated at 19 °C in P/S
medium (in mM): 96 NaCl, 2.0 KCl, 1.0 MgCl2,
1.8 CaCl2, 5 HEPES, 2.5 sodium pyruvate, and 0.5 theophylline at pH 7.5. The P/S medium was supplemented with 100 units/ml penicillin and 100 µg/ml streptomycin.
The wild type and mutant 1C messages were coinjected in
a 50-nl solution composed of 2 (28) and human
3 (26, 30) subunits in a 1:1:1 molar ratio. The injected
oocytes were incubated in P/S solution at 19 °C. Ca2+
channel currents were recorded 2-4 days post-injection of the cRNAs at
room temperature (20-21 °C). In order to minimize contamination with chloride, oocytes were microinjected with 50 nl of a 40 mM potassium
1,2-bis(2-aminophenoxy)-ethane-N,N,N',N'-tetraacetate solution, 10 mM HEPES, pH 7.05, 60 min prior to current
recording (29). Whole cell currents were recorded using the standard
two microelectrode voltage clamp technique.
The recording medium was a Ca2+- and Cl -free
solution composed of the following (in mM): 40 Ba(OH)2, 50 N-methyl-D-glucamine, 2 KOH, 5 HEPES, pH adjusted to 7.4 with methanesulfonic acid. Voltage and
current electrodes were filled with 3 M KCl and had a
resistance of 0.5-1.5 megohms. Currents were recorded using an
Axoclamp-2A (Axon Instruments Inc., Foster City, CA) amplifier. Whole
cell leakage and capacitive currents were subtracted on-line using the
P/4 procedure. Currents were digitized at 1 kHz after being filtered at
1 kHz. The pClamp software (version 5.5 Axon Instruments) was used for
data acquisition, and version 6.0.3 was used for analysis.
Ba2+ currents were elicited by a 350-ms-long depolarizing
pulse from a holding potential of 80 mV to test potentials between 30 mV and +40 mV in 10-mV increments in order to determine the peak
potentials of the current voltage relationship of the Ca2+
channel construct. Use-dependent block was determined as
the inhibition of peak IBa during trains of 15 test pulses
of 80-ms duration applied at 0.5 Hz from a holding potential of 60 mV to test potentials +10, +20, or/and +30 mV positive to the peak potential of the I-V curves. Identical pulse protocols were used in the
presence of drugs. Drugs were perfused in the bath (for a 2.5-min
period) at concentrations of 300 and 100 µM diltiazem (racemic) and verapamil, respectively. These concentrations were selected since they provided sufficient block for the
use-dependent measurements in Xenopus oocytes.
Tonic block is defined as the peak IBa inhibition during
the first pulse after a 2.5-min equilibration in the drug containing
solution at 60 mV. The drug block under these conditions (tonic
block) reflects steady-state binding to the mixture of closed and
closed/inactivated states present at 60 mV. A double-pulse protocol
was used in those experiments measuring the voltage dependence of
steady-state inactivation. The protocol consisted of a 5-s prepulse
that ranged from 80 to +50 mV at a holding potential of 80 mV
followed by a 30-ms return pulse to 80 mV. Finally a 400-ms-long test
pulse was applied to +10, +20, and/or +30 mV. The curves were fit to
the Boltzmann equation y = A1 A2/(1 + exp(x x0)/dx)·A2.
Recovery of IBa from inactivation was studied after
depolarizing the calcium channels during a 3-s prepulse to +10, +20,
and/or 30 mV. The time course of IBa recovery from
inactivation was estimated at a holding potential of 80 mV by
applying a 400-ms test pulse to +10, +20, and/or +30 mV at various
times after the conditioning prepulse. Peak IBa values were
normalized to the peak current amplitude measured during the prepulse.
After the double-pulse protocol, the membrane was hyperpolarized to
100 mV for 3 min to permit complete recovery from inactivation and block.
Transient Expression in Human Embryonic Kidney (HEK) 293 Cells--
Each large 15-cm plate of (90%) confluent HEK 293 cells
was transfected with a total of 60 µg of cDNA. The
1C or 1633 (wild type or mutant) cDNA were
coinjected with 2 (27) and human 3
(26) in a 1:2:2 molar ratio. All cDNAs were in pAGS-3. Transfection was done according to the calcium phosphate precipitation method by
Chen and Okayama (31). Cells were scraped into phosphate-buffered saline, pH 7.2, 48-72 h post-transfection. The cells were washed twice
in phosphate-buffered saline and disrupted by a Polytron homogenizer in
buffer (50 mM Tris, pH 7.4, 1 mM EDTA, pH 7.4, supplemented with 2 µg/ml aprotinin and 0.5 mM
phenylmethylsulfonyl fluoride). The membranes were pelleted in a
Beckman Ti45 rotor at 40,000 rpm for 35 min and then resuspended in
membrane storage buffer (50 mM HEPES, pH 7.4, 1.37 mM MgCl2 and 1 mM CaCl2
plus protease inhibitors). Protein was determined using the BCA assay kit (Pierce).
Radioligand Binding--
Saturation binding assays of
[3H]PN200-110 (Amersham Pharmacia Biotech) were done
according to the protocols of Varadi et al. (32) using
50-100 µg of protein for each sample. Binding assays were performed
at 25 or 37 °C in binding buffer (100 mM Tris, pH 7.4, 2.4 mM CaCl2 and 1.4 mM
MgCl2). The bound receptors were collected on glass fiber
filters (FP-200 GF/C) and washed three times with ice-cold 50 mM Tris buffer, pH 7.4. Nonspecific and bound radioactivity
was estimated in the presence of 10 µM non-labeled isradipine. Radioactivity was measured by liquid scintillation counting.
Positive allosteric binding assays between labeled DHP and BZTs were
done at 37 °C for 1 h. In these experiments, varying concentrations of diltiazem hydrochloride and 0.8 nM
[3H]PN200-110 were used. The allosteric effect was
determined by dividing the specifically bound radioactivity in the
presence of diltiazem by that specifically bound in the absence of
diltiazem multiplied by 100 for each construct.
Chemicals--
[3H]PN200-110 was purchased from
Amersham Pharmacia Biotech. Diltiazem was a gift from Marion Merrell
Dow (Hoechst-Marion-Roussell). All other chemicals were from Sigma.
