|
J Biol Chem, Vol. 274, Issue 15, 10517-10522, April 9, 1999
Membrane Topology of the Xenobiotic-exporting Subunit, MexB, of
the MexA,B-OprM Extrusion Pump in Pseudomonas
aeruginosa*
Lan
Guan §,
Michael
Ehrmann ¶ ,
Hiroshi
Yoneyama , and
Taiji
Nakae **
From the Department of Molecular Life Science, Tokai
University School of Medicine, Isehara 259-1193, Japan and the
¶ Department of Biology, University of
Konstanz, Konstanz D-78457, Germany
 |
ABSTRACT |
The MexA,B-OprM efflux pump assembly of
Pseudomonas aeruginosa consists of two inner membrane
proteins and one outer membrane protein. The cytoplasmic membrane
protein, MexB, appears to function as the xenobiotic-exporting subunit,
whereas the MexA and OprM proteins are supposed to function as the
membrane fusion protein and the outer membrane channel protein,
respectively. Computer-aided hydropathy analyses of MexB predicted the
presence of up to 17 potential transmembrane segments. To verify the
prediction, we analyzed the membrane topology of MexB using the
alkaline phosphatase gene fusion method. We obtained the following
unique characteristics. MexB bears 12 membrane spanning segments
leaving both the amino and carboxyl termini in the cytoplasmic side of
the inner membrane. Both the first and fourth periplasmic loops had
very long hydrophilic domains containing 311 and 314 amino acid
residues, respectively. This fact suggests that these loops may
interact with other pump subunits, such as the membrane fusion protein
MexA and the outer membrane protein OprM. Alignment of the amino- and
the carboxyl-terminal halves of MexB showed a 30% homology and
transmembrane segments 1, 2, 3, 4, 5, and 6 could be overlaid with the
segments 7, 8, 9, 10, 11, and 12, respectively. This result suggested
that the MexB has a 2-fold repeat that strengthen the experimentally
determined topology model. This paper reports the structure of the pump
subunit, MexB, of the MexA,B-OprM efflux pump assembly. This is the
first time to verify the topology of the resistant-nodulation-division efflux pump protein.
 |
INTRODUCTION |
Nosocomial patients with cancer, transplantation, burn, cystic
fibrosis, etc. are easily infected by bacteria with low virulence. Among those opportunistic pathogens, Pseudomonas aeruginosa
is particularly problematic, since the bacteria show resistance to many
structurally and functionally diverse antibiotics (1). Recent studies
have revealed that this type of resistance is attributable to a synergy
of low outer membrane permeability and active drug extrusion (2). An
increasing number of multidrug extrusion systems are being reported in
both prokaryotes and eukaryotes (2-8). It is likely, therefore, that
active extrusion systems play a crucial role in the cellular defense
mechanism against incoming noxious compounds in many living organisms.
It is of great interest and importance, therefore, to analyze the
mechanism by which such universally occurring extrusion pump function.
The wild-type P. aeruginosa expresses a low level of the
MexA,B-OprM drug extrusion machinery (9, 10). Mutations in
nalB gene cause overexpression of the mexA,B-oprM
operon rendering the bacterium more resistant than the wild-type strain
to a broad spectrum of antibiotics (3). Deletion of the coding region of the wild-type mexA, mexB, or oprM
renders the mutant more susceptible than the wild-type strain to many
antibiotics (9, 11). Thus, it is apparent that the MexA,B-OprM
machinery is involved in the both basal and elevated levels of
intrinsic antibiotic resistance in P. aeruginosa.
The MexA,B-OprM pump consists of three subunits, MexA, MexB, and OprM,
located at the inner and outer membrane, respectively (9, 10). MexB
consists of 1046 amino acid residues and is assumed to extrude the
xenobiotics utilizing the proton motive force as the energy source (4,
12). This protein belongs to the resistant/nodulation/division
(RND)1 family (13, 14). MexA
is an inner membrane-associated lipoprotein belonging to the membrane
fusion protein family. OprM is an outer membrane protein probably
