Advertisement
JBC

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Hiki, K.
Right arrow Articles by Gamble, J. R.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Hiki, K.
Right arrow Articles by Gamble, J. R.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

J Biol Chem, Vol. 274, Issue 15, 10661-10667, April 9, 1999


Cloning, Characterization, and Chromosomal Location of a Novel Human K+-Clminus Cotransporter*

Kazuaki HikiDagger §, Richard J. D'AndreaDagger , Jill FurzeDagger , Joanna Crawfordparallel , Erica Woollattparallel , Grant R. Sutherlandparallel , Mathew A. VadasDagger **, and Jennifer R. GambleDagger **Dagger Dagger

From the Dagger  Department of Human Immunology, Hanson Centre for Cancer Research, Institute of Medical and Veterinary Science and University of Adelaide, Adelaide, South Australia 5000 and parallel  Centre for Medical Genetics, Department of Cytogenetics and Molecular Genetics, Women's and Children's Hospital, North Adelaide, South Australia 5006, Australia

    ABSTRACT
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

Differential display polymerase chain reaction has been used to isolate genes regulated in vascular endothelial cells by the angiogenic factor vascular endothelial cell growth factor (VEGF). Analysis of one of the bands consistently up-regulated by VEGF led us to the identification of a cDNA from a human umbilical vein endothelial cell library that is 77% identical to the human K+-Cl- cotransporter1 (KCC1). We have referred to the predicted protein as K+-Cl- cotransporter 3 (KCC3). Hydrophobicity analysis of the KCC3 amino acid sequence showed an almost identical pattern to KCC1, suggesting 12 membrane-spanning segments, a large extracellular loop with potential N-glycosylation sites, and cytoplasmic N- and C-terminal regions. The KCC3 mRNA was highly expressed in brain, heart, skeletal muscle, and kidney, showing a distinct pattern and size from KCC1 and KCC2. The KCC3 mRNA level in endothelial cells increased on treatment with VEGF and decreased with the proinflammatory cytokine tumor necrosis factor alpha , whereas KCC1 mRNA levels remained unchanged. Stable overexpression of KCC3 cDNA in HEK293 cells produced a glycoprotein of approximately 150 kDa, which was reduced to 120 kDa by glycosidase digestion. An increased initial uptake rate of 86Rb was seen in clones with high KCC3 expression, which was dependent on extracellular Cl- but not Na+ and was inhibitable by the loop diuretic agent furosemide. The KCC3 genomic localization was shown to be 15q13 by fluorescence in situ hybridization. Radiation hybrid analysis placed KCC3 within an area associated with juvenile myoclonic epilepsy. These results suggest KCC3 is a new member of the KCC family that is under distinct regulation from KCC1.

    INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

The cation chloride cotransporter (CCC)1 family is involved in the electroneutral movement of ions across the plasma membrane. There are three CCC subclasses identified thus far on the basis of their structures, ligands, and inhibitors. These are the thiazide-sensitive Na+-Cl- cotransporters, the loop diuretics-sensitive Na+-K+-Cl- (NKCC), and the K+-Cl- cotransporters (KCC; Refs. 1-5). NKCC and KCC have two isotypes. NKCC1 shows ubiquitous distribution (3) among organs, whereas NKCC2 is restricted to kidney (2). KCC1 is ubiquitous (4), whereas KCC2 is only found in brain (5). In addition to the classical roles of transepithelial salt transport (6) and the regulation of cellular volume (7), Harling et al. (8) have recently shown that tobacco protoplast growth becomes independent of the plant hormone, auxin, when NKCC1 is overexpressed, suggesting the possible involvement of the CCC family in cell cycle regulation.

The physiological regulation of the NKCC and KCC family is complex. Other than the electrochemical gradient of their ligands, evidence suggests that activation of this passive transport system is regulated by phosphorylation (9), cytoskeletal rearrangement (10), change of intracellular Mg2+ concentration (6, 7), intracellular pH (11), oxygen concentration (12), and cellular ATP levels (13). In addition, some stimuli can mediate differential effects on various members of the CCC family. For example, cell swelling activates KCC, whereas cell shrinkage activates NKCC (6, 7). Phosphorylation activates NKCC, whereas KCC is activated by dephosphorylation (6, 7). In cultured endothelial cells, transcriptional regulation has been reported for NKCC1 in response to sheer stress and proinflammatory cytokines (14). Cellular differentiation has also been shown to be associated with changes in NKCC and KCC gene expression. In the intestinal epithelial cell line HT29, a change of NKCC1 mRNA level during differentiation has been reported (15, 16), whereas the loss of K+-Cl- flux during the maturation of sheep red blood cells is well known (7).

We report here the isolation and cloning of a new member of the KCC group of cotransporters, which we have named KCC3. KCC3 displays high homology to KCC1, and the characteristics of the ion flux mediated by KCC3 satisfies the criteria for a KCC. KCC3 is regulated at the mRNA level by the angiogenic factor VEGF and by the proinflammatory cytokine TNFalpha , neither of which has any effect on KCC1 mRNA levels. Finally, KCC3 has been localized to chromosome 15q13, a region linked to the inherited disease juvenile myoclonic epilepsy (17).

    EXPERIMENTAL PROCEDURES
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

HUVECs-- HUVECs were isolated as described previously (18). The cells were cultured on gelatin-coated culture flasks in medium 199 with Eagle's salts supplemented with 20% fetal calf serum. After passage 1, the cells were grown in medium with 25 µg/ml endothelial cell growth factor (Collaborative Research) and 25 µg/ml heparin (Sigma). For the differential display, HUVECs were cultured in Opti-MEM medium (Life Technologies, Inc.) with 2% fetal calf serum for 2 days.

Cytokine Stimulation-- HUVECs grown to approximately 70% confluency in Opti-MEM were stimulated with 50 ng/ml VEGF 165 (R & D Systems) and 25 µg/ml heparin for 4 h. For TNFalpha stimulation, HUVECs were grown in medium with 20% fetal calf serum and growth factor, then treated for 4 h with 2 ng/ml TNFalpha (R & D).

Differential Display PCR-- Primary culture HUVECs with or without VEGF stimulation were lysed by Trizol reagent (Life Technologies, Inc.). Total RNA was extracted using the manufacturer's protocol and was treated with RNA clean kit (Genhunter) to remove genomic DNA contamination. The RNA obtained was reverse-transcribed using three classes of anchor primers provided in the RNA Image Kit (Genhunter), and each of three cDNA pools were amplified on the GeneAmp PCR system 2400 model (Perkin-Elmer) with a combination of eight arbitrary primers and the same anchor primer used in reverse transcription. This resulted in the generation of 24 amplicons from one RNA sample. The primer-matched amplicons were electrophoresed side by side in a 6% acrylamide gel. The bands that were consistently regulated were retrieved from the gel, reamplified, and subcloned into a pGEM-T vector (Promega) to be sequenced using Dye terminator cycle sequence kit and the autosequencer (Perkin-Elmer-Applied Bio).

