JBC

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Garvish, J. F.
Right arrow Articles by Lloyd, R. S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Garvish, J. F.
Right arrow Articles by Lloyd, R. S.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

J Biol Chem, Vol. 274, Issue 14, 9786-9794, April 2, 1999


The Catalytic Mechanism of a Pyrimidine Dimer-specific Glycosylase (pdg)/Abasic Lyase, chlorella virus-pdg*

John F. GarvishDagger § and R. Stephen Lloyd§

From Dagger  the Department of Microbiology and Immunology and the § Sealy Center for Molecular Science, University of Texas Medical Branch, Galveston, Texas 77555-1071

    ABSTRACT
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

The repair of UV light-induced cyclobutane pyrimidine dimers can proceed via the base excision repair pathway, in which the initial step is catalyzed by DNA glycosylase/abasic (AP) lyases. The prototypical enzyme studied for this pathway is endonuclease V from the bacteriophage T4 (T4 bacteriophage pyrimidine dimer glycosylase (T4-pdg)). The first homologue for T4-pdg has been found in a strain of Chlorella virus (strain Paramecium bursaria Chlorella virus-1), which contains a gene that predicts an amino acid sequence homology of 41% with T4-pdg. Because both the structure and critical catalytic residues are known for T4-pdg, homology modeling of the Chlorella virus pyrimidine dimer glycosylase (cv-pdg) predicted that a conserved glutamic acid residue (Glu-23) would be important for catalysis at pyrimidine dimers and abasic sites. Site-directed mutations were constructed at Glu-23 to assess the necessity of a negatively charged residue at that position (Gln-23) and the importance of the length of the negatively charged side chain (Asp-23). E23Q lost glycosylase activity completely but retained low levels of AP lyase activity. In contrast, E23D retained near wild type glycosylase and AP lyase activities on cis-syn dimers but completely lost its activity on the trans-syn II dimer, which is very efficiently cleaved by the wild type cv-pdg. As has been shown for other glyscosylases, the wild type cv-pdg catalyzes the cleavage at dimers or AP sites via formation of an imino intermediate, as evidenced by the ability of the enzyme to be covalently trapped on substrate DNA when the reactions are carried out in the presence of a strong reducing agent; in contrast, E23D was very poorly trapped on cis-syn dimers but was readily trapped on DNA containing AP sites. It is proposed that Glu-23 protonates the sugar ring, so that the imino intermediate can be formed.

    INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

UV light damages DNA through the formation of two types of pyrimidine dimers: cyclobutane pyrimidine dimers and 6-4 photoproducts (1). One mechanism for the repair of the cyclobutane pyrimidine dimer is the base excision repair pathway, which is initiated by a DNA glycosylase/abasic (AP)1 lyase. Although many DNA-containing viruses that have sustained UV-induced DNA damage, use host cell enzymes to repair their DNA, the bacteriophage T4 is unusual in that it encodes an enzyme, endonuclease V (T4-pdg, pyrimidine dimer glycosylase), that cleaves the N-glycosyl bond of the 5' thymine of the dimer and then subsequently cleaves the phosphodiester backbone, producing a ring opened sugar as an alpha , beta  unsaturated aldehyde (2-4). T4-pdg has been characterized extensively since its discovery over 40 years ago, and its structure and mechanism of catalysis have been recently reviewed (5, 6).

The first eukaryotic homologue of T4-pdg has been found to be encoded within the genome of an algal virus, Paramecium bursaria Chlorella virus-1. As a prelude to investigating structure-function relationships in Chlorella virus pyrimidine dimer glycosylase (cv-pdg), it is advantageous to utilize molecular modeling tools to direct biochemical analyses. However, in order to justify molecular modeling studies of a protein of which the structure has not been determined by x-ray crystallography or NMR spectroscopy, it is essential that the reference enzyme (T4-pdg): 1) be highly homologous to the protein of interest (cv-pdg), 2) has had its crystal structure solved as both the apoenzyme and as a complex with substrate containing DNA, 3) has had the critical active site residues established, and 4) recognize the same substrate and catalyze a similar reaction mechanism. In this study, T4-pdg is ideally characterized to serve as a homologous reference map for the study of cv-pdg, for the following reasons. First, the gene encoding cv-pdg predicts a protein that has a 41% identity with T4-pdg (7). Additionally, homologous genes from over 40 Chlorella virus genomes reveal a very high degree of sequence conservation.2 Second, the crystal structure (9) and the co-crystal structure of T4-pdg with cyclobutane pyrimidine dimer-containing DNA (10) have been solved at high resolution. Third, two key residues have been identified in T4-pdg to catalyze the combined glycosylase/AP lyase activity, in which the alpha -amino group of Thr-2 and Glu-23 act in concert to catalyze the nucleophilic displacement reaction (11-17). Fourth, as originally hypothesized for T4-pdg, cv-pdg has been hypothesized to initiate repair by protonation on the damaged base followed by glycosidic bond destabilization. This is followed by a nucleophilic attack at the C1' of the deoxyribose sugar via a primary amine present in the protein (18). Similar reaction mechanisms have been described for other enzymes in the base excision repair pathway: formaminopyrimidine DNA glycosylase (19, 20), MutY (21), and the human homologue of endonuclease III (NTH1) (22).

Additionally, the initial characterization of the properties of cv-pdg revealed that despite its high degree of sequence similarity with T4-pdg, there were significant differences in the activities on different isomers of the cyclobutane pyrimidine dimer (23). In contrast to T4-pdg, cv-pdg was able to efficiently cleave the trans-syn II photoisomer, possibly suggesting a subtly different active site or binding pocket.

Thus, with all of these available data, modeling studies and electrostatic potential mapping have been carried out to predict the structural similarities between T4-pdg and cv-pdg (23). In this study, we investigated the catalytic mechanism of cv-pdg by using homology modeling to design site-directed mutations to test the role of Glu-23 in both the glycosylase and AP lyase reactions on thymine dimers and AP sites.

    EXPERIMENTAL PROCEDURES
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

Cloning of Chlorella Virus Pyrimidine Dimer Glycosylase-- The cv-pdg gene (A50L) was PCR-amplified from the pUC19 vector (7) to generate an NdeI site on the 5'-end and a HindIII site on the 3' side. The PCR primers were 5'-CATATGACACGTGTGAATCTCGTACCGG-3' and 5'-AAGCTTAATTATTGCTGGTTTTAGCTTTCGTG-3'. This fragment was subcloned into the pET-lla vector (Stratagene) by the NIEHS Molecular Biology Core at the University of Texas Medical Branch under the supervision of Dr. Thomas G. Wood. PCR conditions can be obtained upon request.