Statistical Analysis--
The results were analyzed by the KELL
program version 4.0 (Biosoft, Cambridge) and Origin version 4.0 (Microcal) and presented as the means ± S.E. The statistical
analysis was done using Student's t test (p < 0.05).
 |
RESULTS |
The regions of the 1C calcium channel responsible
for high affinity binding of PAA, DHP, and BZT include specific amino
acids in IIIS5, IIIS6, and IVS6. However, segments and amino acids
responsible for the use-dependent nature of these drugs are
found dispersed around the presumed area of calcium
blocker-binding sites (20-22, 33). This provided the impetus
to investigate other regions of the calcium channel that may
play an important role in use-dependent block. We
chose amino acid stretches of the rat brain sodium channel 2a
(34) since these channels possess a low affinity pattern of
inhibition by some calcium antagonists (35, 36). Furthermore, very few amino acids are conserved in the membrane spanning regions between the two channels (Fig.
1A), and the majority of the
published residues that have been shown to be critical for the action
of calcium antagonists are absent in the rat brain sodium channel (Fig.
1A).

View larger version (23K):
[in this window]
[in a new window]
|
Fig. 1.
Strategy of mutagenesis between the
1C human cardiac calcium channel and
rat sodium channel 2a. Conserved residues are boxed and
amino acids important for calcium channel blocker binding are
boldface. A, comparison of amino acid sequence
between the 1C human cardiac calcium channel and rat
sodium channel 2a of regions (IIIS5, IIIS6, and IVS6) known to harbor
residues critical for high affinity calcium antagonist binding.
B, sequence alignment of the mutant calcium channels
(HHT-5371, HHT-5411, HHT-5432, and HHT-5658) with the wild type
(WT) human heart 1C sequence. Mutations were
based on non-conserved residues from the rat brain sodium channel 2a.
Intervening amino acid residues among the three IVS5 mutations are
conserved between the two channels. C, relative orientation
of the mutant and wild type amino acids within transmembrane regions
IVS5 and IVS6.
|
|
We investigated motif IVS5 since this segment "opposes" IVS6 much
like the faces of IIIS5 and IIIS6 are believed to be oriented for DHP
binding in the calcium channel. Three separate mutant constructs,
termed HHT-5371, HHT-5411, and HHT 5432, were engineered from the
intracellular portion (amino acids 1326) of motif IVS5 to the
extracellular loop (amino acids 1355) that show a loss of amino acid
conservation. In the three mutations there are a total of nine, five
and four amino acids that were changed in HHT-5371, -5411, and -5432, respectively (Fig. 1B). The intervening residues between the
three mutations in IVS5 are conserved in the two channels. In addition,
in a motif IVS6 mutant (HHT-5658) 11 amino acids were changed to the
corresponding sequence of the rat brain 2a sodium channel. In this
construct, the first three of the four amino acids of the YMAI sequence
that have been demonstrated to form the primary binding site for
calcium antagonists have been changed. The relative location of these
mutations within the transmembrane regions are shown in Fig.
1C. These mutations were then assayed for their influence on
channel function by the different classes of calcium antagonists.
In a previous report from this laboratory, a carboxyl-terminal deletion
of the channel tail after glycine 1633 ( 1633) was found to increase
the Bmax of the 1C in transient
expression systems without affecting the KD (27).
Thus, we used this carboxyl-terminal deletion construct in all binding
assays of HEK 293 cell membranes to enhance expression. Scatchard
analysis showed no difference in affinity (0.1-0.2 nM) but
an approximately 2-fold increase (140 versus 250 fmol/mg
protein) in Bmax between the full-length wild
type and the 1633 construct (data not shown, see Ref. 27). Some of
the mutant constructs expressed poorly in HEK 293 cells (HHT- 5432)
with minor effects on KD values. Interestingly, some
of the mutations within the regions of motif IVS5 also demonstrated a
lowered affinity (HHT- 5371, >1.2 nM and HHT- 5432 0.4 nM) to [3H]PN200-110 (Fig.
2A). The mutations in motif
IVS5 encompass regions that do not overlap with the published binding
sites for calcium channels. The construct HHT- 5658 completely lost
high affinity binding to [3H]PN200-110. Thus, an
estimate for DHP affinity could not be determined. These
results are consistent with the published literature
that motif IVS6 contains the high affinity binding site for DHP
binding (7).

View larger version (20K):
[in this window]
[in a new window]
|
Fig. 2.
DHP binding characteristics of mutants in
motif IVS5. A, effect of IVS5 mutations on
[3H]PN200-110 binding affinity. The vertical
bars represent the KD values from the Scatchard
plots. The names of the cDNA constructs are labeled
below each vertical bar. The data are means ± S.E. A p value smaller than 0.05 is represented by an
asterisk. Two asterisks represent a p
value smaller than 0.001. Binding assays were done as described under
"Experimental Procedures." B, effect of diltiazem on
[3H]PN200-110 binding for wild type and 1633
carboxyl-terminal deletion constructs. Saturation binding of WT
(open circles) and 1633 (solid circles) were
done with subsaturating (0.8 nM)
[3H]PN200-110 with varying concentrations of diltiazem as
indicated. The positive allosteric effect was quantitated by the dpm in
the presence of diltiazem (B) divided by the DPM
bound in the absence of diltiazem (Bo) multiplied by
100. The data are means ± S.E. C, maximal allosteric
effect of diltiazem on [3H]PN200-110 binding for the
calcium channel constructs. Measurements were made from the peak
allosteric bound in the presence of diltiazem as in B. Vertical bars represent the positive allosteric effect on
each cDNA construct and are labeled at the bottom of the
figure. The data are means ± S.E. An asterisk
represents a p value smaller than 0.05. Two
asterisks represent a p value smaller than 0.001. Binding assays were done as described under "Experimental
Procedures."
|
|
We then posed a question to test whether these sites may have any
involvement in establishing the allosteric interaction among calcium
channel blockers. The concentration-dependent enhancement of subsaturating (0.8 nM) concentrations of
[3H]PN200-110 by increasing concentrations of diltiazem
between the wild type and 1633 channel is depicted in Fig.
2B. The maximal allosteric effect of diltiazem between the
full-length wild type channel, the 1633 wild type channel, and the
1633 mutants is shown in Fig. 2C. The full-length wild
type construct showed significantly lower (185%) allosteric
stimulation by diltiazem compared with the 1633 (385%) construct.
