![]()
|
|
||||||||
J Biol Chem, Vol. 274, Issue 15, 10439-10450, April 9, 1999
,
From the Department of Cell Biology, Albert Einstein College of Medicine, New York, New York, 10461 and ¶ Cytel Corporation, La Jolla, California 92121
| |
ABSTRACT |
|---|
|
|
|---|
The LEC11 Chinese hamster ovary (CHO)
gain-of-function mutant expresses an There are five known human FUT genes that encode an
Gain-of-function mutants that express an Since the de novo expression of an Materials--
Restriction enzymes and buffers were from
Boehringer Mannheim, New England Biolabs (Beverly, MA), Promega
(Madison, WI), and Life Technologies, Inc. T4 DNA ligase, alkaline
phosphatase, proteinase K, and DNase I were from Boehringer Mannheim.
T4 polynucleotide kinase, RQ1 DNase, RNasin, Sp6 RNA polymerase, Klenow
fragment, rATP, rCTP, rGTP, and rUTP were from Promega. Superscript II
reverse transcriptase, terminal deoxynucleotidyltransferase, RNase H, DNA molecular weight markers, G418, fetal bovine serum, bovine calf
serum, Cell Lines and Cell Culture--
CHO parental cell lines,
Pro Selection of Generation of Somatic Cell Hybrids--
To obtain somatic cell
hybrids, CHO cells carrying the Pro Monoclonal Antibody Binding--
The ability of CHO cells and
the three LEC11 cell lines to bind to anti-SSEA-1, CSLEX-1, or VIM-2
monoclonal antibodies was quantitated as described (17, 24). Briefly,
106 washed cells were incubated with ~1 µg of antibody
in 200 µl of phosphate-buffered saline, pH 7.2, containing 2% bovine
serum albumin for 1 h at 4 °C. After washing to remove primary
antibody, rabbit anti-mouse IgM antibody was incubated under the same
conditions for 1 h. After removal of unbound secondary antibody,
125I-protein A-Sepharose (~100,000 cpm) was added.
Following 1 h at 4 °C, bound 125I was counted in a
gamma scintillation counter.
E-Selectin Binding Assays--
Confluent 48-well cultures of
human umbilical vein endothelial cells were prepared as described (28)
and stimulated with interleukin-1 Isolation of a Chinese Hamster FUT Gene--
Genomic DNA from
Lec1 CHO cells was partially digested with MboI, and
fragments of 9-23 kb were isolated using sodium chloride gradient
centrifugation. Size-fractionated DNA fragments were partially filled
in with dATP and dGTP and ligated to XhoI-digested
Phage DNA from clone A6.1 contained an ~9-kb EcoRI
fragment and a 3.2-kb SacI fragment that hybridized under
stringent conditions (0.2× SSC containing 0.2% SDS at 65 °C) to
the 944 bp probe. These two fragments and subclones derived from them
were cloned into the pBluescript SK(+) (Stratagene), pGEM3Z vector, or
pGEM7Zf(+) vectors (Promega), respectively. Plasmids were amplified in
E. coli strains XL1-Blue or JM109, and plasmid DNA was
purified using Qiagen (Valencia, CA) plasmid preparation kits. DNA
sequencing on both strands was performed using automated sequencer
models ABI373A and ABI337 (Perkin-Elmer). Reactions were primed with vector-specific oligonucleotides and subsequently with primers derived
from the known sequence of the FUT gene. DNA and protein sequence analyses were performed using the GCG Sequence Analysis Software Wisconsin Package version 9.1, Geneworks version 2.5 (30),
CLUSTAL W version 1.7 (31), and SCANPS version 2.3.1 (32).
Transfection of the Cloned FUT Gene--
Purified plasmid DNA (2 µg) was mixed with pSV2neo DNA (2 µg) and transfected into
Pro Northern Blot Analysis and Ribonuclease Protection--
Total
RNA from CHO or hybrid cells was prepared using 1 ml of TRIzol Reagent
(Life Technologies, Inc.) for 107 cells to obtain ~150
µg of total RNA. Poly(A)+ RNA was isolated from
~108 washed cells using FastTrack 2.0 Kit mRNA
Isolation System (Invitrogen, Carlsbad, CA) to obtain poly(A)+ RNA. RNA
was separated on a 1.2% formaldehyde-agarose gel, transferred to
Hybond nylon membrane (Amersham Pharmacia Biotech), and hybridized at
60 °C in 50 mM PIPES buffer (pH 6.4), 0.1 M
NaCl, 50 mM phosphate buffer, 2 mM EDTA, 5%
SDS, and 100 µg/ml herring sperm DNA. Blots were hybridized initially
to a 0.6-kb AvaI fragment, representing the 5'-coding sequence of the cloned CHO FUT gene and, after boiling in
0.1% SDS, to a human cardiac actin probe (PstI fragment)
(34). DNA probes were labeled with [
For ribonuclease protection experiments, total or poly(A)+
RNA was used with the RPAII Ribonuclease Protection Assay kit from Ambion (Austin, TX) with minor modifications. Riboprobes were labeled
by in vitro transcription to 1-2 × 108
cpm/µg RNA with [32P]CTP using T7 or SP6 RNA polymerase
(Promega). Approximately 10 µg of total RNA or 1 µg of
poly(A)+ RNA was hybridized overnight to ~3 fmol of
antisense RNA probe at 45 °C. RNase T1 was added at a concentration
of 90 units/ml in 220-µl aliquots. Reactions were performed at
37 °C for 50-80 min. Digestion products were denatured and
separated by electrophoresis in 5 or 8% polyacrylamide gels
containing 8 M urea at 250-300 V for 4-8 h. Nonspecific
protection was monitored using yeast tRNA. Protected radiolabeled
fragments were visualized by autoradiography.
Southern Blot Analysis--
Genomic DNA was prepared by either a
standard proteinase K method or the Blood & Cell Culture DNA maxi kit
(Qiagen). Digestion of genomic DNA to completion was accomplished using
various restriction enzymes from Boehringer Mannheim. DNA fragments
were separated by 0.8% agarose-gel electrophoresis at 40 V overnight
followed by transfer to Hybond nylon membrane (Amersham Pharmacia
Biotech) with 20× SSC. After UV cross-linking in a Stratalinker
(Stratagene), the membranes were hybridized in Rapid-Hyb buffer at
65 °C for 3 h. DNA fragments were labeled with
[ Reverse Transcription (RT) and Polymerase Chain Reaction
(PCR)--
For reverse transcription, 1-2 µg of
poly(A)+ RNA, 15 pmol of antisense primer, and 1 unit/µl
RNasin were heated to 75 °C for 10-15 min and slowly cooled to room
temperature before adding 200-400 units of Superscript II reverse
transcriptase together with First Strand Buffer (Life Technologies,
Inc.), each of dATP, dCTP, dGTP, dTTP to 1 mM and 10 mM dithiothreitol. Reactions were incubated for 2 h at
42 °C, heated for 5 min at 95 °C, and stored at
PCR reactions were performed using the Expand Long Template PCR System
(Boehringer Mannheim) following the protocol provided by the
manufacturer. For amplification of small fragments (<3 kb), PCR buffer
1 (50 mM Tris-HCl, pH 9.2, 16 mM
(NH4)2SO4, 1.75 mM
MgCl2) and 350 µM of each dNTP were used; for
amplification of relatively long products PCR buffer 2 (50 mM Tris-HCl, pH 9.2, 16 mM
(NH4)2SO4, 2.25 mM
MgCl2) and 500 µM of each dNTP were used. Two
separate mixes for each reaction were prepared on ice as follows: master mix 1 (up to 25 µl) contained upstream and downstream primers (15 pmol of each), template DNA, and dNTPs; master mix 2 (up to 25 µl) contained PCR buffer, and 0.75 µl of the two thermostable DNA
polymerases, Taq and Pwo. For PCR the mixes were
combined in a single thin wall tube, overlaid with 30 µl of mineral
oil, and heated at 94 °C for 2 min before starting the PCR program. In general the denaturing step was set at 94 °C for 20 s;
annealing was for 30 s, with the annealing temperature
55-65 °C, depending on the melting temperature
(Tm) of the primer pair; the elongation temperature
was always 68 °C, and elongation time varied according to the
expected length of PCR products. After 10 cycles, the elongation time
was extended for 20 s per cycle. The primer pairs are given in
figure legends. To clone, freshly made PCR products were separated on
low melting agarose gels and purified using Wizard PCR Preps DNA
Purification System (Promega). This DNA was subcloned into the pCRII or
pCR2.1 vector using the Original TA Cloning Kit from Invitrogen.