forming the xenobiotics exit channel. A complex formation by these
three subunit proteins has been suggested for many efflux pump
assemblies in Gram-negative bacteria (13, 15-17). In fact, the
functional coupling of the RND protein and the membrane fusion protein
was recently demonstrated by the subunit exchange experiments using
three efflux pump systems in P. aeruginosa (18-21), while
the outer membrane components could be substituted with other proteins
having a similar function. However, the precise molecular mechanism of
substrate recognition and efflux through these pumps remained to be
clarified. For a better understanding of how this pump extrudes the
xenobiotics, it is essential to elucidate the structure and membrane
topology of the individual pump subunit.
The membrane topology of several RND family proteins was suggested to
have 12 transmembrane domains and two large hydrophilic domains (13,
22). Hydropathy analysis of MexB by the TOP-PRED II 1.1 software
packages (23) suggested that it might have 12 certain and 5 putative
transmembrane segments (TMS). Some other software predicted the
presence of 11 TMS.
The topology of cytoplasmic membrane proteins in Gram-negative bacteria
was often studied by the phoA gene fusion method. Alkaline
phosphatase (AP) is enzymatically active after translocation to the
periplasm, but is inactive when localized cytoplasmically (24, 25).
Several tools, including TnphoA, TnTAP, pPHO7, and pBADphoA (24, 26, 27), have been developed to construct the
phoA fusion to the target protein. Although
transposon-mediated generation of gene fusion is simple, insertion of
the reporter gene at a specific target site can be tedious. This
difficulty is even more pronounced if a target protein has short
extramembranous loops. An alternative method is cloning of PCR products
to the 5'-end of the signal sequenceless phoA gene (28).
Using these two methods, we analyzed the topology of MexB. This paper
reports the two-dimensional transmembrane structure of MexB.
 |
EXPERIMENTAL PROCEDURES |
Bacteria and Plasmids--
The Escherichia coli
strains used were LMG194 [F ara714
leu::Tn10 lacX74 phoA
(PvuII) galE galK thi rpsL] (29) and CC118 (araD139 (ara, leu)7697 lacX74
phoA20 galE galK thi rpsE rpoB argEam recA1) (24). The plasmid
pBADphoA is a cloning vector containing a signal
sequenceless phoA with a KpnI cloning site just
in front of phoA. The construction of pBADphoA
from pSWFII (30) and pBAD22 (29) will be described elsewhere. The
transposon delivery plasmid pMM1 carries a mini-transposon TnTAP and
Tn5 transposase (26). TnTAP contains a stretch of sequence coding for
24 amino acid residues,
LTLIHKFENLYFQSAAAMDPRVPC, including a tobacco
etch virus protease cleavage site (underlined), signal sequenceless
phoA, and neo. The Tn5 transposase is expressed in trans. The plasmid pMEXB1 was constructed by
cloning a 3.9-kilobase SalI fragment containing the
wild-type mexB to the shuttle vector pMMB67EH (20).
Construction of mexB-phoA Fusions by PCR--
Fusions of the
truncated mexB to phoA, encoding for signal
sequenceless AP, were carried out by inserting the PCR fragments of
mexB into the 5'-end of the signal sequenceless
phoA in pBADphoA. Eleven out of 15 fusions were
constructed by cloning the PCR fragments containing flanking
KpnI restriction sites into pBADphoA cleaved with
KpnI. The PCR primer used for the 5'-end of the
mexB gene was cccggtaccgTCGAAGTTTTTCATTGATAGG. The 3'-end
primers designed for the immediately downstream of the codons
Gln34, Glu346, Leu366,
Thr392, Gly440, Thr473,
Arg538, Gln871, Pro897,
Ser921, and Cys972 were
aggatggtacCTGGTTGACCGGCAGACTGAG (Gln34),
cgcgcggtacCTCGCCGAGGGTCTTCACTAC (Glu346),
gccgcggtacCAGCGTGGCGCGGAAG (Leu366),
cgcggtacCGTGTTGATCGAGAAGCC (Thr392),
ggcgcggtacCCCCTGGATCTGGCCCATGGA (Gly440),
cgcgcggtacCGTGATGGAGAACTGCCGGTAGAT (Thr473),
cgcggtacCCGATGCTTGAGGATCGAC (Arg538),
ccggcggtacCTGCGAGCCGGACAAGC (Gln871),
cgcggtacCGGAATCGACCAGCTTTCGTACAG (Pro897),
cccccggtacCGACAGGCCGCGCATGGACGTCG (Ser921), and
ccatcggtacCGGCCGCAGACGCAT (Pro972), respectively. For the
