|
J Biol Chem, Vol. 274, Issue 15, 10661-10667, April 9, 1999
Cloning, Characterization, and Chromosomal Location of a
Novel Human K+-Cl Cotransporter*
Kazuaki
Hiki §,
Richard J.
D'Andrea ¶,
Jill
Furze ,
Joanna
Crawford ,
Erica
Woollatt ,
Grant R.
Sutherland ,
Mathew A.
Vadas **, and
Jennifer R.
Gamble **
From the Department of Human Immunology, Hanson
Centre for Cancer Research, Institute of Medical and Veterinary Science
and University of Adelaide, Adelaide, South Australia 5000 and
Centre for Medical Genetics, Department of Cytogenetics and
Molecular Genetics, Women's and Children's Hospital, North Adelaide,
South Australia 5006, Australia
 |
ABSTRACT |
Differential display polymerase chain reaction
has been used to isolate genes regulated in vascular endothelial cells
by the angiogenic factor vascular endothelial cell growth factor
(VEGF). Analysis of one of the bands consistently up-regulated by VEGF led us to the identification of a cDNA from a human umbilical vein
endothelial cell library that is 77% identical to the human K+-Cl cotransporter1 (KCC1). We have
referred to the predicted protein as K+-Cl
cotransporter 3 (KCC3). Hydrophobicity analysis of the KCC3 amino acid
sequence showed an almost identical pattern to KCC1, suggesting 12 membrane-spanning segments, a large extracellular loop with potential
N-glycosylation sites, and cytoplasmic N- and C-terminal regions. The KCC3 mRNA was highly expressed in brain, heart,
skeletal muscle, and kidney, showing a distinct pattern and size from
KCC1 and KCC2. The KCC3 mRNA level in endothelial cells increased
on treatment with VEGF and decreased with the proinflammatory cytokine tumor necrosis factor , whereas KCC1 mRNA levels remained
unchanged. Stable overexpression of KCC3 cDNA in HEK293 cells
produced a glycoprotein of approximately 150 kDa, which was reduced to
120 kDa by glycosidase digestion. An increased initial uptake rate of
86Rb was seen in clones with high KCC3 expression, which
was dependent on extracellular Cl but not Na+
and was inhibitable by the loop diuretic agent furosemide. The KCC3
genomic localization was shown to be 15q13 by fluorescence in
situ hybridization. Radiation hybrid analysis placed KCC3 within an area associated with juvenile myoclonic epilepsy. These results suggest KCC3 is a new member of the KCC family that is under distinct regulation from KCC1.
 |
INTRODUCTION |
The cation chloride cotransporter
(CCC)1 family is involved in
the electroneutral movement of ions across the plasma membrane. There
are three CCC subclasses identified thus far on the basis of their
structures, ligands, and inhibitors. These are the thiazide-sensitive Na+-Cl cotransporters, the loop
diuretics-sensitive Na+-K+-Cl
(NKCC), and the K+-Cl cotransporters (KCC;
Refs. 1-5). NKCC and KCC have two isotypes. NKCC1 shows ubiquitous
distribution (3) among organs, whereas NKCC2 is restricted to kidney
(2). KCC1 is ubiquitous (4), whereas KCC2 is only found in brain (5).
In addition to the classical roles of transepithelial salt transport
(6) and the regulation of cellular volume (7), Harling et
al. (8) have recently shown that tobacco protoplast growth becomes
independent of the plant hormone, auxin, when NKCC1 is overexpressed,
suggesting the possible involvement of the CCC family in cell cycle regulation.
The physiological regulation of the NKCC and KCC family is complex.
Other than the electrochemical gradient of their ligands, evidence
suggests that activation of this passive transport system is regulated
by phosphorylation (9), cytoskeletal rearrangement (10), change of
intracellular Mg2+ concentration (6, 7), intracellular pH
(11), oxygen concentration (12), and cellular ATP levels (13). In
addition, some stimuli can mediate differential effects on various
members of the CCC family. For example, cell swelling activates KCC,
whereas cell shrinkage activates NKCC (6, 7). Phosphorylation activates NKCC, whereas KCC is activated by dephosphorylation (6, 7). In cultured
endothelial cells, transcriptional regulation has been reported for
NKCC1 in response to sheer stress and proinflammatory cytokines (14).
Cellular differentiation has also been shown to be associated with
changes in NKCC and KCC gene expression. In the intestinal epithelial
cell line HT29, a change of NKCC1 mRNA level during differentiation
has been reported (15, 16), whereas the loss of
K+-Cl flux during the maturation of sheep red
blood cells is well known (7).
We report here the isolation and cloning of a new member of the KCC
group of cotransporters, which we have named KCC3. KCC3 displays high
homology to KCC1, and the characteristics of the ion flux mediated by
KCC3 satisfies the criteria for a KCC. KCC3 is regulated at the
mRNA level by the angiogenic factor VEGF and by the proinflammatory
cytokine TNF , neither of which has any effect on KCC1 mRNA
levels. Finally, KCC3 has been localized to chromosome 15q13, a region
linked to the inherited disease juvenile myoclonic epilepsy (17).
 |
EXPERIMENTAL PROCEDURES |
HUVECs--
HUVECs were isolated as described previously (18).
The cells were cultured on gelatin-coated culture flasks in medium 199 with Eagle's salts supplemented with 20% fetal calf serum. After passage 1, the cells were grown in medium with 25 µg/ml endothelial cell growth factor (Collaborative Research) and 25 µg/ml heparin (Sigma). For the differential display, HUVECs were cultured in Opti-MEM
medium (Life Technologies, Inc.) with 2% fetal calf serum for 2 days.
Cytokine Stimulation--
HUVECs grown to approximately 70%
confluency in Opti-MEM were stimulated with 50 ng/ml VEGF 165 (R & D
Systems) and 25 µg/ml heparin for 4 h. For TNF stimulation,
HUVECs were grown in medium with 20% fetal calf serum and growth
factor, then treated for 4 h with 2 ng/ml TNF (R & D).
Differential Display PCR--
Primary culture HUVECs with or
without VEGF stimulation were lysed by Trizol reagent (Life
Technologies, Inc.). Total RNA was extracted using the manufacturer's
protocol and was treated with RNA clean kit (Genhunter) to remove
genomic DNA contamination. The RNA obtained was reverse-transcribed
using three classes of anchor primers provided in the RNA Image Kit
(Genhunter), and each of three cDNA pools were amplified on the
GeneAmp PCR system 2400 model (Perkin-Elmer) with a combination of
eight arbitrary primers and the same anchor primer used in reverse
transcription. This resulted in the generation of 24 amplicons from one
RNA sample. The primer-matched amplicons were electrophoresed side by
side in a 6% acrylamide gel. The bands that were consistently
regulated were retrieved from the gel, reamplified, and subcloned into
a pGEM-T vector (Promega) to be sequenced using Dye terminator cycle sequence kit and the autosequencer (Perkin-Elmer-Applied Bio).
Cloning and Sequencing of KCC3--
One of the bands
consistently up-regulated by VEGF treatment encoded a product whose DNA