Maximal binding for the mutant constructs were not significantly
different compared with the wild type channel producing a 300%
increase in [3H]PN200-110 binding than in the absence of
diltiazem. The exception was with HHT- 5432 in which there was a
significant decrease (240%) in binding compared with the 1633
control. In all of the constructs the
concentration-dependent peak occurred between 30 and 100 µM diltiazem and elicited similar curves as the wild type
constructs (data not shown). There was no observable specific DHP
binding for the HHT- 5658 construct even in the presence of
diltiazem. These results are consistent with the loss of the high
affinity binding site for DHP.
In order to address whether the motif IVS5 mutant constructs maintained
normal biophysical properties and pharmacology to calcium channel
antagonists, we expressed cRNAs for the full-length channels in
Xenopus oocytes. All of the mutants produced
voltage-dependent currents with Ba2+ serving as
the charge carrier. HHT-5411 produced a substantial positive shift
(29.3 ± 0.7 mV), whereas HHT-5658 produced a negative (11.2 ± 1.4 mV) shift in the voltage dependence of the I-V relationship compared with the wild type channel (23.3 ± 1.9 mV). In the case for the constructs HHT-5371 and HHT-5432, there was no significant shift (Fig. 3). As was expected, HHT-5658
produced voltage-dependent Ba2+ currents
despite demonstrating no binding of [3H]PN200-110 to
transfected HEK 293 membrane preparations.

View larger version (25K):
[in this window]
[in a new window]
|
Fig. 3.
Families of Ba2+ currents with
corresponding current-voltage relationships for the wild type and
mutant channels expressed in Xenopus oocytes.
A, representative whole cell current traces for wild type
and mutant Ca2+ channels were recorded in 40 mM
Ba2+ solution at a holding potential 80 mV. Depolarizing
pulses (350 ms) were applied from 30 mV to +40 mV in 10 mV steps.
B, current-voltage relationships of wild type and chimeric
channels. Smooth lines represent the best fit to a Boltzmann
equation ((y = (A2 + (A1 A2))/(1 + exp((x x0)/dx)))·G·(x Er)).
|
|
Analyses of voltage-dependent activation and inactivation
for the mutants used in this study are summarized in Table
I. Activation rates revealed small but
significant differences between the mutants. The half-maximal voltage
for activation significantly shifted toward negative potentials
(V1/2 = 3.3 mV) for HHT-5658, whereas HHT-5411
shifted toward positive potentials (V1/2 = 19.5 mV)
compared with the wild type channels (V1/2 = 13.5 mV). There was no significant difference among the other mutations
(Fig. 4 and Table I). The inactivation
time course of Ba2+ traces could be fitted well by a single
exponential function (Table I). HHT-5371, HHT-5411, and HHT-5432 mutant
channels displayed a significantly slower inactivation rate (>3 s, > 3 s, and 1.6 ± 0.08 s, respectively) than the wild type
(1.1 ± 0.04 s) channel. The steady-state inactivation properties
of wild type and mutant channels exhibited drastic changes in
inactivation of HHT-5411 and HHT-5371 (Fig. 4). HHT-5371 and HHT-5411
revealed incomplete inactivation only to approximately 50% of the
normalized current. Upon addition of diltiazem the steady-state
inactivation was restored to normal (Fig. 4). The
V0.5 values of steady-state inactivation at
HHT-5371 and HHT-5411 with diltiazem were significantly different from
the one obtained for the wild type; however, the slope factors appeared
not significantly different from the wild type (Table I). The wild type
and HHT-5658 (V0.5; 7.6 mV,
kv; 11.9 mV and V0.5; 12.3
mV, kv; 11.5 mV, respectively) inactivated completely, and the midpoint voltages of the curves were
characteristically leftward-shifted in the hyperpolarized direction
(V0.5, 22.4 mV; V0.5,
17.9 mV) after diltiazem addition without a significant change in the
steepness of the voltage dependence (kv, 9.0 and
10.4 mV). The absence of change either in the
V0.5 or in the slope factor of the steady-state
inactivation curve for HHT-5658 is in good agreement with the partial
loss of the BZT-binding site. Mutant HHT-5432 behaved very similarly to
that of the wild type. This mutant inactivated completely either
without or with diltiazem showing only modest changes in the
steady-state inactivation parameters (Table I).
View this table:
[in this window]
[in a new window]
|
Table I
Activation and inactivation rate constants of wild type and mutant
calcium channels
The inactivation time constants for Vm = +10 or +20
mV were estimated at t = 3 s for wild type and
mutant channels in the presence of 40 mM Ba2+. The
inactivation time course of whole cell Ba2+ traces could be
fitted well by a single exponential function. The abbreviations used in
the table are as follows: V0.5, half-maximal voltage
for activation; V0.5 inact., half-maximal voltage
for steady-state inactivation; and kinact., slope
factor of the curve at V0.5 inact.
|
|

View larger version (29K):
[in this window]
[in a new window]
|
Fig. 4.
Effect of diltiazem inhibition on
steady-state inactivation curves. The voltage dependence of
inactivation was investigated for the wild type, HHT-5411, HHT-5432,
HHT-5371, and HHT-5658 channels at the end of a 5-s prepulse.
Open symbols, control; filled symbols in the
presence of 300 µM diltiazem. A, wild type
channel; B, HHT-5432; C, HHT-5411; D,
HHT-5371; and E, HHT-5658. The relative peak current at +10
mV or +20 mV was plotted against the different prepulse potentials.
Curve fitting was performed by the Boltzmann equation as described
under "Experimental Procedures" (n = 5-9).
|
|
We further analyzed motif IVS5 and IVS6 mutant calcium channels with
regard to tonic and use-dependent block by diltiazem and
verapamil. Resting state-dependent (tonic) IBa
inhibition by diltiazem was 0.69 ± 0.02 (n = 30)
in the wild type channel. Only the change in HHT-5432 and HHT-5371
produced a significant increase in tonic block (0.56 ± 0.03, n = 13 and 0.61 ± 0.03, n = 16, respectively). The other mutant calcium channel constructs were not
significantly different (HHT-5411, 0.71 ± 0.03, n = 26; HHT-5658, 0.62 ± 0.04, n = 17) from the
wild type channel (Fig. 5). Tonic block
was less pronounced with verapamil for the wild type channel (0.92 ± 0.04) suggesting that the drug binds poorly to the resting state of
the channel. Similarly to the wild type channel, HHT-5411 (0.86 ± 0.03) and HHT-5371 (0.75 ± 0.07) exhibited very little tonic
block with verapamil.