fusion of phoA to codons Gly1007 and
Gln1046, we designed the primers allowing in-frame
blunt-end ligation, because there are two KpnI sites in this
part of mexB. The PCR fragments purified from agarose gel
and blunted with the T4 DNA polymerase were ligated to the
pBADphoA cleaved by KpnI and blunted with T4 DNA
polymerase. The primer used for the 5'-end of the mexB gene
was TCGAAGTTTTTCATTGATAGGCCC. Two 3'-end primers used to generate
phoA fusions downstream of the codons Gly1007
and Gln1046 were cGCCGATCACGCCGGTACCGAT
(Gly1007) and aTTGCCCCTTTTCGACGGACGCCTGC
(Gln1046), respectively. For fusion pBAD-P9, two
oligonucleotides containing the KpnI sites at the both ends
were annealed and ligated directly to the pBADphoA cleaved
with KpnI. The oligonucleotides for coding and noncoding
strands were CGTCGAAGTTTTTCATTGATAGGCCGGTAC and CGGCCTATCAATGAAAAACTTCGACGGTAC, respectively. The host cells used for
analysis of AP activity was E. coli LMG194. For most fusion plasmids, codons for valine and proline residues were introduced at the
5'- and 3'-ends of the mexB fragments to introduce the KpnI sites.
Construction of mexB-phoA Fusions by TnTAP--
To obtain
in-frame fusions of TnTAP to mexB, the pMM1 containing TnTAP
was transformed into the strain E. coli CC118 carrying pMEXB1, which encodes the wild-type mexB. After
transposition during overnight growth, a pool of plasmid DNA was
isolated and digested with NheI to destroy pMM1, but not
pMEXB1 and TnTAP. The restriction digests were transformed again into
strain CC118. Blue colonies on agar plates containing 40 µg/ml
5-bromo-4-chloro-3-indolyl phosphate, 200 µg/ml ampicillin (for
pMEXB1), and 100 µg/ml kanamycin were purified. Insertions into
mexB were identified by PCR.
DNA Sequencing--
The nucleotide sequence was determined using
the ABI PRISMTM Dye Terminator Cycle Sequencing Core Kit
with ampliTaq® DNA polymerase, FS. The sequencing primer used was
GCAGTAATATCGCCCTGAGCAGC, reading out of the phoA gene toward
the mexB gene. In addition, a primer GCGTCACACTTTGCTATGCC
reading out of the pBADphoA vector toward the
mexB gene was also used.
Assay of AP Activity--
AP activity was assayed by measuring
the rate of hydrolysis of p-nitrophenyl phosphate in
permeabilized cells as described elsewhere (31). One unit of AP
activity corresponds to the rate of p-nitrophenyl phosphate
hydrolysis, 1 µmol of p-nitrophenyl phosphate/min/mg of
protein at 23 °C.
Expression of the Hybrid Proteins--
For the Western blot
analysis of the hybrid proteins, the crude envelope fraction and whole
cell lysate were prepared as described elsewhere (10).
SDS-polyacrylamide gel electrophoresis (10%) and Western blotting were
carried out as described previously (32). The monoclonal antibody
raised against AP was used to probe the hybrid proteins. Boiling the
MexB protein in SDS caused disappearance of the protein band from the gel.
 |
RESULTS |
Construction of the mexB-phoA Fusions--
To analyze the membrane
topology of the MexB protein, we took the 12-TMS model for our working
hypothesis and designed the experiments accordingly (Fig.
1). We constructed 25 clones expressing COOH-terminal-truncated MexB-AP hybrids and one clone (pBAD-Q1046) expressing phoA at the COOH-terminal end of full-length MexB
using pBADphoA and TnTAP (Table
I). Cells harboring the pBAD-P9,
pBAD-L366, pBAD-V411, pBAD-G440, pBAD-R538, pBAD-P897, pBAD-P972, and
pBAD-Q1046 plasmids yielded pale blue colonies, suggesting that the AP
domain is located in the cytoplasmic side of the inner membrane. The fusion pBAD-V411 was obtained accidentally in the course of pBAD-Q1046 construction. The remaining mexB-phoA fusions exhibited blue
colonies on the 5-bromo-4-chloro-3-indolyl phosphate plates suggesting that the AP domain is translocated to the periplasm. The fusion joints
were confirmed by nucleotide sequencing and all reading frames were
correct (Tables II and
III). The distribution of a total of 26 fusion sites covered the entire MexB protein, and each hydrophobic
segment was flanked by phoA fusions (Fig. 1).

