J Biol Chem, Vol. 274, Issue 15, 10382-10387, April 9, 1999
Repression of Human Fibroblast Growth Factor 2 by a Novel
Transcription Factor*
Tetsuya
Ueba
,
Brian
Kaspar,
Xinyu
Zhao, and
Fred H.
Gage§
From the Salk Institute for Biological Studies,
La Jolla, California 92037
 |
ABSTRACT |
Here we describe the cloning of the regulator of
fibroblast growth factor 2 (FGF-2) transcription (RFT) using a yeast
one-hybrid screening with a defined motif in FGF-2 promoter as a target
sequence. Overexpression of human RFT (RFT-A) reduces FGF-2 RNA and
protein levels in both normal and tumor cell lines. Its splice
variants, RFT-A' and RFT-B, have deletions in the putative DNA binding
domain and fail to bind FGF-2 promoter and repress FGF-2 gene
expression. The ratios of RFT isoforms differ between normal and tumor
cells, with the splice variants dominating in tumor cells.
Overexpression of RFT-A induces glioma cell death. Our data suggest
that regulation of FGF-2 by RFT is important for cellular functions and
may be impaired in certain tumors.
 |
INTRODUCTION |
Fibroblast growth factor 2 (FGF-2)1 is a mitogen for
neuroectoderm- and mesoderm-derived cells (1) as well as a potent
angiogenic factor in vivo (2). FGF-2 acts in an autocrine or
a paracrine manner, interacting with its specific receptors (3), and
has been shown to play an important role in limb bud formation (4) and
neural tissue formation (5). In addition, a role for FGF-2 has been
suggested for brain diseases such as tumors (5-7), Alzheimer's disease (8), and Huntington's disease (9). Ninety percent of gliomas
overexpress FGF-2 constitutively, and FGF-2 may play a crucial role in
tumorigenesis and tumor progression of gliomas by acting through an
autocrine mechanism (5-7). Although a clear case has been made for the
involvement of FGF-2 in development and diseases, little is known about
the regulation of FGF-2 gene expression at the transcriptional level
(10-15). Many factors have been shown to stimulate FGF-2 expression.
In adrenal chromaffin cells, stimulation of acetylcholine nicotinic
receptors, or angiotensin II receptors, or direct stimulation of
adenylate cyclase (with forskolin) or protein kinase C (with
phorbolester) increases the level of all FGF-2 isoforms (13). In
primary astrocytes, endothelin-3 increases and natriuretic peptide
decreases FGF-2 expression through modulating immediate early gene,
egr-1 (10). FGF-2 has also been shown to function in both
paracrine and autocrine manners, such that positive feedback may be the
basis for neoplastic transformation (16).
FGF-2 promoter contains no TATA box but has multiple GC-rich regions
for transcriptional initiation. The promoter contains putative sites
for several transcription factors such as SpI and Egr-1 (10, 15). The
homeodomain protein, HOXB7, was shown to bind a +130 to +159 sequence
and increase FGF-2 expression (11), and Egr-1 was shown to bind to
human FGF-2 promoter at two sites (
160 and
60). Interestingly, the
expression of FGF-2 in human astrocytes was shown to be inhibited by
direct cell contact, and the promoter regions related to such
density-dependent regulation have been localized to two
regions (
650 to
513;
273 to +314). A transactivator was shown to
bind to the upstream site (
650 to
513) at low cell density but not
at high density. In transformed glioma cells, such regulation is
abolished, and the putative activator binds to the promoter in a
density-independent manner (12). The density-regulated FGF-2 expression
may explain some differing results obtained from different laboratories
studying FGF-2 function and regulation. Because FGF-2 is a potent
mitogen, the negative regulation of transcription could likely be an
important regulatory mechanism for FGF-2 function; however, to date
only the tumor suppressor, p53 protein, has been suggested as a
repressor of FGF-2 expression (14).
Here we report the cloning and characterization of a novel
transcription factor that represses FGF-2 expression at the
transcriptional level. Our data indicate that loss of such regulation
may be involved in FGF-2-dependent tumor progression.
 |
EXPERIMENTAL PROCEDURES |
Yeast One-hybrid Screening, Cloning Full-length cDNAs, and
Northern Hybridization--
Yeast one-hybrid screening was conducted
as described in the manufacturer's manual
(CLONTECH) using human testis cDNA library (17). The three "gccgaaccgccgaac" tandem repeat was subcloned into
pHISi vector as a reporter plasmid. Full-length RFT cDNAs were
cloned by screening human testis cDNA library
(CLONTECH) with the radiolabeled cDNAs
discovered by yeast one-hybrid screening. All cloned cDNAs were
sequenced by an automated sequencer in the DNA sequencing facility at
the Salk Institute. Multiple tissue Northern blot membranes
(CLONTECH) were hybridized with the same radiolabeled cDNA probes as above.