5'- and 3'-Rapid Amplification of cDNA Ends (RACE)--
For
5'-RACE, first strand cDNA synthesis was performed on 2 µg of
poly(A)+ RNA, using the antisense primer given in the
respective figure legend. After reverse transcription, 1 µl of RNase
H (2.5 units/µl) was added, and the RNA template was digested by
incubation at 55 °C for 20 min. The reaction (100 µl) was
extracted once with phenol:chloroform:IAA (25:24:1), and cDNA
products were purified through a Sephadex G-50 Quick Spin Column
(Boehringer Mannheim). To add poly(A), 15 µl of cDNA was heated
at 95 °C for 2 min and quickly chilled on ice before adding 2 µl
of 5× terminal deoxynucleotidyltransferase buffer (Life Technologies,
Inc.), 2 µl of dATP (2.5 mM) and 1.5 µl of terminal
deoxynucleotidyltransferase (18 units/µl). After incubation at
37 °C for 15 min, the reaction was heated to 70 °C for 15 min,
diluted to 100 µl, and passed through a G-50 column. For first round
PCR amplification, 10 µl of cDNA product was used with
oligo(dT)/anchor primer GATCAGAATTCAGCGGCCGCACC(T)19 and the relevant gene-specific nested primer at an annealing temperature of
58 °C and an elongation time of 1 min. For second round PCR amplification, 5 µl of first round PCR product was added to the anchor primer GATCAGAATTCAGCGGCCGCACC and a second nested primer, the
annealing temperature was 65 °C and the elongation time was 1 min.
After second round PCR, the strongest band observed by ethidium bromide
staining was excised from the gel, further gel-purified, and subjected
to TA cloning (Invitrogen).
For 3'-RACE, poly(A)+ RNA from each LEC11 mutant, and the
oligo(dT)/anchor primer GATCAGAATTCAGCGGCCGCACC(T)19 were
used. After the RT reaction, the sample was diluted to 100 µl and
purified through a Sephadex G-50 column (Boehringer Mannheim). To
amplify 3' cDNA ends, PCR reactions were carried out using 5 µl
of purified first strand cDNA products with a gene-specific primer
(see figure legends) and GATCAGAATTCAGCGGCCGCACC. The annealing
temperature was 65 °C, and the elongation time was 1 min. The most
intense ethidium bromide products between 0.5 and 1.2 kb were
gel-purified and subjected to TA cloning and sequencing.
Selection of Independent Gain-of-Function Mutants with a LEC11
Phenotype--
Independent LEC11 mutants were obtained by selecting
for resistance to WGA and screening surviving colonies for expression of LeX using the anti-LeX monoclonal antibody
Isolation of a CHO FUT Gene That Is Expressed in LEC11, LEC11A, and
LEC11B Cells--
A
The 3.2-kb SacI fragment contained a long open reading frame
homologous to the coding region of the human FUT5,
FUT3, and FUT6 genes (73, 72.1, and 71.9%
identical respectively) but considerably different from the
FUT4 (50.8% identical), FUT7 (53.2% identical), and the Fuc-TIX cDNA (50.5% identical) coding sequences. Northern analysis with coding region probe 2 gave a hybridization signal of
~1.8 kb with RNA from each LEC11 mutant but not with RNA from parental CHO (Fig. 2A).
Ribonuclease protection with riboprobes transcribed from probes 2 and
3, respectively, showed that each LEC11 mutant expresses the same or a
highly homologous FUT gene. The 5'-riboprobe of 668 nt
protected a sequence spanning nt 12-617 (Fig. 2B) and the
3'-riboprobe of 415 nt protected a sequence spanning nt 638-1053 of
the FUT gene coding region (Fig. 2C). No
transcripts were protected in parent CHO cell poly(A)+ RNA.
In addition, other gain-of-function CHO mutants that possess a
biochemically distinct The Cloned CHO FUT Gene Is Orthologous to Human FUT6--
The
coding region of the cloned FUT gene contains an ATG that
conforms to the Kozak consensus sequence (37) and predicts a
polypeptide of 362 amino acids (Fig.
3A). Hydropathy analysis (38)
revealed a single hydrophobic membrane spanning domain of 20 amino
acids near the N terminus, which predicts the Type 2 transmembrane
topology typical of mammalian glycosyltransferases (39). The sequences
also predict three N-linked glycosylation sites, each
located at a position similar to N-glycosylation sequons in
the human FUT5 and FUT6 genes and in a bovine
FUT gene (35). The CHO and bFUT genes lack a
fourth N-glycosylation sequon at position 46 (hFUT5) or 60 (hFUT6). A comparison of the
deduced CHO FUT gene amino acid sequences with the most
related human
CLUSTAL W analysis showed the CHO FUT gene coding sequence
to be most related to the coding sequence of the hFUT6 gene
(Fig. 3B). The CHO Rearrangements of a CHO FUT6 Gene in LEC11 and LEC11A Cells
Indicate a cis Mechanism of Gene Activation--
To determine if the
CHO FUT6 gene was rearranged in any of the LEC11 mutants,
Southern analyses were performed using coding region probe 2 and the
locus-specific probe 1 immediately upstream of the coding region (Fig.
4). Following EcoRI or
HindIII digestion, locus-specific probe 1 detected a single
hybridizing band in DNA from CHO cells and each LEC11 mutant (Fig.
4A). However, the same blot hybridized to coding region
probe 2 gave two or three hybridizing bands, the largest one being the
same size as the fragment detected by probe 1. Six different
restriction enzymes gave at least two hybridizing fragments with coding
region probe 2. Fragments of identical size were present in Chinese
hamster liver DNA (Fig. 4A and data not shown). Since these
enzymes do not cut within the sequence of coding region probe 2, the
data suggest that the Chinese hamster (cg) genome contains two, highly
homologous cgFUT 6 genes and that their integrity and
location is maintained in the genome of CHO cells.
Southern analyses with coding region probe 2 identified an additional
band in genomic DNA from both LEC11 and LEC11A cells that was absent
from Chinese hamster liver, CHO, and LEC11B DNA (Fig. 4,
A-C). This extra hybridizing fragment was of weaker
intensity indicating that it came from one copy of one allele of a
cgFUT6 gene. Five of six restriction enzymes examined
detected an extra fragment in LEC11A DNA (EcoRI, 5.2 kb;
HindIII, 3 kb; BamHI, 6.3 kb; BglII,
9.7 kb; KpnI, 6.5 kb) and three detected an extra fragment in LEC11 DNA (BamHI 7.8 kb; KpnI, 7.2 kb;
ApaI, 5 kb). Therefore, one copy of a CHO cgFUT6
gene in both LEC11A and LEC11 cells appears to have undergone
rearrangement leading to expression of the gene. By comparing Southern
patterns obtained with probes 1 and 2, it can be deduced that the
breakpoint for the rearrangement in LEC11A DNA occurred in the
~0.5-kb region between probes 1 and 2, just upstream of the cloned
CHO cgFUT6 gene-coding region. This type of cis
rearrangement in LEC11 and LEC11A cells is not predicted to be relevant
to the in vivo regulation of a FUT6 gene.
However, no rearrangements were detected in genomic DNA from LEC11B
cells. Therefore, the mechanism of activation of a cgFUT6
gene in this mutant was examined by somatic cell hybrid analysis.