Cloning and Sequencing of KCC3-- One of the bands consistently up-regulated by VEGF treatment encoded a product whose DNA sequence was 90% identical to human KCC1. We used this sequence as a probe (7AV1 probe) to screen a lambda gt10/HUVEC library (a gift from Dr. Sawamura, Kyoto University). A 2.7-kb phage clone (clone 3) showed significant homology to KCC1 (U55054 in GenBankTM/EBI data bank). We further screened the library with a 5' sequence of clone 3 (3R probe, a PCR product using primers 5'-CATTGACGTTTGCTCTAAGACC and 5'-GTTTGATCCAGCCATGATACC, see Fig. 2A) to obtain a 2.1-kb clone (clone 9) that spanned a putative initiating ATG signal. Clone 3 and clone 9 shared an overlap of 1 kb including a BstB1 site, which enabled us to construct a 3.7-kb cDNA with an open reading frame for a 1099-amino acid protein (see Fig. 2A, KCC3 protein, cDNA sequence deposited in GenBankTM data base, accession number AF108831). Analysis of the nucleic acid and amino acid sequences was carried out using the programs provided by ANGIS (Australian National Genomic Information Service).

Northern Blot Analysis-- Total RNA was extracted from HUVECs of primary and passaged cultures using Trizol reagent. Twenty µg of total RNA was prepared and separated by electrophoresis in a 1% agarose gel containing formaldehyde. RNA was transferred to Hybond N (Amersham Pharmacia Biotech) membrane and UV-cross-linked. To produce a specific KCC3 probe, we generated a 942-base pair PCR product using KCC3-specific primers (GTCCCATCAAAGTTATG and GCAATAGCTTGTAGCAGCCTCG, corresponding to amino acids 349-548). This segment of cDNA was chosen because it had low homology to KCC1. After purification of this product from agarose gel using Bresa Clean Kit (Bresatec), the fragment was labeled with [32P]dATP (Giga label kit, Bresatec) in the presence of 1 ng/ml reverse primer to replace the random primers. To produce a KCC1-specific probe, TGGGACCATTTTCCTGACC and CATGCTTCTCCACGATGTCAC (corresponding to amino acids 254-394) were used as forward and reverse primers, respectively, and the same protocol was used. Hybridization was carried out with ExpressHyb hybridization solution (CLONTECH). For studying tissue-specific expression of KCC3, a human multiple tissue Northern blot (CLONTECH) was hybridized to the KCC3-specific probe.

Preparation of KCC3-overexpressing Transfectants-- A FLAG epitope-tagged full-length KCC3 cDNA expression construct was produced. By PCR, a FLAG sequence of DYKDDDDK was added to the N terminus of KCC3 using the following primers (GAATTCATGGACTACAAGGACGACGACGACAAGATGCCACATTTTACTGTGACT and CTCCCTTGGGTAGGTAATTA (corresponding to amino acids 1-403). The PCR generated a 1-kb PCR product that was digested with XhoI and linked to the rest of the KCC3 sequence. The construct was introduced into the pcDNA zeo 3.1 mammalian expression vector (Invitrogen), which was introduced to HEK293 cells using LipofectAMINE (Life Technologies, Inc.). HEK293 cells were selected with 100 µg/ml zeocin (Invitrogen), and colonies were picked to generate clonal populations.

Isotopic Flux Assays-- Transfected HEK 293 cells were grown to confluency in 24-well dishes coated with poly-D-lysine. Cells were washed twice with flux medium (135 mM NaCl, 3 mM glucose, 5 mM RbCl, 1 mM CaCl2, 1 mM MgCl2, 1 mM Na2HPO4, 2 mM Na2SO4, 20 mM HEPES, pH 7.4, and 0.1 mM ouabain) and then incubated for 15 min at room temperature with 400 µl of flux medium containing 1 mM N-ethylmaleimide (ICN). One hundred µl of flux medium containing 10 µCi/ml 86RbCl (Amersham Pharmacia Biotech) was quickly added. Cells were incubated for 3 min before washing 3 times with ice-cold phosphate-buffered saline. For sodium-free experiments, sodium was replaced by N-methyl-D-glucamine (ICN), and for chloride-free experiments, it was replaced by gluconate. Bumetanide (Sigma) and furosemide (Sigma) were administered at the indicated concentration at the start of the preincubation with N-ethylmaleimide. Cells were lysed with 2% SDS and assayed for protein content using a BCA protein assay kit (Pierce) and for 86Rb using Cerenkov radiation in a scintillation counter.

Preparation of Anti-KCC3 Antibody and Protein Detection-- Synthetic KCC peptide 1 (SQNSITGEHSQLLDD) and peptide 2 (AIFHSDDALKESAA) were linked to chicken albumin (Sigma) to immunize rabbits, and anti-KCC3 peptide antibodies (P1 antibody by peptide 1 and P2 antibody by peptide 2) were prepared as described previously (19). To digest KCC3 protein by N-glycanase F (Boehringer Mannheim), immunoprecipitated KCC3 was incubated with 250 milliunits/ml glycosidase overnight at 30 °C in the presence of 10% Nonidet P-40.

Genomic Localization-- The KCC3 coding sequence in the pGEM4Z vector was nick-translated with biotin-14-dATP and hybridized in situ at a final concentration of 15 ng/ml to metaphases from two normal males. The fluorescence in situ hybridization method was modified from that previously described (20). Chromosomes were stained before analysis with both propidium iodide (as counterstain) and 4',6-diamino-2-phenylindole dihydrochloride (for chromosome identification). For the radiation hybrid analysis, we performed a screen of a medium resolution Stanford G3 panel of 83 clones to refine the map position of the KCC3 gene. PCR amplification was carried out on this panel using primers g5 (TGCCACATTTTACTGTGAC) and g6 (TCATCTGAATCCTGAATCC), both of which lie in the 5' region of KCC3 gene. PCR results were analyzed using the radiation hybrid mapping facility at the Stanford Human Genome Center.