sequence was 90% identical to human KCC1. We used this sequence as a
probe (7AV1 probe) to screen a gt10/HUVEC library (a gift from Dr.
Sawamura, Kyoto University). A 2.7-kb phage clone (clone 3) showed
significant homology to KCC1 (U55054 in GenBankTM/EBI data
bank). We further screened the library with a 5' sequence of clone 3 (3R probe, a PCR product using primers 5'-CATTGACGTTTGCTCTAAGACC and
5'-GTTTGATCCAGCCATGATACC, see Fig. 2A) to obtain a 2.1-kb clone (clone 9) that spanned a putative initiating ATG signal. Clone 3 and clone 9 shared an overlap of 1 kb including a BstB1 site, which
enabled us to construct a 3.7-kb cDNA with an open reading frame
for a 1099-amino acid protein (see Fig. 2A, KCC3 protein,
cDNA sequence deposited in GenBankTM data base,
accession number AF108831). Analysis of the nucleic acid and amino acid
sequences was carried out using the programs provided by ANGIS
(Australian National Genomic Information Service).
Northern Blot Analysis--
Total RNA was extracted from HUVECs
of primary and passaged cultures using Trizol reagent. Twenty µg of
total RNA was prepared and separated by electrophoresis in a 1%
agarose gel containing formaldehyde. RNA was transferred to Hybond N
(Amersham Pharmacia Biotech) membrane and UV-cross-linked. To produce a
specific KCC3 probe, we generated a 942-base pair PCR product using
KCC3-specific primers (GTCCCATCAAAGTTATG and GCAATAGCTTGTAGCAGCCTCG,
corresponding to amino acids 349-548). This segment of cDNA was
chosen because it had low homology to KCC1. After purification of this
product from agarose gel using Bresa Clean Kit (Bresatec), the fragment was labeled with [32P]dATP (Giga label kit, Bresatec) in
the presence of 1 ng/ml reverse primer to replace the random primers.
To produce a KCC1-specific probe, TGGGACCATTTTCCTGACC and
CATGCTTCTCCACGATGTCAC (corresponding to amino acids 254-394) were used
as forward and reverse primers, respectively, and the same protocol was
used. Hybridization was carried out with ExpressHyb hybridization
solution (CLONTECH). For studying tissue-specific
expression of KCC3, a human multiple tissue Northern blot
(CLONTECH) was hybridized to the KCC3-specific probe.
Preparation of KCC3-overexpressing Transfectants--
A FLAG
epitope-tagged full-length KCC3 cDNA expression construct was
produced. By PCR, a FLAG sequence of DYKDDDDK was added to the N
terminus of KCC3 using the following primers
(GAATTCATGGACTACAAGGACGACGACGACAAGATGCCACATTTTACTGTGACT and
CTCCCTTGGGTAGGTAATTA (corresponding to amino acids 1-403). The
PCR generated a 1-kb PCR product that was digested with XhoI and linked to the rest of the KCC3 sequence. The construct was introduced into the pcDNA zeo 3.1 mammalian expression vector (Invitrogen), which was introduced to HEK293 cells using LipofectAMINE (Life Technologies, Inc.). HEK293 cells were selected with 100 µg/ml
zeocin (Invitrogen), and colonies were picked to generate clonal populations.
Isotopic Flux Assays--
Transfected HEK 293 cells were grown
to confluency in 24-well dishes coated with poly-D-lysine.
Cells were washed twice with flux medium (135 mM NaCl, 3 mM glucose, 5 mM RbCl, 1 mM
CaCl2, 1 mM MgCl2, 1 mM
Na2HPO4, 2 mM
Na2SO4, 20 mM HEPES, pH 7.4, and 0.1 mM ouabain) and then incubated for 15 min at room
temperature with 400 µl of flux medium containing 1 mM
N-ethylmaleimide (ICN). One hundred µl of flux medium
containing 10 µCi/ml 86RbCl (Amersham Pharmacia Biotech)
was quickly added. Cells were incubated for 3 min before washing 3 times with ice-cold phosphate-buffered saline. For sodium-free
experiments, sodium was replaced by
N-methyl-D-glucamine (ICN), and for
chloride-free experiments, it was replaced by gluconate. Bumetanide
(Sigma) and furosemide (Sigma) were administered at the indicated
concentration at the start of the preincubation with
N-ethylmaleimide. Cells were lysed with 2% SDS and assayed for protein content using a BCA protein assay kit (Pierce) and for
86Rb using Cerenkov radiation in a scintillation counter.
Preparation of Anti-KCC3 Antibody and Protein
Detection--
Synthetic KCC peptide 1 (SQNSITGEHSQLLDD) and peptide 2 (AIFHSDDALKESAA) were linked to chicken albumin (Sigma) to immunize rabbits, and anti-KCC3 peptide antibodies (P1 antibody by peptide 1 and
P2 antibody by peptide 2) were prepared as described previously (19).
To digest KCC3 protein by N-glycanase F (Boehringer
Mannheim), immunoprecipitated KCC3 was incubated with 250 milliunits/ml
glycosidase overnight at 30 °C in the presence of 10% Nonidet
P-40.
Genomic Localization--
The KCC3 coding sequence in the pGEM4Z
vector was nick-translated with biotin-14-dATP and hybridized in
situ at a final concentration of 15 ng/ml to metaphases from two
normal males. The fluorescence in situ hybridization method
was modified from that previously described (20). Chromosomes were
stained before analysis with both propidium iodide (as counterstain)
and 4',6-diamino-2-phenylindole dihydrochloride (for chromosome
identification). For the radiation hybrid analysis, we performed a
screen of a medium resolution Stanford G3 panel of 83 clones to refine
the map position of the KCC3 gene. PCR amplification was carried out on
this panel using primers g5 (TGCCACATTTTACTGTGAC) and g6
(TCATCTGAATCCTGAATCC), both of which lie in the 5' region of KCC3 gene.
PCR results were analyzed using the radiation hybrid mapping facility
at the Stanford Human Genome Center.
 |
RESULTS |
Isolation and Analysis of a KCC3 cDNA--
In the differential
display PCR using total RNA extracted from 4-h VEGF-treated HUVECs, a
band was consistently up-regulated in experiments using three
independent pools of primary and passaged HUVECs as RNA sources. A
representative example of these differential displays is shown in Fig.
1. We have characterized this product and
generated a full-length cDNA from two overlapping clones (Fig. 2A). The cDNA sequence
shows high homology to KCC1 and encodes a predicted protein of 1099 amino acids. The primary amino acid sequence of this protein, which we
have named KCC3, is 77% identical to KCC1 and 73% identical to KCC2
(Fig. 3). Five N-glycosylation consensus sites are found in the large extracellular domain between the
5th and 6th membrane-spanning regions (Fig. 3). The hydropathy profile
(by Kyte-Doolittle analysis) of KCC3 was almost identical to that of
KCC1, predicting a protein with 12 membrane-spanning segments and large
intracellular N- and C-terminal domains (Fig. 2B).
Considerable diversity is seen, relative to KCC1, in the N-terminal
portion, the extracellular domain between the 3rd and 4th
membrane-spanning segments and the 5th and 6th membrane-spanning segments and in the area near the C terminus. KCC3 does not have a
glutamic acid residue at the beginning of the transmembrane domain 2. This residue has been suggested to be important for the enhanced
extracellular potassium binding in KCC2 (21).

