![]()
|
|
||||||||
J Biol Chem, Vol. 274, Issue 15, 10105-10112, April 9, 1999
,
,
, andFrom the Department of Pharmacology and Therapeutics, McGill University, Montreal, Quebec H3G 1Y6, Canada
| |
ABSTRACT |
|---|
|
|
|---|
This paper tests the hypothesis that DNA
methyltransferase plays a causal role in cellular transformation
induced by SV40 T antigen. We show that T antigen expression results in
elevation of DNA methyltransferase (MeTase) mRNA, DNA MeTase
protein levels, and global genomic DNA methylation. A T antigen mutant
that has lost the ability to bind pRb does not induce DNA MeTase. This up-regulation of DNA MeTase by T antigen occurs mainly at the posttranscriptional level by altering mRNA stability. Inhibition of
DNA MeTase by antisense oligonucleotide inhibitors results in
inhibition of induction of cellular transformation by T antigen as
determined by a transient transfection and soft agar assay. These
results suggest that elevation of DNA MeTase is an essential component
of the oncogenic program induced by T antigen.
In mammalian cells 60-80% of CpG dinucleotides are methylated,
forming a pattern that correlates with gene expression (1, 2). The DNA
5-cytosine methyltransferase (DNA
MeTase)1 is the enzyme
responsible for the establishment of this pattern (3). Several reports
have demonstrated that cancer cells bear increased levels of DNA MeTase
(4), that increased DNA MeTase is an early event in tumor progression
in an animal model of lung carcinogenesis (5), and that regional
hypermethylation is characteristic of tumor cells (6, 7). However, the
extent to which DNA MeTase activity is elevated in cancer cells
in vivo is still debatable (8).
A basic question is whether an increase in DNA MeTase activity is a
critical downstream component of oncogenic pathways (9) or whether it
is an aberrant consequence of the transformed state? One molecular link
between DNA MeTase and an oncogenic pathway is the observation that its
expression in mouse cells is up-regulated at the transcriptional level
by the Ras signaling pathway (9-11). Several lines of evidence have
suggested recently that elevated DNA MeTase might play a causal role in
cancer (12). Inhibition of DNA MeTase in Y1 adrenal carcinoma cells by
either expressing an antisense to DNA MeTase (13) or by antisense
oligonucleotides (14) inhibits tumorigenesis ex vivo.
Injection of DNA MeTase antisense oligonucleotides into mice harboring
Y1 tumors inhibits tumor growth in vivo (14), and reduction
of DNA MeTase level by 5-azaCdR suppresses neoplasia in Min
mice (15).
If increased DNA MeTase is a necessary constituent of cellular
transformation, it should be induced by diverse oncogenic pathways. SV40 T antigen is one of the most studied viral oncoproteins that can
induce frequent tumors when expressed as a transgene in mice (16), can
immortalize primary cell lines (17) or transform immortalized cells
(18), but transforms primary cells only when expressed in conjunction
with Ras or other components of its signaling pathway (19). Thus, T
antigen induces a very effective transformation pathway that is
complementary to, but different from, the one induced by Ras. Extensive
studies have established that T antigen transformation is a consequence
of its ability to physically interact with the tumor suppressors pRb
(20) and p53(21) as well as yet non characterized functions. A recent
observation has shown that two human SV40-transformed lines express
higher levels of DNA MeTase protein than their nontransformed
counterparts (22). Is it possible that similar to the Ras signaling
pathway, the T antigen-tumor suppressor pathway utilizes DNA MeTase as
a downstream effector? This paper tests this hypothesis by determining
whether expression of T antigen increases the levels of DNA MeTase
mRNA and protein in the cell, defining the level of gene expression regulation at which T antigen acts, and testing whether DNA MeTase plays a causal role in T antigen triggered cellular transformation?
Cell Culture and DNA-mediated Gene Transfer--
Balb/c 3T3
cells (ATCC) were maintained as monolayers in Dulbecco's modified
Eagle's medium medium which was supplemented with 10%
heat-inactivated fetal calf serum (Immunocorp, Montreal). All other
media and reagents for cell culture were obtained from Life
Technologies, Inc. Cells (1 × 106) were plated on a
150-mm dish (Nunc) 15 h before transfection. The pZip U19 (ts
A58)Tneo T antigen expressing vector (23) (this plasmid
expresses high levels of T antigen and is highly transforming in our
experience at 37 °C, it was not temperature-sensitive in our
experience) was introduced into Balb/c 3T3 cells with 1 µg of
pUCSVneo as a selectable marker by DNA mediated gene
transfer using the calcium phosphate protocol. Selection was initiated 48 h after transfection by adding 1 mg/ml G418 (Life Technologies, Inc.) to the medium. G418-resistant cells were cloned in selective medium.