    RESULTS
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

Isolation and Analysis of a KCC3 cDNA-- In the differential display PCR using total RNA extracted from 4-h VEGF-treated HUVECs, a band was consistently up-regulated in experiments using three independent pools of primary and passaged HUVECs as RNA sources. A representative example of these differential displays is shown in Fig. 1. We have characterized this product and generated a full-length cDNA from two overlapping clones (Fig. 2A). The cDNA sequence shows high homology to KCC1 and encodes a predicted protein of 1099 amino acids. The primary amino acid sequence of this protein, which we have named KCC3, is 77% identical to KCC1 and 73% identical to KCC2 (Fig. 3). Five N-glycosylation consensus sites are found in the large extracellular domain between the 5th and 6th membrane-spanning regions (Fig. 3). The hydropathy profile (by Kyte-Doolittle analysis) of KCC3 was almost identical to that of KCC1, predicting a protein with 12 membrane-spanning segments and large intracellular N- and C-terminal domains (Fig. 2B). Considerable diversity is seen, relative to KCC1, in the N-terminal portion, the extracellular domain between the 3rd and 4th membrane-spanning segments and the 5th and 6th membrane-spanning segments and in the area near the C terminus. KCC3 does not have a glutamic acid residue at the beginning of the transmembrane domain 2. This residue has been suggested to be important for the enhanced extracellular potassium binding in KCC2 (21).


View larger version (79K):
[in this window]
[in a new window]
 
Fig. 1.   Differential display PCR comparing VEGF-stimulated and -unstimulated RNA populations. HT11A anchor primer and AP7 arbitrary primer (RNA image kit, Genhunter) were used to amplify cDNAs derived from primary HUVECs treated with VEGF (VEGF) or without VEGF (ctrl). Amplicons from each group were applied in duplicate. Consistently up-regulated bands are indicated by an arrow. Similar up-regulation was seen in three other independent experiments.


View larger version (19K):
[in this window]
[in a new window]
 
Fig. 2.   Schematic diagram of selected clones encoding KCC3 and a predicted hydropathy profile. Panel A, map of KCC3 cDNA. Clone 3 and clone 9 have an overlap of 1 kb that contains a BstBI site used to construct a 3767-bp KCC3 cDNA. The coding region of KCC3 (3297 bp) is shown by the filled box. The location of the two probes used for screening is shown (3R and 7AV1). Panel B, hydropathy profiles of KCC3 and KCC1. KCC3 and KCC1 peptide sequences were analyzed using the Kyte-Doolittle algorithm in the PEPPROT program at ANGIS.


View larger version (99K):
[in this window]
[in a new window]
 
Fig. 3.   Comparison of the primary structures of the KCC family members. Identical amino acids are shaded. Predicted transmembrane segments are highlighted by lines above the KCC3 sequence. Consensus motifs for N-glycosylation sites (Gly), casein II kinase phosphorylation sites (C), and protein kinase C phosphorylation sites (PK) are also shown above the sequence. Multiple sequence alignment was performed using the PILEUP and PRETTY BOX programs (ANGIS), and consensus sites were identified with the MOTIF program at ANGIS.

Expression and Regulation of KCC3 mRNA-- Fig. 4A shows the tissue-specific expression of KCC3. Unlike ubiquitously expressed KCC1 and brain-restricted KCC2, strong expression of KCC3 was observed in brain, heart, skeletal muscle, and kidney. Transcripts of approximately 9, 7.5, and 4.5 kb were detected (lanes 2, 3, 7, and 8 in Fig. 4A), and these showed tissue-specific differences in abundance. KCC3 mRNA level increased from as early as 1.5 h after VEGF administration, whereas KCC1 levels remained unchanged (Fig. 4B). This was true not only in primary HUVECs but also in passaged cells (data not shown). We have also used semiquantitative PCR to analyze the VEGF responsiveness and have obtained results similar to the Northern blot data (not shown). It has been reported that NKCC1 is up-regulated by TNFalpha (14); however, the KCC3 mRNA level showed a down-regulation in response to TNFalpha , whereas KCC1 remained unchanged (Fig. 4B).


View larger version (42K):
[in this window]
[in a new window]
 
Fig. 4.   Distribution and regulation of the KCC3 mRNA. Panel A, tissue-specific expression of KCC3 mRNA. A multiple tissue Northern blot membrane (CLONTECH) was probed with a KCC3-specific probe. Lane 1, pancreas; lane 2, kidney; lane 3, skeletal muscle; lane 4, liver; lane 5, lung; lane 6, placenta; lane 7, brain; lane 8, heart. Molecular size (kb) is indicated on the left. Panel B, regulation of KCC3 mRNA level by VEGF and TNFalpha treatment. Primary culture HUVECs were treated for 1.5 h with (VEGF) or without (ctrl) VEGF. Passaged HUVECs were treated for 4 h with (TNFalpha ) or without (ctrl) TNFalpha . Each membrane was probed with KCC3, KCC1, and : glyceraldehyde-3-phosphate dehydrogenase (GAPDH) probes in that order. The increase of the KCC3 mRNA observed by treatment with VEGF is 1.8-fold, and the decrease by TNFalpha is 52%. Two other experiments showed similar results.

Detection of KCC3 Protein in HUVECs and in HEK293 Cells-- To further analyze the KCC3 gene product, we have generated a KCC3 cDNA incorporating an N-terminal FLAG epitope (N-FLAG KCC3). We have produced stable HEK293 cell lines overexpressing N-FLAG KCC3. The FLAG-tagged protein, when immunoprecipitated with anti-FLAG antibody (M2 antibody, Eastman Kodak Co.), was approximately150 kDa (Fig. 5A, lanes 1 and 2) and reduced to 120 kDa by digestion with glycosidase treatment (Fig. 5B). Immunoprecipitation using M2 antibody followed by Western blotting with anti-KCC3 synthetic peptide 1 antibody (P1 antibody, Fig. 5A, lanes 3 and 4) and immunoprecipitation using P1 antibody followed by Western blotting with M2 antibody (Fig. 5A, lanes 5 and 6) gave the same results. These results were also reproduced when we used P2 antibody instead of P1 antibody (data not shown). KCC3 protein was also immunoprecipitated and blotted from cultured HUVECs using P1 antibody (Fig. 5C).