Plasmid Construction, Cell Culture, DNA Transfection, Luciferase
Assays, and
-Galactosidase Assays--
The His-tagged RFT isoforms
were generated by polymerase chain reactions and subcloned into
pCDNA3 mammalian expression vector (Invitrogen). RFT-
A was
generated by digesting RFT-A with AvaI, which deleted the
sequence encoding the first 111 amino acids. All constructs were
sequenced. To generate FGF-2 promoter-luciferase reporter construct
(pGL1.2F), 1.2 kb of FGF-2 promoter (18) was subcloned into pGL-2-basic
vector (Promega). U87MG (ATCC) and 293 cells (19) were cultured in
Dulbecco's modified Eagle's medium with 10% fetal calf serum in a
5% CO2 incubator. For DNA transfection, the calcium
phosphate method (14) was used for 293 cells and SuperFectant method
(Qiagen) was used for U87MG cells. Briefly, 1 × 105
cells were cotransfected with 0.9 µg each of RFT expression vector, 0.9 µg of pGL1.2F, and 0.2 µg of H-RAS-
-galactosidase (20) as a
transfection internal control. Luciferase assays and
-galactosidase assays were done as described previously (14). The assays were performed at least three times independently.
Immunocytochemistry--
Immunocytochemistry was performed to
detect overexpressed RFT isoforms and endogenous FGF-2 using anti-His
tag monoclonal antibody (1:1000, Qiagen) and anti-human FGF-2
monoclonal antibody (1:20, R&D Systems), respectively. Cy3-conjugated
donkey anti-rabbit IgG (1:250, Jackson Immunochemicals) for anti-His
antibody and fluorescein isothiocyanate-conjugated donkey anti-goat IgG
(1:250, Jackson Immunochemicals) for FGF-2 were used as secondary
antibodies. The green fluorescent protein (GFP)-infected cells were
visualized by green autofluorescence and stained with the anti-human
FGF-2 primary antibody. In this case, Cy3-conjugated donkey anti-goat IgG was used as the secondary antibody to detect FGF-2. The image was
analyzed by a confocal microscope and color modifications were made in
Adobe Photoshop 5.0 as follows: His-tagged RFT shown in figures as
blue, FGF-2 in red, and GFP in green.
In Vitro Translations and Gel Mobility Shift Assays--
For
in vitro translations, RFT expression vectors were incubated
with [35S]methionine in the rabbit reticulocyte lysate as
described in the manufacturer's protocol (Promega). Translated
products were separated on an 8% SDS-acrylamide gel and quantified by
a PhosphorImager (Molecular Dynamics). The result was adjusted based on
the numbers of methionine content in each of the RFT isoforms. For
electrophoretic mobility shift assay, the same molar amount of each
product was incubated with radiolabeled oligonucleotides (20,000 cpm)
in the buffer containing 10 mM Hepes, pH 7.5, 50 mM KCl, 1 mM dithiothreitol, 0.1% Nonidet
P-40, and 3.75% glycerol. The oligonucleotide containing RFT binding
sequence is gccgaaccgccgaacgccgaaccgccgaacgccgaaccgccgaac. The same
unlabeled oligo was used as a specific competitor in the assay. A
agcttcgatcgcgataaggatttatccttatccccatcctcga oligo derived mainly from
FGF-2 promoter (
574 to
597) was used as a nonspecific competitor.
Ribonuclease Protection Assay (RPA)--
The partial RFT
cDNA obtained through the yeast one-hybrid screening was subcloned
into the pBluescript vector (Stratagene). In vitro
transcription of the antisense probes and RPA was performed as
described in the manufacturer's protocol (Ambion). Briefly, 100 ng of
poly(A)+ RNA from human testis (CLONTECH)
and 50 µg total RNA from U87MG and 293 cells were hybridized with
gel-purified probes (50,000 cpm). The protected bands were loaded on a
5% native gel as double-strand RNAs with the radiolabeled 123 bp DNA
ladder (Life Technologies, Inc.). The results were analyzed by a
phosphoimager, and RFT A/A'/B ratios were calculated with the
adjustment of the numbers of [32P]UTP in the protected bands.
Adeno-associated Virus (AAV), Reverse Transcriptase Polymerase
Chain Reaction (PCR), and TdT-mediated dUTP-X Nick End-labeling
(TUNEL)--
Each RFT isoform was subcloned into pBK1AAV, which is an
AAV multiple cloning vector based on the cytomegalovirus immediate early enhancer and promoter (21). Recombinant AAV vectors were produced
by a modified transient plasmid transfection protocol followed by two
rounds of cesium chloride equilibrium density gradients and heat
treatment at 56 °C for 60 min to destroy residual adenovirus (21,
22). The titer of the recombinant virus was determined by DNA dot blot
and antibody staining against the His-tag region of the inserted
protein. As a control, AAV carrying GFP (CLONTECH)
was produced. To analyze the level of endogenous FGF-2 message, cells
were harvested 40 h after infection with RFT-AAV at the
multiplicity of infection of 25. Total RNA were extracted using RNAzol
B (TEL-TEST). One hundred ng of total RNA was reverse transcribed by
avian myeloblastosis virus reverse transcriptase (Promega), and PCR
reactions were done using Taq polymerase (Promega). Linear
ranges of PCR were determined by sampling the PCR products at every two
cycles. The data shown were sampled at 25 cycles for FGF-2 and 23 cycles for G3PDH. The primer sets for FGF-2 and G3PDH were described
previously (11). To analyze the cellular levels of expressed RFT and
endogenous FGF-2 protein, cells were fixed at 72 h postinfection
and analyzed by immunocytochemistry. The TUNEL staining was performed
as described in the manufacturer's protocol (Boehringer Mannheim).