View larger version (61K):
[in this window]
[in a new window]
|
Fig. 1.
Schematic representation of the topological
structure of the MexB protein. Symbols: filled circle,
positively charged amino acid; shaded circle, negatively
charged amino acid; open circle, uncharged amino acid. Amino acid
residues in transmembrane segments were expressed by a one-letter code.
Arrow: one-letter code number in parentheses represents the
fusion site-amino acid residue-AP activity (units). Shaded
rectangles around circles, putative TMS. a through
e are weak hydrophobic segments.
|
|
View this table:
[in this window]
[in a new window]
|
Table II
Nucleotide sequence of the mexB-phoA fusion junction derived from
pBADphoA
The table shows the nucleotide sequence and the deduced amino acid
sequence at the fusion junctions. Hyphens mark the fusion points. The
DNA sequences of the mexB fragment amplified by PCR are
indicated in bold. The lowercase letters represent the linker for the
KpnI restriction sites. Underlined sections represent the
original bases of mexB and these alterations did not change
the amino acid sequence. Small fonts show the inserted amino acid
residues.
|
|
View this table:
[in this window]
[in a new window]
|
Table III
Nucleotide sequence of the mexB-phoA fusion junction derived from
TnTAP
The table shows the nucleotide sequence and the deduced amino acid
sequence at the fusion junctions. Hyphens mark the fusion points. The
DNA sequence from TnTAP is shown in
bold.
|
|
Alkaline Phosphatase Activities of the Cells Harboring the Fusion
Plasmids--
We quantified the AP activities of the cells harboring
the mexB-phoA fusions (Fig. 1). The AP activities in these
cells harboring the fusions derived from pBADphoA were
divided into two major classes. One class of cells showed about
0.2-0.4 unit of AP activity, which is close to the activity in the
control cell (pBADphoA, 0.32 unit) and another showed
1.7-11 units. Fusions at Pro9, Leu366,
Val411, Gly440, Arg538,
Pro897, Pro972, and Gln1046
belonged to the former class. Therefore, these fusion sites are most
likely to be located at the cytoplasmic side (Fig. 1). The remaining
fusions, including the Gln34, Glu346,
Thr392, Thr473, Gln871,
Ser921, and Gly1007 sites, showed high AP
activities, suggesting that these sites are located at the periplasmic
side (Fig. 1).
All the cells harboring the mexB-phoA fusions derived from
TnTAP showed an AP activity of about 1-3 units (Fig. 1), whereas the
AP activity of cells containing mexB without phoA
(pMEXB1) was only 0.33 unit. Based on these results, we concluded that all the fusion sites, including Asp59, Thr89,
Val105, Arg124, Ile214,
Gly271, Thr309, Leu349,
Phe459, Asn616, and Leu696, were
located at the periplasmic side (Fig. 1).
Expression of the Hybrid Proteins--
The expression of hybrid
proteins derived from TnTAP and pBADphoA is under the
control of lac and araBAD promotor, respectively, and therefore the cells harboring the fusions were induced in the
presence of 100 µM
isopropyl- -D-thiogalactopyranoside and 100 µM L-arabinose, respectively. The hybrid
proteins with high and low AP activities are shown in Fig.
2, lanes 3-20 and lanes 21-27, respectively. The size of the hybrid proteins was within the range of the expected molecular mass. The protein band of the
fusion at Pro9 was undetectable, since the hybrid protein
is expected to be soluble in the cytoplasm. All the bands for
cytoplasmic hybrid proteins showed weaker signals than the periplasmic
hybrid proteins, which probably was attributable to the proteolytic
degradation of the hybrid protein as reported earlier (33, 34). In
addition, protein bands with a higher molecular mass than expected were seen as reported elsewhere (35). This might be explained by suggesting
that the chimeric proteins maintaining the native conformation bind
less SDS than fully denatured proteins in the electrophoresis buffer,
because the samples were subjected to electrophoresis without heating.
Fusion Gly440 appeared only in a higher molecular weight
range than expected and was barely seen.