View larger version (35K):
[in this window]
[in a new window]
 
Fig. 5.   Analysis of the KCC3 protein. Panel A, detection of the KCC3 protein in HEK293 cells overexpressing KCC3 (clone 847). Cells were lysed, and the KCC3 protein was immunoprecipitated using anti-FLAG M2 antibody and blotted with M2 (lanes 1 and 2) or anti-KCC3 synthetic peptide1 antibody (P1 antibody, see "Experimental Procedures," lanes 3 and 4). In lanes 5 and 6, KCC3 was immunoprecipitated with P1 antibody and blotted with M2 antibody. HEK293 cells overexpressing KCC3 were used in lanes 1, 3, and 5, and control HEK293 cells were used in lanes 2, 4, and 6. Panel B, glycosylation of KCC3 protein. KCC3 was immunoprecipitated from clone 847 cells with M2 antibody and digested overnight with N-glycosidase F. F-, before digestion; F+, after digestion. Panel C, detection of the endogenous KCC3 protein in HUVECs. Passage 3 HUVECs were lysed, and the KCC3 protein was immunoprecipitated with control antibody (lane 1) or P1 antibody (lane 2) followed by Western blotting with P1 antibody.

Functional Characterization of KCC3-- We used a 86Rb uptake assay as a measure of K+ flux as described elsewhere (4). When the FLAG sequence was added to the C terminus of KCC3, there was no measurable difference in 86Rb uptake between KCC3 clones and control populations (data not shown). Therefore the N-FLAG KCC3 construct was used for the functional analysis of KCC3. Expression of KCC3 in HEK293 cells was confirmed after selection in zeocin by Western blotting using M2 antibody. The results for 1 clone (clone 847) are shown in Fig. 6, although similar results were seen in 5 other independent clones (data not shown). A 3-min assay was used because in both control and transfectants, 86Rb uptake was linear at least for the initial 15 min (data not shown). The results shown in Fig. 6B demonstrate a significantly increased furosemide-sensitive 86Rb uptake in clone 847 that expresses a high level of KCC3 (Fig. 6A). The magnitude of furosemide-sensitive 86Rb uptake was similar to that reported for KCC1 (4), because our value of 10 cpm/µg of protein/3 min is equal to 3.2 nmol Rb/µg of protein/min. Such an increase was not seen in clones that were zeocin-resistant but expressed a low level of KCC3 (data not shown). The uptake was dependent on extracellular Cl- with little dependence on extracellular Na+ (Fig. 6C). The loop diuretics furosemide and bumetanide showed a dose-dependent inhibition of uptake with furosemide slightly more effective than bumetanide (Ki of approximately10 µM versus 40 µM, Fig. 6D). The KCC3 transfectants did not show a significant increase in 86Rb uptake in response to hypotonic treatment (data not shown). These results show that KCC3 satisfies the functional criteria of the KCC class of cotransporters.


View larger version (30K):
[in this window]
[in a new window]
 
Fig. 6.   Functional analysis of KCC3. Panel A, expression of the KCC3 protein in clone 847 cells. KCC3 was immunoprecipitated from either clone 847 (lane 1) or control cells (lane 2) by M2 antibody followed by Western blotting with P1 antibody. Panel B, demonstration of enhanced 86Rb uptake by KCC3-transfected HEK293 cells. HEK293 cells, HEK293 cells transfected with blank vector (CTRL), and clone 847 were assayed for their 86Rb uptake after preincubation with 1 mM N-ethylmaleimide. Values after subtracting furosemide-insensitive 86Rb uptake are shown. Values are shown as mean ±S.D. (n = 3). Two other experiments showed similar results. Panel C, extracellular Na+ independence and Cl- dependence of KCC3. Clone 847 cells were assayed for furosemide-sensitive 86Rb uptake in the absence of extracellular Na+ (Na-) or Cl- (Cl-, n = 3). See "Experimental Procedures" for details. Values are shown as mean ±S.D. Two other experiments showed similar results. Panel D, sensitivity for loop diuretic agents. Percent decrease of 86Rb uptake of clone 847 cells by incremental concentration of furosemide (closed circle) and bumetanide (open circle) are shown (n = 3). Values are shown as mean ±S.D. Two other experiments showed similar results.

Genomic Localization of KCC3-- Twenty-five metaphases from a normal male were examined for fluorescent signal. All of these metaphases showed a signal on one or both chromatids of chromosome 15 in the region 15q13 (Fig. 7). There was a total of 2 nonspecific background dots observed in these 25 metaphases. A similar result was obtained from hybridization of the probe to 15 metaphases from a second normal male (data not shown). Radiation hybrid analysis indicated that KCC3 is most closely associated with the chromosome 15 marker SHGC-33497 with a LOD score of 1000. Assessment of flanking markers D15S1010 and D15S1040, using the integrated gene maps available at NCBI, gave a result consistent with the localization of KCC3 by fluorescence in situ hybridization analysis.


View larger version (77K):
[in this window]
[in a new window]
 
Fig. 7.   Fluorescence in situ hybridization analysis with a KCC3 probe. Normal male chromosomes were stained with propidium iodide and 4',6-diamino-2-phenylindole dihydrochloride before hybridization with a KCC3 probe. This is a single metaphase spread of 40 that were analyzed. All showed a similar hybridization pattern. Hybridization sites on chromosome 15 are indicated by arrows.


    DISCUSSION
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

We describe here the cloning of a new member of the CCC family that is structurally closely related to the potassium chloride cotransporter KCC1 and that we therefore have named KCC3. The amino acid sequence shows significant homology to other KCC family members with overall amino acid identity between KCC1 and KCC3 being 77%. There is a large predicted extracellular domain between the 5th and 6th putative membrane-spanning regions that is common to the KCC family but not observed in the NKCC family. Considerable diversity is observed in the N-terminal portion and in the extracellular domains between the 3rd and 4th and 5th and 6th putative membrane-spanning segments (Fig. 3). It is also notable that there are four deletions in the C-terminal region common to KCC1 and KCC3 that are not present in KCC2 (Fig. 3). The C-terminal conserved portion appears important in its function as addition of a FLAG epitope to the C terminus of KCC3 abolished the uptake of 86Rb in our assay (data not shown). Furthermore, Harling et al. (8) find that the C-terminal fragment of AXI 4, a plant CCC, is sufficient for establishing auxin-independent growth of tobacco protoplast growth.

Overexpression of KCC3 in HEK293 cells allowed functional analysis and demonstrated that KCC3 exhibits characteristics expected of a KCC. 86Rb flux was significantly increased in KCC3 transfectants. This increase was independent of extracellular Na+ but dependent on extracellular Cl-. This and the fact that the 86Rb flux was measured in the presence of the SH-reactive reagent N-ethylmaleimide (22), which inhibits NKCC1 but activates KCC (4), suggest that NKCC1 is not a major contributor in our assay. It is also considered unlikely that KCC1 is responsible for all the 86Rb uptake observed in the transfectants, because increased uptake was only seen in clones expressing high levels of KCC3. Furthermore, in both KCC3-expressing transfectants and control transfectants, the mRNA levels of KCC1 were equivalent (data not shown).