Homology Model of cv-pdg Based on the Endonuclease V Structure-- The amino acid sequence of T4-pdg was aligned with the predicted amino acid sequence of the cv-pdg protein using the Look computer modeling package SegMod (Molecular Applications Group, Palo Alto, CA). The SegMod algorithm can be briefly described as follows. The cv-pdg sequence was divided into short segments, and these segments were matched to fragments in the Brookhaven Protein Data Bank structural data base. The fragments were combined into a framework based on a template structure, in this case, the known structure of T4-pdg (10). Multiple structures of the model were built and averaged into a final structure, which was then stereochemically refined using 500 rounds of energy minimization. The RMS deviation of backbone atoms relative to the T4-pdg structure was 1.6 Å.

The coordinates of the modeled cv-pdg structure were used to calculate a relative electrostatic potential map using GRASP (24). The GRASP Poisson-Boltzmann calculation used the following parameters: interior dielectric constant, 2.0; exterior dielectric constant, 80; water probe radius, 2.0; and salt concentration, 0.0. The relative potential values were mapped onto the Connolly surface of the model. The same procedure was followed with the T4-pdg structure for comparison with the modeled cv-pdg protein.

Oligonucleotide Site-directed Mutagenesis of cv-pdg-- Site-directed mutagenesis was carried out on the pET-11a vector containing the cv-pdg gene using the Quikchange mutagenesis kit (Stratagene). The sequence of the primers used to carry out the mutagenesis of the cv-pdg gene were as follows: 5'-GCTTCGGAATCATCTTAAGGTCACGAAATTCTGCCATGAG-3' (E23D cv-pdg), 5'-CTCATGGCAGAATTTCGTGACCTTAAGATGATTCCGAAGGC-3' (E23D cv-pdg), 5'-CTTCGGAATCATCTTAAGTTGACGAAATTCTGCCATGAGAT-3'(E23Q cv-pdg), and 5'-ATCTCATGGCAGAATTTCGTCAACTTAAGATGATTCCGAAG-3' (E23Q cv-pdg), where the mismatched nucleotides are underlined. PCR conditions are available upon request. Following the PCRs, the templates were digested with DpnI, and the PCR product was visualized following separation on a 0.8% agarose gel and staining with ethidium bromide. An aliquot of the PCR (4 µl) was used for transformation into Supercompetent XL1 Blue bacterial cells (Stratagene). After 1 h at 0 °C, the transformation reaction was heat-shocked for 1 min at 42 °C. The cells were allowed to recover for 1 h at 37 °C in 2X-YT medium (pH 7.0) (16 g of bacto-tryptone, 10 g of bacto-yeast extract, 5 g of NaCl per liter of deionized water). Cells were then plated out on LB plates that contained 100 µg/ml ampicillin (amp). Plasmid preparations were prepared from amp resistant colonies and analyzed by automated sequencing (NIEHS Molecular Biology Core Facility) to confirm each mutation.

Purification of Chlorella Virus Pyrimidine Dimer Glycosylase Mutants E23D and E23Q-- The purification scheme for the mutant enzymes differed slightly from that previously described for the wild type enzyme (7). After sequencing each mutated gene to ensure that the only mutation generated was the mutation of interest, the plasmid was introduced into E. coli BL21DE3, which is used for expression from this plasmid. This cell is a DE3 lysogen in which the gene for the T7 RNA polymerase has been inserted in the lambda  int gene, such that the lysogen remains stable. The T7 RNA polymerase gene is induced by induction with isopropyl-1-thio-beta -D-galactopyranoside. Cultures (2 liters) were grown in LB medium containing 100 µg/ml amp at 30 °C for 6 h. Cells were pelleted by centrifugation at 4000 × g for 15 min at 4 °C and resuspended in Buffer A (50 mM Tris-HCl (pH 7.5), 2 mM EDTA, 5% glycerol, 5 mM dithiothreitol, 100 mM NaCl, and 0.6 M sucrose). The cells were broken using a French press at a constant pressure of 9000 p.s.i. The lysates were cleared of cellular debris by centrifugation at 8000 × g for 30 min at 4 °C. The cleared lysates were loaded onto two 60-ml tandem Q-Sepharose-SP-Sepharose columns that had been previously equilibrated with Buffer B (25 mM sodium phosphate (pH 7.5), 1 mM EDTA, 0.5 mM dithiothreitol, and 100 mM NaCl). The mutant cv-pdg proteins flowed through the Q-Sepharose but bound to the SP-Sepharose matrix and were eluted with a linear gradient of Buffer B from 0.1 M to 1.0 M NaCl (200 ml total volume). Fractions were collected and monitored by Western blot analysis and Coomassie Brilliant Blue R-250 staining of 15% polyacrylamide-SDS gels. The fractions that contained the mutant cv-pdg proteins were pooled, dialyzed, and loaded onto a 25-ml single-stranded DNA cellulose column that had been equilibrated with Buffer B. A linear gradient was run over the column of Buffer B from 0.1 M to 1.0 M NaCl (150 ml total volume). Several fractions appeared to contain pure cv-pdg by Coomassie Brilliant Blue staining and were subsequently analyzed via silver staining.

Qualitative in Vivo Assay of Mutant Enzyme Activity-- E. coli strain AB2480 (uvrA, recA-) containing the pET-11a vector with either wild type cv-pdg, E23D cv-pdg, or E23Q cv-pdg was grown overnight at 37 °C in LB medium containing 100 µg/ml amp. Aliquots of these cultures were streaked onto an LB agar plate that also contained 100 µg/ml amp. The liquid bacterial medium was allowed to dry, and areas on the plate were irradiated with 254-nm light at 1.0 µW/cm2 for increasing amounts of time. Following irradiation, the plates were incubated in the dark at 37 °C for 12 h.