View larger version (51K):
[in this window]
[in a new window]
|
Fig. 5.
Tonic IBa inhibition by 300 µM diltiazem for wild type and motif IV
mutants expressed in Xenopus oocytes. Tonic block
was defined as the IBa peak inhibition during the first
pulse after a 2.5-min equilibration in the drug containing solution at
60 mV. Tonic block is presented in the form of peak current ratios
IDiltiazem/IControl. A p value
smaller than 0.05 is indicated by an asterisk
(n = 13-26).
|
|
We then studied the impact of the amino acid substitutions on use- or
frequency-dependent block by calcium antagonists.
Representative current traces are shown for diltiazem and verapamil
(Fig. 6 and 7, respectively).
Use-dependent block in the wild type channel appeared more
efficient with verapamil (30.4 ± 2.1%) than with diltiazem
(20.0 ± 2.1%). The IVS6 mutant HHT-5658 displayed less use-dependent block (12.6 ± 1.5%) by diltiazem
compared with wild type. The IVS5 mutant HHT-5432 exhibited many
similar characteristics to the wild type channel.

View larger version (32K):
[in this window]
[in a new window]
|
Fig. 6.
Use-dependent block of wild type
and mutant calcium channel currents. Mutations in IVS5 affect
IBa decay during 0.5-Hz pulse trains. Representative
current traces of wild type and mutant channels in the absence
(A) and presence (B) of 300 µM
diltiazem for wild type, HHT-5432, HHT-5411, HHT-5371, and HHT-5658,
respectively. C, use-dependent IBa
inhibition during 15 consecutive test pulses by 300 µM
diltiazem compared with the current decay in the control. 0.5-Hz trains
of 15 pulses were applied from a holding potential at 60 mV to a test
potential of +10 or +20 mV. Peak currents during each pulse were
normalized to the peak IBa during the first pulse and are
plotted against pulse number.
|
|

View larger version (31K):
[in this window]
[in a new window]
|
Fig. 7.
Use-dependent block of
IBa by motif IV mutants by verapamil and isradipine.
Representative current traces of wild type in the absence
(A) and presence (B) of 100 µM
verapamil. Use-dependent block by 100 µM
verapamil for wild type (WT) (C), HHT-5411
(E), and HHT-5371 (G). Use-dependent
block by 10 µM isradipine are shown for wild type
(WT) (D), HHT-5411 (F), and HHT-5371
(H). The same protocol was applied as described in Fig.
6.
|
|
A remarkable and unexpected observation was the complete disappearance
of use-dependent block of both mutant HHT-5371 and HHT-5411, for either diltiazem (Fig. 6C, 0.9 ± 2.4 and
3.1 ± 3.1%, respectively) or verapamil (Fig. 7, E and
G) (3.0 ± 0.7 and 5.8 ± 3.3%, respectively).
Previously, it has been demonstrated that DHPs also exert
use-dependent block at pulse frequencies of 1 Hz or greater
(37). By using the same protocol as described above for BZT, we
observed use-dependent block for 10 µM
isradipine at a frequency of 1 Hz for both the wild type channel (Fig.
7D) and the mutants HHT-5411 and HHT-5371 (Fig. 7,
F and H, respectively). Since the mutants tested
throughout these studies retained the DHP- and BZT-binding sites (with
the exception of the HHT-5658 where the YMA part of the binding site
was eliminated), it is logical to assume that the alteration of
inactivation properties of the mutant channels is responsible for the
loss of use-dependent block by diltiazem and verapamil.
A more complete analysis of the role of channel inactivation in
development of block was performed by studying the recovery from
depolarization-dependent block (Fig.
8). We measured the IBa
recovery from inactivation by a two-pulse protocol after maintained 3-s
depolarizations. The recovery of the channel from inactivation was
estimated at different intervals (recovery interval) from 20 ms to
28 s. Data points in the presence of diltiazem (Fig. 8A) were fitted by a two exponential curve with exception of
HHT-5371 in which, due to the very fast recovery, a single exponential fit was employed. The mutant HHT-5371 and HHT-5411 displayed
characteristically faster recovery kinetics compared with the wild type
in the presence of diltiazem (Table II).
The recovery from inactivation also was tested for wild type and
HHT-5411 in presence of verapamil (Fig. 8B). Upon the
addition of verapamil, the time constants of recovery from inactivation
were 0.57 and 0.18 s ( fast) and of 3.1 and 2.1 s ( slow) for the wild type and the mutant HHT-5411,
respectively. In HHT-5371 and HHT-5411 mutants drastic changes in both
fast and slow were noted, showing that
the drug still binds to the channel and that BZT- and PAA-binding sites
are fully retained. Both mutations have a reduced rate of inactivation
and an enhanced rate of recovery from inactivation at 80 mV
suggesting that the inactivated state of the calcium channel is
destabilized by these two mutations. Therefore, the loss of use
dependence is largely due to the decrease of the affinity of the drug
to the inactivated state of this mutant compared with the wild
type.

View larger version (22K):
[in this window]
[in a new window]
|
Fig. 8.
Kinetics of IBa recovery from
inactivation after treatment with diltiazem and verapamil. Time
course of inactivation of wild type, HHT-5411, and HHT-5371 after 300 µM diltiazem (A) and 100 µM
verapamil (B). The bars represent the mean ± S.E. of 5-11 experiments. The time constants are summarized in
Table II. The time course of recovery from inactivation at 80 mV was
determined by subsequent test pulses applied at various times (recovery
interval) after the prepulse as described under "Experimental
Procedures." In the mutant channels (HHT-5411 and HHT-5371) about
80-95% of the IBa recovered within 20 ms.
|
|
View this table:
[in this window]
[in a new window]
|
Table II
Time constants of recovery from inactivation for wild type, HHT-5432,
HHT-5411, HHT-5371, and HHT-5658 channels in the absence and presence
of diltiazem, isradipine, and verapamil
Data generated for this table are derived from experiments summarized
in Figs. 8 and 9 and experimental details are given therein. The
relative current values were plotted against time, and data points were
fitted by a double exponential function when it was possible or for
most cases by a single exponential only. The parameters given in the
table are as follows: 1 and 2, time constants of
a double exponential function; 1 one exponential (exp.),
time constant of a single exponential function.
|
|
We further investigated whether this phenomenon holds true with
isradipine. In the presence of isradipine, the time course of recovery
from inactivation for HHT-5411 did not appear statistically different
from the wild type. The IBa recovery from inactivation of
wild type and the mutants HHT-5411 and HHT-5371 in the presence of
isradipine are depicted in Fig.