 |
RESULTS |
Cloning RFT and Structural Analysis--
Human FGF-2 gene has a
TATA-less promoter, and its transcript is initiated at only one site
(18). We further noticed that a gccgaac sequence is tandemly repeated
at both sides of the transcription initiation site of the human FGF-2
gene (Fig. 1A). Using this DNA
sequence as bait, we conducted a yeast one-hybrid screening (17). We
screened 7 × 106 cDNA clones generated from human
testis poly(A)+ RNA. We retrieved two partial cDNA clones
that were 447 and 405 bp. Both clones encode an identical cysteine
(Cys)-rich region that is a putative zinc finger domain (Fig.
1B). Because this novel clone may encode a DNA binding
protein that binds to FGF-2 promoter, we named this gene the regulator
of FGF-2 transcription (RFT). We screened a human testis cDNA
library (CLONTECH) using the partial clones as
probes. From 12 positive clones isolated, we have obtained full-length
clones (RFT-A), and two shorter isoforms, RFT-A' and RFT-B. RFT-A' has
a single amino acid deletion at lysine-407 and RFT-B has a deletion of
58 amino acids in the putative DNA binding domain (Fig. 1, B
and C). The open reading frame is 1893 nucleotides in RFT-A,
1890 in RFT-A', and 1725 in RFT-B, which encode proteins that are 632, 621, and 574 amino acids, respectively. Based on the genomic DNA
sequence (data not shown), RFT-A' is probably formed by a differential
splicing mechanism and RFT-B is formed by an alternative splicing
mechanism of this exon.

View larger version (37K):
[in this window]
[in a new window]
|
Fig. 1.
Molecular cloning of the RFT gene.
A, a schematic presentation of the human FGF-2 promoter and
the transcription start site. gccgaac sequences are shown.
B, a deduced amino acid sequence of the RFT gene. The
underlined regions were cloned by the yeast one-hybrid
system. Cysteines with asterisks (*) constitute the two
putative zinc finger motif. K indicates the deleted lysine
407 for RFT-A'. Bold letters show the domain spliced out in
RFT-B. C, a schematic presentation of RFT-A, RFT-A', and
RFT-B.
|
|
A structural analysis in Fig. 1C shows that the RFT-A and
RFT-A' forms contain two Cys-rich regions. The N-terminal Cys-rich region shows 50% similarity to the human trithorax gene
(HRX) (also called mixed lineage leukemia (MLL)
(23) or acute lymphoblastic leukemia (ALL-1) (24) genes).
The C-terminal Cys-rich region discovered by the yeast one-hybrid
screening, a putative zinc finger domain, shows 50% similarity to the
HRX protein and DNA methyltransferase genes (25). The function of the
similar region in the HRX gene is not known. The electric
charges of the two Cys-rich regions are different, with the N-terminal
Cys-rich region being negatively charged and the C-terminal Cys-rich
region being positively charged, implicating the C-terminal Cys-rich
region as a DNA binding domain. Nine Ser/Thr-Pro-Xaa-Xaa
(S/TPXX) motifs are present in all variants of RFT. S/TPXX
motifs reportedly are to be found more frequently in gene regulatory
proteins and are located on either side of DNA recognizing units (26).
In addition, two putative nuclear localizing signals are present near
the splicing region.
Expression and Localization of RFT--
Northern blot analysis of
human multiple tissue shows that the gene is expressed ubiquitously
(Fig. 2A). The size of the
transcripts on the Northern blot analysis is about 3.0 kb in all
tissues, with an approximately 2.6-kb transcript being present in many tissues (Fig. 2A). We performed 3'-rapid amplification of
cDNA ends method using RFT-specific primers and human testis
poly(A) RNA. The results indicate that the difference in size of these transcripts was attributable to an alternative splicing in the 3'-untranslated region, suggesting a potential instability of mRNA
(data not shown).

View larger version (65K):
[in this window]
[in a new window]
|
Fig. 2.
Distribution and localization of
RFT. A, Northern blot analysis of multiple human
tissues. The numbers on the left indicate the molecular
sizes (in kb). B, immunohistochemical analysis of U87MG and
293 cells by a confocal microscopic image overlaid onto a differential
interference contrast image. Cells were stained by anti-His tag
antibody to localize the overexpressed RFT isoforms
(green).
|
|
In vitro translated products of RFT-A, RFT-A', and RFT-B
forms migrate at the molecular weight of approximately 90, 90, and 75 kDa, respectively, on a denaturing gel (data not shown).