Gel Mobility Shift Binding Assay-- The cis-syn 49-mer, trans-syn II 49-mer, reduced AP 49-mer, pyrrolidine (P) 25-mer (5'-GGATAGTGTCCAPGTTACTCGAAGC-3'), and tetrahydrofuran (F) 25-mer (5'-GGATAGTGTCCAFGTTACTCGAAGC-3') were 5'-end-labeled with [gamma -32P]ATP and annealed to the appropriate complementary oligonucleotide with an adenine opposite the damaged nucleotide. The reduced AP 49-mer was generated by the same method as the AP 49-mer substrate except that subsequent to treatment with UDG, the DNA was treated with 100 mM NaBH4 for 10 min at 25 °C. Binding of the E23D cv-pdg or E23Q cv-pdg was assessed by gel mobility shift analysis. The reactions were conducted in a 20-µl total volume with the appropriate dilutions of the enzymes, and 20 pM substrate DNA duplexes in 25 mM NaH2PO4 (pH 6.8), 100 mM NaCl, and 100 µg/ml bovine serum albumin and a 1000-fold weight excess of poly dI:dC over the specific target DNA duplex. The reactions were incubated for 30 min at 25 °C, followed by the addition of a one-half volume of loading buffer (50% glycerol and 0.05% (w/v) bromphenol blue). The free DNA was separated from the enzyme-bound DNA duplex by electrophoresis through an 8% native polyacrylamide gel in 45 mM Tris borate (pH 7.5) 1 mM EDTA for 3 h at 120 V. Free DNA and enzyme-bound DNA complexes were visualized by autoradiography of the wet gels using Hyperfilm (Amersham Pharmacia Biotech) x-ray film. The binding data was quantitated using a Molecular Dynamics PhosphorImager and ImageQuant software (Sunnyvale, CA). The data were plotted and fit to a hyperbolic curve function using Kaleidagraph (Synergy Software, Reading, PA). The KD values were determined to be the enzyme concentration at which 50% of the substrate was shifted.

Dimer-specific Nicking Activities-- Oligonucleotides (49-mers) containing either a site-specific cis-syn, trans-syn I, or trans-syn II thymine dimer were provided generously by Colin Smith and John-Stephen Taylor (Washington University, St. Louis, MO) with the sequence 5'-AGCTACCATGCCTGCACGAATTAAGCAATTCGTAATCATGGTCATAGCT3' (23, 25). The underlining shows the position of the dimer. These DNAs were 32P-labeled on the 5'-end with T4 polynucleotide kinase and annealed to an unlabeled complementary oligonucleotide. The double stranded thymine dimer-containing 49-mer was diluted with reaction buffer (25 mM NaH2PO4 (pH 6.8), 1 mM EDTA, 100 mM NaCl, and 100 µg/ml bovine serum albumin), and the appropriate concentrations of the T4-pdg, cv-pdg, E23D cv-pdg, or E23Q cv-pdg were added to the reactions for 30 min at 37 °C. Incision reactions were terminated by the addition of the loading buffer (95% (v/v) formamide, 20 mM EDTA, 0.02% (w/v) bromphenol blue, and 0.02% (w/v) xylene cyanol). The reactions were subsequently treated with 1 M piperidine and heated to boiling for 10 min. The purpose of the piperidine treatment was to convert any abasic sites into single strand breaks. The substrate DNAs were separated from the incision product DNAs by electrophoresis through a 15% denaturing polyacrylamide gel containing M urea. The DNA bands were visualized by autoradiography of the wet gels using Hyperfilm-MP x-ray film (Amersham Pharmacia Biotech).

AP Site-specific Nicking Activity-- A 49-mer oligonucleotide containing a site-specific uracil was synthesized (Midland Research) with the sequence 5'-AGCTACCATGCCTGCACGAAUTAAGCAATTCGTAATCATGGTCATAGCT-3'. The underlining shows the position of the uracil. This uracil-containing 49-mer was 32P-labeled on the 5'-end with T4 polynucleotide kinase and annealed to its complementary oligonucleotide. The double stranded uracil-containing 49-mer was incubated with uracil DNA glycosylase (Epicentre Technologies) for 10 min at 37 °C, generating an AP site. This oligonucleotide was then diluted with reaction buffer (25 mM NaH2PO4 (pH 6.8), 1 mM EDTA, 100 mM NaCl, and 100 µg/ml bovine serum albumin), and the appropriate concentrations of the T4-pdg, cv-pdg, E23D cv-pdg, or E23Q cv-pdg were added to the AP-containing DNA (30 min at 37 °C). The reactions were analyzed as described above.

Covalent Trapping of Imino Intermediate Using Sodium Borohydride-- Oligonucleotides containing either a cis-syn thymine dimer or the abasic site were diluted to obtain a final substrate concentration of 0.5 nM in the reaction buffer described above. Reactions were initiated by the simultaneous addition of 100 mM NaBH4 or 100 mM NaCl with 115 nM T4-pdg, cv-pdg, E23D cv-pdg, or E23Q cv-pdg. In control experiments, the substrates were preincubated with 100 mM NaBH4 or 100 mM NaCl for 5 min prior to addition of the enzymes. All reactions were incubated for 30 min at 25 °C. Reactions were terminated as described above, and the trapped complexes were separated from free DNAs by electrophoresis through a 15% polyacrylamide 8 M urea denaturing gel.

    RESULTS
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

Generation of Mutations at Glu-23 in cv-pdg and Protein Purification-- Site-directed mutagenesis was carried out on the pET-11a vector containing the cv-pdg gene using the Quikchange mutagenesis kit (Stratagene) to introduce a codon change at Glu-23 to create either a glutamine (E23Q) or an aspartic acid (E23D). The cv-pdg genes were completely sequenced to verify the identity at each nucleotide. These DNAs were transformed into E. coli BL21DE3 for expression. The mutant proteins were expressed and purified as described under "Experimental Procedures." The purity of the protein preparations was assessed by silver staining of a 15% polyacrylamide gel. E23Q cv-pdg (Fig. 1, lane 1), E23D cv-pdg (lane 2), and wild type cv-pdg (lane 3) were visible without any discernable contaminants.


View larger version (56K):
[in this window]
[in a new window]
 
Fig. 1.   SDS-polyacrylamide gel electrophoresis analysis of cv-pdg, E23D cv-pdg, and E23Q cv-pdg after silver staining. The left lane shows low range molecular mass markers (Low MW marker). Lanes 1-3 show the pure fractions of E23Q cv-pdg, E23D cv-pdg, and cv-pdg, respectively.

Relative UV Survival-- The ability of cv-pdg and the E23D and E23Q mutants to enhance the survival of an E. coli strain that is recombination and nucleotide excision repair-deficient (uvrA-, recA-) was determined by challenge with increasing doses of UV irradiation (Fig. 2). Plasmids containing the wild type and mutant cv-pdg genes were transformed into E. coli AB2480. Overnight cultures of these cells were streaked onto an agar plate and either completely shielded from UV irradiation (Fig. 2, lanes 1-4) or irradiated (lanes 5-8) for increasing times. Cells that expressed cv-pdg (lane 5) exhibited increased survival, whereas cells expressing the two mutants, E23D and E23Q (lanes 6 and 7, respectively), had survivals that were indistinguishable from cells that contained the pET11a vector alone (lane 8). These results demonstrate that cv-pdg led to increased survival of UV challenged bacteria, whereas the bacteria expressing cv-pdg mutants at Glu-23 resulted in no increased survival following UV challenge.