Analysis of multiple tissue blot Northern filters probed with a KCC3-specific probe showed a tissue-specific expression pattern with highest levels observed in kidney, skeletal muscle, heart, and brain. This contrasted with the expression of KCC1, which is ubiquitous (4), and KCC2, which is restricted to brain (5). Although the reason for the selective tissue distribution is unknown, it suggests that KCC3 does not serve a general housekeeping function such as cell volume regulation as has been proposed for KCC1 (4). This is further supported by the lack of detectable regulation of KCC3 activity in response to alterations in osmolarity (data not shown).

At present we do not know the role of KCC3 in endothelial cells. However, the responsiveness of this gene in HUVECs to VEGF suggests an involvement in angiogenesis. It is tempting to speculate that the up-regulation of KCC3 mRNA levels mediated by VEGF may be through modulation of the cytoskeleton, which results in changes in cell shape (23). Such changes have been reported to be one of the initial events upon angiogenic stimulation (24), and changes of this type can also affect the expression of the CCC members (7). Recently Edwards et al. (25) reported that K+ released from endothelial cells in response to acetylcholine stimulation caused hyperpolarization and relaxation of smooth muscle cells through activation of the Na-K-ATPase and Ba2+-sensitive K+ channel. Thus K+ may also be important in the control of blood pressure. Because the Na-K-ATPase generates the chemical gradient that drives CCCs, it also implies that KCC3 may be involved in modulating the local K+ concentration.

We also observed a down-regulation of the KCC3 mRNA level in response to TNFalpha . Because NKCC1 is up-regulated by TNFalpha (14), our results suggest that KCC3 may be a functional counterpart of NKCC1. Certainly KCC1 mRNA levels showed no change in response to TNFalpha , supporting the idea that KCC3 and NKCC1 are coregulated in response to TNFalpha . NKCC1 has been reported to play a role downstream of the growth hormone auxin in tobacco protoplasts (8), where it is involved in cell cycle progression; therefore we speculate that KCC3 may also be involved in cell cycle regulation. Interestingly, the tissue-specific expression pattern of KCC3 resembles that of cyclin G1 (26), a cyclin involved in cell cycle arrest.

KCC3 has been localized to 15q13 and between the genetic markers D15S1010 and D15S1040. This region has recently been linked to juvenile myoclonic epilepsy (17), raising the possibility that KCC3 is a candidate gene for this disease. Payne (21) has postulated that KCC2, a brain-restricted KCC, acts as a neuronal Cl- pump, complementing other systems in regulating K+ homeostasis. The concept is now emerging that the idiopathic epilepsies may represent ion channel disorders (27) based on certain inherited forms of epilepsy in mice (28), mutations in the alpha 4 subunit of neuronal nicotinic acetylcholine receptor responsible for autosomal dominant nocturnal frontal lobe epilepsy (29), and benign familial neonatal convulsions because of mutations of potassium channel gene (30-32). Thus, we suggest that KCC3 may be a candidate gene for juvenile myoclonic epilepsy worthy of further investigation.

    ACKNOWLEDGEMENTS

We thank Dr. Yutaka Tagaya (NIH, Bethesda, MD) for practical advice on performing differential display PCR and interpretation of its pattern and Professor David Cook (Sydney University) and Dr. Peter Little (Baker Institute Melbourne) for helpful advice. We also thank the staff at the delivery rooms of the Women's and Children's Hospital and Burnside War Memorial Hospital Adelaide for collection of umbilical cords.

    FOOTNOTES

* This work was supported by grants from National Health and Medical Research Council and the National Heart Foundation of Australia.The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

§ Supported by Kyoto University and Ikadachi Hospital, Japan. Current address: Dept. of Pharmacology, Faculty of Medicine, Kyoto University, Yoshida Konoe Cho, Sakyo-ku, Kyoto 606 Japan.

Supported by an HM Lloyd Senior Research Fellowship in Oncology from the University of Adelaide.

** These authors contributed equally to this paper.

Dagger Dagger To whom correspondence should be addressed: Dept. of Human Immunology, Hanson Centre for Cancer Research, Institute of Medical and Veterinary Science and University of Adelaide, Frome Rd., Adelaide, SA 5000, Australia. Tel.: 618--8222-3482; Fax: 618-8232-4092; E-mail: jennifer.gamble{at}imvs.sa.gov.au.

    ABBREVIATIONS

The abbreviations used are: CCC, cation chloride cotransporter; NKCC, sodium potassium chloride cotransporter; KCC, potassium chloride cotransporter; VEGF, vascular endothelial cell growth factor; HUVEC, human umbilical vein endothelial cell; PCR, polymerase chain reaction; TNFalpha , tumor necrosis factor alpha ; kb, kilobase(s).