To determine the localization of each form of RFT in cells, we
constructed His-tagged expression vectors of each form and transfected
them into the human glioma cell line, U87MG (ATCC), and the human
kidney tumor cell line, 293 (18). After staining by anti-His tag
antibody, a confocal microscopic analysis study showed clear nuclear
localization of all forms in each cell line (Fig.
2B).
Next, to determine the affinity specificity of each form to the gccgaac
sequence, we performed gel mobility shift assays. The RFT-A form shows
highly specific affinity to gccgaac sequence, and the RFT-A' and RFT-B
forms show undetectable affinity to the same sequence (Fig.
3A). Thus, the structural
examination, the localization study, and the DNA binding assay support
the suggestion that the RFT gene product is a nuclear protein, and it
may function as a transcription factor.

View larger version (34K):
[in this window]
[in a new window]
|
Fig. 3.
Biological activity of the RFT.
A, gel mobility shift assays by in vitro
translated RFT-A, RFT-A', and RFT-B. Free indicates probe
only. Addition of 50× specific competitor is indicated by
S. Addition of 50× nonspecific competitor is indicated by
N. B, transient transfection assay. Effects of
each RFT form on FGF-2 promoter activity in U87MG cells and 293 cells
are shown as relative fold of activities. C,
semiquantification of endogenous FGF-2 mRNA by reverse
transcriptase polymerase chain reaction in the linear range after
overexpression of RFT isoforms carried by AAV vectors. AAV-GFP was used
as control.
|
|
RFT-A Represses FGF-2 Expression--
To investigate the function
of the RFT gene, we performed co-transfection using the expression
vectors for each RFT isoform and pGL1.2 F carrying 1.2-kb fragment of
FGF-2 promoter fused with luciferase gene as a reporter construct into
the U87MG and 293 cells. As an internal control, H-Ras
-galactosidase (19) was also transfected. After 40 h,
luciferase and
-galactosidase assays revealed that, in the U87MG
cell lines, the RFT-A form repressed the 1.2 kb of FGF-2 promoter
activity more than 10-fold; in the 293 cell line, RFT-A nearly
completely repressed the 1.2 kb of FGF-2 promoter activity. By
contrast, RFT-A' and RFT-B did not repress but rather induced a small
activation of the FGF-2 promoter in the 293 cell line and, to a lesser
extent, in the U87MG cell line (Fig. 3B). In both cell
lines, a dose-dependent effect of all forms of the RFT was
observed (data not shown). To investigate if the transcriptional
repression of RFT-A is specific for FGF-2 promoter, we did
co-transfection using RFT expression vectors and epidermal growth
factor receptor promoter-luciferase construct. RFT-A does not affect
epidermal growth factor receptor promoter activity that does not have
the gccgaac motif (data not shown).
To determine whether the RFT gene product could regulate the endogenous
FGF-2 gene expression, reverse transcriptase PCR in the linear range
was performed on the two cell lines after the cells were infected with
an engineered AAV carrying each form of the RFT gene. The results were
consistent with those of luciferase assay, demonstrating that RFT-A
repressed FGF-2 expression, whereas neither RFT-A' nor RFT-B had any
effect on FGF-2 (Fig. 3C).
To determine whether FGF-2 protein level is also decreased upon
overexpression of RFT-A, we infected U87MG cells with AAV carrying
His-tagged RFT-A and RFT-B (Fig. 4). The
expression of RFT was detected by anti-His antibodies. The cellular
FGF-2 level was shown by using anti-FGF-2 antibodies. RFT-A infected
cells have undetectable levels of FGF-2, whereas the RFT-B infected cells can coexpress RFT-B and FGF-2 in the same cell. The absence of
FGF-2 staining in some cells that stain for RFT-B may reflect the fact
that not all U87MG cells express the same level of FGF-2. Control cells
were also infected with AAV carrying green fluorescence protein
(GFP-AAV), which does not have an obvious effect on endogenous FGF-2
expression. To test if RFT also represses endogenous FGF-2 protein
level in untransformed cells, we did parallel experiments on primary
human embryonic fibroblasts (HEF). The results from HEF cells are
consistent with those from U87MG cells (Fig. 4).

View larger version (12K):
[in this window]
[in a new window]
|
Fig. 4.
Biological function of the RFT gene.
Immunocytochemical analysis of U87MG and HEF cells by a confocal
microscope after overexpression of RFT-A, RFT-A', RFT-B, and RFT- A.
Cells were immunostained with anti-His tag (blue) and
anti-FGF-2 (red) antibodies to localize the RFT proteins and
to measure relative levels of FGF-2 protein, respectively. AAV-GFP
infected cells were used as a control, and GFP is shown in
green. Untreated cells are also included as
Control.
|
|
During preparation of this manuscript, PCM-1 from human retinal
cDNA library was computationally cloned (27). The sequence of this
gene suggests it is a tissue-specific, alternatively spliced isoform of
the RFT-A because we did not clone PCM-1 from human testis library.