View larger version (73K):
[in this window]
[in a new window]
 
Fig. 2.   In vivo complementation of UV-irradiated repair-deficient E. coli by cv-pdg, E23D cv-pdg, and E23Q cv-pdg. E. coli AB2480 (uvrA-, recA-) cells containing the pET-lla vector with cv-pdg (lanes 1 and 5), E23D cv-pdg (lanes 2 and 6), or E23Q cv-pdg (lanes 3 and 7) or vector alone (lanes 4 and 8) were grown to stationary phase and applied to an agar plate containing 100 µg/ml amp. Cells in lanes 5-8 were UV-irradiated with 254-nm light at 1 µW/cm2 for increasing amounts of time from 0-35 s. Plates were then incubated for 12 h at 37 °C in the dark.

KD Determinations-- A possible explanation for the decreased UV survival of cells expressing mutant forms of cv-pdg was that these mutations altered pyrimidine dimer-specific binding. In order to estimate relative binding affinities, dissociation constants were determined for wild type and mutant enzyme on noncleavable substrate analogues. For these determinations, gel mobility shift analyses were chosen because this assay represents the standard method that is used to estimate KD values for other glycosylase/AP lyases in the base excision repair pathway, i.e. endonuclease VIII (26), Fpg (27), endonuclease V (28), and MutY (29). For these assays, it was necessary to use substrates that are not catalytic substrates for these enzymes. Although previously it had been demonstrated that T4-pdg and cv-pdg could not incise DNAs containing reduced AP sites, tetrahydrofuran residues, or pyrrolidine sites (23, 28), to ensure a complete lack of activity on these substrates, cv-pdg, E23D cv-pdg, and E23Q cv-pdg were examined for residual incision activity. The data in Fig. 3 show no activity for the enzyme preparations on any of these three substrates.


View larger version (57K):
[in this window]
[in a new window]
 
Fig. 3.   Reactions using DNAs with damaged oligonucleotides a reduced abasic site, pyrrolidine, or tetrahydrofuran. Oligonucleotides containing centrally located damage (A, reduced abasic site (49-mer); B, pyrrolidine (25-mer); C, tetrahydrofuran (25-mer)) were reacted with no enzyme (lane 1), cv-pdg (lane 2), E23D cv-pdg (lane 3), or E23Q cv-pdg (lane 4) for 30 min at 37 °C. All enzymes were at 115 nM. S represents the substrate band, and Sn represents the nicked substrate (product) band. The reaction products were separated by electrophoresis on a 15% polyacrylamide denaturing gel containing 8 M urea.

Gel shift analyses were performed to determine the relative dissociation constants for the wild type and mutant enzymes on noncleaveable substrates (Table I). Labeled DNAs were incubated with increasing concentrations of enzymes for 30 min at 25 °C and analyzed by native polyacrylamide gel electrophoresis. The wild type cv-pdg showed comparable dissociation constants to those determined for the E23D cv-pdg mutant on all of its noncleavable DNA substrates. These data strongly suggest that the decreased UV survival cannot be attributed to a loss of specific DNA binding. However, the E23Q cv-pdg mutant was found to have a reduced binding of 20-100-fold on all the substrates tested. These data indicate that reduced affinity for specific substrates may significantly contribute to reduced UV survival. In comparison, the T4-pdg mutant E23Q did not exhibit significant loss in binding to these noncleavable substrates, suggesting significant differences in the details of the damage recognition site.

                              
View this table:
[in this window]
[in a new window]
 
Table I
Dissociation constant determination

Pyrimidine Dimer Substrate Specificity-- To characterize the dimer substrate specificity, in vitro incision assays were used to determine the relative nicking activity of the wild type and mutant cv-pdg enzymes on separate DNAs, each containing one of the three isomers of the cyclobutane pyrimidine dimer, cis-syn, trans-syn I, or trans-syn II. Seven concentrations of T4-pdg, cv-pdg, and E23D cv-pdg were assessed for activity on the cis-syn thymine dimer 49-mer (Fig. 4). To monitor every glycosylase event and not only the combined glycosylase and concomitant AP lyase activities, the reactions were treated with piperidine prior to electrophoretic separation of substrates and nicked products. The relative activity between these proteins can be compared by the enzyme concentration that converted 50% of a 0.5 nM substrate into product in 30 min. These activity comparisons were made relative to the activity of the wild type cv-pdg on the cis-syn 49-mer (Table II). Wild type cv-pdg had a relative activity of 0.09 nM, T4-pdg was 0.19 nM, and E23D cv-pdg was 0.60 nM. Additionally, when these experiments were carried out without the final piperidine treatment, no decrease in the amount of product DNA generated was detected, suggesting that all the glycosylase activity was followed by a concomitant AP lyase activity (data not shown). E23Q cv-pdg was found to have no detectable activity on the cis-syn 49-mer, even when the reaction time was increased from 30 min to 6 h (data not shown). Consistent with this finding, the binding affinity of E23Q for DNA containing a cis-syn dimer was very weak (400 nM.) (Table I), a value approaching the affinity for undamaged DNA.


View larger version (32K):
[in this window]
[in a new window]
 
Fig. 4.   Cis-syn thymine dimer-specific nicking. An oligonucleotide containing a cis-syn thymine dimer (0.5 nM) was reacted with increasing concentrations of T4-pdg (endonuclease V) (A), cv-pdg (B), E23D cv-pdg (C), and E23Q cv-pdg (D) for 30 min at 37 °C. S represents the DNA substrate band, and Sn represents the nicked substrate (product) band. Following the 30-min incubation, each reaction was treated with piperidine to convert any DNAs containing AP sites to the incised product band. The reaction products were separated by electrophoresis on a 15% polyacrylamide denaturing gel containing 8 M urea. Lanes 1-7 are at 0, 0.094, 0.19, 0.37, 0.75, 1.5, and 3.0 nM for each enzyme except E23Q cv-pdg (D), for which lanes 1 and 2 are 0 and 3.0 nM.