Tumorigenicity Assay--
For analysis of growth in soft agar,
3 × 103 cells were seeded in triplicate onto a six
well dish (Falcon) in 4 ml of complete medium containing 0.33% agar
solution at 37 °C (24). Cells were fed with 2 ml of medium every 2 days. Growth was scored as colonies containing >10 cells, 21 days
after plating.
Oligodeoxynucleotide Treatment and Transient
Transfection--
Cells were plated on tissue culture grade 100-mm
dishes at a density of 1 × 105/plate 24 h before
treatment. Each treatment was performed in triplicate. The
phosphorothioate oligodeoxynucleotides used in this study are
HYB101584, which is antisense to a sequence encoding the second
putative translation initiation site of DNA MeTase (5'-TCT ATT TGA GTC
TGC CAT TT-3') and the reverse sequence HYB101585 (5'-TTT ACC GTC TGA
GTT TAT CT-3') as described in Ref. 14. To determine whether DNA MeTase
antisense oligonucleotides inhibit transformation initiated by
transient expression of T antigen, Balb/c 3T3 cells were plated at a
density of 2.5 × 104/well in a six-well plate 24 h before initiation of oligonucleotide treatment. Oligonucleotides were
mixed with 31 µl of Lipofectin (Life Technologies, Inc.) and 4 ml of
Opti-MEM (Life Technologies, Inc.) were added to the mix. The cells
were incubated in the Opti-MEM/oligonucleotide mix for 4 h,
following which the mix was replaced with regular growth medium. The
cells were treated with 100 nM amounts of either HYB101584,
HYB101585, or with Lipofectin carrier alone. 48 h after plating, 2 µg of either pZip U19 (ts A58)Tneo, T ant Rb DNA and RNA Analyses--
Genomic DNA was prepared from pelleted
nuclei, and total cellular RNA was prepared from cytosolic fractions.
To quantify the relative abundance of DNA MeTase and T antigen
mRNA, total RNA (5 µg) was blotted onto Hybond N+ using the
Bio-Rad slot blot apparatus. The filter-bound RNA was hybridized to a
32P-labeled 0.6-kilobase pair cDNA probe encoding the
5' sequences of the mouse DNA MeTase (1-600) (13) and exposed to XAR
film (Eastman Kodak Co.). The filter was rehybridized with a T antigen probe, and after removing this probe, the filter was hybridized to an
18 S RNA-specific 32P-labeled oligonucleotide (13). The
autoradiograms were scanned with a Scanalytics scanner (one D
analysis), and the signal at each band was determined. The signal
obtained at each point was normalized to the amount of total RNA at the
same point. For Northern blot analysis, the RNA was transferred to an
Hybond N+ membrane (Amersham Pharmacia Biotech). The Northern blots
were hybridized to a 0.6-kilobase pair antisense fragment resulting
from a single stranded PCR reaction with a DNA MeTase cDNA fragment
(1-600) using the oligonucleotide (TCAATGACAGCTCTCTCTGGTGTGACG) as a
3' primer and a single-stranded PCR amplification of c-fos
(1440-1458) using the oligonucleotide (CCCAGCCCACAAAGGTCCAGAATC) as a
3' primer as well as an oligonucleotide hybridizing to 18 S rRNA. The
autoradiograms were quantified by densitometry (Scanalytics), and
hybridization was plotted as DNA MeTase signal standardized to 18 S and
compared with 0 h actinomycin D treatment.
RNase Protection Assays--
RNA was prepared from exponentially
growing cells using standard protocols. RNase protection assays were
performed as described in Ref. 11 using a 0.7-kilobase pair
HindIII-BamHI fragment as a riboprobe. This probe
is a genomic fragment bearing exons 3 and 4 of the murine DNA MeTase
probe. It therefore protects, as described in Ref. 11, two major bands
of 112 and 100 nucleotides corresponding to these exons as well as a
number of minor alternatively spliced and alternate initiations as
described previously (25). To normalize the signal obtained for DNA
MeTase with the amount of total RNA present in each sample and to
verify equal loading, the RNA was simultaneously hybridized with a
32P-labeled riboprobe complementary to 18 S RNA and
subjected to RNase digestion and protection (Ambion).
Nuclear Run-on Assays--
Nuclei were prepared from 3 × 106 exponentially growing 3T3 and T ant 10 transfectants
and were incubated with [ Nearest Neighbor Analysis--
Two µg of DNA were incubated at
37 °C for 15 min with 0.1 unit of DNase, 2.5 µl of
[ Assay of DNA Methyltransferase Activity--
To determine
nuclear DNA MeTase levels, cells were harvested immediately
posttransfection, and DNA MeTase activity was assayed as described
previously (26).