Both RFT and PCM-1 contain a methylated CpG binding domain (Fig.
1C) that can repress transcription of a methylated promoter
in vitro. To determine whether the FGF-2 repressor function of RFT is independent of its CpG binding domain, we truncated the first
111 amino acids of RFT-A, which contain the homologous methylated CpG
binding region of RFT-A (RFT-
A), and co-transfected RFT-
A with
FGF-2 promoter construct into cells. The results reveal that truncated
RFT-
A repressed FGF-2 promoter activity to the same level as that of
wild type RFT-A (data not shown). RFT-
A also reduces FGF-2 protein
level in both U87MG and HEF cells (Fig. 4). Therefore, the FGF-2
promoter repression function of RFT appears to be independent of its
potential methylated-CpG binding function.
RFT-A Induces Glioma Cell Death--
Because the majority of human
gliomas overexpress FGF-2, we hypothesize that glioma cells may not
have functional RFT. To determine the ratio of endogenous RFT isoforms
in glioma cells, we conducted a ribonuclease protection assay using
antisense riboprobes to the DNA binding region of RFT-A. In human
testis, RFT-A form is dominant, and the RFT A/A'/B ratio is 20/1/1. In
the 293 cell line, the RFT A/A'/B ratio is 1/2/4, and in the U87MG cell
line, the RFT A/A'/B ratio is 1/9/44 (Fig.
5A). Quantitative comparison between each expression pattern may be difficult because the cells are
derived from different tissue, but clearly we can tell that the ratio
of RFT-A is much higher in normal tissue than in transformed tumor cell
lines.

View larger version (86K):
[in this window]
[in a new window]
|
Fig. 5.
Biological function of the RFT.
A, ribonuclease protection assays for the detection of each
the RFT isoforms in tumor cell lines and testis. Probes used for the
assay are indicated. The size of protected bands is shown by the DNA
marker (bp). B, phase contrast images of cells
96 h after RFT-AAV infection. 40× microscope images indicate that
RFT-A induces U87MG cell death, whereas the other forms or GFP do not.
The lower panel in AAV-A demonstrates cell death
determination by a confocal microscopic image of TdT-mediated dUTP-X
nick end-labeling (TUNEL) staining in green for cells
infected with RFT-AAV-A. Positive TUNEL staining was observed at
72 h postinfection and peaked at 96 h. Note that RFT-B
infected cells grow in clusters.
|
|
A neutralizing antibody against FGF-2 has been reported to induce
apoptosis in glioma cell lines (28). If RFT-A is acting by suppressing
FGF-2, and this suppression is lethal to gliomas, then overexpression
of RFT-A should also kill tumor cells that overexpress FGF-2.
Specifically, we hypothesized that infection of AAV carrying RFT-A
(AAV-A) into the U87MG cells would repress FGF-2 gene expression,
resulting in cell death. To test this hypothesis, we infected AAV
carrying each form of the RFT gene (AAV-A, AAV-A', and AAV-B) into
U87MG cells. AAV carrying the green fluorescence protein gene
(CLONTECH) (AAV-GFP) was infected as a control.
Fig. 5B shows that only the RFT-A form actually induced
U87MG cell death 96 h after infection. Interestingly, RFT-B
overexpression did not cause cell death, but cells lost contact
inhibition and started to grow in clumps. We subsequently checked two
additional glioma cell lines (U251MG and U373MG) and obtained the same
results (data not shown). We also infected cells with AAV carrying
RFT-
A (AAV-
A) into glioma cells, and it also induced cell death,
as did the wild type RFT-A (data not shown). This further proves that
the reported functions of PCM-1 and RFT are independent.
 |
DISCUSSION |
In search of the mechanism that regulates FGF-2 expression, we
have observed a tandem repeat sequence (gccgaac) around the transcription initiation site of FGF-2 promoter. Using this sequence as
bait, we were able to clone a novel transcription factor, RFT, that
represses FGF-2 expression in transient transfection assay and in
cells. This is the first negative regulator for FGF-2 that has been
shown to bind a definitive sequence in FGF-2 promoter. Given the
significance of FGF-2 in development, neurological diseases, and tumor
formation, discovery and understanding of such a factor bring us closer
to the understanding of FGF-2-dependent cellular processes.
RFT Represses the Expression of FGF-2--
Our data have shown
that RFT can bind to the specific gccgaac sequence and reduces the
promoter activity and endogenous RNA (Fig. 3) and protein (Fig. 4)
levels of FGF-2. Taking these results together with the nuclear
localization of each RFT form (Fig. 3A), we conclude that
RFT-A is a transcription factor that can bind to the basal core
promoter of the FGF-2 gene and repress the promoter activity. The
working hypothesis is that RFT binds to the gccgaaccgccgaac sequence
and blocks the binding of RNA polymerase II to the transcriptional
initiation site. How such repression is regulated under physiological
conditions is unknown.