View larger version (37K):
[in this window]
[in a new window]
|
Fig. 2.
Western blot analysis of the MexB-AP hybrid
proteins. Crude envelope fraction was prepared as described under
"Experimental Procedures," subjected to polyacrylamide (10%) gel
electrophoresis in SDS without heating, electroblotted to the
polyvinylidene difluoride membrane and visualized with monoclonal
antibody raised against alkaline phosphatase (lanes 2-20).
Whole cell lysate was subjected to the electrophoresis and stained as
above (lanes 21-27). The sample was coded by the fusion
site. Lane 1, molecular weight markers (Western doctor);
lane 2, Pro9; lane 3,
Gln34; lane 4, Asp59; lane
5, Thr89; lane 6, Val105;
lane 7, Arg124; lane 8,
Ile214; lane 9, Gly271; lane
10, Thr309; lane 11, Glu346;
lane 12, Leu349; lane 13,
Thr392; lane 14, Phe459; lane
15, Thr473; lane 16, Asn616;
lane 17, Leu696; lane 18,
Gln871; lane 19, Ser921; lane
20, Gly1007; lane 21, Leu366;
lane 22, Val411; lane 23,
Gly440; lane 24, Arg538; lane
25, Pro897; lane 26, Pro972;
lane 27, Gln1046; lane 28,
pBADphoA; lane 29, pMEXB1; lane 30,
bacterial alkaline phosphatase.
|
|
 |
DISCUSSION |
Most living organisms, if not all, seem to be equipped with
xenobiotics extrusion pump(s). Mammalian cells, for instance, express
P-glycoproteins (8), multidrug resistance associated protein (36), and
cannalicular multispecific organic anion transporter (37), which
extrude anticancer drugs, bile acids, and others. Expression of the
efflux proteins in bacteria renders the organisms resistant to many
antibiotics, organic solvents, hydrophobic dyes, and surfactants.
Structure of the efflux pump in Gram-negative bacteria is
particularly complicated, since the outer membrane covers the inner
membrane. An extrusion pump in P. aeruginosa consisted of
three subunits, MexA, MexB and OprM. Among them, MexB is particularly
important in the pump function, since this subunit primarily recognizes
and extrudes the substrates. To analyze the two-dimensional membrane
topology of MexB, we constructed 26 phoA fusions, which
covered the entire MexB protein.
The NH2-terminal segment before the first hydrophobic
segment consists of 9 amino acid residues containing 2 positively and 1 negatively charged residues. This segment is unlikely to cross the
membrane according to the positive charge inside rule (38). The
periplasmic location of the Gln34 and Gly1007
sites and the cytoplasmic location of the Pro9 and
Gln1046 sites indicated that a cytoplasmic location of both
the NH2- and COOH-terminal ends (Fig. 1). The hybrid
protein Gln34 was detected in the crude envelope fraction
(Fig. 2, lane 3) indicating that TMS1 is an uncleaved
signal-anchor. The periplasmic location of the Glu346,
Thr392, Thr473, Gln871,
Ser921, and Gly1007 sites, and the cytoplasmic
location of the Leu366, Val411,
Gly440, Arg538, Pro897,
and Pro972 sites verified the transmembrane nature of the
TMS 2-11 (Fig. 1). Five weak hydrophobic segments suggested by the
TOPRED II software (a-e, Fig. 1) did not function as
transmembrane segments, because they were flanked by fusions with high
AP activities (Fig. 1). These results supported our working model. Some
of the computer programs for the topology prediction suggested the
presence of 11 TMS in the MexB polypeptide. Our results experimentally
ruled out this possibility.
We carried out computer-aided alignment analysis of the amino-terminal
and carboxyl-terminal halves of the polypeptide from Met1
to Arg529 and Gly530 to Gln1046,
respectively. Fig. 3 shows 30% homology
between the first and second halves. TMS 1, 2, 3, 4, 5, and 6 of the
amino-terminal half could be overlaid by TMS 7, 8, 9, 10, 11, and 12 in
the carboxyl-terminal half, respectively. This 2-fold repeat suggested
that mexB is evolved from an ancestral gene encoding a
protein of six TMS by an intragenic duplication as predicted earlier
(13, 22). This is to doubly support the transmembrane nature of the
segments experimentally assigned to be the membrane-spanning domain. In addition, the distribution of positive charges in the cytoplasmic and
periplasmic domains were 22 and 2, respectively, excepting the first
and fourth large periplasmic domains with more than 60 amino acid
residues (Fig. 1). The result was in accord with the positive inside
rule (38).