    REFERENCES
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES
  1. Gamba, G., Saltzberg, S. N., Lombardi, M., Miyanoshita, A., Lytton, J., Hediger, M. A., Brenner, B. M., and Herbert, S. C. (1993) Proc. Natl. Acad. Sci. U. S. A. 90, 2749-2753[Abstract/Free Full Text]
  2. Gamba, G., Miyanoshita, A., Lombardi, M., Lytton, J., Lee, W. S., Hediger, M. A., and Herbert, S. C. (1994) J. Biol. Chem. 269, 17713-17722[Abstract/Free Full Text]
  3. Xu, J. C., Lytle, C., Zhu, T. T., Payne, J. A., Benz, E., Jr., and Forbush, B., III (1994) Proc. Natl. Acad. Sci. U. S. A. 91, 2201-2205[Abstract/Free Full Text]
  4. Gillen, C. M., Brill, S., Payne, J. A., and Forbush, B., III. (1996) J. Biol. Chem 271, 16237-16244[Abstract/Free Full Text]
  5. Payne, J. A., Stevenson, T. J., and Donaldson, L. F. (1996) J. Biol. Chem. 271, 16245-16252[Abstract/Free Full Text]
  6. Haas, M. (1994) Am. J. Physiol. 267, C869-C885[Abstract/Free Full Text]
  7. Lauf, P. K., Bauer, J., Adragna, N. C., Fujise, H., Zade-Oppen, A. M. M., Ryu, K. H., and Delpire, E. (1992) Am. J. Physiol. 263, C917-C932[Abstract/Free Full Text]
  8. Harling, H., Czaja, I., Shell, J., and Walden, R. (1997) EMBO J. 16, 5855-5866[CrossRef][Medline] [Order article via Infotrieve]
  9. Krarup, T., Jakobsen, L. D., Jensen, B. S., and Hoffmann, E. K. (1998) Am. J. Physiol. 275, C239-C250[Abstract/Free Full Text]
  10. Matthews, J. B., Awtrey, C. S., and Madara, J. L. (1992) J. Clin. Invest. 90, 1608-1613
  11. Zade-Oppen, A. M. M., and Lauf, P. K. (1990) J. Membr. Biol. 118, 143-151[CrossRef][Medline] [Order article via Infotrieve]
  12. Gibson, J. S., Speake, P. F., and Ellory, J. C. (1998) J. Physiol. (Lond.) 511, 225-234[Abstract/Free Full Text]
  13. Lauf, P. K. (1983) Am. J. Physiol. 245, C445-C448[Abstract/Free Full Text]
  14. Topper, J. N., Wasserman, S. M., Anderson, K. R., Cai, J., Falb, D., and Gimbrone, M. A., Jr. (1997) J. Clin. Invest. 99, 2941-2949[Medline] [Order article via Infotrieve]
  15. Matthews, J. B., Hassan, I., Meng, S., Archer, S. Y., Hrnjez, B. J., and Hodin, R. A. (1998) J. Clin. Invest. 101, 2072-2079[Medline] [Order article via Infotrieve]
  16. Moore-Hoon, M. L., and Turner, R. J. (1998) Biochem. Biophys. Res. Commun. 244, 15-19[CrossRef][Medline] [Order article via Infotrieve]
  17. Elslie, F. V., Rees, M., Williamson, M. P., Kerr, M., Kjeldsen, M. J., Pang, K. A., Sundqvist, A., Mögens, L. F., Chadwick, D., Richens, A., Covanis, A., Santos, M., Arzimanoglou, A., Panayiotopoulos, C. P., Curtis, D., Whitehouse, W. P., and Gardiner, R. N. (1997) Hum. Mol. Genet. 6, 1329-1334[Abstract/Free Full Text]
  18. Wall, R. T., Harker, L. A., Quadracci, L. J., and Striker, G. E. (1978) J. Cell. Physiol. 96, 203-213[CrossRef][Medline] [Order article via Infotrieve]
  19. Tomiyama, S, and Andoh, T. (1987) Manual for Monoclonal Antibody, pp. 178-179, Kodansha Scientific, Tokyo
  20. Callen, D. F., Baker, E., Eyre, H. J., Chernos, J. E., Bell, J. A., and Sutherland, G. R. (1990) Ann. Genet. 33, 219-221[Medline] [Order article via Infotrieve]
  21. Payne, J. A. (1997) Am. J. Physiol. 273, C1516-C1525[Abstract/Free Full Text]
  22. Kramhoft, B., Lambert, I. H., Hoffman, E. K., and Jorgensen, F. (1986) Am. J. Physiol. 251, C369-C379[Abstract/Free Full Text]
  23. Waltenberger, J., Claesson-Welsh, L., Siegbahn, A., Shibuya, M., and Heldin, C.-H. (1994) J. Biol. Chem. 269, 26988-26995[Abstract/Free Full Text]
  24. Folkman, J., and Shing, Y. (1992) J. Biol. Chem 267, 10931-10934[Free Full Text]
  25. Edwards, G., Dora, K. A., Gardener, M. J., Garland, C. J., and Weston, A. H. (1998) Nature 396, 269-272[CrossRef][Medline] [Order article via Infotrieve]
  26. Horne, M. C., Goolsby, G. L., Donaldson, K. L., Tran, D., Neubauer, M., and Wahl, A. F. (1996) J. Biol. Chem. 271, 6050-6061[Abstract/Free Full Text]
  27. Steinlein, O. K. (1998) Clin. Genet 54, 169-175[Medline] [Order article via Infotrieve]
  28. Flethcer, C. F., Lutz, C. M., O'Sullivan, T. N., Shaughnessy, J. D., Jr., Hawkes, R., Frankel, W. N., Copeland, N. G., and Jenkins, N. A. (1996) Cell 87, 607-617[CrossRef][Medline] [Order article via Infotrieve]
  29. Steinlein, O. K., Mulley, J. C., Propping, P., Wallace, R. H., Phillips, H. A., Sutherland, G. R., Scheffer, I. E., and Berkovic, S. F. (1995) Nat. Genet. 11, 201-203[CrossRef][Medline] [Order article via Infotrieve]
  30. Biervert, C., Schroeder, B. C., Kubisch, C., Berkovic, S. F., Propping, P., Jentsch, T. J., and Steinlein, O. K. (1998) Science 279, 403-406[Abstract/Free Full Text]
  31. Charlier, C., Singh, N. A., Ryan, S. G., Lewis, T. B., Reus, B. E., Leach, R. J., and Leppert, M. (1998) Nat. Genet. 18, 53-55[CrossRef][Medline] [Order article via Infotrieve]
  32. Singh, N. A., Charlier, C., Stauffer, D., Dupont, B. R., Leach, R. J., Melis, R., Ronen, G. M., Bijerre, I., Quattlebaum, T., Murphy, J. V., McHarg, M. L., Gagnon, D., Rosales, T. O., Peiffer, A., Anderson, V. E., and Leppert, M. (1998) Nat. Genet. 18, 25-29[CrossRef][Medline] [Order article via Infotrieve]


Copyright © 1999 by The American Society for Biochemistry and Molecular Biology, Inc.
Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
Am. J. Physiol. Renal Physiol.Home page
H. Castrop and J. Schnermann
Isoforms of renal Na-K-2Cl cotransporter NKCC2: expression and functional significance
Am J Physiol Renal Physiol, October 1, 2008; 295(4): F859 - F866.
[Abstract] [Full Text] [PDF]


Home page
Hum Mol GenetHome page
A. Salin-Cantegrel, M. Shekarabi, S. Holbert, P. Dion, D. Rochefort, J. Laganiere, S. Dacal, P. Hince, L. Karemera, C. Gaspar, et al.
HMSN/ACC truncation mutations disrupt brain-type creatine kinase-dependant activation of K+/Cl- co-transporter 3
Hum. Mol. Genet., September 1, 2008; 17(17): 2703 - 2711.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
Y.-M. Hsu, Y.-F. Chen, C.-Y. Chou, M.-J. Tang, J. H. Chen, R. J. Wilkins, J. C. Ellory, and M.-R. Shen
KCl Cotransporter-3 Down-regulates E-Cadherin/{beta}-Catenin Complex to Promote Epithelial-Mesenchymal Transition
Cancer Res., November 15, 2007; 67(22): 11064 - 11073.
[Abstract] [Full Text] [PDF]