9A. The recovery from
inactivation for HHT-5371 after isradipine treatment could only be fit
using a one exponential function. These results are similar to those observed from recovery in the presence of diltiazem and verapamil (Fig.
8) for both HHT-5411 and HHT-5371. Mutant HHT-5371 IBa
recovery appeared to be faster than wild type; however, it should be
noted that even after a 5-s conditioning prepulse only 10% of the
channels are inactivated (Fig. 9). For HHT-5411 about 30% of the
channels were inactivated at the end of the conditioning prepulse.
Therefore, determining the time constants for this latter process
seemed not to be realistic (Table II). Representative current traces are illustrated in the absence (Fig. 9, B, D, and
F) and presence of isradipine (Fig. 9, C, E, and
G) for wild type, HHT-5411, and HHT-5371, respectively. Mean
time constants of IBa recovery from inactivation by
diltiazem, isradipine, and verapamil are summarized in Table II.

View larger version (28K):
[in this window]
[in a new window]
|
Fig. 9.
Effect of isradipine on the recovery from
inactivation. A, IBa recovery from
inactivation of wild type, HHT-5411, and HHT-5371 mutant channels as
measured by a two-pulse protocol in the presence of 200 nM
isradipine. The currents were inactivated by a 3-s prepulse to +10 or
+20 mV. Recovery from inactivation at 80 mV was measured by applying
a sequence of test pulses at various intervals (between 20 ms and
28 s) after the prepulse. After a two-pulse experiment the
membrane was depolarized to 100 mV for 2 min to permit complete
recovery from inactivation and block. Peak currents of the test pulses
were normalized to the peak currents of the prepulse and plotted
against time. Representative current traces are shown in the absence
(B, D, and F) and in presence
(C, E and G) of isradipine for wild
type, HHT-5411, and HHT-5371, respectively. Displayed currents were
recorded after interpulse intervals of 20, 100, 300, 500, 1000, 3000, and 5000 ms (wild type, HHT-5411) and 20, 100, 50, 1000, and 3000 ms
(HHT-5371). The traces are superimposed. After the 3-s prepulse (to +10
or +20 mV) the IBa recovered within 20 ms to 80-90% of
its original value in control (absence of drug) for HHT-5411 and
HHT-5371. The data points are fitted by a single exponential function
for HHT-5371 and a double exponential function for the wild type and
HH-5411. The time constants were calculated from 6 to 11 independent
experiments and are summarized in Table II.
|
|
 |
DISCUSSION |
There is little information on the mechanism of
use-dependent block, a feature that is critical to the
therapeutically useful calcium antagonists. These drugs preferentially
inhibit channels during high electric activity as found in certain
cardiac arrhythmias and diseases such as ischemic heart disease.
According to the guarded receptor hypothesis (23), the molecular
elements may be distinct from the structures that specify simple or
tonic binding.
In this study we identified a region proximal to the cytoplasmic
connecting link of motif IVS5 that contributes to the
use-dependent block of BZTs and PAAs. These results are
consistent with those reported by Cai et al. (20), in which
they demonstrated that a motif I-II replacement with 1A
still maintained use-dependent inhibition by verapamil and
diltiazem as well as in a mutant in which the high affinity YAI
residues had been also mutated to that of the 1A
channel. In more recent studies (3, 21, 22), other regions in motifs
III and IV that are outside of the high affinity YAI-binding region
have been shown to be critical for the use-dependent block
observed for these drugs.
We have found that the loss of use-dependent block is
closely associated with a decrease in voltage-dependent
inactivation. In both HHT-5411 and HHT-5371 diminished inactivation
resulted in the absence of use-dependent block by diltiazem
and verapamil. These results are rather specific to these classes of
calcium antagonists since use-dependent block by the
dihydropyridine antagonist isradipine was not affected. The loss of
use-dependent block from the mutations in IVS5 appear to be
coupled to a decrease of voltage-dependent inactivation as
has been shown for mutants in IIIS6 (22).
It appears that motif IVS5 plays an important role in the stability of
channel inactivation. In steady-state inactivation studies, both
HHT-5411 and HHT-5371 did not completely inactivate except in the
presence of calcium antagonists (4). These results provide evidence
that the loss of this aspect of calcium channel block is specific
rather than due to a general loss in function attributed to gross
changes in tertiary structure resulting from the introduction of
foreign amino acid residues. There are several reasons why we support
this contention. First, only the use-dependent block of
these drugs is affected, and the tonic block by BZTs is spared. These
results may be due to the fact that the high affinity binding region in
motif IV is still intact. However, one mutation, HHT-5658 which we have
described in this report, has three of the four residues in the YMAI
sequence altered. Despite these changes the channel when expressed in
Xenopus oocytes behaves much like the wild type
Ba2+ currents and exhibits tonic and
use-dependent block by calcium antagonists. As anticipated,
the high affinity binding to [3H]PN200-110 in saturation
binding assays was lost. These new data further implicate other regions
outside those areas that have been recently published (IIIS5, IIIS6,
and IVS6) to be important for high affinity binding of these classes of
drugs (3-22). Second, the loss of use-dependent block is
unique to verapamil and diltiazem. Use-dependent block by
DHPs is not affected. These results suggest that the
use-dependent block by PAA and BZT operates through a mechanism different from DHPs. Furthermore, the conclusion that there
is a functional disparity between PAA/BZT and DHP is reasonable since
there is more overlap in the high affinity binding region for PAAs and
BZTs than for DHPs. Third, HHT-5411 which demonstrates a loss of
use-dependent block to BZT and PAA maintains normal DHP
binding affinity and allosteric modulation by diltiazem. HHT-5371 which
did not retain use-dependent block to BZTs and PAAs shows an approximate 6-fold lowered affinity to DHP binding. A fourth issue
in support of our contention that motif IVS5 has a specific structural
role for BZT and PAA action is that another mutant, HHT-5432 which is
also from the same region, displayed use-dependent block by
these drugs and otherwise normal channel currents. When this mutant was
expressed in HEK 293 cells, it showed a slightly lowered (2-fold)
affinity to DHPs and suggests a role in DHP binding in this region of
motif IVS5.