A trans-Acting, Negative Regulatory Factor That Controls cgFUT6
Gene Expression Is Inactive in LEC11B Cells--
In order to determine
whether a cis- or trans-genetic mechanism caused
expression of a cgFUT6 gene in LEC11B cells, somatic cell
hybrids were analyzed for the ratio of cgFUT6 gene
transcripts compared with actin transcripts. In a cis
mechanism of gene activation, a rearranged cgFUT6 allele
would continue to be transcribed in hybrids formed with CHO cells, and
the cgFUT6 genes in the CHO genome would remain silent,
giving a cgFUT6 transcript:actin transcript ratio close to
0.5. In a trans-positive mechanism, a gene other than a
cgFUT6 gene would be affected, and its product would
activate a cgFUT6 gene in the mutant and in the
parent CHO genomes. In this case, the cgFUT6:actin
transcript ratio would be close to 1.0. In a trans-negative
mechanism of gene activation, the negative regulator that keeps
cgFUT6 genes silent in CHO cells would suppress the
cgFUT6 gene expressed in the mutant, and the cgFUT6:actin transcript ratio would be close to zero.
Independent hybrids between CHO parental cells and LEC11, LEC11A, or
LEC11B cells were isolated, and total RNA was subjected to Northern
analysis using coding region probe 2 followed by an actin gene probe.
The results in Fig. 5A show
that LEC11 × CHO and LEC11A × CHO hybrids contained readily
detectable cgFUT6 gene transcripts, as predicted if they
arose by a cis mechanism. However, LEC11B × CHO
hybrids had little or no hybridizing signal with probe 2, despite
equivalent hybridization to the actin probe. The suppression of
cgFUT6 gene transcripts in these hybrids provides evidence
for the action of a negative regulatory factor encoded by the CHO
genome. Consistent with this, hybrids formed between LEC11B and an
unrelated glycosylation mutant LEC18 that should also contain the
negative regulator had zero or low levels of cgFUT6 gene
transcripts by Northern analysis (Fig. 5B). The presence of
low levels of cgFUT6 gene transcripts in hybrids formed with LEC11B cells may be due to limiting amounts of the
trans-acting negative regulator. Alternatively, the gene
encoding the negative regulator could be lost in a few hybrids due to
chromosomal segregation. Although CHO cell hybrids are relatively
stable, chromosomal segregation occurs at frequencies of
~10
The ratio of cgFUT6:actin gene transcripts was calculated by
densitometry of Northern signals (Table
II). In all hybrid combinations that
included LEC11B, the cgFUT6:actin transcript ratio was the level
predicted for a trans-negative mechanism: in LEC11B × CHO hybrids the transcript ratio was
Additional evidence for the presence of a negative regulator of
cgFUT6 gene expression in CHO cells that is inactive in
LEC11B cells was obtained by Only One of Two cgFUT6 Genes Is Expressed in LEC11B
Cells--
Southern analyses showed that the CHO genome contains two
genes homologous to the cloned cgFUT6 gene (Fig. 4). To
determine whether one or both of these genes is expressed in LEC11B
cells, 3'-RACE was performed on poly(A)+ RNA from each
LEC11 mutant. A complete 3'-UTR sequence was obtained in each case
(Fig. 6A). The LEC11B and
LEC11 3'-RACE products differed in only three
nucleotides from the sequence of the cloned cgFUT6 gene up
to nucleotide 38 from the coding region stop codon. Thereafter,
however, they diverged completely from the cloned sequence (Fig. 3) and
from the sequence obtained from LEC11A 3'-RACE products (Fig.
6A). By contrast, LEC11A 3'-RACE products were identical to
the cloned sequence in Fig. 3 and included additional sequence until a
stretch of poly(A) (Fig. 6B). From these analyses it could
be concluded that LEC11A transcripts derived from the cloned
cgFUT6 gene, whereas LEC11 and LEC11B transcripts both derived from a distinct FUT6 gene. Consistent with this, it
was shown that a probe obtained from the unique 3'-UTR sequence common to LEC11 and LEC11B transcripts hybridized only to transcripts from
those cells and not to LEC11A transcripts (Fig.
7).
When LEC11B poly(A)+ RNA was subjected to 5'-RACE using a
primer near the ATG of the cloned cgFUT6A gene, a sequence
that diverged 5' of the cloned cgFUT6A gene sequence was
obtained, precisely at a conserved splice acceptor site (Fig.
6B). A probe derived from this new sequence hybridized only
to cgFUT6 gene transcripts in LEC11B cells (Fig. 7). This 5'
exon was shown to be linked to the coding region by sequencing of
RT-PCR products from primers that spanned the 5'-UTR and coding exons
(data not shown). The fact that the 5' exon was not present in LEC11 or
LEC11A cgFUT6 gene transcripts provides further evidence for
rearrangement of the respective cgFUT6 genes transcribed in
these mutants.
The transcript-specific 3'-UTR probes and coding region probe 2 were
used in Southern analyses to identify hybridizing fragments corresponding to the distinct cgFUT6 genes (Fig.
8). The 3'-UTR probe that hybridized
solely to transcripts from LEC11A cells hybridized to only one of the
two DNA fragments detected by coding region probe 2. Therefore, this
fragment contains the cloned cgFUT6 gene that is
functionally expressed only in LEC11A cells and is henceforth termed
cgFUT6A. The 3'-UTR probe that hybridized solely to
transcripts from LEC11 and LEC11B cells was found by Southern analysis
to hybridize to the second genomic DNA fragment identified by coding
region probe 2. Therefore this probe hybridized to the second
functional cgFUT6 gene, henceforth termed
cgFUT6B.
Additional evidence for the existence of two FUT6 genes was
obtained by sequencing PCR products derived from genomic DNA of Pro cgFUT6B Gene Transcripts Are Suppressed in LEC11A × LEC11B
Hybrids--
If a negative regulatory factor represses expression of
the cgFUT6B gene in LEC11B cells by a trans
mechanism, and the cgFUT6A gene is expressed in LEC11A cells
by a cis mechanism, hybrids formed between LEC11A and LEC11B
cells should suppress expression of cgFUT6B gene transcripts
and express mainly cgFUT6A gene transcripts. The Northern
blots in Fig. 9 show this to be the case.
Independent LEC11A × LEC11B hybrids contained predominantly
cgFUT6A gene transcripts. Densitometry analyses of the
FUT6:actin signal ratio for hybrids with the cgFUT6A
gene-specific probe averaged 0.88 compared with 0.94 for LEC11A RNA and
0.02 for LEC11B RNA (Fig. 9A). By contrast, the ratio for
the cgFUT6B probe averaged 0.1 for hybrid transcripts (Fig.
9B). A 4-fold difference was obtained between
LEC11A-specific and LEC11B-specific transcripts in hybrids, similar to
the ratio observed in LEC11B × CHO and LEC11B × LEC18
hybrids (Fig. 4 and Table II). Therefore, LEC11A × LEC11B hybrids
expressed predominantly transcripts from the cgFUT6A gene
which is functional in LEC11A cells, whereas transcripts from the
cgFUT6B gene were suppressed. Consistent with this,
fucosyltransferase activities of two LEC11A × LEC11B hybrids were
those expected if only one cgFUT6 gene was active. Thus, the
trans-negative regulatory factor contributed by the LEC11A
genome specifically suppressed expression of the cgFUT6B
gene in both the LEC11A and the LEC11B genome.
Gain-of-function CHO mutants have provided access to several
developmentally regulated glycosyltransferase activities, including two
novel GlcNAc-T activities that generate new N-glycan cores not available from any other source (14, 46). In this paper, characterization of three gain-of-function LEC11 mutants has shown that
two of them arose due to a cis mechanism of gene
rearrangement that resulted in expression of one of two
cgFUT6 genes, whereas the third arose due to the loss of an
NRF that suppresses expression of only the cgFUT6B gene in
CHO cells (Table IV). Neither
cgFUT6 gene gave detectable transcripts in
poly(A)+ RNA from CHO cells. The cgFUT6 genes
therefore appear to be transcriptionally silent in CHO cells, since
even very short-lived messenger RNAs such as myc gene
transcripts with a half-life of only 9 min are detected by Northern
analysis (47).