View larger version (79K):
[in this window]
[in a new window]
|
Fig. 1.
Differential display PCR comparing
VEGF-stimulated and -unstimulated RNA populations. HT11A anchor
primer and AP7 arbitrary primer (RNA image kit, Genhunter) were used to
amplify cDNAs derived from primary HUVECs treated with VEGF
(VEGF) or without VEGF (ctrl). Amplicons from
each group were applied in duplicate. Consistently up-regulated bands
are indicated by an arrow. Similar up-regulation was seen in
three other independent experiments.
|
|

View larger version (19K):
[in this window]
[in a new window]
|
Fig. 2.
Schematic diagram of selected clones encoding
KCC3 and a predicted hydropathy profile. Panel A, map of
KCC3 cDNA. Clone 3 and clone 9 have an overlap of 1 kb that
contains a BstBI site used to construct a 3767-bp KCC3
cDNA. The coding region of KCC3 (3297 bp) is shown by the
filled box. The location of the two probes used for
screening is shown (3R and 7AV1). Panel B, hydropathy
profiles of KCC3 and KCC1. KCC3 and KCC1 peptide sequences were
analyzed using the Kyte-Doolittle algorithm in the PEPPROT program at
ANGIS.
|
|

View larger version (99K):
[in this window]
[in a new window]
|
Fig. 3.
Comparison of the primary structures of the
KCC family members. Identical amino acids are shaded.
Predicted transmembrane segments are highlighted by
lines above the KCC3 sequence. Consensus motifs for
N-glycosylation sites (Gly), casein II kinase
phosphorylation sites (C), and protein kinase C
phosphorylation sites (PK) are also shown above the
sequence. Multiple sequence alignment was performed using the PILEUP
and PRETTY BOX programs (ANGIS), and consensus sites were identified
with the MOTIF program at ANGIS.
|
|
Expression and Regulation of KCC3 mRNA--
Fig.
4A shows the tissue-specific
expression of KCC3. Unlike ubiquitously expressed KCC1 and
brain-restricted KCC2, strong expression of KCC3 was observed in brain,
heart, skeletal muscle, and kidney. Transcripts of approximately 9, 7.5, and 4.5 kb were detected (lanes 2, 3,
7, and 8 in Fig. 4A), and these showed
tissue-specific differences in abundance. KCC3 mRNA level increased
from as early as 1.5 h after VEGF administration, whereas KCC1
levels remained unchanged (Fig. 4B). This was true not only
in primary HUVECs but also in passaged cells (data not shown). We have
also used semiquantitative PCR to analyze the VEGF responsiveness and
have obtained results similar to the Northern blot data (not shown). It
has been reported that NKCC1 is up-regulated by TNF (14); however,
the KCC3 mRNA level showed a down-regulation in response to TNF ,
whereas KCC1 remained unchanged (Fig. 4B).

View larger version (42K):
[in this window]
[in a new window]
|
Fig. 4.
Distribution and regulation of the KCC3
mRNA. Panel A, tissue-specific expression of KCC3
mRNA. A multiple tissue Northern blot membrane
(CLONTECH) was probed with a KCC3-specific probe.
Lane 1, pancreas; lane 2, kidney; lane
3, skeletal muscle; lane 4, liver; lane 5,
lung; lane 6, placenta; lane 7, brain; lane
8, heart. Molecular size (kb) is indicated on the left.
Panel B, regulation of KCC3 mRNA level by VEGF and
TNF treatment. Primary culture HUVECs were treated for 1.5 h
with (VEGF) or without (ctrl) VEGF. Passaged
HUVECs were treated for 4 h with (TNF ) or without
(ctrl) TNF . Each membrane was probed with KCC3, KCC1, and
: glyceraldehyde-3-phosphate dehydrogenase (GAPDH) probes in
that order. The increase of the KCC3 mRNA observed by treatment
with VEGF is 1.8-fold, and the decrease by TNF is 52%. Two other
experiments showed similar results.
|
|
Detection of KCC3 Protein in HUVECs and in HEK293 Cells--
To
further analyze the KCC3 gene product, we have generated a KCC3
cDNA incorporating an N-terminal FLAG epitope (N-FLAG KCC3). We
have produced stable HEK293 cell lines overexpressing N-FLAG KCC3. The
FLAG-tagged protein, when immunoprecipitated with anti-FLAG antibody
(M2 antibody, Eastman Kodak Co.), was approximately150 kDa (Fig.
5A, lanes 1 and
2) and reduced to 120 kDa by digestion with glycosidase
treatment (Fig. 5B). Immunoprecipitation using M2 antibody
followed by Western blotting with anti-KCC3 synthetic peptide 1 antibody (P1 antibody, Fig. 5A, lanes 3 and
4) and immunoprecipitation using P1 antibody followed by
Western blotting with M2 antibody (Fig. 5A, lanes
5 and 6) gave the same results. These results were also
reproduced when we used P2 antibody instead of P1 antibody (data not
shown). KCC3 protein was also immunoprecipitated and blotted from
cultured HUVECs using P1 antibody (Fig. 5C).