View larger version (43K):
[in this window]
[in a new window]
|
Fig. 3.
Sequence alignment of amino- and
carboxyl-terminal halves. Amino acid sequence of MexB was split
into two between residues 529 and 530. Multiple sequence alignment was
carried out using the program Clustal W 1.7. The horizontal
dots indicate the TMS. Asterisks and dots
indicate identical and similar amino acid residues, respectively.
|
|
This is the first experimental verification of the transmembrane
topology of the RND family extrusion pump protein. This experimentally verified model has the following features. (i) The MexB protein spans
the membrane 12 times leaving amino and carboxyl termini at cytoplasmic
side of the inner membrane as suggested for the RND family proteins
(13, 22). (ii) MexB has two large hydrophilic segments with 311 and 314 amino acid residues from 29 to 338 (between TMS 1 and 2) and from 558 and 871 (between TMS 7 and 8), respectively. (iii) The membrane
topology of MexB appeared to have a 2-fold repeat. These big loops
might interact with the periplasmic subunit, MexA, and the outer
membrane subunit, OprM. It is conceivable that these large loops
transmit cellular energy to the OprM channel gate. In addition, we
found 5 charged amino acid residues in the transmembrane domains. These
charged residues were highly conserved in the RND family efflux
proteins as aligned by the Clustal W multi-alignment software (data not
shown). Specific localization of the highly conserved charged residues
in the TMS suggested that they might play an important role in
substrate binding and proton transport. Further studies are needed to
elucidate the role of these amino acid residues in the mechanism of
xenobiotics extrusion.
 |
ACKNOWLEDGEMENT |
We acknowledge the preliminary participation
of Weil EL-Naggar in this study.
 |
FOOTNOTES |
*
This work was supported by grants from the Ministry of
Education of Japan, Science, Sports and Culture, the Ministry of Health and Welfare of Japan, the Japan Society for Promotion of Science, and
the Tokai University School of Medicine Research Project.The costs of publication of this
article were defrayed in part by the
payment of page charges. The article
must therefore be hereby marked
"advertisement" in
accordance with 18 U.S.C. Section
1734 solely to indicate this fact.
§
Recipient of the Tokai University School of Medicine Research Fellowship.
Visited Tokai University with the support of the Japan Society
for Human Science.
**
To whom correspondence should be addressed. Tel.: 81-463-93-5436;
Fax: 81-463-93-5437; E-mail: nakae{at}is.icc.u-tokai.ac.jp.
 |
ABBREVIATIONS |
The abbreviations used are:
RND, resistance
nodulation division;
AP, alkaline phosphatase;
TMS, transmembrane segment(s);
PCR, polymerase chain reaction.
 |
REFERENCES |
-
Brown, M. R. W.
(1975)
in
Resistance of Pseudomonas aeruginosa (Brown, M. R. W., ed), pp. 71-107, John Wiley and Sons, London
-
Nakae, T.,
Yoshihara, E.,
and Yoneyama, H.
(1997)
J. Infect. Chemother
3,
173-183
-
Rella, M.,
and Haas, D.
(1982)
Antimicrob. Agents Chemother.
22,
242-249[Abstract/Free Full Text]
-
Lei, Y.,
Sato, K.,
and Nakae, T.
(1991)
Biochem. Biophys. Res. Commun.
178,
1043-1048[CrossRef][Medline]
[Order article via Infotrieve]
-
Hirai, K.,
Suzue, S.,
Irikura, T.,
Iyobe, S.,
and Mitsuhashi, S.
(1987)
Antimicrob. Agents Chemother.
31,
582-586[Abstract/Free Full Text]
-
Fukuda, H.,
Hosaka, M.,
Hirai, K.,
and Iyobe, S.
(1990)
Antimicrob. Agents Chemother.
34,
1757-1761[Abstract/Free Full Text]
-
Ramos, J. L.,
Duque, E.,
Godoy, P.,
and Segura, A.
(1998)
J. Bacteriol.
180,
3323-3329[Abstract/Free Full Text]
-
Goldstein, L. J.,
Galski, H.,
Fojo, A.,
Willingham, M.,
Lai, S. L.,
Gazdar, A.,
Priker, R.,
Green, A.,
Crist, W.,
and Brodeur, G. M.
(1989)
J. Natl. Cancer Inst.
81,
116-124[Abstract/Free Full Text]
-
Poole, K.,