(1,3)fucosyltransferase
(
(1,3)Fuc-T) activity that generates the LeX,
sialyl-LeX, and VIM-2 glycan determinants and has been
extensively used for studies of E-selectin ligand specificity. In order
to identify regulatory mechanisms that control
(1,3)Fuc-T expression
in mammals, mechanisms of FUT gene expression were
investigated in LEC11 cells and two new, independent mutants, LEC11A
and LEC11B. Northern and ribonuclease protection analyses, using probes
that span the coding region of a cloned CHO FUT gene,
detected transcripts in each LEC11 mutant but not in CHO cells or other
gain-of-function CHO mutants that express a different
(1,3)Fuc-T
activity. Coding region sequence analysis and
(1,3)Fuc-T acceptor
specificity comparisons with recombinant human Fuc-TV and Fuc-TVI
showed that the cloned FUT gene is orthologous to the human
FUT6 gene. Southern analyses identified two closely related
FUT6 genes in the Chinese hamster, whose evolutionary
relationships are discussed. The blots showed that rearrangements had
occurred in LEC11A and LEC11 genomic DNA, consistent with a
cis mechanism of FUT6 gene activation in these
mutants. By contrast, somatic cell hybrid analyses revealed that LEC11B
cells express FUT6 gene transcripts due to the loss of a
trans-acting, negative regulatory factor. Sequencing of
reverse transcriptase-polymerase chain reaction products identified
unique 5'- and 3'-untranslated region sequences in FUT6
gene transcripts from each LEC11 mutant. Northern and Southern analyses
with gene-specific probes showed that LEC11A cells express only the
cgFUT6A gene (where cg is Cricetulus griseus),
whereas LEC11 and LEC11B cells express only the cgFUT6B
gene. In LEC11A × LEC11B hybrid cells, the cgFUT6A
gene was predominantly expressed, as predicted if a
trans-acting negative regulatory factor functions to
suppress cgFUT6B gene expression in CHO cells. This factor
is predicted to be a cell type-specific regulator of FUT6
gene expression in mammals.
![]()
INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES
(1,3)Fucosyltransferases
(
(1,3)Fuc-T)1 transfer
fucose to lactosamine sequences in glycan units, thereby creating
onco-fetal antigens that may function as cell recognition determinants
(reviewed in Refs. 1-3). Because fucose is added last in this
synthesis, regulated expression of an
(1,3)Fuc-T activity may be
critical to controlling a specific cell-cell adhesion event. This
principle was nicely demonstrated in mice by targeted disruption of the FUT7 gene (4). Mice lacking Fuc-TVII exhibit an increase in circulating lymphocytes, neutrophils, monocytes, and eosinophils that
rely on ligands fucosylated by Fuc-TVII to bind to selectins on
vascular endothelium. Leukocytes lacking Fuc-TVII are also defective in
extravasation from the bloodstream following an inflammatory stimulus,
and they home poorly to spleen and lymph nodes (4).
(1,3)Fuc-T activity (reviewed in Refs. 2 and 3). The
FUT3, FUT5, and FUT6 (Lewis) genes
reside in a cluster on chromosome 19 (5, 6); the FUT4 gene
is on chromosome 11 (7), and the FUT7 gene is on chromosome
9 (5). The recently described cDNA encoding mouse Fuc-TIX
identifies an additional FUT locus (8). The transferases encoded by
these FUT genes transfer fucose to GlcNAc in lactosamine units to generate the LeX and/or sialyl-LeX
determinants. Fuc-TIII generates in addition the Lea,
Leb, sialyl Lea, and sialyl-Leb
determinants (9). The human
(1,3)Fuc-T activities are differentially expressed in adult tissues and in cancer (2, 10, 11). The enhanced
ability of cancer cells to express sialyl-LeX has been
suggested to aid in their growth and metastatic properties and to
correlate with poor prognosis (reviewed in Ref. 12). Consistent with
this is the finding that P-selectin-deficient mice exhibit increased
experimental metastasis of human colon carcinoma cells (13). Therefore,
it is important to identify factors that control the expression of the
FUT genes and thereby regulate
(1,3)Fuc-T levels and
activities in a cell type- or tissue-specific fashion. To date it is
known that the 5'-untranslated regions of the FUT3,
FUT5, and FUT6 genes are complex and that different transcripts arise from differential splicing (11), but
promoter regions of these and related genes have not been isolated.
(1,3)Fuc-T activity not
detectable in wild-type cells provide an approach to identifying factors that serve to regulate FUT gene expression in
vivo (14). The LEC11 CHO mutant expresses an
(1,3)Fuc-T
activity that generates the LeX, sialyl-LeX,
and VIM-2 determinants on cell-surface glycans (15-17). The
sialyl-LeX determinant is instrumental in causing LEC11
cells to be recognized by E-selectin (18-21). By contrast, parent CHO
cells have no
(1,3)Fuc-T activity and do not bind antibodies that
recognize Lewis antigens, nor do they bind E-selectin expressed on
activated endothelial cells (15-21).
(1,3)Fuc-T activity in
gain-of-function LEC11 CHO mutants provides an approach to identifying regulatory mechanisms that operate in vivo, we investigated
the molecular basis of
(1,3)Fuc-T gene expression in three
independent LEC11 mutants. We show in this paper that each LEC11 mutant
expresses one of two Chinese hamster (Cricetulus griseus;
cg) FUT genes that are both orthologous to the human
FUT6 gene, whereas CHO cells contain no cgFUT6
gene transcripts by RNase protection analysis. Invesigations of somatic
cell hybrids formed between LEC11 mutants and CHO cells, as well as
LEC11 mutants with each other and with other gain-of-function mutants,
show that LEC11 and LEC11A mutants arose by a cis-dominant
mechanism probably due to rearrangement of a cgFUT6 gene. By
contrast, LEC11B cells arose by a trans-recessive mechanism,
due to the loss of a negative regulatory factor that controls
expression of the cgFUT6B gene.
![]()
EXPERIMENTAL PROCEDURES
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES
-medium, Opti-MEM I Reduced Serum Medium were from Life
Technologies, Inc. 51Cr, [
-32P]dCTP,
[
-32P]ATP, [
-32P]CTP, and
GDP-[14C]fucose (260.3 mCi/mmol) were from NEN Life
Science Products. The deoxyribonucleotide triphosphates (dNTPs) were
from Perkin-Elmer or Boehringer Mannheim. Synthetic oligonucleotides
were from the DNA Synthesis Facility of Albert Einstein College of
Medicine. Hybond Nylon membrane and Rapid-hyb buffer were from Amersham Pharmacia Biotech. Nonidet P-40, dimethyl sulfoxide, MOPS, PIPES, polyethylene glycol, N-acetyllactosamine (Gal
(1,4)GlcNAc;
LacNAc), Type 1 acceptor (Gal
1,3GlcNAc), 2'-fucosyllactose, fetuin,
sodium cacodylate, N-ethylmaleimide (NEM), and
2,3-dehydro-2-deoxy-N-acetylneuraminic acid were from Sigma.
Sialic acid
(2,3)LacNAc and unlabeled GDP-fucose were from Oxford
Glycosystems (Wakefield, MA). Fuc
(1,2)Gal
(1,3)GlcNAc-R where
R is O(CH2)8O2Me was a kind gift of
Dr. Stefan Oscarsson (Stockholm University, Sweden) and LacNAc
benzyl
and 2'-fucosyl-LacNAc were the kind gifts of Dr. Kushi Matta (Roswell
Park, Buffalo, NY). N-Methyl-N-nitrosoguanidine
was from ICN Biomedicals, Costa Mesa, CA, and ethylmethanesulfonate was
from Eastman Kodak Co. Sheep red blood cells were obtained from P.M.L.