These alterations in function are not likely to be due to the transfer
of specific sodium channel sequences into the cardiac calcium channel
for several reasons. Motif IVS6 in sodium channels has evolved to
harbor specific amino acid residues for local anesthetic action (36).
Mutation of these residues reduces not only block but also eliminates
the use-dependent characteristics for local anesthetics
(36). Thus, unlike the calcium channel, the sodium channel has both its
binding site and use-dependent functions contained in motif IVS6.
These results also suggest that the nature of use-dependent
block may be different for the calcium antagonists and local
anesthetics. Second, it is believed that the intracellular linker
between motifs III and IV is responsible for this
voltage-dependent inactivation (38).
According to the modulated receptor hypothesis (23), variable affinity
channel binding and modification of inactivation kinetics are required
for the use-dependent effect of calcium channel drugs. In
the case of HHT-5371 and HHT-5411, the very slow inactivation kinetics
reflects a slow transition between the open and inactivated state of
the channel. Thus, the open state of the channel exerts a lesser
affinity to BZT and PAA. The transitions for this mutant to the
inactivated state is a less preferred conformation so that repeated
depolarizations do not lead to an increased fraction of inactivated
channels. However, diltiazem binds to the HHT-5411 and HHT-5371 mutant
channels as shown by the change in voltage dependence of inactivation
and use dependence. Similar studies performed on these two constructs testing the use-dependence for verapamil confirmed the importance of
inactivation in the development of use-dependent block (21, 22). It is a reasonable assumption that a slowly inactivating mutant
will be less efficiently blocked by PAA. In the case of calcium
channels the only published reports of areas responsible for
voltage-dependent inactivation implicates motif IS6 (39) and the carboxyl terminus in the case for 1C alternative
splice variants (40). Therefore, the results suggest a possible third region of the calcium channel for use-dependent inactivation.
This report is the first to demonstrate a functional role of motif IVS5
for calcium channel function and the action of calcium channel
antagonists, and the first to dissect the molecular regions involved in
use-dependent block by BZT and PAA. We suggest a model (Fig. 10) in which inactivation of the
channel occurs in two kinetic states. Both states bind to BZT and PAA.
However, in the cardiac calcium channel IVS5 mutants HHT-5411 and
HHT-5371, the interconversion between the open and the inactivation
state is incomplete. Treatment of either BZT or PAA forces the calcium
channel toward complete inactivation. The slowed rate of inactivation
in these channels can explain the loss of use-dependent
block by these drugs in parallel with the observed decrease in
voltage-dependent inactivation without affecting any of the
residues for high affinity antagonist binding. We believe that motif
IVS5 serves as either an accessory binding domain or a conduit for a
conformational movement within the membrane to provide the
use-dependent nature characterized by these two classes of
calcium-blocking drugs.

View larger version (33K):
[in this window]
[in a new window]
|
Fig. 10.
Model illustrating the fast and slow
components of inactivation for the cardiac calcium channels in response
to BZT and PAA. The channel exists initially in a resting
(R) state that does not bind to BZT and PAA. In this state
the drug-binding site is inaccessible and/or has a low affinity to the
drugs. Upon depolarization the calcium channel opens (O)
allowing the passage of calcium through the pore. In the open state the
channel still has a low affinity to the drugs. Then the channel
inactivates (I). Our results have demonstrated that
inactivation can be divided into two kinetic states (Ifast
and Islow). Both Ifast and Islow
bind drug. After the drug dissociates, the channel is left in an
intermediate inactivated state (I*) that is no longer bound by drug
before returning back to the resting (R) state. We have
shown that a mutation in motif IVS5 does not completely inactivate,
demonstrating an incomplete interconversion from the open to the
inactivated state. This observation can be seen by the incomplete
voltage-dependent inactivation shown in the
electrophysiological traces of Figs. 5-7. However, upon the addition
of BZT or PAA the mutant channels (HHT-5371 and (HHT-5411) completely
inactivate. These results demonstrate the coupling between
voltage-dependent inactivation and drug binding in the
cardiac calcium channel without altering the residues shown to be
required for high affinity drug binding.
|
|
 |
ACKNOWLEDGEMENTS |
We thank Gwen Kraft and Sheryl Koch for the
preparation of the figures. Our sincerest gratitude is extended to
Prof. Taku Nagao and Dr. Satomi Adachi-Akahane for kindness in carrying
out some preliminary experiments for these studies at the University of
Tokyo, Japan.
 |
FOOTNOTES |
*
This work was supported in part by National Institutes of
Health Grants PO1-HL22619, T32-HL07382, and 5R37-HL43231.The costs of publication of this
article were defrayed in part by the
payment of page charges. The article
must therefore be hereby marked
"advertisement" in
accordance with 18 U.S.C. Section
1734 solely to indicate this fact.
Both authors contributed equally to this work.
§
Present address: Dept. of Pharmacology, Columbia University, New
York, NY 10032.
To whom correspondence should be addressed: Institute of
Molecular Pharmacology and Biophysics, University of Cincinnati College of Medicine, 231 Bethesda Ave., P. O. Box 670828, Cincinnati, OH
45267-0828. Tel.: 513-558-2466; Fax: 513-558-1778; E-mail: varadig{at}emailuc.edu.
 |
ABBREVIATIONS |
The abbreviations used are:
DHP, dihydropyridine;
PAA, phenylalkylamine;
BZT, benzothiazepine;
PCR, polymerase chain reaction;
HEK, human embryonic kidney.
 |
REFERENCES |
-
Hofmann, F.,
Biel, M.,
and Flockerzi, V.
(1994)
Annu. Rev. Neurosci.
17,
399-418[CrossRef][Medline]
[Order article via Infotrieve]
-
Mori, Y.,
Mikala, G.,
Varadi, G.,
Kobayashi, T.,
Koch, S.,
Wakamori, M.,
and Schwartz, A.
(1996)
Jpn. J. Pharmacol.
72,
83-109[Medline]
[Order article via Infotrieve]
-
Streissnig, J.,
Grabner, M.,
Mitterdorfer, J.,
Hering, S.,
Sinnegger, M. J.,
and Glossman, H.