View larger version (35K):
[in this window]
[in a new window]
|
Fig. 5.
Analysis of the KCC3 protein. Panel
A, detection of the KCC3 protein in HEK293 cells overexpressing
KCC3 (clone 847). Cells were lysed, and the KCC3 protein was
immunoprecipitated using anti-FLAG M2 antibody and blotted with M2
(lanes 1 and 2) or anti-KCC3 synthetic peptide1
antibody (P1 antibody, see "Experimental Procedures," lanes
3 and 4). In lanes 5 and 6, KCC3
was immunoprecipitated with P1 antibody and blotted with M2 antibody.
HEK293 cells overexpressing KCC3 were used in lanes 1,
3, and 5, and control HEK293 cells were used in
lanes 2, 4, and 6. Panel B,
glycosylation of KCC3 protein. KCC3 was immunoprecipitated from clone
847 cells with M2 antibody and digested overnight with
N-glycosidase F. F , before digestion; F+, after
digestion. Panel C, detection of the endogenous KCC3 protein
in HUVECs. Passage 3 HUVECs were lysed, and the KCC3 protein was
immunoprecipitated with control antibody (lane 1) or P1
antibody (lane 2) followed by Western blotting with P1
antibody.
|
|
Functional Characterization of KCC3--
We used a
86Rb uptake assay as a measure of K+ flux as
described elsewhere (4). When the FLAG sequence was added to the C terminus of KCC3, there was no measurable difference in
86Rb uptake between KCC3 clones and control populations
(data not shown). Therefore the N-FLAG KCC3 construct was used for the
functional analysis of KCC3. Expression of KCC3 in HEK293 cells was
confirmed after selection in zeocin by Western blotting using M2
antibody. The results for 1 clone (clone 847) are shown in Fig.
6, although similar results were seen in
5 other independent clones (data not shown). A 3-min assay was used
because in both control and transfectants, 86Rb uptake was
linear at least for the initial 15 min (data not shown). The results
shown in Fig. 6B demonstrate a significantly increased
furosemide-sensitive 86Rb uptake in clone 847 that
expresses a high level of KCC3 (Fig. 6A). The magnitude of
furosemide-sensitive 86Rb uptake was similar to that
reported for KCC1 (4), because our value of 10 cpm/µg of protein/3
min is equal to 3.2 nmol Rb/µg of protein/min. Such an increase was
not seen in clones that were zeocin-resistant but expressed a low level
of KCC3 (data not shown). The uptake was dependent on extracellular
Cl with little dependence on extracellular
Na+ (Fig. 6C). The loop diuretics furosemide and
bumetanide showed a dose-dependent inhibition of uptake
with furosemide slightly more effective than bumetanide
(Ki of approximately10 µM
versus 40 µM, Fig. 6D). The KCC3
transfectants did not show a significant increase in 86Rb
uptake in response to hypotonic treatment (data not shown). These
results show that KCC3 satisfies the functional criteria of the KCC
class of cotransporters.

View larger version (30K):
[in this window]
[in a new window]
|
Fig. 6.
Functional analysis of KCC3. Panel
A, expression of the KCC3 protein in clone 847 cells. KCC3 was
immunoprecipitated from either clone 847 (lane 1) or control
cells (lane 2) by M2 antibody followed by Western blotting
with P1 antibody. Panel B, demonstration of enhanced
86Rb uptake by KCC3-transfected HEK293 cells. HEK293 cells,
HEK293 cells transfected with blank vector (CTRL), and clone
847 were assayed for their 86Rb uptake after preincubation
with 1 mM N-ethylmaleimide. Values after
subtracting furosemide-insensitive 86Rb uptake are shown.
Values are shown as mean ±S.D. (n = 3). Two other
experiments showed similar results. Panel C, extracellular
Na+ independence and Cl dependence of KCC3.
Clone 847 cells were assayed for furosemide-sensitive 86Rb
uptake in the absence of extracellular Na+
(Na ) or Cl (Cl ,
n = 3). See "Experimental Procedures" for details.
Values are shown as mean ±S.D. Two other experiments showed similar
results. Panel D, sensitivity for loop diuretic agents.
Percent decrease of 86Rb uptake of clone 847 cells by
incremental concentration of furosemide (closed circle) and
bumetanide (open circle) are shown (n = 3).
Values are shown as mean ±S.D. Two other experiments showed similar
results.
|
|
Genomic Localization of KCC3--
Twenty-five metaphases from a
normal male were examined for fluorescent signal. All of these
metaphases showed a signal on one or both chromatids of chromosome 15 in the region 15q13 (Fig. 7). There was a
total of 2 nonspecific background dots observed in these 25 metaphases.
A similar result was obtained from hybridization of the probe to 15 metaphases from a second normal male (data not shown). Radiation hybrid
analysis indicated that KCC3 is most closely associated with the
chromosome 15 marker SHGC-33497 with a LOD score of 1000. Assessment of
flanking markers D15S1010 and D15S1040, using the integrated gene maps
available at NCBI, gave a result consistent with the localization of
KCC3 by fluorescence in situ hybridization analysis.