Bisulfite Mapping--
Bisulfite mapping was performed as
described previously with small modifications (27). Sodium bisulfite,
catalog number S-8890, free weight = 104, was used. A 3.6 M
solution of sodium bisulfite (ACS grade, Sigma) (pH 5) was prepared
fresh each time, and a 20 mM stock of solution of
hydroquinone was prepared and stored at To determine whether ectopic expression of T antigen alters the
levels of DNA MeTase in the cell, we cotransfected immortalized but
nontransformed Balb/c 3T3 cells with a T antigen expression vector
pZipneoSV40U19tsA58 (23), and G418-resistant clones were isolated. Quantification of the level of DNA MeTase mRNA as a function of T antigen expression in 24 independent T antigen
transfectants by a slot blot analysis (Fig.
1A) shows a strong stimulation
of DNA MeTase mRNA by increasing levels of T antigen expression, as
assessed by quantifying the hybridization signals obtained with a DNA
MeTase probe or T antigen probe and normalizing these signals to the
signal observed following hybridization to an 18 S ribosomal RNA probe.
Our data show a good correlation between T antigen and DNA MeTase
expression. The levels of DNA MeTase mRNA in four independent
neo clones expressing the selection marker but not T antigen
remain significantly lower than the levels observed in the high T
antigen expressers (Fig. 1A). These data exclude the
possibility that the dramatic increase in DNA MeTase observed in T
antigen transfectants is a consequence of clonal variability in
expression of this gene.
![]()
INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES
![]()
EXPERIMENTAL PROCEDURES
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES
or pUC SV
neo plasmids were included in the transfection mix with
oligonucleotides. The oligonucleotide treatment was then repeated a
third time 72 h after plating with oligonucleotides but without
plasmid. The cells were then harvested following the third treatment
and counted. The viability was determined by trypan blue dye exclusion,
and the cells were plated onto soft agar as described above. For RNase protection, methyltransferase activity assay and nearest neighbor analysis, RNA, nuclear extracts, and DNA were prepared from treated cells as described below. To verify equal efficiency of transfection and expression of T antigen under the different conditions, a sample of
the transfected cells was plated on glass coverslips, fixed for
immunostaining with methanol, and incubated with an SV40 T antigen
mouse monoclonal antibody (Santa Cruz number sc-147) for 1 h in
phosphate-buffered saline, 0.1% bovine serum albumin. The signal was
detected using Texas Red-conjugated secondary anti-mouse monoclonal
antibody (Vector number H0724) using standard techniques as recommended
by the manufacturer. No difference in transfection efficiency and
expression of T antigen was observed in oligonucleotide-treated transfectants. Nuclei were stained with 4',6-diamidino-2-phenylindole dihydrochloride (ICN number 157574) (data not shown). For transient transfection of a human DNA MeTase expression plasmid bearing the
entire coding sequence of DNA MeTase (codons 1-1616) under the
direction of a cytomegalovirus promoter (pcDNA 3.1 His DNA MeTase),
10 µg of either pcDNA 3.1 His DNA MeTase or pcDNA His control
were mixed with 4 µl of Lipofectin, and transfection was performed as
described above. Expression of transfected constructs was verified by
immunocytochemistry essentially as described above using the Xpress
monoclonal antibody (Invitrogen number 46-0528) for detection of
His-tagged proteins and Texas Red secondary monoclonal antibody. Nuclei
were stained with 4',6-diamidino-2-phenylindole dihydrochloride (data
not shown). Cells were harvested for soft agar assay 48 h posttransfection.
-32P]UTP (800 Ci/mmol) as
described previously (26). An equal concentration of
32P-labeled RNA samples (1 × 106
dpm/sample) was hybridized in triplicate with Hybond-N+ filters bearing
20 µg of immobilized pSKMet5' (containing a genomic fragment bearing
exons 2-4 of the murine DNA MeTase gene) (31) (indicated as Met in
Fig. 3), pZip U19 (ts A58)Tneo (T ant), and p
-actin (
-actin) plasmids and subjected to autoradiography as described previously (26). The intensity of the signals corresponding to
32P-labeled RNA hybridizing to DNA MeTase transcribed in T
antigen expressing transfectants and control cells was determined by
scanning densitometry and normalized to the signal obtained for
-actin. The ratio of DNA MeTase/actin signal in T antigen
transfectants was compared with the value obtained for neo transfectants.
-32P]dGTP (3000 Ci/mmol from Amersham Pharmacia
Biotech), and 2 units of Kornberg DNA polymerase (Boehringer Mannheim)
were then added and the reaction was incubated for an additional 15 min
at 30 °C as described previously (10). The labeled DNA (8 µl) was digested to 3' mononucleotides with 70 µg of micrococcal nuclease (Amersham Pharmacia Biotech) in the manufacturer's recommended buffer
for 10 h at 37 °C, spleen phosphodiesterase (Boehringer Mannheim) was then added, and the reaction mixture was incubated for 3 additional h. Equal amounts of radioactivity were loaded on TLC
phosphocellulose plates (Kodak), and the 3' mononucleotides were
separated by chromatography in one dimension (isobutyric acid:H2O:NH4OH in the ratio 66:33:1). The
chromatograms were exposed to XAR film (Kodak), and the autoradiograms
were scanned by scanning laser densitometry (Scanalytics one D
analysis). Spots corresponding to cytosine and 5-methylcytosine were quantified.