(1998)
Trends Pharmacol. Sci.
19,
108-115[CrossRef][Medline]
[Order article via Infotrieve]
-
Mitterdorfer, J.,
Grabner, M.,
Kraus, R. L.,
Hering, S.,
Prinz, H.,
Glossman, H.,
and Streissnig, J.
(1998)
J. Bioenerg. Biomembr.
30,
319-334[CrossRef][Medline]
[Order article via Infotrieve]
-
Doring, F.,
Degtiar, V. E.,
Grabner, M.,
Streissnig, J.,
Hering, S.,
and Glossman, H.
(1996)
J. Biol. Chem.
271,
11745-11749[Abstract/Free Full Text]
-
Johnson, B. D.,
Hockerman, G. H.,
Scheuer, T.,
and Catterall, W. A.
(1996)
Mol. Pharmacol.
50,
1388-1400[Abstract]
-
Schuster, A.,
Lacinova, L.,
Klugbauer, N.,
Ito, H.,
Birnbaumer, L.,
and Hofmann, F.
(1996)
EMBO J.
15,
2365-2370[Medline]
[Order article via Infotrieve]
-
Hockerman, G. H.,
Johnson, B. D.,
Abbott, M. R.,
Scheuer, T.,
and Catterall, W. A.
(1997)
J. Biol. Chem.
272,
18759-18765[Abstract/Free Full Text]
-
Hering, S.,
Aczel, S.,
Grabner, M.,
Doring, F.,
Berjukow, S.,
Mitterdorfer, J.,
Sinnegger, M. J.,
Streissnig, J.,
Dektiar, V. E.,
Wang, Z.,
and Glossman, H.
(1996)
J. Biol. Chem.
271,
24471-24475[Abstract/Free Full Text]
-
Kraus, R.,
Reichl, B.,
Kimball, S. D.,
Grabner, N.,
Murphy, B. J.,
Catterall, W. A.,
and Streissnig, J.
(1996)
J. Biol. Chem.
271,
20113-20118[Abstract/Free Full Text]
-
Tang, S.,
Yatani, A.,
Bahinski, A.,
Mori, Y.,
and Schwartz, A.
(1993)
Neuron
11,
1013-1021[CrossRef][Medline]
[Order article via Infotrieve]
-
Grabner, M.,
Wang, Z.,
Hering, S.,
Streissnig, J.,
and Glossman, H.
(1996)
Neuron
16,
207-218[CrossRef][Medline]
[Order article via Infotrieve]
-
Peterson, B. Z.,
Tanada, T. N.,
and Catterall, W. A.
(1996)
J. Biol. Chem.
271,
5293-5296[Abstract/Free Full Text]
-
Peterson, B. Z.,
Johnson, B. D.,
Hockerman, G. H.,
Avheson, M.,
Scheuer, T.,
and Catterall, W. A.
(1997)
J. Biol. Chem.
272,
18752-18758[Abstract/Free Full Text]
-
Hockerman, G. H.,
Johnson, B. D.,
Scheuer, T.,
and Caterall, W. A.
(1995)
J. Biol. Chem.
270,
22119-22122[Abstract/Free Full Text]
-
Mitterdorfer, J.,
Wang, Z.,
Sinneger, M. J.,
Hering, S.,
Sreissnig, J.,
Grabner, M.,
and Glossman, H.
(1996)
J. Biol. Chem.
271,
30330-30335[Abstract/Free Full Text]
-
He, M.,
Bodi, I.,
Mikala, G.,
and Schwartz, A.
(1997)
J. Biol. Chem.
272,
2629-2633[Abstract/Free Full Text]
-
Sinnegger, M. J.,
Wang, Z.,
Grabner, M.,
Hering, S.,
Streissnig, J.,
Glossman, H.,
and Mitterdorfer, J.
(1997)
J. Biol. Chem.
272,
27686-27693[Abstract/Free Full Text]
-
Hockerman, G. H.,
Peterson, B. Z.,
Sharp, E.,
Tanada, T. N.,
Scheuer, T.,
and Catterall, W. A.
(1997)
Proc. Natl. Acad. Sci. U. S. A.
94,
14906-14911[Abstract/Free Full Text]
-
Cai, D.,
Mulle, J. G.,
and Yue, D. T.
(1997)
Mol. Pharmacol
51,
872-881[Abstract/Free Full Text]
-
Hering, S.,
Aczel, S.,
Kraus, R. L.,
Berjukow, S.,
Streissnig, J.,
and Timin, E. N.
(1997)
Proc. Natl. Acad. Sci. U. S. A.
94,
13323-13328[Abstract/Free Full Text]
-
Kraus, R. L.,
Hering, S.,
Grabner, M.,
Ostler, D.,
and Streissnig, J.
(1998)
J. Biol. Chem.
273,
27205-27212[Abstract/Free Full Text]
-
Starmer, C. F.,
Grant, A. O.,
and Strauss, H. C.
(1984)
Biophys. J.
46,
15-27[Medline]
[Order article via Infotrieve]
-
Miyazaki, J.-I.,
Takaki, S.,
Araki, K.,
Tashiro, F.,
Tominaga, A.,
Takatsu, K.,
and Yamamura, K.
(1989)
Gene (Amst.)
79,
269-277[CrossRef][Medline]
[Order article via Infotrieve]
-
Wei, X.,
Neely, A.,
Lacerda, A. E.,
Olcese, R.,
Stefani, E.,
Perez-Reyes, E.,
and Birnbaumer, L.
(1994)
J. Biol. Chem.
269,
1635-1640[Abstract/Free Full Text]
-
Klockner, U.,
Mikala, G.,
Varadi, M.,
Varadi, G.,
and Schwartz, A.
(1995)
J. Biol. Chem.
270,
17306-1731[Abstract/Free Full Text]
-
Mikala, G.,
Klockner, U.,
Varadi, M.,
Eisfeld, J.,
Schwartz, A.,
and Varadi, G.
(1998)
Mol. Cell. Biochem.
185,
95-109[CrossRef][Medline]
[Order article via Infotrieve]
-
Ellis, S. B.,
Williams, M. E.,
Ways, N. R.,
Brenner, R.,
Sharp, A. H.,
Leung, A. T.,
Campbell, K. P.,
McKenna, E.,
Koch, W. J.,
Hui, A.,
Schwartz, A.,
and Harpold, M. M.