Splice Variants of RFT--
Alternative splicing, which happens in
1 of 20 genes, plays important roles in diversifying cellular gene
regulation. Splice variants often have different expression patterns
and carry different physiological functions (29-31). In several well
characterized cases, splice variants either serve as dominant negative
regulators by competing with the same effector or serve as traps by
forming a dimer with the active form. For example, ITF-2, a basic
helix-loop-helix protein, forms an active dimer with MyoD, but its
splice variant ITF2B inhibits the function of ITF-2 by forming an
inactive dimer with MyoD (32). ATFa, an ATF/CREM family transcription
factor, has a splice variant, ATFa-O, that inhibits ATFa function by
forming heterodimers (33).
The splice variants of RFT, RFT-A', and RFT-B contain defective DNA
binding domains and fail to bind the gccgaac sequence and repress FGF-2
transcription. This lack of function is attributable to the mutations
in their DNA binding domain and is likely caused by alternative
splicing but not to the disruption of the nuclear localization signal.
So far, the functions of RFT-A' and B are not fully understood. Because
the RFT binding sequence is a tandem repeat, RFT-A may form a dimer to
bind to FGF-2 promoter. In such a case, RFT-A' and B may inhibit RFT-A
function by forming a heterodimer, as in the case of ATFa. In Fig. 3,
B and C, RFT-A' and B induce a slight activation
in both U87MG and 293 cells, but there is a difference in the magnitude
of responsiveness for RFT-A' and RFT-B between the U87MG and 293 cell
lines. We hypothesize that this difference might be because of the
difference in endogenous levels of each RFT isoform between the two
cell lines. Our interpretation is that high endogenous RFT-A' and RFT-B
levels in U87MG cells have a more dominant negative effect on cellular
RFT-A; therefore, exogenous RFT-A' and B in U87MG cells are less
effective than in 293 cells.
When we measured the protein level of FGF-2 after overexpression of
RFT, we saw that FGF-2 level is nondetectable in RFT-A-infected cells.
However, in RFT-B-infected cells, some cells continue to show a high
level expression of FGF-2 while they express high levels of RFT-B.
These results indicate that, unlike RFT-A, RFT-B overexpression is not
incompatible with FGF-2 expression.
It appears that, at least proportionally, transformed glial cells
express more mutant forms of RFT (A' and B) than the functional form
(A) (Fig. 5). We do not know if this is the cause of the transformation
or a middle step or the result of tumor progression. Our data suggest
that these splice variants could be either dominant negative regulators
of RFT-A or by-products of mistaken alternative splicing. We are
currently conducting experiments to investigate this issue.
RFT-A Causes Glioma Cell Death--
Most human gliomas are
characterized by high level expression of FGF-2. However, it is not
known if overexpression of FGF-2 is the direct cause of tumorigenesis
and progression. Previous data have shown that anti-FGF-2 neutralizing
antibodies cause glioma cell apoptosis (28).
In our studies, introducing high level RFT-A carried by AAV into glioma
cells also decreases intracellular FGF-2 level and causes cell death.
The positive TUNEL staining suggests that the cells may undergo
apoptosis, but at present we are exploring the mechanism of cell death
further. Interestingly, overexpression of RFT-B, which is a dominant
form of RFT in human glioma, not only did not cause cell death but also
increased cell growth into proliferative aggregates of cells that piled
upon each other (Fig. 5B). Such an effect may be because of
the activating function of RFT-B as shown in transient transfection
assay (Fig. 3B). Moffet et al. (12) observed that
factors in human astrocytes bind to FGF-2 promoter in a cell
density-dependent manner and induce contact inhibition. The
function of RFT suggests that it may be one of the candidates for such
factors. Therefore, our data suggest that even though FGF-2 may not be
the original cause of tumor progression, it may be a key player in this
process. An abnormally high level of FGF-2 may result from the lack of
RFT-A expression relative to RFT-A' and B. If such a hypothesis is
proven to be correct, we speculate that RFT-A could be a useful agent
in treating FGF-2-dependent tumors.
In conclusion, FGF-2 gene expression is negatively regulated by RFT-A
by transcriptional repression. Regulation of such function is partly
achieved through the alternative splicing mechanism in the DNA binding
domain of RFT, suggesting that the imbalance in the ratios of these
splice variants may be responsible for the constitutive expression of
FGF-2 gene, resulting in tumor progression in
FGF-2-dependent tumors. Furthermore, overexpression of the
normal transcriptional repressor, RFT-A, induces apoptosis when FGF-2
is deregulated in tumor cells.
 |
ACKNOWLEDGEMENTS |
We thank L. Kitabayashi for taking the
confocal microscopic images; Dr. K. Tashiro for the cDNA library;
Dr. G. Karpen and J. Wahlstrom for technical assistance; Dr. J. Ray for
a critical discussion; Dr. I. Verma, Dr. K. Sakurada, M. L. Gage,
Dr. S. Suhr, Dr. D. V. Schaffer, and Dr. T. Palmer for critical
reading of the manuscript.
 |
FOOTNOTES |
*
This work was supported by NIA and NINDS, contract number
NO1-NS-6-2348 from the National Institutes of Health.The costs of publication of this
article were defrayed in part by the
payment of page charges. The article
must therefore be hereby marked
"advertisement" in
accordance with 18 U.S.C. Section
1734 solely to indicate this fact.