View larger version (77K):
[in this window]
[in a new window]
|
Fig. 7.
Fluorescence in situ
hybridization analysis with a KCC3 probe. Normal male
chromosomes were stained with propidium iodide and
4',6-diamino-2-phenylindole dihydrochloride before hybridization with a
KCC3 probe. This is a single metaphase spread of 40 that were analyzed.
All showed a similar hybridization pattern. Hybridization sites on
chromosome 15 are indicated by arrows.
|
|
 |
DISCUSSION |
We describe here the cloning of a new member of the CCC
family that is structurally closely related to the potassium chloride cotransporter KCC1 and that we therefore have named KCC3. The amino
acid sequence shows significant homology to other KCC family members
with overall amino acid identity between KCC1 and KCC3 being 77%.
There is a large predicted extracellular domain between the 5th and 6th
putative membrane-spanning regions that is common to the KCC family but
not observed in the NKCC family. Considerable diversity is observed in
the N-terminal portion and in the extracellular domains between the 3rd
and 4th and 5th and 6th putative membrane-spanning segments (Fig. 3).
It is also notable that there are four deletions in the C-terminal
region common to KCC1 and KCC3 that are not present in KCC2 (Fig. 3).
The C-terminal conserved portion appears important in its function as
addition of a FLAG epitope to the C terminus of KCC3 abolished the
uptake of 86Rb in our assay (data not shown). Furthermore,
Harling et al. (8) find that the C-terminal fragment of AXI
4, a plant CCC, is sufficient for establishing auxin-independent growth
of tobacco protoplast growth.
Overexpression of KCC3 in HEK293 cells allowed functional analysis
and demonstrated that KCC3 exhibits characteristics expected of a KCC.
86Rb flux was significantly increased in KCC3
transfectants. This increase was independent of extracellular
Na+ but dependent on extracellular Cl . This
and the fact that the 86Rb flux was measured in the
presence of the SH-reactive reagent N-ethylmaleimide (22),
which inhibits NKCC1 but activates KCC (4), suggest that NKCC1 is not a
major contributor in our assay. It is also considered unlikely that
KCC1 is responsible for all the 86Rb uptake observed in the
transfectants, because increased uptake was only seen in clones
expressing high levels of KCC3. Furthermore, in both KCC3-expressing
transfectants and control transfectants, the mRNA levels of KCC1
were equivalent (data not shown).
Analysis of multiple tissue blot Northern filters probed with a
KCC3-specific probe showed a tissue-specific expression pattern with
highest levels observed in kidney, skeletal muscle, heart, and brain.
This contrasted with the expression of KCC1, which is ubiquitous (4),
and KCC2, which is restricted to brain (5). Although the reason for the
selective tissue distribution is unknown, it suggests that KCC3 does
not serve a general housekeeping function such as cell volume
regulation as has been proposed for KCC1 (4). This is further supported
by the lack of detectable regulation of KCC3 activity in response to
alterations in osmolarity (data not shown).
At present we do not know the role of KCC3 in endothelial cells.
However, the responsiveness of this gene in HUVECs to VEGF suggests an
involvement in angiogenesis. It is tempting to speculate that the
up-regulation of KCC3 mRNA levels mediated by VEGF may be through
modulation of the cytoskeleton, which results in changes in cell shape
(23). Such changes have been reported to be one of the initial events
upon angiogenic stimulation (24), and changes of this type can also
affect the expression of the CCC members (7). Recently Edwards et
al. (25) reported that K+ released from endothelial
cells in response to acetylcholine stimulation caused hyperpolarization
and relaxation of smooth muscle cells through activation of the
Na-K-ATPase and Ba2+-sensitive K+ channel. Thus
K+ may also be important in the control of blood pressure.
Because the Na-K-ATPase generates the chemical gradient that drives
CCCs, it also implies that KCC3 may be involved in modulating the local K+ concentration.
We also observed a down-regulation of the KCC3 mRNA level in
response to TNF . Because NKCC1 is up-regulated by TNF (14), our
results suggest that KCC3 may be a functional counterpart of NKCC1.
Certainly KCC1 mRNA levels showed no change in response to TNF ,
supporting the idea that KCC3 and NKCC1 are coregulated in response to
TNF . NKCC1 has been reported to play a role downstream of the growth
hormone auxin in tobacco protoplasts (8), where it is involved in cell
cycle progression; therefore we speculate that KCC3 may also be
involved in cell cycle regulation. Interestingly, the tissue-specific
expression pattern of KCC3 resembles that of cyclin G1
(26), a cyclin involved in cell cycle arrest.
KCC3 has been localized to 15q13 and between the genetic markers
D15S1010 and D15S1040. This region has recently been linked to juvenile
myoclonic epilepsy (17), raising the possibility that KCC3 is a
candidate gene for this disease. Payne (21) has postulated that KCC2, a
brain-restricted KCC, acts as a neuronal Cl pump,
complementing other systems in regulating K+ homeostasis.
The concept is now emerging that the idiopathic epilepsies may
represent ion channel disorders (27) based on certain inherited forms
of epilepsy in mice (28), mutations in the 4 subunit of neuronal
nicotinic acetylcholine receptor responsible for autosomal dominant
nocturnal frontal lobe epilepsy (29), and benign familial neonatal
convulsions because of mutations of potassium channel gene (30-32).
Thus, we suggest that KCC3 may be a candidate gene for juvenile
myoclonic epilepsy worthy of further investigation.
 |
ACKNOWLEDGEMENTS |
We thank Dr. Yutaka Tagaya (NIH, Bethesda,
MD) for practical advice on performing differential display PCR and
interpretation of its pattern and Professor David Cook (Sydney
University) and Dr. Peter Little (Baker Institute Melbourne) for
helpful advice. We also thank the staff at the delivery rooms of the
Women's and Children's Hospital and Burnside War Memorial Hospital
Adelaide for collection of umbilical cords.
 |
FOOTNOTES |
*
This work was supported by grants from National Health and
Medical Research Council and the National Heart Foundation of
Australia.The costs of publication of this
article were defrayed in part by the
payment of page charges. The article
must therefore be hereby marked
"advertisement" in
accordance with 18 U.S.C. Section
1734 solely to indicate this fact.
§
Supported by Kyoto University and Ikadachi Hospital, Japan. Current
address: Dept. of Pharmacology, Faculty of Medicine, Kyoto University,
Yoshida Konoe Cho, Sakyo-ku, Kyoto 606 Japan.
¶
Supported by an HM Lloyd Senior Research Fellowship in
Oncology from the University of Adelaide.
**
These authors contributed equally to this paper.