                              
View this table:
[in this window]
[in a new window]
 
Table II
Specific activity of T4-pdg, cv-pdg, and cv-pdg mutants

Additionally, five concentrations of T4-pdg, cv-pdg, and E23D cv-pdg were analyzed for their activity on another isomer of the thymine dimer, trans-syn II (Fig. 5). Relative to the activities observed on the DNA containing the cis-syn dimer, the activity on this substrate was reduced for T4-pdg (6.0 nM) and cv-pdg (1.5 nM) (Table I). However, the most significant differential effect was evident when comparing the activities of the E23D cv-pdg enzyme on the trans-syn II and cis-syn isomers, in which the E23D cv-pdg lost all detectable activity on the trans-syn II isomer (Fig. 5D). The E23Q cv-pdg showed no activity on the trans-syn II dimers, data that are consistent with its lack of activity on the cis-syn dimer (Fig. 4D). Because cv-pdg mutants E23D and E23Q did not incise DNA containing the trans-syn II dimer, relative binding affinities were determined using this DNA as a substrate (Table I). The E23D mutant bound with a 1.5 nM affinity (Fig. 6) and yet was unable to cleave this substrate. The E23Q mutant displayed a significantly weaker affinity at 130 nM (Table I).


View larger version (51K):
[in this window]
[in a new window]
 
Fig. 5.   Trans-syn II thymine dimer-specific nicking activity. An oligonucleotide containing a trans-syn II thymine dimer (0.5 nM) was reacted with increasing concentrations of T4-pdg (B), cv-pdg (C), and E23D cv-pdg (D) for 30 min at 37 °C. A shows control trans-syn II dimer DNA without the addition of any enzyme. B-D (lanes 1-5) show reactions at 0.37, 0.75, 3.0, 12.0, and 48.0 nM, respectively, for each enzyme. S represents the substrate band, and Sn represents the nicked substrate (product) band. The reaction products were separated by electrophoresis on a 15% polyacrylamide denaturing gel containing 8 M urea.


View larger version (25K):
[in this window]
[in a new window]
 
Fig. 6.   Gel Shift of E23D cv-pdg on trans-syn II 49-mer. A, oligonucleotides containing a trans-syn II thymine dimer (20 pM) were incubated with increasing concentrations of E23D cv-pdg for 30 min at 25 °C. The products were separated by electrophoresis through an 8% native polyacrylamide gel. The wet gels were visualized on x-ray film, and the substrate and product bands were quantitated using a Molecular Dynamics PhosphorImager and ImageQuant software. B, the data were plotted using Kaleidgraph software, and the KD was determined by fitting the data to a hyperbolic function, plotting percentage shifted versus enzyme concentration, and determining the enzyme concentration that resulted in a 50% substrate shift.

T4-pdg, cv-pdg, E23D cv-pdg, and E23Q cv-pdg were also examined for activity on a third thymine dimer isomer, trans-syn I. Because it had been previously reported that this preparation of trans-syn I dimer was contaminated with 1-2% cis-syn dimer (23), when each of the enzymes were reacted with this substrate, approximately 5% of the DNAs were incised (Fig. 7A). These data were consistent with incision at the cis-syn contaminant and not the trans-syn I substrate. However, to confirm this interpretation, kinetic experiments were carried out at a very high enzyme concentration (175 nM) (Fig. 7B). These results demonstrated no increase in product DNAs beyond that observed in Fig. 7A. Taken together, these data suggest that T4-pdg, cv-pdg, and E23D cv-pdg do not have substantial activity on DNA containing the trans-syn I isomer.


View larger version (26K):
[in this window]
[in a new window]
 
Fig. 7.   Trans-syn I thymine dimer-specific nicking activity. An oligonucleotide containing a trans-syn I thymine dimer (0.5 nM) was reacted with increasing concentrations of T4-pdg, cv-pdg, and E23D cv-pdg for 30 min at 37 °C. A, lane 1, control trans-syn I dimer with no added enzyme; lanes 2-4, T4-pdg; lanes 5-7, cv-pdg; lanes 8-10, E23D cv-pdg; each at 12, 48, and 192 nM, respectively. B shows a kinetic analysis of incision of DNA containing trans-syn I dimer (0.5 nM) with T4-pdg (115 nM) (lanes 2-5) and cv-pdg (115 nM) (lanes 6-9). Time points were taken at 0, 1, 2, 4, and 6 h, for T4-pdg and cv-pdg (lanes 2-5 and 6-9, respectively). S represents the substrate DNA band, and Sn represents the nicked substrate (product) band. The reaction products were separated by electrophoresis on a 15% polyacrylamide denaturing gel containing 8 M urea.

AP Site-specific Nicking Activity on Synthetic Oligonucleotides-- In order to determine the ability of T4-pdg, cv-pdg, E23D cv-pdg, and E23Q cv-pdg to incise DNA at AP sites, an AP-containing oligonucleotide was prepared as described under "Experimental Procedures." This 32P-labeled duplex AP-containing 49-mer (0.5 nM) was incubated with seven concentrations of the pure enzymes for 30 min at 25 °C (Fig. 8). The relative activities of T4-pdg (0.15 nM), cv-pdg (0.17 nM), and E23D cv-pdg (0.18 nM) on the AP-containing 49-mer were very consistent, whereas the E23Q cv-pdg mutant, which had no activity on DNA containing cyclobutane dimers (Fig. 4D), had very low activity (>115 nM) (Table II and Fig. 9A). This approximately 1000-fold decreased activity of the E23Q cv-pdg mutant, relative to either of the two wild type enzymes, was confirmed by kinetic experiments (Fig. 9B).


View larger version (42K):
[in this window]
[in a new window]
 
Fig. 8.   AP site-specific nicking. An oligonucleotide containing an abasic site (0.5 nM) was reacted with increasing concentrations of T4-pdg (A), cv-pdg (B), E23D cv-pdg (C), and E23Q cv-pdg (D) for 30 min at 25 °C. The concentrations of T4-pdg and cv-pdg were 0, 0.023, 0.047, 0.094, 0.19, 0.37, and 0.75 nM for lanes 1-7, respectively; concentrations of E23D cv-pdg were 0, 0.047, 0.094, 0.19, 0.37, 0.75, and 1.5 nM for lanes 1-7, respectively; and concentrations of E23Q cv-pdg were 0 and 1.5 nM, for lanes 1 and 2, respectively. S represents the substrate DNA band, and Sn represents the nicked substrate (product) band. The reaction products were separated by electrophoresis on a 15% polyacrylamide denaturing gel containing 8 M urea.