20 °C. 5 µg of DNA
(digested with EcoRI) were incubated for 15 min at 37 °C
with 54 µl of double distilled H2O, 6 µl of 3N NaOH.
Following this incubation, 431 µl of a 3.6 M sodium
bisulfite, 1 mM hydroquinone solution was added. 100 µl
of mineral oil were added to overlay the solution, and the tube was
heated at 55 °C for 12 h. The bisulfite reaction was recovered
from beneath the mineral oil and desalted using the QIA Quick PCR
Purification Kit (followed manufacturer's protocol). 6 µl of 3 N NaOH were added to the desalted solution, and the tube
was incubated for 15 min at 37 °C. Following ethanol precipitation
(in the presence of 0.3 M NH4OAc) the DNA was
resuspended in 100 µl in double distilled H2O.
Approximately 50 ng of DNA were used in each of the PCR amplifications. PCR products were used as templates for subsequent PCR reactions utilizing nested primers. The PCR products of the second reaction were
then subcloned using the Invitrogen TA Cloning Kit (we followed the
manufacturer's protocol), and the clones were sequenced using the T7
Sequencing Kit (Amersham Pharmacia Biotech) (we followed the
manufacturer's protocol, procedure C). The primers used for the MyoD
first exon (GenBankTM accession M84918) were: MyoD5'1,
5'-atttaggaattgggatatgga-3' (176-196); MyoD5' (nested),
5'-ttttttttgtttttttgagat-3' (245-265); MyoD3'1,
5'-ctcatttcacttactccaaaa-3' (577-554); and MyoD3' (nested), 5'-caaacaacacccaaacattc-3' (488-469). The primers used for the DNA
MeTase genomic region (GenBankTM accession M84387) were:
MET5'1, 5'-ggattttggtttatagtattgt-3'; MET 5' (nested),
5'-ggaattttaggtttttatatgtt-3'; MET3'1, 5'-ctcttcataaactaaatattataa-3'; and MET3' (nested), 5'-tccaaaactcaacataaaaaaat-3'.
![]()
RESULTS
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

View larger version (21K):
[in a new window]
Fig. 1.
T antigen expression elevates DNA MeTase
levels. A, T antigen and DNA MeTase mRNA levels in
24 independent T antigen transfectants. RNA was prepared from 24 different T antigen transfectants and subjected to a slot blot analysis
of DNA MeTase and T antigen expression as described under
"Experimental Procedures." The results were plotted as DNA
MeTase/18 S. Two clones were selected for further studies. T ant 10, a
high expresser, and T ant 22, a medium expresser. Four representative
neo clones expressing the bacterial neo
resistance gene, but not T antigen, were processed similarly.
B, Western blot analysis of DNA MeTase and T antigen levels.
Nuclear extracts (50 µg) were isolated from 3T3, T ant 10, and T ant
22 cells, electrophoresed on 5% SDS-polyacrylamide gel
electrophoresis, and electrotransferred to a Hybond nitrocellulose
(Amersham Pharmacia Biotech) membrane. T antigen was detected using
antibody (Pab 101, Santa Cruz), and DNA MeTase was detected by a
polyclonal antibody raised to a peptide in the catalytic domain (14)
using the ECL kit (Amersham Pharmacia Biotech).
Two independent clones were chosen to discount the possibility of clonal artifacts; T antigen 10 (high level of T antigen and DNA MeTase expression) and T antigen 22 (medium level of T antigen and DNA MeTase expression) were used for further characterization. T ant 10 was arbitrarily chosen as a representative clone in a category of high T antigen expressers. T ant 22 was also arbitrarily chosen as a representative clone in a category of significantly lower T antigen expressers. The Western blot presented in Fig. 1B demonstrates a significant increase in DNA MeTase protein in these T antigen transfectants that corresponds with the differences observed in T antigen expression. This increase in DNA MeTase protein results in a 5-15-fold increase in DNA maintenance methylation activity as determined using a hemimethylated DNA substrate and [3H]S-adenosylmethionine (18) (data not shown).
The general level of methylation of CpG dinucleotides in the genome of
the T antigen transfectants and the control cells was determined by a
nearest neighbor analysis (10). As shown in Fig.