Present address: Kyoto University Medical School, Department of
Neurosurgery, Kawaharachou Shougoin Sakyoku, Kyoto 606, Japan.
§
To whom correspondence and requests for reprints should be
addressed. E-mail: fgage{at}salk.edu.
 |
ABBREVIATIONS |
The abbreviations used are:
FGF-2, fibroblast
growth factor 2;
RFT, regulator of FGF-2 transcription;
kb, kilobase(s);
GFP, green fluorescent protein;
bp, base pair(s);
AAV, adeno-associated virus;
PCR, polymerase chain reaction;
TUNEL, TdT-mediated dUTP-X nick end-labeling;
HEF, human embryonic fibroblast;
G3PDH, glyceraldehyde-3-phosphate dehydrogenase.
 |
REFERENCES |
-
Abraham, J. A.,
Mergia, A.,
Whang, J. L.,
Tumolo, A.,
Friedman, J.,
Hjerrild, K. A.,
Gospodarowicz, D.,
and Fuddas, J. C.
(1986)
Science
233,
545-548[Abstract/Free Full Text]
-
Hanahan, D.,
and Folkman, J.
(1996)
Cell
86,
353-364[CrossRef][Medline]
[Order article via Infotrieve]
-
Lee, P. L.,
Johnson, D. E.,
Cousens, L. S.,
Fried, V. A.,
and Williams, L. T.
(1989)
Science
245,
57-60[Abstract/Free Full Text]
-
Cohn, M. J.,
Izpisua-Belmonte, J. C.,
Abud, H.,
Heath, J. K.,
and Tickle, C.
(1995)
Cell
80,
739-746[CrossRef][Medline]
[Order article via Infotrieve]
-
Baird, A.
(1994)
Curr. Opin. Neurobiol.
4,
78-86[CrossRef][Medline]
[Order article via Infotrieve]
-
Takahashi, J. A.,
Mori, H.,
Fukumoto, M.,
Igarashi, K.,
Jaye, M.,
Oda, Y.,
Kikuchi, H.,
and Hatanaka, M.
(1990)
Proc. Natl. Acad. Sci. U. S. A.
87,
5710-5714[Free Full Text]
-
Zagzag, D.,
Miller, D. C.,
Sato, Y.,
Rifkin, D. B.,
and Burstein, D. E.
(1990)
Cancer Res.
50,
7393-7398[Abstract/Free Full Text]
-
Cotman, C. W.,
and Gomez-Pinilla, F.
(1991)
Ann. N. Y. Acad. Sci.
638,
221-231[CrossRef][Medline]
[Order article via Infotrieve]
-
Tooyama, I.,
Kremer, H. P. H.,
Hayden, M. R.,
Kimura, H.,
McGeer, E. G.,
and McGeer, P. L.
(1993)
Brain Res.
610,
1-7[CrossRef][Medline]
[Order article via Infotrieve]
-
Biesiada, E.,
Razandi, M.,
and Levin, E. R.
(1996)
J. Biol. Chem.
271,
18576-18581[Abstract/Free Full Text]
-
Care, A.,
Silvani, A.,
Meccia, E.,
Mattia, G.,
Stoppacciaro, A.,
Parmiani, G.,
Peschle, C.,
and Colombo, M. P.
(1996)
Mol. Cell. Biol.
16,
4842-4851[Abstract]
-
Moffett, J.,
Kratz, E.,
Florkiewicz, R.,
and Stachowiak, M. K
(1996)
Proc. Natl. Acad. Sci. U. S. A.
93,
2470-2475[Abstract/Free Full Text]
-
Stachowiak, M. K.,
et al..
(1994)
J. Cell Biol.
127,
203-223[Abstract/Free Full Text]
-
Ueba, T.,
Nosaka, T.,
Takahashi, J. A.,
Shibata, F.,
Florkiewicz, R. Z.,
Vogelstein, B.,
Oda, Y.,
Kikuchi, H.,
and Katanaka, M.
(1994)
Proc. Natl. Acad. Sci. U. S. A.
91,
9009-9013[Abstract/Free Full Text]
-
Wang, D.,
Mayo, M. W.,
and Baldwin, A. S., Jr.
(1997)
Oncogene
14,
2291-2299[CrossRef][Medline]
[Order article via Infotrieve]
-
Gospodarowicz, D.