View larger version (49K):
[in this window]
[in a new window]
 
Fig. 9.   E23Q cv-pdg incision of a synthetic oligonucleotide containing an abasic site. An oligonucleotide containing an abasic site (0.5 nM) was reacted with increasing concentrations of E23Q cv-pdg for 30 min at 25 °C. A, lanes 1-6 show increasing concentrations of E23Q cv-pdg 0, 57.5, 115, 172.5, 230, and 287.5 nM, respectively. Due to the relatively high enzyme concentration necessary to achieve a small amount of nicked substrate, a kinetic experiment (B) was carried out in which 0.5 nM DNA was reacted with 115 nM E23Q cv-pdg for increasing amounts of time. Lane 1 shows the reaction at 0 h, and lanes 2-7 show the DNA products at 0.5, 1, 2, 3, 4, and 5 h, respectively. S represents the substrate DNA band, and Sn represents the nicked substrate (product) band. The reaction products were separated by electrophoresis on a 15% polyacrylamide denaturing gel containing 8 M urea.

Covalent Trapping of the Imino Intermediate via NaBH4-- Previously, it was determined that other glycosylase/AP lyases that function in the base excision repair pathway are able to cleave the phosphodiester backbone via a beta -elimination reaction through the formation of an imino intermediate (17, 30). In support of this conclusion was the ability of these enzymes to be covalently trapped on DNAs containing pyrimidine dimers and abasic sites when reactions were carried out in the presence of a strong reducing agent, NaBH4. Thus, the ability to form and trap this imino intermediate was assessed for all the enzymes on both the cis-syn- and AP site-containing 49-mers (Fig. 10, A and B, respectively). The reactions shown in the first lane of each enzyme grouping (Fig. 10, A, lanes 2, 5, 8, and 12, and B, lanes 2, 5, 8, and 11) were conducted such that the NaBH4 and the appropriate enzyme at 115 nM were simultaneously added to the substrate DNA. The trapped complexes were observed as having reduced mobility due to the enzyme-DNA covalent linkage upon NaBH4 reduction. Significant amounts of trapped complexes were evident for T4-pdg and cv-pdg, whereas a small amount of trapped complex was visible for the E23D cv-pdg mutant on the cis-syn 49-mer. No trapped complex was evident for the E23Q cv-pdg mutant. The DNAs shown in the second lane of each enzyme grouping (Fig. 10, A, lanes 3, 6, 9, and 13, and B, lanes 3, 6, 9, and 12) show the data from experiments in which the substrates were preincubated with 100 mM NaBH4 for 5 min prior to the addition of enzyme. This preincubation step did not significantly affect the amount of pyrimidine dimer trapped complex seen as an altered mobility in the gel for the T4-pdg and cv-pdg, whereas no trapped complexes were observed for either the E23D or E23Q cv-pdg mutant.


View larger version (25K):
[in this window]
[in a new window]
 
Fig. 10.   Covalent trapping on cis-syn dimer and AP site containing DNA. DNAs containing either a centrally located cis-syn thymine dimer (0.5 nM) (A) or a centrally located abasic site (0.5 nM) (B) were incubated with 115 nM of T4-pdg, cv-pdg, E23D cv-pdg, and E23Q cv-pdg. DNAs were either preincubated with 100 mM NaBH4 for 5 min prior to addition of the enzyme or added simultaneously with the enzyme. Reactions were incubated for 30 min at 25 °C. S represents the substrate DNA band, Sn represents the nicked substrate (product) band, and E-S represents the enzyme DNA covalent complex.

When the abasic site containing 49-mer was used as a substrate, T4-pdg, cv-pdg, and E23D cv-pdg were all trapped, a result consistent with the incision data (Fig. 10B). No trapped complex appeared with the E23Q cv-pdg mutant. Also as expected, preincubation of the AP-containing DNA with NaBH4 resulted in an inability to trap covalent complexes when the enzymes were added after the 5 min preincubation. During the initial 5-min incubation, all AP sites were reduced and thus not subject to covalent trapping by NaBH4. The remainder of the experiments were controls to show activity on the cis-syn and AP site containing 49-mers.

    DISCUSSION
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

In the initial description of cv-pdg, Chlorella cells that were infected with Paramecium bursaria Chlorella virus-1 were found to have dimer-specific nicking activity similar to the activity exhibited by T4-pdg (7, 23). The 41% amino acid identity between these two enzymes, as well as a basic similarity in substrate activity, led to the formation of a structural model for cv-pdg based on the x-ray crystal structures of T4-pdg and T4-pdg bound to a dimer-containing oligonucleotide. Through analysis of this structural model, site-directed mutants were designed to examine the catalytic mechanism of cv-pdg. Due to the proximity of Glu-23 to the dimer in the modeled structure and the mechanistic information available about other glycosylase/AP lyases, this residue was hypothesized to serve as the acidic residue necessary for glycosidic bond destabilization. This allows the C1' of the deoxyribose sugar of the 5' pyrimidine to become vulnerable to attack from a primary or secondary amine. Mutations in cv-pdg were designed to assess the necessity of the acidic charge at this position (E23Q) and the importance of side chain positioning in the active site (E23D).

Initially, the wild type and mutant cv-pdg enzymes were assessed for their ability to enhance the survival of recombinational repair and nucleotide excision repair deficient E. coli. Wild type cv-pdg enhanced survival over that of the plasmid alone, whereas both of the mutants resulted in survival levels corresponding to that seen with the plasmid alone. The inability of either the E23D or E23Q cv-pdg mutants to enhance survival of repair-deficient E. coli are consistent with the results obtained when the same mutations were created in T4-pdg. However, this lack of biological activity is not completely consistent with the relative in vitro activities of the E23D mutants of cv-pdg versus T4-pdg, in which the cv-pdg mutant retained substantial cis-syn dimer-specific nicking activity. An understanding of this difference may lie in the differential specific activities of the two mutants. Although similar differences in in vitro versus in vivo activities have been previously observed for mutants of T4-pdg that affect nontarget binding, there is no indication that the E23D cv-pdg mutant has been affected in the mechanism of target site location (31-33). However, these differential survivals provided the first evidence that Glu-23 was going to be critical for the activity of this enzyme. This led us to perform a number of more sensitive in vitro assays to determine the relative binding and activity of the wild type and mutant proteins on various isomers of thymine dimers and abasic sites.

The E23Q mutant was inactive on all thymine dimer-containing substrates tested. This result indicates that the acidic nature at Glu-23 is critical to thymine dimer-specific nicking activity, although a confounding factor in this analysis was that dimer-specific DNA binding was greatly reduced in this mutant. However, the overall fold of E23Q cv-pdg is probably correct because it did have some very minor activity on AP site-containing DNA; however, even this activity could be attributed to the presence of various basic residues on the face of this DNA binding enzyme in close proximity to the AP site. Similar observations have been made for DNA ligase on AP-containing DNAs (8).