2A there is a 1.5 (T ant
22)- to 2-fold (T ant 10) reduction in the population
of nonmethylated CpG dinucleotides in T antigen-transfected cells,
suggesting that increased DNA MeTase activity results in a detectable
increase in genomic DNA methylation.
|
It is hard to determine whether this hypermethylation indicates complete hypermethylation of a limited set of specific sites or whether it reflects a limited increase in the frequency of methylation of all sites. Comparing the state of methylation of specific sites in different transfectants is an arduous task because of the tendency of cells in culture to exhibit fluctuations in the state of methylation of CpG sites. A previous report has shown, however, that increased ectopic expression of DNA MeTase leads to hypermethylation of CpG islands (28). We therefore studied by bisulfite mapping the state of methylation of the CG-rich region in the first exon of the MyoD gene (GenBankTM accession number M84918) in the higher expressing T antigen clone, T ant 10. CpG islands in general and MyoD in particular have been shown to undergo hypermethylation upon cellular transformation (29). The bisulfite method enables one to look at a large number of copies of the studied gene, thus enabling a representative picture of the state of methylation of each specific site in the population of cells (27). As observed in Fig. 2, B and D, the MyoD region analyzed in our study is hypermethylated in T antigen transfectants relative to neo controls. Of the 18 CpG sites analyzed, a total of 9 sites were found to be hypermethylated in the T ant 10 stable line relative to neo controls (Fig. 2B). When the results for all of the CpG sites in this region in all the sequenced clones (18 for neo, 16 for T ant 10) were pooled and averaged for comparative analysis, the average methylation of CpG sites was found to be 39% for neo transfectants and 71% for T ant 10 transfectants. In order to determine whether this genomic hypermethylation extends to CG sites not contained in CG-rich areas, we chose to map the region upstream to the second exon of the DNA Methyltransferase (dnmt 1) locus. As shown in Fig. 2, C and D, the methylation status of the dnmt 1 locus does not change substantially with T antigen overexpression. Of the seven CpG sites analyzed in this region, only one site (CpG 101) was shown to be partially hypermethylated in the T ant 10 stable line relative to the neo control line. Interestingly, another site (CpG 157) was actually hypomethylated in T ant 10 relative to the neo control. The methylation status of other sites was not substantially different between the clones examined. When the results for all of the CpG sites for all sequenced clones were pooled and averaged, there was no significant difference in the average methylation of CpG sites, contrary to the results for the MyoD locus. One possible interpretation of this data could be that CpG sites contained in CG-rich areas of the genome are preferentially hypermethylated as a result of DNA MeTase induction. However, confirmation of this hypothesis would require substantially more study of many additional regions. Whereas it is unclear whether hypermethylation of specific sites plays a causal role in T antigen-mediated transformation, our results support the hypothesis that T antigen expression stimulates DNA methylation activity in mammalian cells. In accordance with previous observations (30), we show here that an increase in DNA MeTase activity is followed by an increase in overall genomic DNA methylation and that there is localized hypermethylation of at least one CG-rich site.
One of the established mechanisms of transformation by T antigen is its
ability to bind and inactivate the tumor suppressor Rb (20). To
determine whether induction of DNA MeTase is dependent on Rb
inactivation, we took advantage of a previously characterized mutant of
T antigen, T ant Rb
(bearing a E107K point mutation in the Rb
pocket), which does not bind Rb (31). This mutation has been shown to
selectively impair interactions between Rb and T antigen while leaving
p53 and p300 interactions with T antigen unimpaired (31). Balb/c
transfectants expressing high levels of T ant Rb
as determined by
Northern analysis (Fig. 3, A
and B) and Western blot analysis (Fig. 3C) do not
express induced levels of DNA MeTase mRNA (Fig. 3, A and
B) and protein (Fig. 3C). The variability of the
DNA MeTase mRNA levels in T ant Rb
clones is in the order of the
variability in neo clones (compare Fig. 1A and
3A). These results suggest that induction of DNA MeTase is
dependent on tumor suppressor inactivation by T antigen. It is yet
unclear whether Rb is directly involved in regulating DNA MeTase
mRNA levels or whether the changes in DNA MeTase mRNA are a
consequence of the multiple downstream effectors of Rb. It is also
possible that other proteins that are inactivated by T antigen are
involved in regulating DNA MeTase.
|
Two modes of regulation of DNA MeTase activity have been described
previously: first, transcriptional regulation by the Ras signaling
pathway (10, 11) and second, posttranscriptional regulation at the
level of message stability is involved in cell cycle regulation of DNA
MeTase (26). We found no evidence for transcriptional regulation of DNA
MeTase by T antigen. First, expression of a previously described DNA
MeTase-CAT expression vector bearing a transcriptional regulatory
region of the murine DNA MeTase (11) is not induced by coexpression of
T antigen but is induced by coexpression of c-Jun, suggesting that T
antigen activity is not mediated by induction of AP-1 (data not shown). Second, a nuclear runon assay (Fig.