Krebes, K.,
McNally, C.,
and Neshat, S.
(1993)
J. Bacteriol.
175,
7363-7372[Abstract/Free Full Text]
-
Moreshed, S. R. M.,
Lei, Y.,
Yoneyama, H.,
and Nakae, T.
(1995)
Biochem. Biophys. Res. Commun.
210,
356-362[CrossRef][Medline]
[Order article via Infotrieve]
-
Yoneyama, H.,
Ocaktan, A.,
Tsuda, M.,
and Nakae, T.
(1997)
Biochem. Biophys. Res. Commun.
233,
611-618[CrossRef][Medline]
[Order article via Infotrieve]
-
Ocaktan, A.,
Yoneyama, H.,
and Nakae, T.
(1997)
J. Biol. Chem.
272,
21964-21969[Abstract/Free Full Text]
-
Paulsen, I. T.,
Brown, M. H.,
and Skurray, R. A.
(1996)
Microbiol. Rev.
60,
575-608[Abstract/Free Full Text]
-
Dong, Q.,
and Mergeay, M.
(1994)
Mol. Microbiol.
14,
185-187[CrossRef][Medline]
[Order article via Infotrieve]
-
Dinh, T.,
Paulsen, I. T.,
and Saier, M. H., Jr.
(1994)
J. Bacteriol.
176,
3825-3831[Abstract/Free Full Text]
-
Nikaido, H.
(1994)
Science
264,
382-388[Abstract/Free Full Text]
-
Ma, D.,
Cook, D. N.,
Hearst, J. E.,
and Nikaido, H.
(1994)
Trends Microbiol.
2,
489-493[CrossRef][Medline]
[Order article via Infotrieve]
-
Srikumar, R.,
Li, X.,
and Poole, K.
(1997)
J. Bacteriol.
179,
7875-7881[Abstract/Free Full Text]
-
Gotoh, N.,
Tsujimoto, H.,
Nomura, A.,
Okamoto, K.,
Tsuda, M.,
and Nishino, T.
(1998)
FEMS Microbiol. Lett.
165,
21-27[Medline]
[Order article via Infotrieve]
-
Yoneyama, H.,
Ocaktan, A.,
Gotoh, N.,
Nishino, T.,
and Nakae, T.
(1998)
Biochem. Biophys. Res. Commun.
244,
898-902[CrossRef][Medline]
[Order article via Infotrieve]
-
Köhler, T.,
Michéa-Hamzehpour, M.,
Henze, U.,
Gotoh, N.,
Curty, L. K.,
and Pechère, J.-C.
(1997)
Mol. Microbiol.
23,
345-354[CrossRef][Medline]
[Order article via Infotrieve]
-
Saier, M. H., Jr.,
Tam, R.,
Reizer, A.,
and Reizer, J.
(1994)
Mol. Microbiol.
11,
841-847[CrossRef][Medline]
[Order article via Infotrieve]
-
von Heijne, G.
(1992)
J. Mol. Biol.
225,
487-494[CrossRef][Medline]
[Order article via Infotrieve]
-
Manoil, C.,
and Beckwith, J.
(1985)
Proc. Natl. Acad. Sci. U. S. A.
82,
8129-8133[Abstract/Free Full Text]
-
Manoil, C.,
Mekalanos, J. J.,
and Beckwith, J.
(1990)
J. Bacteriol.
172,
515-518[Abstract/Free Full Text]
-
Ehrmann, M.,
Bolek, P.,
Mondigler, M.,
Boyd, D.,
and Lange, R.
(1997)
Proc. Natl. Acad. Sci. U. S. A.
94,
13111-13115[Abstract/Free Full Text]
-
Gutierrez, C.,
and Devedjian, J.
(1989)
Nucleic Acids Res
17,
3999[Free Full Text]
-
Boyd, D.,
Traxler, B.,
and Beckwich, J.
(1993)
J. Bacteriol.
175,
553-556[Abstract/Free Full Text]
-
Guzman, L.-M.,
Belin, D.,
Carson, M. J.,
and Bechwith, J.
(1995)
J. Bacteriol.
177,
4121-4130[Abstract/Free Full Text]
-
Ehrmann, M.,
Boyd, D.,
and Beckwich, J.
(1990)
Proc. Natl. Acad. Sci. U. S. A.
87,
7574-7578[Abstract/Free Full Text]
-
Michaelis, S.,
Inouye, H.,
Oliver, D.,
and Beckwith, J.
(1983)
J. Bacteriol.
154,
366-374[Abstract/Free Full Text]
-
Laemmli, U. K.
(1970)
Nature
227,
680-685[CrossRef][Medline]
[Order article via Infotrieve]
-
Gott, P.,
and Boos, W.
(1988)
Mol. Microbiol.
2,
655-663[CrossRef][Medline]
[Order article via Infotrieve]
-
Allard, J. D.,
and Bertrand, K. P.
(1992)
J. Biol. Chem.
267,
17809-17819[Abstract/Free Full Text]
-
Enomoto, H.,
Unemoto, T.,
Nishibuchi, M.,
Padan, E.,
and Nakamura, T.
(1998)
Biochim. Biophys. Acta
1370,
77-86[Medline]
[Order article via Infotrieve]
-
Cole, S. P.,
Bhardwaj, G.,
Gerlach, J. H.,
Mackie, J. E.,
Grant, C. E.,
Almquist, K. C.,
Stewart, A. J.,
Kurz, E. U.,
Duncan, A. M.,
and Deeley, R. G.
(1992)
Science
258,
1650-1654[Abstract/Free Full Text]
-
Fujii, R.,
Mutoh, M.,
Niwa, K.,
Yamada, K.,
Aikou, T.,
Nakagawa, M.,
Kuwano, M.,
and Akiyama, S.
(1994)
Jpn. J. Can. Res.
85,
426-433[CrossRef][Medline]
[Order article via Infotrieve]
-
von Heijne, G. C.
(1986)
EMBO J.
5,
3021-3027[Medline]
[Order article via Infotrieve]
Copyright © 1999 by The American Society for Biochemistry and Molecular Biology, Inc.