(1988)
Science
241,
1661-1664[Abstract/Free Full Text]
-
Neely, A.,
Olcese, R.,
Wei, X.,
Birnbaumer, L.,
and Stefani, E.
(1994)
Biophys. J.
66,
1895-1903[Medline]
[Order article via Infotrieve]
-
Collin, T.,
Lory, P.,
Taviaux, S.,
Courtieu, C.,
Guilbault, P.,
Berta, P.,
and Nargeot, J.
(1994)
Eur. J. Biochem.
220,
257-262[Medline]
[Order article via Infotrieve]
-
Chen, C.,
and Okayama, H.
(1987)
Mol. Cell. Biol.
7,
2745-2752[Abstract/Free Full Text]
-
Varadi, G.,
Lory, P.,
Schultz, D.,
Varadi, M.,
and Schwartz, A.
(1991)
Nature
352,
159-162[CrossRef][Medline]
[Order article via Infotrieve]
-
Hering, S.,
Berjukow, S.,
Aczél, S.,
and Timin, E. N.
(1998)
Trends Pharmacol. Sci.
19,
439-443[CrossRef][Medline]
[Order article via Infotrieve]
-
Noda, M.,
Ikeda, T.,
Suzuki, H.,
Yakeshima, H.,
Takahashi, T.,
Kuno, M.,
and Numa, S.
(1986)
Nature
322,
826-828[CrossRef][Medline]
[Order article via Infotrieve]
-
Yatani, A.,
Kunze, D. L.,
and Brown, A.
(1988)
Am. J. Physiol.
254,
H140-H147[Abstract/Free Full Text]
-
Ragsdale, D. S.,
Scheuer, T.,
and Catterall, W. A.
(1991)
Mol. Pharmacol.
40,
756-765[Abstract]
-
Sanguinetti, M. C.,
and Kass, R. S.
(1984)
Circ. Res.
55,
336-48[Abstract/Free Full Text]
-
Stuhmer, W.,
Conti, F.,
Suzuki, H.,
Wang, X.,
Noda, M.,
Yahagi, N.,
Kubo, H.,
and Numa, S.
(1989)
Nature
339,
597-603[CrossRef][Medline]
[Order article via Infotrieve]
-
Zhang, J.-F.,
Ellinor, P. T.,
Aldrich, R. W.,
and Tsien, R. W.
(1994)
Nature
372,
97-100[CrossRef][Medline]
[Order article via Infotrieve]
-
Soldatov, N. M.,
Oz, M.,
O'Brien, K. A.,
Abernethy, D. R.,
and Morad, M.
(1998)
J. Biol. Chem.
273,
957-963[Abstract/Free Full Text]
Copyright © 1999 by The American Society for Biochemistry and Molecular Biology, Inc.

CiteULike Complore Connotea Del.icio.us Digg Reddit Technorati What's this?
This article has been cited by other articles:

|
 |

|
 |
 
V. Yarotskyy, G. Gao, B. Z. Peterson, and K. S. Elmslie
The Timothy syndrome mutation of cardiac CaV1.2 (L-type) channels: multiple altered gating mechanisms and pharmacological restoration of inactivation
J. Physiol.,
February 1, 2009;
587(3):
551 - 565.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. Zahradnikova, I. Minarovic, and I. Zahradnik
Competitive and Cooperative Effects of Bay K8644 on the L-Type Calcium Channel Current Inhibition by Calcium Channel Antagonists
J. Pharmacol. Exp. Ther.,
August 1, 2007;
322(2):
638 - 645.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
B. S. Freeze, M. M. McNulty, and D. A. Hanck
State-Dependent Verapamil Block of the Cloned Human Cav3.1 T-Type Ca2+ Channel
Mol. Pharmacol.,
August 1, 2006;
70(2):
718 - 726.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
N. Dilmac, N. Hilliard, and G. H. Hockerman
Molecular Determinants of Ca2+ Potentiation of Diltiazem Block and Ca2+-Dependent Inactivation in the Pore Region of Cav1.2
Mol. Pharmacol.,
August 1, 2003;
64(2):
491 - 501.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
I. Bodi, S. E. Koch, H. Yamaguchi, G. P. Szigeti, A. Schwartz, and G. Varadi
The Role of Region IVS5 of the Human Cardiac Calcium Channel in Establishing Inactivated Channel Conformation. USE-DEPENDENT BLOCK BY BENZOTHIAZEPINES
J. Biol. Chem.,
May 31, 2002;
277(23):
20651 - 20659.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. J. Gage, S. G. Rane, G. H. Hockerman, and T. J. Smith
The Virally Encoded Fungal Toxin KP4 Specifically Blocks L-Type Voltage-Gated Calcium Channels
Mol. Pharmacol.,
April 1, 2002;
61(4):
936 - 944.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
V. Piacentino III, J. P. Gaughan, and S. R. Houser
L-Type Ca2+ Currents Overlapping Threshold Na+ Currents: Could They Be Responsible for the "Slip-Mode" Phenomenon in Cardiac Myocytes?
Circ. Res.,
March 8, 2002;
90(4):
435 - 442.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
C. Shi and N. M. Soldatov
Molecular Determinants of Voltage-dependent Slow Inactivation of the Ca2+ Channel
J. Biol. Chem.,
February 22, 2002;
277(9):
6813 - 6821.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. Hering, S. Berjukow, S. Sokolov, R. Marksteiner, R. G Weiss, R. Kraus, and E. N Timin
Molecular determinants of inactivation in voltage-gated Ca2+ channels
J. Physiol.,
October 15, 2000;
528(2):
237 - 249.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
V. Piacentino III, J. P. Gaughan, and S. R. Houser
L-Type Ca2+ Currents Overlapping Threshold Na+ Currents: Could They Be Responsible for the "Slip-Mode" Phenomenon in Cardiac Myocytes?
Circ. Res.,
March 8, 2002;
90(4):
435 - 442.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. Sokolov, E. Timin, and S. Hering
On the Role of Ca2+- and Voltage-Dependent Inactivation in Cav1.2 Sensitivity for the Phenylalkylamine (-)Gallopamil
Circ. Res.,
October 12, 2001;
89(8):
700 - 708.
[Abstract]
[Full Text]
[PDF]
|
 |
|
Copyright © 1999 by the American Society for Biochemistry and Molecular Biology.
|
Advertisement
Advertisement
|