4A) shows that there is no significant change in the transcriptional rate of the DNA MeTase gene
in the presence of T antigen. Quantification of this experiment is
presented in the bottom panel of Fig. 4A.
|
To determine whether the stability of DNA MeTase mRNA is altered as a consequence of T antigen expression, the T antigen transfectants as well as 3T3 controls were treated with actinomycin D (an inhibitor of mRNA transcription) for 0, 1, 4, or 7 h and the level of DNA MeTase mRNA was assessed using a Northern blot analysis (the signal was normalized to the level of 18 S rRNA in each lane). While the levels of mRNA in Balb/c 3T3 cells decline to undetectable levels by 7 h (Fig. 4B) (this result has been repeated in three independent experiments), the profile of decline in DNA MeTase mRNA obtained for the T antigen transfectants is markedly different. The mRNA in T ant 22 remains at 50% of control (0 h) levels after 7 h (Fig. 4B, left panels) and even up to 24 h treatment (data not shown). In T ant 10, the level of DNA MeTase mRNA remains at, or close to, 100% for the duration of the actinomycin D treatment (Fig. 4B, middle panels). The rate of decay of c-fos mRNA (which expression increased 2-3-fold more in T antigen transfectants versus Balb/c 3T3), a gene known to be regulated by stabilization of its message (32), is unchanged (Fig. 4B, bottom). Therefore, T antigen expression affects the stability of DNA MeTase mRNA without affecting the general ability of the cell to degrade mRNA. Further experiments will be required to determine what are the downstream effectors of Rb that modulate the stability of DNA MeTase mRNA and whether the change in stability of the mRNA can account for all of the increased expression of DNA MeTase. Our data suggest, however, that the level of DNA MeTase can be regulated by viral antigens acting on tumor suppressors at a different level than the transcriptional up-regulation induced by protooncogenes such as Ras (10, 11).
We have utilized DNA MeTase-specific antisense oligonucleotides that we
have developed recently (14) to test the hypothesis that DNA MeTase is
a critical downstream effector of T antigen-initiated cellular
transformation. This oligonucleotide has been shown previously to
reduce DNA MeTase mRNA in Y1 carcinoma cells and inhibit
tumorigenesis ex vivo and in vivo (14). We first
determined that the antisense oligonucleotides can effectively inhibit
DNA MeTase in our system. Balb/c cells were treated with 100 nM DNA MeTase phosphorothioate antisense
oligonucleotide (HYB101584) (14) as well as a reverse control
phosphorothioate oligonucleotide (HYB101585) (14) in the presence of a
lipid carrier (Lipofectin) and transiently transfected with
pZipneoSV40U19tsA58. We first determined whether DNA MeTase antisense oligonucleotide treatment (for 72 h) reduces the level of DNA MeTase mRNA relative to treatment with the nonspecific oligonucleotide control as described previously (14). Cellular RNA
prepared from the treated cells was subjected to an RNase protection
assay for DNA MeTase mRNA, using a previously described DNA
MeTase-specific riboprobe (11). The results shown in Fig. 5A show that T
antigen-transfected Balb/c cells express lower levels of DNA MeTase
mRNA following antisense treatment than those treated with equal
concentrations of control oligonucleotides. Scanning densitometry
values show nearly 90% inhibition of message expression for
antisense-treated cells relative to reverse-treated control cells when
normalized to the signal obtained for 18 S ribosomal RNA in the same
hybridization reaction.
|
To determine whether this message level inhibition translated into a decrease in DNA methyltransferase activity, an activity assay was performed using nuclear extracts prepared from oligonucleotide-treated cells. As described previously (26), the assay tests the ability of cellular extracts to incorporate a methyl group from tritiated S-adenosylmethionine into a hemimethylated substrate. Quantification of this assay in Fig. 5B revealed, similarly to the results of the RNase protection assay, a dramatic (9-fold) and highly significant (p < 0.001) inhibition of DNA methyltransferase activity in antisense relative to reverse oligonucleotide-treated cells.
We then determined whether the inhibition of DNA methyltransferase message levels and activity results in generalized genomic hypomethylation. Nearest neighbor analysis was used to test this hypothesis, as shown in Fig. 5C. The level of methylation of CpG dinucleotides in Balb/c controls is approximately 65% (data not shown), a result similar to that obtained for Balb/c neo control stable transfectants (Fig. 2A). As expected, reverse oligonucleotide treatment showed no significant change in methylation levels from control Balb/c cells. However, antisense-treated cells showed a remarkable reduction in the level of DNA methylation. Only 20% of the CpGs in the genome were methylated following antisense treatment (Fig. 5C).