Microbiologicals (Richmond, British Columbia, Canada). Dowex 1 × 4 (100-200 mesh) chloride form was from Bio-Rad. Other chemicals and
reagents were from either Sigma or Fisher. The monoclonal antibody
anti-SSEA-1 was prepared by 40% ammonium sulfate precipitation of
ascites produced by Caf1/J mice injected with the hybridoma
cell line 480 obtained from Dr. Barbara Knowles (Jackson Laboratories,
Bar Harbor, ME). The purified CSLEX-1 monoclonal antibody was obtained from Dr. Paul Terasaki (University of California, Los Angeles, CA), and
the VIM-2 monoclonal antibody was the generous gift of Dr. Bruce Macher
(San Francisco State University, San Francisco). Anti-E-selectin
monoclonal antibody H18/7, IgG2a, was provided by Dr. Michael
Bevilaqua. Rabbit anti-mouse IgM was from Zymed Laboratories
Inc. (San Francisco) and 125I-protein A
(~108 cpm/mg protein) was from Amersham Pharmacia
Biotech. Recombinant human Fuc-TV and human Fuc-TVI were from
Calbiochem. Interleukin-1
was from Genetics Institue (Cambridge,
MA). Lectins including wheat germ agglutinin (WGA), agglutinins
from Phaseolus vulgaris (E-PHA and L-PHA), and
ricin were from Vector Laboratories, Burlingame, CA. Ecolume was from
ICN Biomedicals (Costa Mesa, CA). Chinese hamster liver was
provided by Dr. Peter Wejksnora (University of Wisconsin, Madison, WI).
5 and Gat
2, were isolated previously
(22). The origin of the CHO mutants LEC11 (Pro
LEC11.E7)
and LEC12 (Pro-LEC12.1B) is described (23), and the LEC30 CHO mutant
was isolated as described (24). HL-60 cells were from the American Type
Culture Collection (Rockville, MD). All cells were maintained in
suspension culture at 37 °C in complete
medium supplemented with
10% fetal bovine serum or 10% bovine calf serum and 1% fetal bovine serum.
(1,3)Fuc-T Expressing CHO Mutants--
The two
new CHO mutants, LEC11A (Pro
LEC11.E2) and
LEC11B(Gat
LEC11.F2), were isolated form
Pro
5 or Gat
2 cells following mutagenesis
with N-methyl-N-nitrosoguanidine or
ethylmethanesulfonate, respectively, as described (25). Selection was
from ~107 cells with 3.5 µg/ml (LEC11A) or 7.5 µg/ml
(LEC11B) wheat germ agglutinin (WGA) followed by screening of surviving
colonies for the expression of cell surface LeX, using the
anti-SSEA-1 monoclonal antibody conjugated to sheep red blood cells, as
described (24, 26). Red colonies were picked, expanded, and cloned by
limiting dilution. Lectin resistance was determined by titration of
cytotoxic lectins in 96-well microtiter dishes as described (27).
auxotrophic marker
and CHO cells carrying the Gat
auxotrophic marker were
mixed; fusion was induced by treatment with polyethylene glycol 1000, and dimethyl sulfoxide and hybrids were selected in
-medium lacking
glycine, adenosine, thymine, and proline and containing 10% dialyzed
fetal calf serum as described (27). Hybrids arose at a frequency of
~10
3. Spontaneous hybrids and revertants arose at
frequencies of <10
5. Hybrids were shown by karyotype
analysis to be pseudotetraploid as described previously (27).
(10 µg/ml) for 4 h to
induce expression of E-selectin. HL-60 and LEC11 mutant cells were
labeled by incubation with 450 µCi of 51Cr per 3 × 106 cells. Labeled cells (2 × 105) were
incubated with phosphate-buffered saline containing 2 µg/ml anti-E-selectin antibody H18/7 (29) or buffer alone in 400 µl. After
30 min at 15 °C, unbound cells were removed following systematic resuspension with a Pasteur pipette. Adherent cells were lysed in 2%
SDS containing 10% glycerin and counted in a gamma counter. Percent
counts/min in bound cells compared with input cells was plotted as the
mean and S.D. of triplicate assay points.
(1,3)Fuc-T Assays--
The preparation of cell-free extracts
and the assay conditions used to measure
(1,3)Fuc-T activity were as
described previously (24, 26). 2'-Fucosyllactose and 2'-fucosylLacNAc,
LacNAc, and SA
(2,3)LacNAc were used as acceptors. Briefly, each
reaction mixture contained 2.5 µmol of MOPS (pH, 7.0), 5 µmol of
NaCl, 0.25 µmol of MnCl2, 2-4 nmol of
GDP-[14C]fucose (10,000 cpm/nmol), 0.1-1.0 µmol of
acceptor, and 5-10 µl of cell extract (~100 µg of protein) in a
final volume of 50 µl. After incubation at 37 °C for 30 min, the
reaction was stopped by the addition of 1 ml of ice-cold deionized,
distilled water. When 2'-fucosyllactose or LacNAc was the substrate,
all product was eluted from 1.5-ml ion exchange columns (Dowex 1 × 4, Cl
form) with 2 ml of deionized, distilled water.
However, complete elution of product when 2'-fucosylLacNAc or
SA
(2,3)LacNAc was the acceptor required an additional wash with 3 ml
of 0.1 M or 0.15 M NaCl. Protein concentrations
were measured using the Bio-Rad protein assay reagent under conditions
recommended by the manufacturer.
FIXII
(Stratagene, La Jolla, CA) phage arms that also had been partially
filled in with dTTP and dCTP. The ligation product was packaged
in vitro with packaging extracts from Stratagene and titered
on KW251 Escherichia coli host cells. Approximately 7 × 105 recombinants were transferred to nitrocellulose
filters (Schleicher & Schuell) and hybridized at 42 °C to the 944-bp
radiolabeled XbaI-EcoRI fragment isolated from
the insert of plasmid pSi+FTE(
1,3/1,4) kindly supplied by Dr. John
Lowe (University Michigan, Ann Arbor, MI). This fragment contains most
of the coding sequence of the human Lewis enzyme,
(1,3)Fuc-TIII (9).
After hybridization for 48 h in 50% formamide, 5× SSC, 10×
Denhart's solution, 0.1% SDS, 0.8% dextran sulfate, and 100 µg/ml
denatured herring sperm DNA, filters were rinsed twice for 30 min at
room temperature in 1× SSC, 0.4% SDS and then three times for 1 h at 45 °C in the same buffer. Hybridizing plaques were purified
through three rounds of replica plating.
5 CHO cells using the Polybrene method described
previously (33). Transfectants selected for resistance to G418 (1.0 mg/ml active weight) were screened for the expression of
(1,3)Fuc-T
activity by their ability to bind an
SSEA-1/sRBC conjugate as
described (24, 26). Positive red colonies were cultured and cell
extracts tested for
(1,3)Fuc-T activity.
-32P]dCTP to a
specific activity of ~109 cpm/µg using the Prime-It RmT
dCTP-Labeling kit (Stratagene). Buffer and unincorporated nucleotides
were removed by passage through a G-50 minispin column (Worthington).
Oligonucleotides were labeled with [
-32P]ATP using T4
polynucleotide kinase. Membranes were finally washed in 1× SSC
containing 0.2% SDS at 50 °C. The blot was exposed to x-ray film at
80 °C for at least 24 h.
-32P]dCTP using Prime-It RmT kit (Stratagene) to a
specific activity of 109 cpm/µg DNA. After hybridization,
blots were finally washed at 65 °C in 0.2× SSC containing 0.2% SDS
for 30 min and exposed at
70 °C to Kodak X-Omat films with
intensifying screens. Before rehybridization, blots were erased by
boiling in 0.1% SDS.
20 °C.
![]()
RESULTS
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES
-SSEA-1 conjugated to sheep red blood cells. LEC11A and LEC11B
mutants were isolated from two separately mutagenized populations. They
have lectin resistance properties similar to LEC11 cells (23) being
2-4-fold resistant to L-PHA, E-PHA, and WGA and
~5-10-fold hypersensitive to ricin and abrin compared with parental
CHO cells. Both new mutants expressed the fucosylated determinants
LeX, sialyl-LeX, and VIM-2 at similar levels to
LEC11 cells (Fig. 1A) and,
like LEC11 cells, bound E-selectin expressed on activated human
umbilical vein endothelial cells (Fig. 1B).