To whom correspondence should be addressed: Dept. of Human
Immunology, Hanson Centre for Cancer Research, Institute of Medical and
Veterinary Science and University of Adelaide, Frome Rd., Adelaide, SA
5000, Australia. Tel.: 618--8222-3482; Fax: 618-8232-4092; E-mail:
jennifer.gamble{at}imvs.sa.gov.au.
 |
ABBREVIATIONS |
The abbreviations used are:
CCC, cation chloride
cotransporter;
NKCC, sodium potassium chloride cotransporter;
KCC, potassium chloride cotransporter;
VEGF, vascular endothelial cell
growth factor;
HUVEC, human umbilical vein endothelial cell;
PCR, polymerase chain reaction;
TNF , tumor necrosis factor ;
kb, kilobase(s).
 |
REFERENCES |
-
Gamba, G.,
Saltzberg, S. N.,
Lombardi, M.,
Miyanoshita, A.,
Lytton, J.,
Hediger, M. A.,
Brenner, B. M.,
and Herbert, S. C.
(1993)
Proc. Natl. Acad. Sci. U. S. A.
90,
2749-2753[Abstract/Free Full Text]
-
Gamba, G.,
Miyanoshita, A.,
Lombardi, M.,
Lytton, J.,
Lee, W. S.,
Hediger, M. A.,
and Herbert, S. C.
(1994)
J. Biol. Chem.
269,
17713-17722[Abstract/Free Full Text]
-
Xu, J. C.,
Lytle, C.,
Zhu, T. T.,
Payne, J. A.,
Benz, E., Jr.,
and Forbush, B., III
(1994)
Proc. Natl. Acad. Sci. U. S. A.
91,
2201-2205[Abstract/Free Full Text]
-
Gillen, C. M.,
Brill, S.,
Payne, J. A.,
and Forbush, B., III.
(1996)
J. Biol. Chem
271,
16237-16244[Abstract/Free Full Text]
-
Payne, J. A.,
Stevenson, T. J.,
and Donaldson, L. F.
(1996)
J. Biol. Chem.
271,
16245-16252[Abstract/Free Full Text]
-
Haas, M.
(1994)
Am. J. Physiol.
267,
C869-C885[Abstract/Free Full Text]
-
Lauf, P. K.,
Bauer, J.,
Adragna, N. C.,
Fujise, H.,
Zade-Oppen, A. M. M.,
Ryu, K. H.,
and Delpire, E.
(1992)
Am. J. Physiol.
263,
C917-C932[Abstract/Free Full Text]
-
Harling, H.,
Czaja, I.,
Shell, J.,
and Walden, R.
(1997)
EMBO J.
16,
5855-5866[CrossRef][Medline]
[Order article via Infotrieve]
-
Krarup, T.,
Jakobsen, L. D.,
Jensen, B. S.,
and Hoffmann, E. K.
(1998)
Am. J. Physiol.
275,
C239-C250[Abstract/Free Full Text]
-
Matthews, J. B.,
Awtrey, C. S.,
and Madara, J. L.
(1992)
J. Clin. Invest.
90,
1608-1613
-
Zade-Oppen, A. M. M.,
and Lauf, P. K.
(1990)
J. Membr. Biol.
118,
143-151[CrossRef][Medline]
[Order article via Infotrieve]
-
Gibson, J. S.,
Speake, P. F.,
and Ellory, J. C.
(1998)
J. Physiol. (Lond.)
511,
225-234[Abstract/Free Full Text]
-
Lauf, P. K.
(1983)
Am. J. Physiol.
245,
C445-C448[Abstract/Free Full Text]
-
Topper, J. N.,
Wasserman, S. M.,
Anderson, K. R.,
Cai, J.,
Falb, D.,
and Gimbrone, M. A., Jr.
(1997)
J. Clin. Invest.
99,
2941-2949[Medline]
[Order article via Infotrieve]
-
Matthews, J. B.,
Hassan, I.,
Meng, S.,
Archer, S. Y.,
Hrnjez, B. J.,
and Hodin, R. A.
(1998)
J. Clin. Invest.
101,
2072-2079[Medline]
[Order article via Infotrieve]
-
Moore-Hoon, M. L.,
and Turner, R. J.
(1998)
Biochem. Biophys. Res. Commun.
244,
15-19[CrossRef][Medline]
[Order article via Infotrieve]
-
Elslie, F. V.,
Rees, M.,
Williamson, M. P.,
Kerr, M.,
Kjeldsen, M. J.,
Pang, K. A.,
Sundqvist, A.,
Mögens, L. F.,
Chadwick, D.,
Richens, A.,
Covanis, A.,
Santos, M.,
Arzimanoglou, A.,
Panayiotopoulos, C. P.,
Curtis, D.,
Whitehouse, W. P.,
and Gardiner, R. N.
(1997)
Hum. Mol. Genet.
6,
1329-1334[Abstract/Free Full Text]
-
Wall, R. T.,
Harker, L. A.,
Quadracci, L. J.,
and Striker, G. E.
(1978)
J. Cell. Physiol.
96,
203-213[CrossRef][Medline]
[Order article via Infotrieve]
-
Tomiyama, S,
and Andoh, T.
(1987)
Manual for Monoclonal Antibody, pp. 178-179, Kodansha Scientific, Tokyo
-
Callen, D. F.,
Baker, E.,
Eyre, H. J.,
Chernos, J. E.,
Bell, J. A.,
and Sutherland, G. R.
(1990)
Ann. Genet.
33,
219-221[Medline]
[Order article via Infotrieve]
-
Payne, J. A.
(1997)
Am. J. Physiol.
273,
C1516-C1525[Abstract/Free Full Text]
-
Kramhoft, B.,
Lambert, I. H.,
Hoffman, E. K.,
and Jorgensen, F.
(1986)
Am. J. Physiol.
251,
C369-C379[Abstract/Free Full Text]
-
Waltenberger, J.,
Claesson-Welsh, L.,
Siegbahn, A.,
Shibuya, M.,
and Heldin, C.-H.
(1994)
J. Biol. Chem.
269,
26988-26995[Abstract/Free Full Text]
-
Folkman, J.,
and Shing, Y.
(1992)
J. Biol. Chem
267,
10931-10934[Free Full Text]
-
Edwards, G.,
Dora, K. A.,
Gardener, M. J.,
Garland, C. J.,
and Weston, A. H.
(1998)
Nature
396,
269-272[CrossRef][Medline]
[Order article via Infotrieve]
-
Horne, M. C.,
Goolsby, G. L.,
Donaldson, K. L.,
Tran, D.,
Neubauer, M.,
and Wahl, A. F.
(1996)
J. Biol. Chem.
271,
6050-6061[Abstract/Free Full Text]
-
Steinlein, O. K.
(1998)
Clin. Genet
54,
169-175[Medline]
[Order article via Infotrieve]
-
Flethcer, C. F.,
Lutz, C. M.,
O'Sullivan, T. N.,
Shaughnessy, J. D., Jr.,
Hawkes, R.,
Frankel, W. N.,
Copeland, N. G.,
and Jenkins, N. A.
(1996)
Cell
87,
607-617[CrossRef][Medline]
[Order article via Infotrieve]
-
Steinlein, O. K.,
Mulley, J. C.,
Propping, P.,
Wallace, R. H.,
Phillips, H. A.,
Sutherland, G. R.,
Scheffer, I. E.,
and Berkovic, S. F.
(1995)
Nat. Genet.
11,
201-203[CrossRef][Medline]
[Order article via Infotrieve]
-
Biervert, C.,
Schroeder, B. C.,
Kubisch, C.,
Berkovic, S. F.,
Propping, P.,
Jentsch, T. J.,
and Steinlein, O. K.
(1998)
Science
279,
403-406[Abstract/Free Full Text]
-
Charlier, C.,
Singh, N. A.,
Ryan, S. G.,
Lewis, T. B.,
Reus, B. E.,
Leach, R. J.,
and Leppert, M.
(1998)
Nat. Genet.
18,
53-55[CrossRef][Medline]
[Order article via Infotrieve]
-
Singh, N. A.,
Charlier, C.,
Stauffer, D.,
Dupont, B. R.,
Leach, R. J.,
Melis, R.,
Ronen, G. M.,
Bijerre, I.,
Quattlebaum, T.,
Murphy, J. V.,
McHarg, M. L.,
Gagnon, D.,
Rosales, T. O.,
Peiffer, A.,
Anderson, V. E.,
and Leppert, M.
(1998)
Nat. Genet.
18,
25-29[CrossRef][Medline]
[Order article via Infotrieve]
Copyright © 1999 by The American Society for Biochemistry and Molecular Biology, Inc.