Having established that the antisense oligonucleotides effectively
inhibited DNA methyltransferase message and activity levels and DNA
methylation levels in Balb/c cells, we devised a cell culture assay to
test the role of DNA methyltransferase as a downstream effector of T
antigen. To show that DNA methyltransferase is directly involved in
initiation of the transformed phenotype, we transiently transfected
Balb/c 3T3 cells with the pZipneoSV40U19tsA58 T antigen expression vector following pretreatment with either 100 nM
antisense or reverse oligonucleotides. As expected, transient
transfection of normal Balb/c 3T3 cells by a T antigen expression
vector for 48 h results in their transformation as indicated by
their ability to grow in an anchorage independent manner on soft agar
(Fig. 6A). Transfection with a
neo expression vector or a vector directing the expression
of a T antigen that is defective in its ability to interact with Rb
does not result in cellular transformation similar to the results
observed following stable transfection. Thus, since this assay does not
require drug selection it allows us to study the initial stages of
transformation induced by T antigen. To determine whether DNA MeTase is
required for initiation of cell transformation, the cells were
pretreated with 100 nM amounts of either DNA MeTase
antisense or reverse oligonucleotides 24 h prior to introduction
of T antigen into the cells. Treatment was terminated following an
additional 48 h exposure to the oligonucleotides, and the cells
were plated on soft agar in the absence of any further treatment. As
observed in Fig. 6A, exposure of cells at the initial stages
of transformation by T antigen to DNA MeTase antisense results in
significant inhibition of cellular transformation as determined by a
soft agar assay. Since the antisense oligonucleotide is not present
during growth on soft agar, it supports the hypothesis that DNA MeTase
is required for the initial stages of transformation.
|
If induction of DNA MeTase is a downstream effector of transformation
induced by transient expression of T antigen, then transient expression
of DNA MeTase should similarly induce cellular transformation. To test
this hypothesis, we introduced an expression vector encoding the entire
coding sequence of the human DNA MeTase under the cytomegalovirus promoter, including the recently identified N-terminal amino acids (33)
into Balb/c cells and plated the transiently transfected cells after
48 h on soft agar. As observed in Fig. 6B, transient expression of DNA MeTase in Balb/c cells induces anchorage-independent growth on soft agar, an indicator of cellular transformation.
| |
DISCUSSION |
|---|
|
|
|---|
Our manuscript shows that similar to the Ras oncogenic pathway, SV40 large T antigen elevates cellular DNA MeTase mRNA and protein levels (10, 11). This activity of T antigen is dependent on its interaction with the tumor suppressor pRb, suggesting that overexpression of DNA MeTase lies downstream to inactivation of the tumor suppressor Rb. It is unclear yet whether Rb has a direct effect on DNA MeTase or whether these effects are mediated through interactions with other cell cycle regulators. It is also unclear whether other proteins that interact with T antigen are also involved in regulating DNA MeTase. Whereas up-regulation by the Ras oncogene involves transcriptional activation, T antigen up-regulates DNA MeTase at the posttranscriptional level.
This paper also tests the hypothesis that an increase in DNA MeTase levels is critical for cellular transformation triggered by T antigen. The fact that DNA MeTase has been shown to be critical for two different pathways of oncogenesis is consistent with a central role for DNA MeTase in cellular transformation (9, 12). DNA MeTase is critical for the initial stages of transformation by T antigen, since inhibition of DNA MeTase at the time of introduction of T antigen into the cells by transient transfection prevents cellular transformation.
What might be the possible role of DNA MeTase in cellular transformation? One hypothesis that has been supported by a growing body of evidence is that an increase in DNA MeTase might lead to an aberrant increase in methylation and inactivation of tumor suppressors (6), suggesting that increased levels of DNA MeTase cause cellular transformation by ectopic methylation of tumor suppressor genes. In contrast, our data surprisingly shows that DNA MeTase expression is controlled by tumor suppressors. Therefore activation of DNA MeTase might be the downstream target of a transformation program triggered by tumor suppressors. An alternative hypothesis is that the DNA MeTase protein is directly involved in controlling cellular growth (9, 12). Such a model is consistent with the requirement for increased DNA MeTase protein in both Ras and T antigen pathways. An interesting observation is that methyl deficient diets, which cause hypomethylation of DNA, also result in induction of DNA MeTase levels and are known to be carcinogenic (34). This observation could be explained, if the critical event for oncogenesis is not hypermethylation of DNA but rather high levels of DNA MeTase protein. Recent data showing that DNA MeTase binds proliferating cell nuclear antigen in the replication fork, and competes with p21WAF1 for the binding site, lends support to the hypothesis that DNA MeTase protein plays a direct regulatory role in the replication fork (22).
The fact that transient transfection of DNA MeTase is sufficient to induce cellular transformation and that transient inhibition of DNA MeTase at the time of induction of cellular transformation by T antigen is sufficient to prevent transformation is consistent with a direct role for the DNA MeTase protein in transformation. The cloned DNA MeTase is very inefficient in de novo methylation and it is improbable that transient expression of the enzyme results in significant hypermethylation of a tumor suppressors (28). Overexpression of DNA MeTase can result in hypermethylation of CG islands, but this is a slow process which takes about 40-50 passages (6-7 months in culture) (28). Vertino et al. (28) have shown previously that there was no detectable change in the methylation of CG islands in transfectants expressing greater than nine fold of DNA MeTase levels up to 20-23 population doublings. Whereas it is generally accepted that many tumor suppressors are inactivated by methylation, the data presented here are consistent with the hypothesis that DNA MeTase levels are controlled by tumor suppressors.