Home page
NeurologyHome page
A. Salin-Cantegrel, J. -B. Riviere, N. Dupre, F. M. Charron, M. Shekarabi, L. Karemera, C. Gaspar, J. Horst, M. Tekin, G. Deda, et al.
Distal truncation of KCC3 in non French Canadian HMSN/ACC families
Neurology, September 25, 2007; 69(13): 1350 - 1355.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
C. F. Simard, M. J. Bergeron, R. Frenette-Cotton, G. A. Carpentier, M.-E. Pelchat, L. Caron, and P. Isenring
Homooligomeric and Heterooligomeric Associations between K+-Cl- Cotransporter Isoforms and between K+-Cl- and Na+-K+-Cl- Cotransporters
J. Biol. Chem., June 22, 2007; 282(25): 18083 - 18093.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
M. J. Bergeron, E. Gagnon, L. Caron, and P. Isenring
Identification of Key Functional Domains in the C Terminus of the K+-Cl- Cotransporters
J. Biol. Chem., June 9, 2006; 281(23): 15959 - 15969.
[Abstract] [Full Text] [PDF]


Home page
IOVSHome page
K.-S. N. Chee, J. Kistler, and P. J. Donaldson
Roles for KCC Transporters in the Maintenance of Lens Transparency
Invest. Ophthalmol. Vis. Sci., February 1, 2006; 47(2): 673 - 682.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
A. Mercado, V. Broumand, K. Zandi-Nejad, A. H. Enck, and D. B. Mount
A C-terminal Domain in KCC2 Confers Constitutive K+-Cl- Cotransport
J. Biol. Chem., January 13, 2006; 281(2): 1016 - 1026.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Renal Physiol.Home page
A. Mercado, N. Vazquez, L. Song, R. Cortes, A. H. Enck, R. Welch, E. Delpire, G. Gamba, and D. B. Mount
NH2-terminal heterogeneity in the KCC3 K+-Cl- cotransporter
Am J Physiol Renal Physiol, December 1, 2005; 289(6): F1246 - F1261.
[Abstract] [Full Text] [PDF]


Home page
Physiol. Rev.Home page
G. Gamba
Molecular Physiology and Pathophysiology of Electroneutral Cation-Chloride Cotransporters
Physiol Rev, April 1, 2005; 85(2): 423 - 493.
[Abstract] [Full Text] [PDF]


Home page
J. Physiol.Home page
J. A Fraser, C. E. J Rang, J. A Usher-Smith, and C. L.-H Huang
Slow volume transients in amphibian skeletal muscle fibres studied in hypotonic solutions
J. Physiol., April 1, 2005; 564(1): 51 - 63.
[Abstract] [Full Text] [PDF]


Home page
J. Physiol.Home page
C. Rivera, J. Voipio, and K. Kaila
Two developmental switches in GABAergic signalling: the K+-Cl- cotransporter KCC2 and carbonic anhydrase CAVII
J. Physiol., January 1, 2005; 562(1): 27 - 36.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
M.-R. Shen, A.-C. Lin, Y.-M. Hsu, T.-J. Chang, M.-J. Tang, S. L. Alper, J. C. Ellory, and C.-Y. Chou
Insulin-like Growth Factor 1 Stimulates KCl Cotransport, Which Is Necessary for Invasion and Proliferation of Cervical Cancer and Ovarian Cancer Cells
J. Biol. Chem., September 17, 2004; 279(38): 40017 - 40025.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
G.-P. Zhou, C. Wong, R. Su, S. C. Crable, K. P. Anderson, and P. G. Gallagher
Human potassium chloride cotransporter 1 (SLC12A4) promoter is regulated by AP-2 and contains a functional downstream promoter element
Blood, June 1, 2004; 103(11): 4302 - 4309.
[Abstract] [Full Text] [PDF]


Home page
J BiochemHome page
H. Ochiai, K. Higa, and H. Fujise
Molecular Identification of K-Cl Cotransporter in Dog Erythroid Progenitor Cells
J. Biochem., March 1, 2004; 135(3): 365 - 374.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
E. Gagnon, M. J. Bergeron, G. M. Brunet, N. D. Daigle, C. F. Simard, and P. Isenring
Molecular Mechanisms of Cl- Transport by the Renal Na+-K+-Cl- Cotransporter: IDENTIFICATION OF AN INTRACELLULAR LOCUS THAT MAY FORM PART OF A HIGH AFFINITY Cl--BINDING SITE
J. Biol. Chem., February 13, 2004; 279(7): 5648 - 5654.
[Abstract] [Full Text] [PDF]


Home page
J. Am. Soc. Nephrol.Home page
P. G.J.F. Starremans, F. F.J. Kersten, L. P.W.J. van den Heuvel, N. V.A.M. Knoers, and R. J.M. Bindels
Dimeric Architecture of the Human Bumetanide-Sensitive Na-K-Cl Co-transporter
J. Am. Soc. Nephrol., December 1, 2003; 14(12): 3039 - 3046.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
M.-R. Shen, C.-Y. Chou, K.-F. Hsu, Y.-M. Hsu, W.-T. Chiu, M.-J. Tang, S. L. Alper, and J. C. Ellory
KCl Cotransport Is an Important Modulator of Human Cervical Cancer Growth and Invasion
J. Biol. Chem., October 10, 2003; 278(41): 39941 - 39950.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Renal Physiol.Home page
H. Velazquez and T. Silva
Cloning and localization of KCC4 in rabbit kidney: expression in distal convoluted tubule
Am J Physiol Renal Physiol, July 1, 2003; 285(1): F49 - F58.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Renal Physiol.Home page
M. J. Bergeron, E. Gagnon, B. Wallendorff, J.-Y. Lapointe, and P. Isenring
Ammonium transport and pH regulation by K+-Cl- cotransporters
Am J Physiol Renal Physiol, July 1, 2003; 285(1): F68 - F78.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
J. C. de Jong, P. H. G. M. Willems, F. J. M. Mooren, L. P. W. J. van den Heuvel, N. V. A. M. Knoers, and R. J. M. Bindels
The Structural Unit of the Thiazide-sensitive NaCl Cotransporter Is a Homodimer
J. Biol. Chem., June 27, 2003; 278(27): 24302 - 24307.
[Abstract] [Full Text] [PDF]