CiteULike Complore Connotea Del.icio.us Digg Reddit Technorati What's this?
This article has been cited by other articles:

|
 |

|
 |
 
H. Castrop and J. Schnermann
Isoforms of renal Na-K-2Cl cotransporter NKCC2: expression and functional significance
Am J Physiol Renal Physiol,
October 1, 2008;
295(4):
F859 - F866.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. Salin-Cantegrel, M. Shekarabi, S. Holbert, P. Dion, D. Rochefort, J. Laganiere, S. Dacal, P. Hince, L. Karemera, C. Gaspar, et al.
HMSN/ACC truncation mutations disrupt brain-type creatine kinase-dependant activation of K+/Cl- co-transporter 3
Hum. Mol. Genet.,
September 1, 2008;
17(17):
2703 - 2711.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
Y.-M. Hsu, Y.-F. Chen, C.-Y. Chou, M.-J. Tang, J. H. Chen, R. J. Wilkins, J. C. Ellory, and M.-R. Shen
KCl Cotransporter-3 Down-regulates E-Cadherin/{beta}-Catenin Complex to Promote Epithelial-Mesenchymal Transition
Cancer Res.,
November 15, 2007;
67(22):
11064 - 11073.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. Salin-Cantegrel, J. -B. Riviere, N. Dupre, F. M. Charron, M. Shekarabi, L. Karemera, C. Gaspar, J. Horst, M. Tekin, G. Deda, et al.
Distal truncation of KCC3 in non French Canadian HMSN/ACC families
Neurology,
September 25, 2007;
69(13):
1350 - 1355.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
C. F. Simard, M. J. Bergeron, R. Frenette-Cotton, G. A. Carpentier, M.-E. Pelchat, L. Caron, and P. Isenring
Homooligomeric and Heterooligomeric Associations between K+-Cl- Cotransporter Isoforms and between K+-Cl- and Na+-K+-Cl- Cotransporters
J. Biol. Chem.,
June 22, 2007;
282(25):
18083 - 18093.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. J. Bergeron, E. Gagnon, L. Caron, and P. Isenring
Identification of Key Functional Domains in the C Terminus of the K+-Cl- Cotransporters
J. Biol. Chem.,
June 9, 2006;
281(23):
15959 - 15969.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
K.-S. N. Chee, J. Kistler, and P. J. Donaldson
Roles for KCC Transporters in the Maintenance of Lens Transparency
Invest. Ophthalmol. Vis. Sci.,
February 1, 2006;
47(2):
673 - 682.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. Mercado, V. Broumand, K. Zandi-Nejad, A. H. Enck, and D. B. Mount
A C-terminal Domain in KCC2 Confers Constitutive K+-Cl- Cotransport
J. Biol. Chem.,
January 13, 2006;
281(2):
1016 - 1026.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. Mercado, N. Vazquez, L. Song, R. Cortes, A. H. Enck, R. Welch, E. Delpire, G. Gamba, and D. B. Mount
NH2-terminal heterogeneity in the KCC3 K+-Cl- cotransporter
Am J Physiol Renal Physiol,
December 1, 2005;
289(6):
F1246 - F1261.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
G. Gamba
Molecular Physiology and Pathophysiology of Electroneutral Cation-Chloride Cotransporters
Physiol Rev,
April 1, 2005;
85(2):
423 - 493.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. A Fraser, C. E. J Rang, J. A Usher-Smith, and C. L.-H Huang
Slow volume transients in amphibian skeletal muscle fibres studied in hypotonic solutions
J. Physiol.,
April 1, 2005;
564(1):
51 - 63.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
C. Rivera, J. Voipio, and K. Kaila
Two developmental switches in GABAergic signalling: the K+-Cl- cotransporter KCC2 and carbonic anhydrase CAVII
J. Physiol.,
January 1, 2005;
562(1):
27 - 36.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M.-R. Shen, A.-C. Lin, Y.-M. Hsu, T.-J. Chang, M.-J. Tang, S. L. Alper, J. C. Ellory, and C.-Y. Chou
Insulin-like Growth Factor 1 Stimulates KCl Cotransport, Which Is Necessary for Invasion and Proliferation of Cervical Cancer and Ovarian Cancer Cells
J. Biol. Chem.,
September 17, 2004;
279(38):
40017 - 40025.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
G.-P. Zhou, C. Wong, R. Su, S. C. Crable, K. P. Anderson, and P. G. Gallagher
Human potassium chloride cotransporter 1 (SLC12A4) promoter is regulated by AP-2 and contains a functional downstream promoter element
Blood,
June 1, 2004;
103(11):
4302 - 4309.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
H. Ochiai, K. Higa, and H. Fujise
Molecular Identification of K-Cl Cotransporter in Dog Erythroid Progenitor Cells
J. Biochem.,
March 1, 2004;
135(3):
365 - 374.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
E. Gagnon, M. J. Bergeron, G. M. Brunet, N. D. Daigle, C. F. Simard, and P. Isenring
Molecular Mechanisms of Cl- Transport by the Renal Na+-K+-Cl- Cotransporter: IDENTIFICATION OF AN INTRACELLULAR LOCUS THAT MAY FORM PART OF A HIGH AFFINITY Cl--BINDING SITE
J. Biol. Chem.,
February 13, 2004;
279(7):
5648 - 5654.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
P. G.J.F. Starremans, F. F.J. Kersten, L. P.W.J. van den Heuvel, N. V.A.M. Knoers, and R. J.M. Bindels
Dimeric Architecture of the Human Bumetanide-Sensitive Na-K-Cl Co-transporter
J. Am. Soc. Nephrol.,
December 1, 2003;
14(12):
3039 - 3046.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M.-R. Shen, C.-Y. Chou, K.-F. Hsu, Y.-M. Hsu, W.-T. Chiu, M.-J. Tang, S. L. Alper, and J. C. Ellory
KCl Cotransport Is an Important Modulator of Human Cervical Cancer Growth and Invasion
J. Biol. Chem.,
October 10, 2003;
278(41):
39941 - 39950.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
H. Velazquez and T. Silva
Cloning and localization of KCC4 in rabbit kidney: expression in distal convoluted tubule
Am J Physiol Renal Physiol,
July 1, 2003;
285(1):
F49 - F58.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. J. Bergeron, E. Gagnon, B. Wallendorff, J.-Y. Lapointe, and P. Isenring
Ammonium transport and pH regulation by K+-Cl- cotransporters
Am J Physiol Renal Physiol,
July 1, 2003;
285(1):
F68 - F78.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. C. de Jong, P. H. G. M. Willems, F. J. M. Mooren, L. P. W. J. van den Heuvel, N. V. A. M. Knoers, and R. J. M. Bindels
The Structural Unit of the Thiazide-sensitive NaCl Cotransporter Is a Homodimer
J. Biol. Chem.,
June 27, 2003;
278(27):
24302 - 24307.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
R. S. Hoover, E. Poch, A. Monroy, N. Vazquez, T. Nishio, G. Gamba, and S. C. Hebert
N-Glycosylation at Two Sites Critically Alters Thiazide Binding and Activity of the Rat Thiazide-sensitive Na+:Cl- Cotransporter
J. Am. Soc. Nephrol.,
February 1, 2003;
14(2):
271 - 282.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
K. Piechotta, J. Lu, and E. Delpire
Cation Chloride Cotransporters Interact with the Stress-related Kinases Ste20-related Proline-Alanine-rich Kinase (SPAK) and Oxidative Stress Response 1 (OSR1)
J. Biol. Chem.,
December 20, 2002;
277(52):
50812 - 50819.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
H. Fujise, K. Higa, T. Kanemaru, M. Fukuda, N. C. Adragna, and P. K. Lauf
GSH depletion, K-Cl cotransport, and regulatory volume decrease in high-K/high-GSH dog red blood cells
Am J Physiol Cell Physiol,
December 1, 2001;
281(6):
C2003 - C2009.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M.-R. Shen, C.-Y. Chou, K.-F. Hsu, H.-S. Liu, P. B. Dunham, E. J. Holtzman, and J. C. Ellory
The KCl cotransporter isoform KCC3 can play an important role in cell growth regulation
PNAS,
November 20, 2001;
(2001)
251388798.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. Casula, B. E. Shmukler, S. Wilhelm, A. K. Stuart-Tilley, W. Su, M. N. Chernova, C. Brugnara, and S. L. Alper
A Dominant Negative Mutant of the KCC1 K-Cl Cotransporter. BOTH N- AND C-TERMINAL CYTOPLASMIC DOMAINS ARE REQUIRED FOR K-Cl COTRANSPORT ACTIVITY
J. Biol. Chem.,
November 2, 2001;
276(45):
41870 - 41878.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
G. Gamba
Alternative splicing and diversity of renal transporters
Am J Physiol Renal Physiol,
November 1, 2001;
281(5):
F781 - F794.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. L. Jennings and M. F. Adame
Direct estimate of 1:1 stoichiometry of K+-Cl{-} cotransport in rabbit erythrocytes
Am J Physiol Cell Physiol,
September 1, 2001;
281(3):
C825 - C832.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. Mercado, P. de los Heros, N. Vazquez, P. Meade, D. B. Mount, and G. Gamba
Functional and molecular characterization of the K-Cl cotransporter of Xenopus laevis oocytes
Am J Physiol Cell Physiol,
August 1, 2001;
281(2):
C670 - C680.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. C. Muzyamba, P. F. Speake, and J. S. Gibson
Oxidants and regulation of K+-Cl- cotransport in equine red blood cells
Am J Physiol Cell Physiol,
October 1, 2000;
279(4):
C981 - C989.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
K. Strange, T. D. Singer, R. Morrison, and E. Delpire
Dependence of KCC2 K-Cl cotransporter activity on a conserved carboxy terminus tyrosine residue
Am J Physiol Cell Physiol,
September 1, 2000;
279(3):
C860 - C867.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
T. Q. Vu, J. A. Payne, and D. R. Copenhagen
Localization and Developmental Expression Patterns of the Neuronal K-Cl Cotransporter (KCC2) in the Rat Retina
J. Neurosci.,
February 15, 2000;
20(4):
1414 - 1423.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. Gibson, A. Cossins, and J. Ellory
Oxygen-sensitive membrane transporters in vertebrate red cells
J. Exp. Biol.,
January 5, 2000;
203(9):
1395 - 1407.
[Abstract]
[PDF]
|
 |
|