Fucosyltransferase assays showed that the
(1,3)Fuc-T of both new
LEC11 mutants was inhibited >97% by 3 mM NEM as observed
previously for LEC11 cells, and like LEC11 cells, they transferred
fucose to LacNAc, sialyl-LacNAc, and 2'-fucosyl-LacNAc but not to the
Type 1 acceptor, Gal
(1,3)GlcNAc, and poorly to 2'-fucosyllactose (15, 17, 24, 26; data not shown). Therefore, the LEC11
(1,3)Fuc-T was not similar to human Fuc-T III which prefers Type 1 over Type 2 acceptors (9, 35) but was most similar
to human Fuc-TV and Fuc-TVI based on acceptor specificity (36).

View larger version (30K):
[in a new window]
Fig. 1.
LEC11 mutants express sialyl-LeX
and recognize E-selectin. A, CHO cells and the LEC11
mutants were incubated with the monoclonal antibodies shown above, and
binding was determined in triplicate (± S.D.) using rabbit anti-mouse
IgM and 125I-protein A as described under "Experimental
Procedures." Gal (
), sialic acid (
), GlcNAc (
), fucose
(
). B, the LEC11 mutants and HL-60 human myeloid cells
labeled with 51Cr were incubated on human umbilical vein
endothelial cells that had been treated with interleukin-1
(IL-1
) in the presence or absence of an antibody to
E-selectin (H18/7), and binding was determined as described under
"Experimental Procedures."
FIXII genomic DNA library prepared from Lec1
CHO cells (58) was screened with a human FUT3 gene coding
region probe to obtain phage A6.1. An ~9-kb EcoRI fragment
and a 3.2-kb SacI subclone were co-transfected with pSV2neo
into parental Pro
5 CHO cells that lack endogenous
(1,3)Fuc-T activity. Both clones gave more than 30% G418-resistant
transfectants which bound
SSEA-1/sRBC, whereas pSV2neo transfectants
were uniformly negative. The encoded CHO
(1,3)Fuc-T activity was
inhibited by NEM and had the same acceptor specificities as the LEC11
(1,3)Fuc-T (data not shown).
(1,3)Fuc-T such as LEC12 (15-17) and LEC30
(24) also did not express this CHO FUT gene.

View larger version (50K):
[in a new window]
Fig. 2.
Each LEC11 mutant expresses the cloned
FUT gene. The diagram shows a partial
restriction map of the cloned CHO FUT gene (X,
XbaI; A, AvaI; H,
HindIII; K, KpnI) with the coding
region shaded. Probes 2 and 3 were generated by subcloning.
A, Northern analysis of 15 µg of total RNA for each cell
line probed with probe 2 (upper panel) and subsequently with
a probe for actin (lower panel). B, ribonuclease
protection using total RNA and riboprobe 2. The protected fragment (605 nt) is only present in LEC11 mutants. C, ribonuclease
protection with riboprobe 3 using poly(A)+ RNA. The
protected fragment of 417 nt was present only in LEC11 mutants. The
size marker used in B and C is a MspI
digest of pBR322.
(1,3)Fuc-T sequences reveals that the CHO
(1,3)Fuc-T is 83.9% similar to Fuc-TVI, 81% to Fuc-TV, and 84% to
Fuc-TIII. The distribution of Cys residues is conserved in human,
bovine, and Chinese hamster
(1,3)Fuc-Ts, a key structural feature of
NEM-sensitive fucosyltransferases (40). Cys144 of the CHO
(1,3)Fuc-Ts, is likely to be the Cys that is protected from NEM
inactivation by GDP-fucose, analogous to Cys143 of human
Fuc-TIII, Cys156 of human Fuc-TV and Cys142 of
human Fuc-TVI.

View larger version (65K):
[in a new window]
Fig. 3.
Sequence of the cloned CHO FUT
gene. A, the nucleotide sequence and predicted
amino acid sequence of the CHO FUT gene cloned from Lec1
genomic DNA are shown. The putative transmembrane domain identified by
Kyte Doolittle hydropathy analysis (38) is underlined.
Conserved Cys residues typical of NEM-sensitive fucosyltransferases are
boxed. Potential N-linked glycosylation sites are
shaded. This sequence has been deposited in
GenBankTM data bank (accession number U78737).
B, CLUSTAL W analysis of the CHO FUT coding amino acids
compared with human Fuc-TV (accession number M81485) and human Fuc-TVI
(accession number L01698). Identical residues are black and
similar residues are shaded. The position of amino acids
postulated to confer Fuc-TVI acceptor specificity in the human enzyme
are starred. The CHO Fuc-T is most similar to human
Fuc-TVI.
(1,3)Fuc-T lacks the 11-amino acid
insert (position 47-57) characteristic of hFuc-TV (41) and missing
from the hFuc-TVI sequence (36) and the bovine
(1,3)Fuc-T (35). In
addition, the CHO
(1,3)Fuc-T contains some features of a sequence
identified as "unique" to the human Fuc-TVI (starred
amino acids in Fig. 3B) and postulated to confer acceptor
preferences (42). When the acceptor preferences of the
(1,3)Fuc-T
expressed in each LEC11 mutant were compared directly with those of
recombinant hFuc-TVI and hFuc-TV, it was apparent that the CHO
(1,3)Fuc-T is most similar to hFuc-TVI (Table
I; Refs. 35, 43, and 44). Whereas
recombinant hFuc-TV transferred fucose to fucosylated Type 1 and
2'-fucosyllactose acceptors better than to LacNAc, hFuc-TVI and the
LEC11 mutants essentially did not utilize these acceptors under these
conditions. Based on sequence and functional relationships therefore,
the cloned CHO
(1,3)Fuc-T expressed in each LEC11 mutant represents
a Chinese hamster (C. griseus; cg) orthologue of the
hFUT6 gene.
Each LEC11
(1,3)Fnc-T is most similar to human Fuc-TVI

View larger version (60K):
[in a new window]
Fig. 4.
Rearrangements of a cgFUT6
gene in genomic DNA from LEC11 and LEC11A cells. The diagram shows
a partial restriction map of the cloned cgFUT6 gene
(X, XbaI; A, AvaI,
H, HindIII; K, KpnI) with
the coding region shaded. For Southern analysis, 15 µg of
genomic DNA was digested with the restriction enzymes shown,
electrophoresed, transferred to membrane, and probed with
locus-specific probe 1 or coding region probe 2. A, membrane
on the left was hybridized with probe 2, erased, and
rehybridized with probe 1 (right). CHL, Chinese
hamster liver DNA; E, EcoRI; H,
HindIII. B, DNA digested with BamHI
and hybridized to probe 2. C, DNA digested with
ApaI and hybridized to probe 2.
4 per cell per generation (45).

View larger version (90K):
[in a new window]
Fig. 5.
Suppression of cgFUT6 gene
transcripts in LEC11B hybrids. A, total RNA (10-15
µg) from independent CHO cell hybrid lines (derived from fusing the
designated pairs of cells) or from CHO cells and the LEC11 mutants were
electrophoresed, transferred to membrane, and hybridized to probe 2 (top panel). Blots were subsequently stripped and hybridized
to an actin probe (lower panel). B, total RNA
from 11 independent hybrids obtained from fusing LEC18 and LEC11B cells
was electrophoresed, transferred to membrane, and hybridized to probe 2 (upper panel). Ethidium bromide staining showed that
approximately equal amounts of RNA were loaded.
0.1; in hybrids formed with either LEC11 or LEC11A cells the transcript ratio was ~0.5.
Ratio of cgFUT6:actin gene transcripts in hybrids
(1,3)Fuc-T assays of hybrid extracts.
CHO × LEC11B hybrids had low levels of
(1,3)Fuc-T activity,
much lower than predicted from the combined
(1,3)Fuc-T activity of LEC11B and parent cells (Table III). This
negative effect was not due to the presence of an inhibitor of
(1,3)Fuc-T activity in CHO cells, since extract mixing experiments
gave additive results. This recessive behavior of the LEC11B phenotype
was also observed in lectin resistance tests. LEC11B × CHO
hybrids were not resistant to WGA or hypersensitive to ricin. The
combined data provide strong evidence that the cgFUT6 gene
is expressed in LEC11B cells due to an inactivating mutation in a gene
that encodes a negative regulatory factor.