Home page
J. Am. Soc. Nephrol.Home page
R. S. Hoover, E. Poch, A. Monroy, N. Vazquez, T. Nishio, G. Gamba, and S. C. Hebert
N-Glycosylation at Two Sites Critically Alters Thiazide Binding and Activity of the Rat Thiazide-sensitive Na+:Cl- Cotransporter
J. Am. Soc. Nephrol., February 1, 2003; 14(2): 271 - 282.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
K. Piechotta, J. Lu, and E. Delpire
Cation Chloride Cotransporters Interact with the Stress-related Kinases Ste20-related Proline-Alanine-rich Kinase (SPAK) and Oxidative Stress Response 1 (OSR1)
J. Biol. Chem., December 20, 2002; 277(52): 50812 - 50819.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Cell Physiol.Home page
H. Fujise, K. Higa, T. Kanemaru, M. Fukuda, N. C. Adragna, and P. K. Lauf
GSH depletion, K-Cl cotransport, and regulatory volume decrease in high-K/high-GSH dog red blood cells
Am J Physiol Cell Physiol, December 1, 2001; 281(6): C2003 - C2009.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
M.-R. Shen, C.-Y. Chou, K.-F. Hsu, H.-S. Liu, P. B. Dunham, E. J. Holtzman, and J. C. Ellory
The KCl cotransporter isoform KCC3 can play an important role in cell growth regulation
PNAS, November 20, 2001; (2001) 251388798.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
S. Casula, B. E. Shmukler, S. Wilhelm, A. K. Stuart-Tilley, W. Su, M. N. Chernova, C. Brugnara, and S. L. Alper
A Dominant Negative Mutant of the KCC1 K-Cl Cotransporter. BOTH N- AND C-TERMINAL CYTOPLASMIC DOMAINS ARE REQUIRED FOR K-Cl COTRANSPORT ACTIVITY
J. Biol. Chem., November 2, 2001; 276(45): 41870 - 41878.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Renal Physiol.Home page
G. Gamba
Alternative splicing and diversity of renal transporters
Am J Physiol Renal Physiol, November 1, 2001; 281(5): F781 - F794.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Cell Physiol.Home page
M. L. Jennings and M. F. Adame
Direct estimate of 1:1 stoichiometry of K+-Cl{-} cotransport in rabbit erythrocytes
Am J Physiol Cell Physiol, September 1, 2001; 281(3): C825 - C832.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Cell Physiol.Home page
A. Mercado, P. de los Heros, N. Vazquez, P. Meade, D. B. Mount, and G. Gamba
Functional and molecular characterization of the K-Cl cotransporter of Xenopus laevis oocytes
Am J Physiol Cell Physiol, August 1, 2001; 281(2): C670 - C680.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Cell Physiol.Home page
M. C. Muzyamba, P. F. Speake, and J. S. Gibson
Oxidants and regulation of K+-Cl- cotransport in equine red blood cells
Am J Physiol Cell Physiol, October 1, 2000; 279(4): C981 - C989.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Cell Physiol.Home page
K. Strange, T. D. Singer, R. Morrison, and E. Delpire
Dependence of KCC2 K-Cl cotransporter activity on a conserved carboxy terminus tyrosine residue
Am J Physiol Cell Physiol, September 1, 2000; 279(3): C860 - C867.
[Abstract] [Full Text] [PDF]


Home page
J. Neurosci.Home page
T. Q. Vu, J. A. Payne, and D. R. Copenhagen
Localization and Developmental Expression Patterns of the Neuronal K-Cl Cotransporter (KCC2) in the Rat Retina
J. Neurosci., February 15, 2000; 20(4): 1414 - 1423.
[Abstract] [Full Text] [PDF]


Home page
J. Exp. Biol.Home page
J. Gibson, A. Cossins, and J. Ellory
Oxygen-sensitive membrane transporters in vertebrate red cells
J. Exp. Biol., January 5, 2000; 203(9): 1395 - 1407.
[Abstract] [PDF]


Home page
Am. J. Physiol. Cell Physiol.Home page
J. E. Race, F. N. Makhlouf, P. J. Logue, F. H. Wilson, P. B. Dunham, and E. J. Holtzman
Molecular cloning and functional characterization of KCC3, a new K-Cl cotransporter
Am J Physiol Cell Physiol, December 1, 1999; 277(6): C1210 - C1219.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Cell Physiol.Home page
W. Su, B. E. Shmukler, M. N. Chernova, A. K. Stuart-Tilley, L. de Franceschi, C. Brugnara, and S. L. Alper
Mouse K-Cl cotransporter KCC1: cloning, mapping, pathological expression, and functional regulation
Am J Physiol Cell Physiol, November 1, 1999; 277(5): C899 - C912.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
L. Caron, F. Rousseau, E. Gagnon, and P. Isenring
Cloning and Functional Characterization of a Cation-Cl- Cotransporter-interacting Protein
J. Biol. Chem., October 6, 2000; 275(41): 32027 - 32036.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
A. Mercado, L. Song, N. Vazquez, D. B. Mount, and G. Gamba
Functional Comparison of the K+-Cl- Cotransporters KCC1 and KCC4
J. Biol. Chem., September 22, 2000; 275(39): 30326 - 30334.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
P. Sangan, S. R. Brill, S. Sangan, B. Forbush III, and H. J. Binder
Basolateral K-Cl Cotransporter Regulates Colonic Potassium Absorption in Potassium Depletion
J. Biol. Chem., September 29, 2000; 275(40): 30813 - 30816.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
M. Di Fulvio, T. M. Lincoln, P. K. Lauf, and N. C. Adragna
Protein Kinase G Regulates Potassium Chloride Cotransporter-3 Expression in Primary Cultures of Rat Vascular Smooth Muscle Cells
J. Biol. Chem., June 8, 2001; 276(24): 21046 - 21052.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
M. Di Fulvio, P. K. Lauf, and N. C. Adragna
Nitric Oxide Signaling Pathway Regulates Potassium Chloride Cotransporter-1 mRNA Expression in Vascular Smooth Muscle Cells
J. Biol. Chem., November 21, 2001; 276(48): 44534 - 44540.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
M.-R. Shen, C.-Y. Chou, K.-F. Hsu, H.-S. Liu, P. B. Dunham, E. J. Holtzman, and J. C. Ellory
The KCl cotransporter isoform KCC3 can play an important role in cell growth regulation
PNAS, December 4, 2001; 98(25): 14714 - 14719.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Hiki, K.
Right arrow Articles by Gamble, J. R.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Hiki, K.
Right arrow Articles by Gamble, J. R.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 All ASBMB Journals   Molecular and Cellular Proteomics 
 Journal of Lipid Research   ASBMB Today 
Copyright © 1999 by the American Society for Biochemistry and Molecular Biology.
Advertisement
spacer
Advertisement
Advertisement