|
 |

|
 |
 
J. E. Race, F. N. Makhlouf, P. J. Logue, F. H. Wilson, P. B. Dunham, and E. J. Holtzman
Molecular cloning and functional characterization of KCC3, a new K-Cl cotransporter
Am J Physiol Cell Physiol,
December 1, 1999;
277(6):
C1210 - C1219.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
W. Su, B. E. Shmukler, M. N. Chernova, A. K. Stuart-Tilley, L. de Franceschi, C. Brugnara, and S. L. Alper
Mouse K-Cl cotransporter KCC1: cloning, mapping, pathological expression, and functional regulation
Am J Physiol Cell Physiol,
November 1, 1999;
277(5):
C899 - C912.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
L. Caron, F. Rousseau, E. Gagnon, and P. Isenring
Cloning and Functional Characterization of a Cation-Cl- Cotransporter-interacting Protein
J. Biol. Chem.,
October 6, 2000;
275(41):
32027 - 32036.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. Mercado, L. Song, N. Vazquez, D. B. Mount, and G. Gamba
Functional Comparison of the K+-Cl- Cotransporters KCC1 and KCC4
J. Biol. Chem.,
September 22, 2000;
275(39):
30326 - 30334.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
P. Sangan, S. R. Brill, S. Sangan, B. Forbush III, and H. J. Binder
Basolateral K-Cl Cotransporter Regulates Colonic Potassium Absorption in Potassium Depletion
J. Biol. Chem.,
September 29, 2000;
275(40):
30813 - 30816.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. Di Fulvio, T. M. Lincoln, P. K. Lauf, and N. C. Adragna
Protein Kinase G Regulates Potassium Chloride Cotransporter-3 Expression in Primary Cultures of Rat Vascular Smooth Muscle Cells
J. Biol. Chem.,
June 8, 2001;
276(24):
21046 - 21052.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. Di Fulvio, P. K. Lauf, and N. C. Adragna
Nitric Oxide Signaling Pathway Regulates Potassium Chloride Cotransporter-1 mRNA Expression in Vascular Smooth Muscle Cells
J. Biol. Chem.,
November 21, 2001;
276(48):
44534 - 44540.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M.-R. Shen, C.-Y. Chou, K.-F. Hsu, H.-S. Liu, P. B. Dunham, E. J. Holtzman, and J. C. Ellory
The KCl cotransporter isoform KCC3 can play an important role in cell growth regulation
PNAS,
December 4, 2001;
98(25):
14714 - 14719.
[Abstract]
[Full Text]
[PDF]
|
 |
|
Copyright © 1999 by the American Society for Biochemistry and Molecular Biology.
|
Advertisement
Advertisement
|