(1,3)Fuc-T assays of LEC11B × CHO hybrids
(1,3)Fuc-T assays was Gal
(1,4)GlcNAc
(LacNAc).


View larger version (106K):
[in a new window]
Fig. 6.
LEC11B transcripts have divergent 3'- and
5'-UTR sequences. A, 3'-RACE of poly(A)+
RNA from LEC11, LEC11A, and LEC11B cells using the oligo(dT)/anchor
primer ("Experimental Procedures") for reverse transcription. First
round cDNA products were amplified with the anchor primer
("Experimental Procedures.") and primer 152 (AGGCCTCGCTTGTCTAGCATGG; sense) from the 3' end of the
cgFUT6 gene coding sequence (Fig. 3). cDNA products were
cloned, and
2 independent clones were sequenced from both strands.
LEC11 and LEC11B sequences were identical and differed from LEC11A. The
arrow marks the beginning of divergent sequence. The TGA
stop codon is double underlined, and the
poly(A)+ addition sequence is boxed.
B, the 3'-UTR obtained from LEC11A poly(A)+ RNA
is aligned with the corresponding sequence of the cloned
cgFUT6 gene (Fig. 3). The TGA stop codon is double
underlined, and the putative poly(A)+ addition
sequence is underlined. C, for 5'-RACE,
poly(A)+ RNA from LEC11B cells was subjected to RT-PCR
using primer 122 (TGCCTGGGAGCATCTTGGAAC; antisense) near the 5' end of
the cloned cgFUT6 gene coding region (Fig. 3). After
addition of poly(A) by terminal deoxynucleotidyltransferase, cDNA
products were amplified using the oligo(dT)/anchor primer and primer
121 (CATGTCCACAGTAAGATGAG; antisense). Two 5'-RACE sequences are
aligned with the sequence upstream of the cloned cgFUT6
gene-coding region (Fig. 3). The ATG initiation codon is double
underlined. D, the coding region of the
cgFUT6 gene expressed in LEC11B cells was obtained by RT-PCR
from poly(A)+ RNA using primers from the 5'- and 3'-UTR
sequences that span the coding region. The RT reaction was performed
with 3'-UTR antisense primer AZ2 (GAGGCCACTTACTGAATTGCTCCC). PCR of
cDNA products was performed with the 5'-UTR sense primer 141 (CTGCTACCCTGCAGTAGAGCTTG) and 3'-UTR antisense primer AZ1
(ACACTGCCTGCAGGACTCTGGC). The 1.2-kb PCR product was cloned, and four
independent clones gave the deduced amino acid sequence shown
(cgFUT6B). The same sequence was obtained from genomic DNA
of Gat
2 parental CHO cells using primer 257B
(GATCCCCCAGGCCATGGAT; sense) immediately upstream of the
cgFUT6B coding region and primer 171 (AGCTTACATTTCTCAGTCACACTCC; antisense) from the 3'-UTR region. Genomic
DNA from Pro
5 and Gat
2 parental CHO cells
was also used to obtain the sequence of the cgFUT6A gene
with primer 257A (GGACTACCAGGCCATGGAT; sense) immediately upstream of the coding region and primer 169 (CTGACAGAATAAGGTCTCATCTGG; antisense) from the unique 3'-UTR region.
This sequence differed by 2 nucleotides (G214C and G225C numbered from
the ATG) and 2 amino acids (A72P and R75S) from the FUT coding region
cloned from Lec1 genomic DNA (Fig. 3) but did not differ from the
cgFUT6B gene at these positions. The combined genomic DNA
and cDNA sequences of the cgFUT6B gene are submitted
under GenBankTM accession number AF090449 and the coding
region and 3'-UTR sequence for cgFUT6A has
GenBankTM accession number AF090450.

View larger version (50K):
[in a new window]
Fig. 7.
Northern analysis using gene-specific
probes. Total RNA (10-15 µg) from CHO and LEC11 mutants was
electrophoresed, transferred to membrane, and hybridized to probes
derived from 3'-RACE and 5'-RACE products or coding region probe 2 (Fig. 2) or the actin probe. The 5'-UTR probe specific for LEC11B
transcripts was an EcoRI fragment of 150 bp derived from a
cloned 5'-RACE product obtained by RT-PCR from LEC11B
poly(A)+ RNA using primer 143 (TTCTGCAGGCCAAGCTCTACTGC;
antisense) based on sequence unique to the LEC11B 5'-UTR (Fig.
6C). The 3'-UTR probe (275 bp) specific for transcripts of
LEC11A cells was obtained by PCR of a cloned cDNA obtained by
3'-RACE of poly(A)+ RNA from LEC11A cells using sense
primer 168 (GTGCTAGACACTCCCTTGATGAGC) and antisense primer 169 (CTGACAGAATAAGGTCTCATCTGG). The 3'-UTR probe (324 bp) specific for
transcripts of LEC11 and LEC11B cells was obtained by PCR of a cloned
cDNA obtained by 3'-RACE from LEC11B poly(A)+ RNA using
sense primer 170 (TTGCCCCTGTGTTGTGCTCTATCG) and antisense
primer 171 (AGCTTACATTTCTCAGTCACACTCC).

View larger version (43K):
[in a new window]
Fig. 8.
Southern analysis using gene-specific
probes. Gene-specific probes were derived from the 3'-UTR
sequences unique to the LEC11A and LEC11B transcripts, respectively, as
depicted in the diagram. Sequence differences between the coding
regions of each transcript are denoted by stars in LEC11B.
Genomic DNA (10-15 µg) from CHO cells and LEC11 mutants was digested
with EcoRI, electrophoresed, transferred to membrane, and
hybridized to coding region probe 2 (see diagram) or the probe specific
for the 3'-UTR region of LEC11A transcripts in order to identify the
cgFUT6A gene, or the probe specific for the 3'-UTR of LEC11B
transcripts to identify the cgFUT6B gene (see Fig. 7).
Slight degradation of LEC11B genomic DNA is apparent in the middle
blot. The cgFUT6B gene-specific probe gave background
hybridization but hybridized at high stringency only to the 2.3-kb
fragment that contains cgFUT6B.
5 and Gat
2 parental CHO cells and RT-PCR
products from LEC11B transcripts. Gene-specific primers were designed
from sequences immediately upstream of the respective
cgFUT6A and cgFUT6B coding regions and paired
with primers from the unique 3'-UTR region of each gene (see Fig.
6A). With cgFUT6A gene-specific primers, CHO
genomic DNA gave coding region sequence that was identical to the
cloned gene from Lec1 cells in Fig. 3, except for two nucleotide
differences (G214C and G225C numbered from the ATG). The latter
presumably reflects cgFUT6A gene mutations present in the
Lec1 genome or that arose during cloning. These changes translate into
two amino acid differences (A72P and R75S; Fig. 6D). With
cgFUT6B gene-specific primers, CHO genomic DNA gave a coding
region sequence identical to that obtained by RT-PCR with primers from
the 5'-UTR and 3'-UTR sequences unique to LEC11B transcripts. The
coding region sequence of the cgFUT6B gene differed from the
cgFUT6A gene sequence in seven nucleotides that translated
into only two amino acid differences (Fig. 6D).

View larger version (45K):
[in a new window]
Fig. 9.
Transcripts of the cgFUT6B
gene are suppressed in LEC11A × LEC11B hybrids. Independent
hybrids 1-5 were isolated from a fusion between LEC11A and LEC11B
cells. Total RNA isolated from the hybrids or from LEC11A or LEC11B
cells was electrophoresed, transferred to membrane, and hybridized with
gene-specific probes (see Fig. 7) followed by an actin probe.
A, probe specific for cgFUT6B transcripts
expressed in LEC11B cells (upper panel). B, probe
specific for cgFUT6A transcripts expressed in LEC11A cells.
The ratio of FUT6:actin signals was determined for each lane by
densitometry and is given in the text.