(1989)
J. Invest. Dermatol.
93,
39S-47S[CrossRef][Medline]
[Order article via Infotrieve]
-
Tashiro, K.,
Pando, M. P.,
Kanegae, Y.,
Wamsley, P. M.,
Inoue, S.,
and Verma, I. M.
(1997)
Proc. Natl. Acad. Sci. U. S. A.
94,
7862-7867[Abstract/Free Full Text]
-
Shibata, F.,
Baird, A.,
and Florkiewicz, R. Z.
(1991)
Growth Factors
4,
277-287[Medline]
[Order article via Infotrieve]
-
Graham, F. L.,
Smiley, J.,
Russell, W. M.,
and Nairm, R.
(1997)
J. Gen. Virol.
36,
59-72[Abstract/Free Full Text]
-
Ishii, S.,
Merlino, G. T.,
and Pastan, I.
(1985)
Science
230,
1378-1381[Abstract/Free Full Text]
-
Snyder, R. O.,
Spratt, S. K.,
Lagarde, C.,
Bohl, D.,
Kaspar, B.,
Sloan, B.,
Cohen, L. K.,
and Danos, O.
(1997)
Human Gene Therapy
8,
1891-1900[Medline]
[Order article via Infotrieve]
-
Zhou, S. Z.,
Cooper, S.,
Kang, L. Y.,
Ruggieri, L.,
Heimfeld, S.,
Srivastava, A.,
and Broxmeyer, H. E.
(1994)
J. Exp. Med.
179,
1867-1875[Abstract/Free Full Text]
-
Zeleznik-Le, N. J.,
Harden, A. M.,
and Rowley, J. D.
(1994)
Proc. Natl. Acad. Sci. U. S. A.
91,
10610-10614[Abstract/Free Full Text]
-
Gu, Y.,
Nakamura, T.,
Alder, H.,
Prasad, R.,
Canaani, O.,
Cimino, G.,
Croce, C. M.,
and Canaani, E.
(1992)
Cell
71,
701-708[CrossRef][Medline]
[Order article via Infotrieve]
-
Bestor, T.,
Laudano, A.,
Mattaliano, R.,
and Ingram, V.
(1988)
J. Mol. Biol.
203,
971-983[CrossRef][Medline]
[Order article via Infotrieve]
-
Suzuki, M.
(1989)
J. Mol. Biol.
207,
61-84[CrossRef][Medline]
[Order article via Infotrieve]
-
Cross, S. H.,
Meehan, R. R.,
Nan, X.,
and Bird, A.
(1997)
Nat. Genet.
16,
256-259[CrossRef][Medline]
[Order article via Infotrieve]
-
Murai, N.,
Ueba, T.,
Takahashi, J. A.,
Yang, H. Q.,
Kikuchi, H.,
Hiai, H.,
Hatanaka, M.,
and Fukumoto, M.
(1996)
Neurosurgery
85,
1072-1077
-
Foulkes, N. S.,
and Sassone-Corsi, P.
(1991)
Cell
68,
411-414
-
Green, M. R.
(1991)
Annu. Rev. Cell Biol.
7,
559-599[CrossRef]
-
Grabowski, P. J.
(1998)
Cell
92,
709-712[CrossRef][Medline]
[Order article via Infotrieve]
-
Skerjanc, I. S.,
Truong, J.,
Filion, P.,
and McBurney, M. W.
(1996)
J. Biol. Chem.
271,
3555-3561[Abstract/Free Full Text]
-
Pescini, R.,
Kaszubska, W.,
Whelan, J.,
DeLamarter, J. F.,
and van Huijsduijnen, R. H.
(1994)
J. Biol. Chem.
269,
1159-1165[Abstract/Free Full Text]
Copyright © 1999 by The American Society for Biochemistry and Molecular Biology, Inc.

CiteULike
Complore
Connotea
Del.icio.us
Digg
Reddit
Technorati What's this?
This article has been cited by other articles:

|
 |

|
 |
 
X. Li, B. Z. Barkho, Y. Luo, R. D. Smrt, N. J. Santistevan, C. Liu, T. Kuwabara, F. H. Gage, and X. Zhao
Epigenetic Regulation of the Stem Cell Mitogen Fgf-2 by Mbd1 in Adult Neural Stem/Progenitor Cells
J. Biol. Chem.,
October 10, 2008;
283(41):
27644 - 27652.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
H. F. Jorgensen, I. Ben-Porath, and A. P. Bird
Mbd1 Is Recruited to both Methylated and Nonmethylated CpGs via Distinct DNA Binding Domains
Mol. Cell. Biol.,
April 15, 2004;
24(8):
3387 - 3395.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
D. Giri and M. Ittmann
Interleukin-8 Is a Paracrine Inducer of Fibroblast Growth Factor 2, a Stromal and Epithelial Growth Factor in Benign Prostatic Hyperplasia
Am. J. Pathol.,
July 1, 2001;
159(1):
139 - 147.
[Abstract]
[Full Text]
[PDF]
|
 |
|
Copyright © 1999 by the American Society for Biochemistry and Molecular Biology.