CiteULike Complore Connotea Del.icio.us Digg Reddit Technorati What's this?
This article has been cited by other articles:

|
 |

|
 |
 
M. Sugimura, H. Maseda, H. Hanaki, and T. Nakae
Macrolide Antibiotic-Mediated Downregulation of MexAB-OprM Efflux Pump Expression in Pseudomonas aeruginosa
Antimicrob. Agents Chemother.,
November 1, 2008;
52(11):
4141 - 4144.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
T. Fujiki, K. Nanatani, K. Nishitani, K. Yagi, F. Ohnishi, H. Yoneyama, T. Uchida, T. Nakajima, and K. Abea
Membrane Topology of Aspartate:Alanine Antiporter AspT from Comamonas testosteroni
J. Biochem.,
January 1, 2007;
141(1):
85 - 91.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
R. J. Gillis, K. G. White, K.-H. Choi, V. E. Wagner, H. P. Schweizer, and B. H. Iglewski
Molecular Basis of Azithromycin-Resistant Pseudomonas aeruginosa Biofilms
Antimicrob. Agents Chemother.,
September 1, 2005;
49(9):
3858 - 3867.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
H. Tokunaga, K. Mitsuo, S. Ichinose, A. Omori, A. Ventosa, T. Nakae, and M. Tokunaga
Salt-Inducible Multidrug Efflux Pump Protein in the Moderately Halophilic Bacterium Chromohalobacter sp.
Appl. Envir. Microbiol.,
August 1, 2004;
70(8):
4424 - 4431.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. V. Smirnova and M. S. Ullrich
Topological and deletion analysis of CorS, a Pseudomonas syringae sensor kinase
Microbiology,
August 1, 2004;
150(8):
2715 - 2726.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
H. Akama, T. Matsuura, S. Kashiwagi, H. Yoneyama, S.-i. Narita, T. Tsukihara, A. Nakagawa, and T. Nakae
Crystal Structure of the Membrane Fusion Protein, MexA, of the Multidrug Transporter in Pseudomonas aeruginosa
J. Biol. Chem.,
June 18, 2004;
279(25):
25939 - 25942.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
H. Maseda, I. Sawada, K. Saito, H. Uchiyama, T. Nakae, and N. Nomura
Enhancement of the mexAB-oprM Efflux Pump Expression by a Quorum-Sensing Autoinducer and Its Cancellation by a Regulator, MexT, of the mexEF-oprN Efflux Pump Operon in Pseudomonas aeruginosa
Antimicrob. Agents Chemother.,
April 1, 2004;
48(4):
1320 - 1328.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. K. Middlemiss and K. Poole
Differential Impact of MexB Mutations on Substrate Selectivity of the MexAB-OprM Multidrug Efflux Pump of Pseudomonas aeruginosa
J. Bacteriol.,
March 1, 2004;
186(5):
1258 - 1269.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. Eda, H. Maseda, and T. Nakae
An Elegant Means of Self-protection in Gram-negative Bacteria by Recognizing and Extruding Xenobiotics from the Periplasmic Space
J. Biol. Chem.,
January 17, 2003;
278(4):
2085 - 2088.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
E. B. Tikhonova, Q. Wang, and H. I. Zgurskaya
Chimeric Analysis of the Multicomponent Multidrug Efflux Transporters from Gram-Negative Bacteria
J. Bacteriol.,
December 1, 2002;
184(23):
6499 - 6507.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. R. Aires, J.-C. Pechere, C. Van Delden, and T. Kohler
Amino Acid Residues Essential for Function of the MexF Efflux Pump Protein of Pseudomonas aeruginosa
Antimicrob. Agents Chemother.,
July 1, 2002;
46(7):
2169 - 2173.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
L. Guan and T. Nakae
Identification of Essential Charged Residues in Transmembrane Segments of the Multidrug Transporter MexB of Pseudomonas aeruginosa
J. Bacteriol.,
March 1, 2001;
183(5):
1734 - 1739.
[Abstract]
[Full Text]
|
 |
|

|
 |

|
 |
 
K. K. Y. Wong, F. S. L. Brinkman, R. S. Benz, and R. E. W. Hancock
Evaluation of a Structural Model of Pseudomonas aeruginosa Outer Membrane Protein OprM, an Efflux Component Involved in Intrinsic Antibiotic Resistance
J. Bacteriol.,
January 1, 2001;
183(1):
367 - 374.
[Abstract]
[Full Text]
|
 |
|

|
 |

|
 |
 
J. Kieboom and J. A. M. de Bont
Identification and molecular characterization of an efflux system involved in Pseudomonas putida S12 multidrug resistance
Microbiology,
January 1, 2001;
147(1):
43 - 51.
[Abstract]
[Full Text]
|
 |
|

|
 |

|
 |
 
M. Putman, H. W. van Veen, and W. N. Konings
Molecular Properties of Bacterial Multidrug Transporters
Microbiol. Mol. Biol. Rev.,
December 1, 2000;
64(4):
672 - 693.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
K. K. Y. Wong and R. E. W. Hancock
Insertion Mutagenesis and Membrane Topology Model of the Pseudomonas aeruginosa Outer Membrane Protein OprM
J. Bacteriol.,
May 1, 2000;
182(9):
2402 - 2410.
[Abstract]
[Full Text]
|
 |
|

|
 |

|
 |
 
H. Maseda, H. Yoneyama, and T. Nakae
Assignment of the Substrate-Selective Subunits of the MexEF-OprN Multidrug Efflux Pump of Pseudomonas aeruginosa
Antimicrob. Agents Chemother.,
March 1, 2000;
44(3):
658 - 664.
[Abstract]
[Full Text]
|
 |
|

|
 |

|
 |
 
H. Yoneyama, H. Maseda, H. Kamiguchi, and T. Nakae
Function of the Membrane Fusion Protein, MexA, of the MexA, B-OprM Efflux Pump in Pseudomonas aeruginosa without an Anchoring Membrane
J. Biol. Chem.,
February 18, 2000;
275(7):
4628 - 4634.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. Nakajima, Y. Sugimoto, H. Yoneyama, and T. Nakae
Localization of the Outer Membrane Subunit OprM of Resistance-Nodulation-Cell Division Family Multicomponent Efflux Pump in Pseudomonas aeruginosa
J. Biol. Chem.,
September 22, 2000;
275(39):
30064 - 30068.
[Abstract]
[Full Text]
[PDF]
|
 |
|
Copyright © 1999 by the American Society for Biochemistry and Molecular Biology.
|
Advertisement
Advertisement
|