While additional experiments are required to support or nullify the
hypothesis that an increase in DNA MeTase is directly involved in
cellular transformation, the fact that a viral oncogene can affect the
cellular DNA methylation machinery raises new directions and
possibilities for understanding cellular transformation processes.
| |
ACKNOWLEDGEMENTS |
|---|
We thank Dr. Almazan for providing us with
the T antigen expression vector and Dr. Howard for his kind gift of T
ant Rb
expression vector. We thank Johanne Theberge for superb
technical assistance. We thank Shyam Ramchandani for his critical
reading of the manuscript.
| |
FOOTNOTES |
|---|
* This work was supported by a grant from the National Cancer Institute Canada and the Medical Research Council (to M. S.).The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
The first three authors contributed equally to the manuscript.
§ To whom correspondence should be addressed. Tel.: 514-398-7107; Fax: 514-398-6690; E-mail: mszyf{at}pharma.mcgill.ca.
| |
ABBREVIATIONS |
|---|
The abbreviations used are: DNA MeTase, DNA methyltransferase; PCR, polymerase chain reaction.
| |
REFERENCES |
|---|
|
|
|---|
This article has been cited by other articles:
![]() |
M. Szyf The Dynamic Epigenome and its Implications in Toxicology Toxicol. Sci., November 1, 2007; 100(1): 7 - 23. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. R. Morey, D. J. Smiraglia, S. R. James, J. Yu, M. T. Moser, B. A. Foster, and A. R. Karpf DNA Methylation Pathway Alterations in an Autochthonous Murine Model of Prostate Cancer Cancer Res., December 15, 2006; 66(24): 11659 - 11667. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. T. McCabe, J. A. Low, S. Daignault, M. J. Imperiale, K. J. Wojno, and M. L. Day Inhibition of DNA Methyltransferase Activity Prevents Tumorigenesis in a Mouse Model of Prostate Cancer Cancer Res., January 1, 2006; 66(1): 385 - 392. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. T. McCabe, J. N. Davis, and M. L. Day Regulation of DNA Methyltransferase 1 by the pRb/E2F1 Pathway Cancer Res., May 1, 2005; 65(9): 3624 - 3632. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. May, H. Hauser, and D. Wirth Transcriptional control of SV40 T-antigen expression allows a complete reversion of immortalization Nucleic Acids Res., October 14, 2004; 32(18): 5529 - 5538. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. K. MacLennan, S. J. James, S. Melnyk, A. Piroozi, S. Jernigan, J. L. Hsu, S. M. Janke, T. D. Pham, and R. H. Lane Uteroplacental insufficiency alters DNA methylation, one-carbon metabolism, and histone acetylation in IUGR rats Physiol Genomics, June 17, 2004; 18(1): 43 - 50. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Shivapurkar, T. Takahashi, J. Reddy, Y. Zheng, V. Stastny, R. Collins, S. Toyooka, M. Suzuki, G. Parikh, S. Asplund, et al. Presence of Simian Virus 40 DNA Sequences in Human Lymphoid and Hematopoietic Malignancies and Their Relationship to Aberrant Promoter Methylation of Multiple Genes Cancer Res., June 1, 2004; 64(11): 3757 - 3760. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. M. Campbell, V. Bovenzi, and M. Szyf Methylated DNA-binding protein 2 antisense inhibitors suppress tumourigenesis of human cancer cell lines in vitro and in vivo Carcinogenesis, April 1, 2004; 25(4): 499 - 507. [Abstract] [Full Text] [PDF] |
||||
![]() |
W. Shi, A. Hoeflich, H. Flaswinkel, M. Stojkovic, E. Wolf, and V. Zakhartchenko Induction of a Senescent-Like Phenotype Does Not Confer the Ability of Bovine Immortal Cells to Support the Development of Nuclear Transfer Embryos Biol Reprod, July 1, 2003; 69(1): 301 - 309. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. I. Young, J. M. Sedivy, and J. R. Smith Telomerase Expression in Normal Human Fibroblasts Stabilizes DNA 5-Methylcytosine Transferase I J. Biol. Chem., May 23, 2003; 278(22): 19904 - 19908. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Milutinovic, Q. Zhuang, A. Niveleau, and M. Szyf Epigenomic Stress Response. KNOCKDOWN OF DNA METHYLTRANSFERASE 1 TRIGGERS AN INTRA-S-PHASE ARREST OF DNA REPLICATION AND |