The E23D cv-pdg mutant exhibited very similar activity on AP-containing DNA to both the wild type cv-pdg and the T4-pdg controls. The activity seen on the cis-syn isomer of the thymine dimer was only slightly diminished for E23D when compared with native cv-pdg. This is in stark contrast to the results observed for the E23D T4-pdg mutant, which has less than 1% of the activity of the wild type T4-pdg (15). This could possibly be explained by a more flexible active site, initially hypothesized by McCullough et al. (23), based on the broader substrate specificity seen for cv-pdg relative to T4-pdg. An additional interesting feature of the E23D cv-pdg mutant was that it had no detectable activity on the trans-syn II isomer, whereas the wild type cv-pdg and T4-pdg had slightly diminished activity when compared with the cis-syn isomer. The trans-syn II thymine dimer has the 3' thymine of the dimer flipped trans, which might alter the positioning of the 5' thymine due to steric considerations. Taking into consideration that these enzymes perform their chemistry on the 5' thymine of the dimer, this could help to explain the activity results obtained for the wild type and E23D cv-pdg. The relative activity between the cis-syn dimer and the trans-syn II isomer for cv-pdg shows approximately a 16-fold decrease. This decrease could result from a slight alteration in the active site geometry. The lack of activity of the E23D cv-pdg mutant on the DNA containing trans-syn II dimers may simply reflect that by shortening the side chain by one carbon, the carboxyl side chain can no longer facilitate glycosyl bond scission but is still appropriately positioned to catalyze the beta -elimination reaction. In the case of the trans-syn I isomer, the 5' thymine is moved into a trans position. The 5' thymine being in a significantly different position could account for the lack of activity of any of these glycosylase/AP lyases, as well as their mutants.

Binding studies were performed to ensure that the mutants that had lost activity had not lost the ability to bind to the DNA. The E23D cv-pdg mutant bound to a trans-syn II dimer with a dissociation constant that showed tighter affinity than that observed for cv-pdg bound to a cis-syn thymine dimer or some of the noncleavable substrates. These data indicate that the inability to incise the DNA at trans-syn II dimers was not a result of a decreased binding to the substrate DNA. The E23D cv-pdg enzyme was able to bind to all noncleavable substrates with approximately equal affinity. These affinities were significantly tighter than that measured for the E23D T4-pdg binding to noncleavable substrates, thus supporting the hypothesis that the active site for cv-pdg may be more flexible.

In the reaction mechanism hypothesized for glycosylase/AP lyases in the base excision repair pathway, there is a combined action requiring an acidic residue and a primary amine. It is hypothesized that Glu-23 is the acidic residue that contributes to glycosidic bond destabilization, functioning either at the ring oxygen of the deoxyribose sugar or the C2 of the thymine. Following this destabilization, a primary amine catalyzes a nucleophilic displacement reaction at the C1' of the deoxyribose sugar. In this reaction mechanism, the enzyme DNA complex forms an imino intermediate, which would be reduced to a covalent complex in the presence of a strong reducing agent. Relevant to these hypotheses, the E23Q cv-pdg mutant could not be trapped on either a cis-syn dimer-containing DNA or an abasic site-containing DNA, suggesting that the acidic character at this position is essential to facilitate the reaction mechanism. The E23D cv-pdg mutant could be trapped on the abasic site-containing DNA to levels approximately the same as those of the wild type cv-pdg and T4-pdg. However, the ability to form a trapped complex for the E23D cv-pdg mutant was significantly reduced when compared with cv-pdg. This result is somewhat surprising, but it may be due to the decrease in the activity that is seen between these two enzymes.

The site-directed mutations that were examined in this study give significant insight into the mechanism of this glycosylase/AP lyase. It is evident that the presence of a carboxylate-containing side chain at the 23rd position is essential to both the glycosylase and the AP lyase activities of this enzyme. There must be a relatively flexible active site in this enzyme as the E23D mutant retains activity on a cis-syn thymine dimer and an abasic site. The ability to trap the wild type cv-pdg and the E23D cv-pdg mutant onto the DNA through the formation of a covalent complex using a strong reducing agent suggests that this glycosylase AP lyase follows the mechanism hypothesized for T4-pdg (17).

    ACKNOWLEDGEMENTS

We thank Drs. J. S. Taylor and C. Smith (Washington University, St. Louis, MO) for their generous gift of synthetic oligonucleotides containing site-specific cis-syn, trans-syn I, and trans-syn II thymine dimers. We thank Drs. F. Johnson and A. Grollman (State University of New York, Stony Brook, NY) for providing the synthetic oligonucleotide containing tetrahydrofuran. The pyrrolidine-containing oligonucleotide was provided by Drs. O. Scharer and G. L. Verdine (Harvard University). The initial amino acid sequence alignment and molecular modeling studies were carried out by Dr. M. L. Dodson. The DNA sequencing and oligonucleotide synthesis was performed by the NIEHS, National Institutes of Health, Molecular Biology Core under the direction of Dr. T. G. Wood, and the T4-pdg was purified by J. R. Carmical.

    FOOTNOTES

* This work supported by NIEHS, National Institutes of Health Grants T327254, ES04091, and ES06676.The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

Holder of the Distinguished Chair for Environmental Toxicology from the Houston Endowment. To whom correspondence should be addressed: Sealy Center for Molecular Science, University of Texas Medical Branch, 301 University Blvd., Galveston, TX 77555-1071. Tel.: 409-772-2179; Fax: 409-772-1790; E-mail: rslloyd{at}utmb.edu.

2 J. Van Etten, personal communication.

    ABBREVIATIONS

The abbreviations used are: AP, abasic; T4-pdg, T4 bacteriophage pyrimidine dimer glycosylase; cv-pdg, Chlorella virus pyrimidine dimer glycosylase; amp, ampicillin; PCR, polymerase chain reaction.