![]()
DISCUSSION
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES
Summary of LEC11 gain-of-function CHO mutants
While the LEC11 and LEC11A mutants provide a source of two
(1,3)Fuc-TVI enzymes and may be useful for studies of selectin cell
adhesion mechanisms, they presumably do not provide insights into
molecular mechanisms that regulate FUT6 gene expression
in vivo. The gene rearrangements detected by Southern
analysis probably arose during culture or due to mutagenesis. By
contrast, the negative regulatory factor (NRF) inactivated by the
LEC11B mutation is likely to function in vivo. Northern and
(1,3)Fuc-T analyses of hybrids formed with LEC11B and several other
cell types clearly show that CHO cells and CHO glycosylation mutants
with other mutations, including LEC11A cells, encode the NRF that
suppresses expression of the cgFUT6B gene. Experiments are
in progress to isolate this factor. It is clearly not a molecule that
recognizes a sequence in either the coding or 3'-UTR regions of the
cgFUT6B gene because LEC11 cells, which carry the NRF,
express stable cgFUT6B gene transcripts (Fig. 7). It could
be an NRF that binds to the 5'-UTR sequence unique to
cgFUT6B transcripts in LEC11B cells or a splicing factor
that normally splices out transcripts of the cgFUT6B gene. However, it seems most likely to be a negative regulator of
transcription of the cgFUT6B gene that acts on a negative
regulatory element (NRE) in the promoter region of this gene. Although
there have been no reports of endogenous positive or negative
transcriptional factors that control expression of the FUT
genes that encode an
(1,3)Fuc-T, there is precedence for this form
of transcriptional control in at least two glycosyltransferase genes.
The
(1,4)Gal-T1 gene is differentially regulated during lactation by
an NRF that binds to an NRE located a few nucleotides upstream of the
ATG (48) and the dolichol-P-GlcNAc-T gene that is regulated during mammary gland development has an NRE located ~1 kb upstream of the
ATG (49, 50).
The FUT6 gene encodes the major
(1,3)Fuc-T expressed in
human liver (11), and analysis of humans with no Fuc-TVI activity have
shown that Fuc-TVI is responsible for fucosylating glycoproteins that
are secreted from liver (51). Humans with a point mutation that
inactivates
(1,3)Fuc-TVI activity appear to suffer no ill effects
(51, 52), but it remains to be seen whether they exhibit a differential
sensitivity to microbial pathogens or liver toxins. The NRF we have
found in CHO cells is predicted to be responsible, at least in part,
for keeping the FUT6 gene silent in the tissues where it is
not expressed, such as lung (11). In human pancreas the FUT6
gene is transcriptionally silent, but it is expressed in pancreatic
tumors (53). This may reflect down-regulation of a FUT6 gene
NRF, leading to enhanced expression. This may in turn lead to
metastasis following expression of LeX and SLeX
on cancer cells. The NRF that regulates FUT6B expression in
CHO cells may be involved in this type of control. Although the
cgFUT6 genes are almost identical in their coding regions,
the regulation of their expression is independent because each LEC11
mutant expresses only one of the two genes. Identifying mechanisms that
regulate specific fucosylation events is critical to understanding
biological roles of the fucose residues transferred by different
fucosyltransferases. The reactivation of FUT genes silenced
during development and differentiation occurs in cancer, and the
expression of SLeX is associated with poor prognosis, possibly because
it correlates with an enhanced metastatic ability. Thus it is important
to identify regulatory mechanisms that fail during cancer progression.
The fact that there are two functional Chinese hamster FUT6
genes that have almost identical coding regions is of interest in terms
of evolutionary relationships of related FUT genes. The human Lewis genes, FUT3, FUT5, and
FUT6 share about 90% sequence identity and are organized in
a cluster on band 13.3 of the short arm of chromosome 19, suggesting
that they were generated by successive gene duplications followed by
divergent evolution. The cluster spans approximately 50 kb, with a
distance of ~13 kb between the FUT6 and FUT3
genes (54) and of ~25 kb between the FUT3 and FUT5 genes (6). Only one bovine gene corresponds to the
human cluster of the Lewis genes, and when transfected into COS-7 cells it gives rise to an
(1,3)Fuc-T activity with properties similar to
human Fuc-TVI (35). By contrast, each of the human Lewis subfamily
genes has a homologue identified in chimpanzee. In fact, each
corresponding pair of genes from the two species shares more than 98%
primary sequence identity. COS-7 cells transfected with chimpanzee and
human genes express similar patterns of cell-surface determinants and
acceptor specificities in in vitro assays (55, 56).
Phylogeny analysis of the Lewis genes subfamily, lead Costache et
al. (55) to propose that duplication events at the origin of the
present cluster of human genes
(FUT6-FUT3-FUT5) appeared between the
great mammalian radiation (80 million year ago) and the separation of
human and chimpanzee (10 million years ago). The three Lewis genes are
predicted to have arisen from two gene duplications, the most recent of
which occurred just before the separation of man and anthropoid apes
from the main evolutionary trunk (55). The Lewis precursor gene was
proposed to be the bovine gene that is most similar to
hFUT6. Although physical linkage of the Chinese hamster FUT6
genes has not been proven, preliminary data from Southern analyses and
restriction mapping of cloned genomic DNA fragments are consistent with
this probability.2 A
phylogenetic tree based on protein distance between the human Lewis
enzymes, the bovine Fuc-T, and CHO Fuc-TVIA and Fuc-TVIB sequences was
constructed using the PHYLIP Phylogeny Interference Package 3.5c of
programs and the Fitch-Margoliash least squares method with an
evolutionary clock (57). The tree was drawn from the PHYLIP
dendrogram3 with the DRAWGRAM
program. It predicts that the first duplication of the original Lewis
gene occurred in lower mammals just before the separation of Chinese
hamster from the main evolutionary trunk.
| |
ACKNOWLEDGEMENTS |
|---|
We are extremely grateful to all those noted in the text who supplied materials. Thanks also to Subha Sundaram for superb technical assistance and to Olga Blumenfeld and Jihua Chen for helpful discussions.
| |
FOOTNOTES |
|---|
* This work was supported by National Cancer Institute Grant R37 30645 (to P. S.) and Medical Scientist Training Program Grant GM T32 07288 (to A. Z.).The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
The nucleotide sequence(s) reported in this paper has been submitted to the GenBankTM/EMBL Data Bank with accession number(s) U78737, AF090449, and AF090450.
Present address: Dept. of Medicine, University of Maryland,
Baltimore, MD 21210.
§ Present address: Genetics Institute, Inc., 87 Cambridge Park Rd., Cambridge, MA 02140.
To whom correspondence should be addressed: Dept. of Cell
Biology, Albert Einstein College Medicine, 1300 Morris Park Ave., New
York, NY, 10461. Tel.: 718-430-3346; Fax: 718-430-8574; E-mail: stanley{at}aecom.yu.edu.
2 A. Zhang and P. Stanley, unpublished observations.
3 Cis Infobiogen available on-line at the following addresses: E-mail: bioinfo{at}infobiogen.fr. and http://www.infobiogen.fr.
| |
ABBREVIATIONS |
|---|
The abbreviations used are:
(1, 3)Fuc-T,
(1,3)fucosyltransferases;
CHO, Chinese hamster ovary;
Gal
(1, 4)GlcNAc, Type 1 acceptor;
LacNAc, N-acetyllactosamine;
Gal
(1, 3)GlcNAc, Type 1 acceptor;
NEM, N-ethylmaleimide;
Fuc-T, fucosyltransferase;
FUT, fucosyltransferase gene;
cg, Cricetulus
griseus or Chinese hamster;
RT, reverse transcriptase;
PCR, polymerase chain reaction;
RACE, rapid amplification of cDNA ends;
L-PHA, leukoagglutinin from P. vulgaris;
E-PHA, erythroagglutinin from P. vulgaris;
WGA, wheat germ
agglutinin;
NRE, negative regulatory element;
NRF, negative regulatory
factor;
MOPS, 3-(N-morpholine)propanesulfonic acid;
PIPES, piperazine-N,N'-bis(2-ethanesulfonic acid);
kb, kilobase pair(s);
UTR, untranslated region;
nt, nucleotides;
bp, base pair(s).
| |
REFERENCES |
|---|
|
|
|---|