    REFERENCES
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES
  1. Wang, S. Y. (ed) (1976) Photochemistry and Photobiology of Nucleic Acids, Vol. I, pp. 169-225, Academic Press, New York
  2. Kim, J., and Linn, S. (1988) Nucleic Acids Res. 16, 1135-1141[Abstract/Free Full Text]
  3. Manaharan, M., Mazumder, A., Ransom, S. C., and Gerlt, J. A. (1988) J. Am. Chem. Soc. 110, 2690-2691[CrossRef]
  4. Bailey, V., Sente, B., and Verly, W. G. (1989) Biochem. J. 259, 751-759[Medline] [Order article via Infotrieve]
  5. Lloyd, R. S. (1998) Mutat. Res. 408, 159-170[Medline] [Order article via Infotrieve]
  6. Lloyd, R. S. (1999) Prog. Nucleic Acid Res. Mol. Biol. 62, 155-175[Medline] [Order article via Infotrieve]
  7. Furuta, M., Schrader, J. O., Schrader, H. S., Kokjohn, T. A., Nyaga, S., McCullough, A. K., Lloyd, R. S., Burbank, D. E., Landstein, D., Lane, L., and Van Etten, J. L. (1997) Appl. Environ. Microbiol. 63, 1551-1556[Abstract]
  8. Bogenhagen, D. F., and Pinz, K. G. (1998) J. Biol. Chem. 273, 7888-7893[Abstract/Free Full Text]
  9. Morikawa, K., Matsumoto, O., Tsujimoto, M., Katayanagi, K., Ariyoshi, M., Doi, T., Ikehara, M., Inaoka, T., and Ohtsuka, E. (1992) Science 256, 523-526[Abstract/Free Full Text]
  10. Morikawa, K., Ariyoshi, M., Vassylyev, D. G., Matsumoto, O., Katayanagi, K., and Ohtsuka, E. (1995) J. Mol. Biol. 249, 360-375[CrossRef][Medline] [Order article via Infotrieve]
  11. Schrock, R. D., III, and Lloyd, R. S. (1991) J. Biol. Chem. 266, 17631-17639[Abstract/Free Full Text]
  12. Schrock, R. D., III, and Lloyd, R. S. (1993) J. Biol. Chem. 268, 880-886[Abstract/Free Full Text]
  13. Doi, T., Recktenwald, A., Karaki, Y., Kikuchi, M., Morikawa, K., Ikehara, M., Inaoka, T., Hori, N., and Ohtsuka, E. (1992) Proc. Natl. Acad. Sci. U. S. A. 89, 9420-9424[Abstract/Free Full Text]
  14. Hori, N., Doi, T., Karaki, Y., Kikuchi, M., Ikehara, M., and Ohtsuka, E. (1992) Nucleic Acids Res. 20, 4761-4764[Abstract/Free Full Text]
  15. Manuel, R. C., Latham, K. A., Dodson, M. L., and Lloyd, R. S. (1995) J. Biol. Chem. 270, 2652-2661[Abstract/Free Full Text]
  16. Dodson, M. L., Schrock, R. D., III, and Lloyd, R. S. (1993) Biochemistry 32, 8284-8290[CrossRef][Medline] [Order article via Infotrieve]
  17. Dodson, M. L., Michaels, M. L., and Lloyd, R. S. (1994) J. Biol. Chem. 269, 32709-32712[Free Full Text]
  18. McCullough, A. K., Dodson, M. L., Scharer, O. D., and Lloyd, R. S. (1997) J. Biol. Chem. 272, 27210-27217[Abstract/Free Full Text]
  19. Zharkov, D. O., Rieger, R. A., Iden, C. R., and Grollman, A. P. (1997) J. Biol. Chem. 272, 5335-5341[Abstract/Free Full Text]
  20. Tchou, J., and Grollman, A. P. (1995) J. Biol. Chem. 270, 11671-11677[Abstract/Free Full Text]
  21. Zharkov, D. O., and Grollman, A. P. (1998) Biochemistry 37, 12384-12394[CrossRef][Medline] [Order article via Infotrieve]
  22. Ikeda, S., Biswas, T., Roy, R., Izumi, T., Boldogh, I., Kurosky, A., Sarker, A. H., Seki, S., and Mitra, S. (1998) J. Biol. Chem. 273, 21585-21593[Abstract/Free Full Text]
  23. McCullough, A. K., Romberg, M. T., Nyaga, S., Wei, Y., Wood, T. G., Taylor, J. S., Van Etten, J. L., Dodson, M. L., and Lloyd, R. S. (1998) J. Biol. Chem. 273, 13136-13142[Abstract/Free Full Text]
  24. Nicholls, A., Sharp, K., and Honig, B. (1991) Proteins Struct. Funct. Genet. 11, 281-296[CrossRef][Medline] [Order article via Infotrieve]
  25. Smith, C. A., and Taylor, J.-S. (1993) J. Biol. Chem. 268, 11143-11151[Abstract/Free Full Text]
  26. Jiang, D., Hatahet, Z., Melamede, R. J., Kow, Y. W., and Wallace, S. S. (1997) J. Biol. Chem. 272, 32230-32239[Abstract/Free Full Text]
  27. Castaing, B., Boiteux, S., and Zelwer, C. (1992) Nucleic Acids Res. 20, 389-394[Abstract/Free Full Text]
  28. McCullough, A. K., Scharer, O., Verdine, G. L., and Lloyd, R. S. (1996) J. Biol. Chem. 271, 32147-32152[Abstract/Free Full Text]
  29. Manuel, R. C., and Lloyd, R. S. (1997) Biochemistry 36, 11140-11152[CrossRef][Medline] [Order article via Infotrieve]
  30. Scharer, O. D., Deng, L., and Verdine, G. L. (1997) Curr. Opin. Chem. Biol. 1, 526-531[CrossRef][Medline] [Order article via Infotrieve]
  31. Dowd, D. R., and Lloyd, R. S. (1989) Biochemistry 28, 8699-8705[CrossRef][Medline] [Order article via Infotrieve]
  32. Dowd, D. R., and Lloyd, R. S. (1990) J. Biol. Chem. 265, 3424-3431[Abstract/Free Full Text]
  33. Dowd, D. R., and Lloyd, R. S. (1990) J. Mol. Biol. 208, 701-707


Copyright © 1999 by The American Society for Biochemistry and Molecular Biology, Inc.
Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
Nucleic Acids ResHome page
E. van den Born, M. V. Omelchenko, A. Bekkelund, V. Leihne, E. V. Koonin, V. V. Dolja, and P. O. Falnes
Viral AlkB proteins repair RNA damage by oxidative demethylation
Nucleic Acids Res., October 1, 2008; 36(17): 5451 - 5461.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
A. M. Wilstermann and N. Osheroff
Base Excision Repair Intermediates as Topoisomerase II Poisons
J. Biol. Chem., November 30, 2001; 276(49): 46290 - 46296.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
S. G. Nyaga and R. S. Lloyd
Two Glycosylase/Abasic Lyases from Neisseria mucosa That Initiate DNA Repair at Sites of UV-induced Photoproducts
J. Biol. Chem., July 28, 2000; 275(31): 23569 - 23576.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
S. Burgess, P. Jaruga, M. L. Dodson, M. Dizdaroglu, and R. S. Lloyd
Determination of Active Site Residues in Escherichia coli Endonuclease VIII
J. Biol. Chem., January 18, 2002; 277(4): 2938 - 2944.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow