![]()
|
|
||||||||
J Biol Chem, Vol. 274, Issue 15, 9984-9992, April 9, 1999
1 and
3 and a
Third New Ligand to the Type I Receptor ALK-1*
§,
, and
**
From the
Department of Genetics, Duke University
Medical Center, Durham, North Carolina 27710 and the
¶ Department of Anatomy and Cell Biology, University of Toronto,
Toronto, Ontario M5S 1A8, Canada
| |
ABSTRACT |
|---|
|
|
|---|
Germ line mutations in one of two distinct genes,
endoglin or ALK-1, cause hereditary hemorrhagic
telangiectasia (HHT), an autosomal dominant disorder of localized
angiodysplasia. Both genes encode endothelial cell receptors for the
transforming growth factor Hereditary hemorrhagic telangiectasia
(HHT),1 or Osler-Rendu-Weber
disease, is an autosomal dominant disorder characterized by localized
angiodysplasia (1). Mutations have been identified in two genes,
endoglin and ALK-1 that can cause HHT (2, 3). The scope and
variety of mutations identified in the endoglin gene (2, 4-8) and the
ALK-1 gene (3, 9, 10), as well as RNA and protein expression
analyses, suggest that the majority of these represent null alleles and
that the disease phenotype is the result of inherited
haploinsufficiency for either endoglin or ALK-1.
By sequence homologies, endoglin and ALK-1 are thought to be
endothelial cell receptors for members of the TGF- Models for TGF- Currently, seven mammalian type I receptors have been cloned. For the
majority of these, ligands and corresponding type II receptors have
been identified. ALK-4 is an activin type I receptor, ActR-IB (22-24).
ALK-3 and ALK-6 are the BMP type I receptors BMPR-IA and BMPR-IB,
respectively (24, 25). ALK-2 is an activin and BMP type I receptor (13,
26). ALK-5 is the TGF- The ligand and corresponding type II receptor(s) for ALK-1 are also
unknown. In the presence of the TGF- Signaling assays have been devised for other receptors in this
superfamily. In Mv1Lu cells, T Endoglin is thought to be a TGF- Cell Lines--
All cell media and fetal bovine serum (FBS) were
obtained by Life Technologies, Inc. COS-1 cells, a gift by Dr. B. Cullen (Duke University, Durham, NC), were cultured in modified
Dulbecco's medium + 5% FBS. R-1B and DR-26 cells were derived in
earlier studies by chemical mutagenesis of Mv1Lu cells (42, 43). Cells were maintained in minimal essential medium (MEM) containing
nonessential amino acids (NEAA) and 10% FBS. All cell lines were
cultured at 37 °C in a 5% CO2 environment.
Antibodies and Cytokines--
Rabbit antiserum against endoglin
and ALK-1 was prepared against part of the endoglin extracellular
domain, encoded by exons 2-5, and the entire ALK-1 extracellular
domain except for the leading sequence. Briefly, the corresponding
cDNAs were cloned into the bacterial expression vector pET-15b
(Novagen) behind a 6× His tag and expressed in bacteria. Bacteria were
lysed, and recombinant proteins were purified over a
nickel-nitrilotriacetic acid column (Qiagen). The column-purified
recombinant proteins were then separated over a SDS-PAGE, cut out, and
electroeluted. The eluted antigen was mixed with Freund's adjuvant and
used to immunize rabbits. The anti-endoglin and anti-ALK-1 rabbit serum were tested in Western blots detecting endoglin and ALK-1 only in those
cells (COS cells) that were transfected with an endoglin or ALK-1
expression construct. Western blot immunostaining with the rabbit
preimmune serum showed no specificity.
Proteins tagged with the HA epitope of the influenza virus
hemagglutinin were detected in immunoblots with a monoclonal antibody. The antibody (12CA5) was obtained from the supernatant of a mouse hybridoma cell line expressing and secreting the monoclonal antibody. Polyclonal anti-TGF-
TGF- Chimeric and Wild-type Receptors--
All cDNAs of the
different receptors and chimeric receptors were cloned into the
mammalian expression vector pCMV5. All constructs, except for endoglin,
have a C-terminal HA epitope tag. Two ALK-1 constructs were used, one
with an HA tag and one without, which will be indicated in the text.
The ALK-1, T
To construct the chimeric type I receptors that were swapped in the GS
domain, we had to introduce a new unique restriction site,
AccIII, in each receptor cDNA sequence, which does not
alter the amino acid sequence in the GS domain. The receptor cDNAs
ALK-1, T
A second set of chimeric receptors was constructed, containing the
extracellular domain of ALK-1 or ALK-3 and the transmembrane domain and
cytoplasmic domain of T
Extracellular HHT patient mutations were introduced in the
ALK-1/T Immunoprecipitation and Western Blot--
COS cells were
cultured in 6-well plates to 70-80% confluence. The LipofectAMINE
method was used for transfections according to the manufacturer's
instruction (Life Technologies, Inc.). Briefly, cells were transfected
with the following: (a) 2 µg of pCMV5; (b) 1 µg of receptor cDNA and 1 µg of pCMV5; or (c) in
co-transfections of two different receptor cDNAs 1 µg of each.
After 2 days post-transfection, cells were lysed in 500 µl of lysis
buffer (50 mM Tris-HCl (pH 7.5), 150 mM NaCl,
0.5% Nonidet P-40, 50 mM NaF, 1 mM
Na3VO4, 1 mM dithiothreitol, 1 mM phenylmethylsulfonyl fluoride, 2.5 µg/ml leupeptin,
2.5 µg/ml aprotinin, 1 mM benzamidine, 10 µg/ml trypsin inhibitor) at 4 °C for 30 min. The lysate was then clarified by centrifugation in a microcentrifuge, and 20 µl were stored away for
later analysis. The remaining cell lysate was precleared with 50 µl
of protein A-Sepharose (Amersham Pharmacia Biotech (resolved in lysis
buffer (w/v)) for 3 h. The precleared lysate was incubated at
4 °C with 10 µl of polyclonal antibody (endoglin or ALK-1 rabbit anti-serum) or 20 µl of monoclonal antibody (cell culture
supernatant). After at least 3 h 20 µl of protein A-Sepharose
was added for additional 3 h. The protein A-Sepharose
immunocomplex was then washed three times in 500 µl of lysis buffer
and resolved in 15 µl of Laemmli buffer. The precipitated proteins
were separated by SDS-PAGE and blotted to a nitrocellulose membrane
(BioBlot-NC, Costar) for immunodetection with the indicated antibody.
Immunodetection was performed with the ECLTM Western
blotting analysis system (Amersham Pharmacia Biotech) according to the
manufacturer's instruction.
Luciferase Reporter Assay--
For luciferase expression assays,
the R-1B and DR-26 cells were transiently transfected with p3TP-Lux
(32), the indicated receptor cDNA in pCMV5, pCMV5 alone, or both.
The pSV- Primers--
The following primers were used in the
constructions: 1 (ALK-1Acc3),
5'-GGGAGTGGCTCCGGACTCCCCTTCC-3'; 2 (TbR-IAcc3),
5'-GGTTCTGGCTCCGGATTACCATTGC-3'; 3 (ActR-IBAcc3),
5'-GGGTCTGGCTCCGGATTACCCCTCT-3'; 4 (ALK-3Acc3),
5'-GTAGTGGGTCCGGACTACCT-3'; 5 (ALK-1MscI/TbR-I),
5'-CAGATGGCCA(G/C)TGGCAGCTGTCATTGCTGGACC-3'; 6 (ALK-3BsmI/TbR-I), 5'-GGCAGCATTCG(A/C)TGGCAGCTGTCATTGCTGGA;
7, 5'-CTACCTGCCGGGGGGGCCTGGTGCAC-'3; 8, 5'-GTGCACCAGGCCCCCCCGGCAGGTAG-'3; 9, 5'-CGGGGGGCCTGTTGCACAGTAGTGCTG-'3; 10, 5'-CAGCACTACTGTGCAACAGGCCCCCCG-'3; 11, 5'-CGGGGGGCCTGGTACACAGTAGTGC-'3; 12, 5'-GCACTACTGTGTACCAGGCCCCCCG-'3;
13, 5'-CCGCAGCCCTGATGTTCCTG-'3; 14, 5'-CAGGAACATCAGGGCTGCGG-'3.
Test of the Chimeric Receptor Signaling Assay--
Since the
ligand and type II receptor for ALK-1 are not known, a signaling assay
for ALK-1 activity is not currently available. We sought to develop a
signaling assay involving chimeric receptors. As an initial test, we
created chimeric receptors which we surmised would be able to transmit
a signal. ALK-3 is the receptor for BMP-2 and to a lesser extent BMP-7,
but does not signal in the p3TP-Lux reporter assay. Thus we created a
chimeric ALK-3 receptor by exchanging the ALK-3 cytoplasmic domain with
the corresponding T Effect of BMP and Activin A on the ALK-1 Chimeric
Receptors--
Since the BMPs could induce a signal via the ALK-3
chimeras, we next examined BMP-induced signaling with chimeras
containing the extracellular domain of ALK-1 (Fig. 1). None of the
ALK-1 constructs were able to transmit a signal in either R-1B cells (not shown) or DR-26 cells (Fig. 2A). However, the ALK-1
chimeras, even in the absence of any ligand, exhibited a 2-3-fold
increase in basal luciferase activity. This ligand-independent high
basal activity was observed in nearly all subsequent experiments with the ALK-1 chimeras. Despite this background, the lack of BMP-2 or
BMP-7-induced signaling for the ALK-1 chimeras indicates that neither
are ligands for ALK-1.
We next examined activin A-induced signaling in the assay.
Mock-transfected cells (empty vector) showed a 4-fold increase of
luciferase activity after activin A incubation (Fig. 2B),
presumably due to the presence of the endogenous ActR-IB receptor (23). Despite this background level of activity, cells transfected with wild-type ActR-IB showed a 12-fold increase over background, and the
ActR-IB/T Effect of TGF-
One of the controls, T Receptor Complexes with Endoglin and ALK-1--
Since endoglin and
ALK-1 show the same TGF-
Similar immunoprecipitations with endoglin and T
In order to identify ALK-1 interactions with type II receptors, cells
were co-transfected with combinations of either ALK-1 and T Human Serum Contains an Unknown Ligand for ALK-1--
In an effort
to identify a ligand for ALK-1, we also examined human serum as a
source of ligand in the signaling assay. All three ALK-1 chimeras
transfected into either R-1B or DR-26 cells showed a
dosage-dependent increase in induction of luciferase activity which reaches a plateau at 20% serum (Fig.
5A). In order to determine if
this response was due to TGF-
In addition, when DR-26 cells were transfected only with T
Inhibin A is similar to activin, present in serum, and binds to ActR-II
(49-51). Since we have shown that ActR-II can be found in a complex
with ALK-1, and DR-26 cells express the endogenous activin type II
receptor, the observed serum response may be induced by inhibin A via
an ActR-II·ALK-1 chimera receptor complex. However, inhibin A was
also unable to induce signaling via the ALK-1 chimeras (Fig.
5D).
Effect of HHT-associated Patient Mutations on ALK-1
Signaling--
To examine further the presence of an ALK-1 ligand in
serum, we tested the effect of ALK-1 chimeras harboring mutations that have been identified in HHT patients. Mutations introduced include one
insertional mutation, insG140 (10), and three base substitutions causing amino acid changes, W50C, C51Y, and R67Q (9, 10). These
mutations were introduced into the extracellular domain of the
ALK-1/T ALK-1 Signaling Interferes with TGF-
Co-expression of T The autosomal dominant vascular disorder HHT is characterized by
the development of localized vascular arteriovenous malformations. Human genetic studies have shown that HHT can be caused by mutations in
one of two genes, endoglin or ALK-1. Endoglin is a TGF- TGF- However, additional data suggest complications to this simple
interpretation. Although T Through the use of a chimeric receptor signaling assay based on the
inducible PAI-1 reporter construct, we have shown that activin A, BMP-2, BMP-7, and inhibin A are unable to activate ALK-1
signaling. The negative result for activin A was surprising since
activin A binds to ALK-1 in the presence of the activin type II
receptor (22), and our data and that of others (25, 31) show ALK-1 and
ActR-II present in a ligand-independent complex. However, we created
two distinct ALK-1 chimeras, containing either the ActRI-B or T The ALK-1 chimeras show increased signaling activity after TGF- Additional but indirect evidence for the importance of endoglin is
provided by Matsuzaki et al. (64), who reported intrinsic ligand-independent interactions among type III and I TGF- TGF- A component of serum, which seems to be not one of the "common"
TGF- The existence of a third unknown ligand for ALK-1 complicates our
understanding of the function of ALK-1 in endothelial cells. Previous
studies have shown that ALK-1 does not mediate growth inhibition or
elevated expression of extracellular matrix proteins such as
fibronectin or PAI-1 after TGF- We are still a long way from understanding the roles of ALK-1 and
endoglin in angiogenesis and their role in the pathogenesis of HHT.
Nonetheless, the cumulative data suggest a basic outline for the role
of the two receptors in these processes. With few exceptions, the
endothelial cell turnover in a healthy adult organism is very low. The
maintenance of this quiescent state is thought to be regulated by
endogenous negative regulators. During angiogenesis the balance between
negative and positive regulators is shifted, and positive regulators
dominate. Studies have shown that TGF-
(TGF-
) ligand superfamily. Endoglin
has homology to the type III receptor, betaglycan, although its exact
role in TGF-
signaling is unclear. Activin receptor-like kinase 1 (ALK-1) has homology to the type I receptor family, but its ligand and corresponding type II receptor are unknown. In order to identify the
ligand and type II receptor for ALK-1 and to investigate the role of
endoglin in ALK-1 signaling, we devised a chimeric receptor signaling
assay by exchanging the kinase domain of ALK-1 with either the TGF-
type I receptor or the activin type IB receptor, both of which can
activate an inducible PAI-1 promoter. We show that TGF-
1
and TGF-
3, as well as a third unknown ligand present in serum, can
activate chimeric ALK-1. HHT-associated missense mutations in the ALK-1
extracellular domain abrogate signaling. The ALK-1/ligand interaction
is mediated by the type II TGF-
receptor for TGF-
and most likely
through the activin type II or type IIB receptors for the serum ligand.
Endoglin is a bifunctional receptor partner since it can bind to ALK-1
as well as to type I TGF-
receptor. These data suggest that HHT
pathogenesis involves disruption of a complex network of positive and
negative angiogenic factors, involving TGF-
, a new unknown ligand,
and their corresponding receptors.
![]()
INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES
superfamily. The
TGF-
superfamily (TGF-
s, activins, bone morphogenetic proteins (BMPs), and Müllerian-inhibiting substance) constitutes a family of multifunctional cytokines that regulate many aspects of cellular function such as proliferation, differentiation, adhesion, migration, and extracellular matrix formation (11-14). Signaling occurs via different ligand-induced heteromeric receptor complexes consisting of
type I and type II transmembrane serine/threonine kinase receptors.
and activin signaling have been proposed by several
authors (15-17). TGF-
or activin initially binds the constitutively
phosphorylated type II receptor, thereby recruiting the type I receptor
into the ligand-type II receptor complex. The type I receptor is
subsequently phosphorylated by the type II receptor on serine and
threonine residues in its cytoplasmic juxtamembrane GS domain (15, 18).
The type I receptor then phosphorylates downstream signaling mediators
such as members of the recently identified Smad family (reviewed in
Refs. 19-21).
type I receptor, T
R-I (27). ALK-7 is
predominantly expressed in the central nervous system and can complex
with type II receptors for both TGF-
and activin (28, 29). However,
in functional assays neither ligand was able to elicit a signal.
type II receptor (T
R-II),
ALK-1 binds TGF-
1, whereas in the presence of the activin type II
receptor (ActR-II), ALK-1 binds activin A (22, 30, 31). However,
neither of these complexes elicits a signal, as determined by a number
of outcomes including proliferation response, an alteration in
fibronectin expression, or the ability to activate a PAI-1
promoter-based reporter gene in the mink cell line Mv1Lu. Nonetheless,
this does not exclude TGF-
and activin as ALK-1 ligands, as ALK-1
signaling initiated by these cytokines might activate other cellular
responses. Unfortunately, the lack of a signaling assay prohibits
further analysis of ALK-1 signal transduction and its role in the
pathogenesis of HHT.
R-I and ActR-IB are able to mediate
TGF-
or activin-induced activation of the p3TP-Lux reporter construct, which contains the ligand-inducible portion of the PAI-1 promoter (22, 32). By using chimeric receptors,
several investigators have shown that signal specificity is determined by the intracellular domain of a chimeric type I receptor, together with the appropriate type II receptor, independent of the ligand binding specificity of the extracellular domain (33-37). We
hypothesized that the same would hold true for the domains of ALK-1 if
provided with the correct ligand/type II receptor combination.
Therefore, we constructed chimeric receptors with the ALK-1
extracellular domain and the cytoplasmic domain of T
R-I or ActR-IB
to create an ALK-1 signaling assay.
type III receptor based on its
sequence homology to the proteoglycan betaglycan (38-40). Betaglycan
presents the ligands to T
R-II and T
R-I increasing the signaling
activity of the type I receptor (41). Because of its sequence homology
to betaglycan, a similar function is proposed for endoglin. We will
present here data that endoglin is the binding partner for ALK-1
suggesting a role for endoglin in modulating signaling via ALK-1.
![]()
EXPERIMENTAL PROCEDURES
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES
1 antibody was obtained from Promega (catalog number G1221), Madison, WI. The monoclonal endoglin antibody P3D1 was
obtained from Karen Jensen (University of Iowa).
1 was obtained from R & D Systems, Minneapolis. TGF-
2 and
-
3 were purchased from Calbiochem, and TGF-
2 was also from R & D
Systems. BMP-2, BMP-7, and Inhibin A were obtained from the National
Hormone and Pituitary Program. For activin A, COS cells were
transiently transfected with a pCMV5-activin A expression construct.
Transfection was done using the LipofectAMINE method (Life
Technologies, Inc.) according to the manufacturer's instruction. After
transfection, cells were kept for an additional day in Iscove's modified Dulbecco's medium + 5% FBS. Medium was then exchanged, and
cells were incubated an additional 3 days in Iscove's modified Dulbecco's medium + 0.5% FBS. The supernatant was collected and stored at 4 °C and was used in the activin A luciferase reporter assays. The supernatant (IMD medium) of COS cells incubated for 3 days
in Iscove's modified Dulbecco's medium + 0.5% FBS was collected and
used as a negative control in the activin A luciferase reporter assays.
Human serum was purchased from the Nation Blood Institute Blood Center
(Cincinnati, OH) and Gemini Biological Products (Calabasas, CA).
R-I, ActR-IB, ALK-3 (BMPR-IA), T
R-II, and ActR-II
constructs were described previously (22, 44). The endoglin cDNA
was obtained from the American Type Culture Collection (ATCC). Endoglin
was cloned into the EcoRI/BamHI sites of pCMV5
(pCMV5-Endowt). The endoglin coding sequence has after the
first seven amino acids after the transmembrane domain a convenient
MluI site, and 3' prime from this there is a second site in
the pCMV5 multiple cloning site. To create the endoglin-truncated
version Endoglin
cyto pCMV5-Endowt was
digested with MluI which cuts out the endoglin cytoplasmic domain and then subsequently religated, resulting in
pCMV5-Endo
cyto.
R-I, ActR-IB, and ALK-3 were first cloned in pUC18 or pUC19, respectively. The new restriction site was introduced with the TransformerTM Site-directed Mutagenesis Kit
(CLONTECH), using sequence-specific oligonucleotides (numbers 1-4) for the GS domains of the different receptors, containing the AccIII recognition sequence in the
middle of the primer. The new AccIII sites were verified by
sequencing. The constructs were then digested with the restriction
enzyme AccIII and an appropriate second enzyme that allowed
us to cut out the C-domain of the different type I receptors. The
resulting DNA fragments were gel-purified (QIAEX Gel Extraction Kit,
Qiagen) and used for ligations to create the different chimeric
receptors. These chimeras are assigned a name with the addition -GS,
i.e. ALK-1/T
R-I(GS). The correct reading frame around the
AccIII site was verified by DNA sequencing. The chimeric
cDNAs were then cloned back into the pCMV5 vector.
R-I, ALK-1/T
R-I(TM) (ALK-1(TM)), and
ALK-3/T
R-I(TM) (ALK-3(TM)). The chimeric receptors were constructed using PCR with a 1/5 mixture of Vent polymerase (New England
Biolabs)/Taq polymerase (Life Technologies, Inc.).
Specifically, the T
R-I cDNA in pUC18 was used as template in the
PCRs. To create ALK-1(TM) the entire T
R-I transmembrane/cytoplasmic
domain encoding sequence was amplified using, as the 5'-primer, an
oligonucleotide (oligonucleotide 5) containing the last 11 nucleotides
of the ALK-1 extracellular domain, with the ALK-1 unique
MscI site, followed by the first 23 nucleotides of the
T
R-I transmembrane domain. As the 3'-primer the M13 reverse primer
was used, amplifying part of the pUC18 multiple cloning site, which
allows cutting the PCR products at their 3'-end with BamHI
for subsequent cloning. To create ALK-3(TM) the same approach was
employed. For the 5'-primer an oligonucleotide (number 6) was used,
containing the last 12 nucleotides of the ALK-3 extracellular domain,
with the ALK-3 unique BsmI site, followed by the first 21 nucleotides of the T
R-I transmembrane domain. For the 3'-end the M13
reverse primer was used. The resulting PCR products were purified with
the QIAquick PCR Purification Kit (Qiagen), digested with
MscI/BamHI or BsmI/BamHI,
gel-purified, and then ligated to the extracellular domain of ALK-1 or
ALK-3. The correct sequence and reading frame were verified by DNA
sequencing. All chimeras were transiently transfected in COS cells, and
their expression was verified by Western blot analysis using the HA antibody since all constructs have a C-terminal HA tag.
R-I(TM) chimeric receptor by site-directed mutagenesis using
the QuickChangeTM mutagenesis Kit (Stratagene). The
following constructs were made with the following oligonucleotide pair
combinations: ALK-1(TM)insG140 (number 7/8), ALK-1(TM)W50C (number
9/10), ALK-1(TM)C51Y (number 11/12), ALK-1(TM)R67Q (number 13/14).
-galactosidase vector (pSV-
) (Promega) was always
included to normalize the luciferase activity for the different
transfections. Cells were plated on 60-mm dishes and grown to 80%
confluence. Prior to transfection, cells were washed once with
serum-free medium. Cells were transfected in 3 ml of serum-free medium
containing 6 µg of total DNA in the following combinations:
(a) 2 µg of p3TP-Lux, 3 µg of pCMV5, and 1 µg of
pSV-
; (b) 2 µg of p3TP-Lux with either 2 µg of type I receptors or type I chimeras, 1 µg of pCMV5, and 1 µg of pSV-
. The transfections also included 0.1 mM chloroquine/ml and
0.125 mg/ml DEAE-dextran in phosphate-buffered saline. In assays where two type I receptors were co-transfected, 1.5 µg of each receptor cDNA were used. In assays where the activity for cells
co-transfected with two receptors had to be compared with the activity
of single receptor transfected cells, the second receptor was
substituted with 1.5 µg of pCMV5 DNA in the single receptor
transfected cells. After 3 h incubation at 37 °C, cells were
shocked with 10% Me2SO in phosphate-buffered saline for 2 min and allowed to recover overnight in MEM/NEAA + 10% FBS. The
following day, cells were trypsinized and replated into a 24-well plate
and incubated for at least 3 h in MEM/NEAA + 10% FBS to allow the
cells to reattach. Prior to the luciferase reporter induction, cells
were incubated for 2 h in MEM/NEAA + 0.2% FBS. Medium was then
exchanged for fresh MEM/NEAA + 0.2% FBS with the addition of the
different cytokines to induce the luciferase reporter. After 16 h
incubation, cells were washed with phosphate-buffered saline and lysed
for 15 min in 40 µl of lysis buffer. 10 µl were used to measure the
luciferase activity using the luciferase assay system (Promega) in a
Berthold Lumat LB 9501 luminometer. The remaining 30-µl lysates were
used to measure the LacZ activity as described previously (45).
Luciferase activity was corrected for LacZ activity.
![]()
RESULTS
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES
R-I and ActR-IB domains. Three chimeras were
constructed; two were exchanged in the GS domain, ALK-3/T
R-I(GS) and
ALK-3/ActR-IB(GS), and one within the transmembrane (TM) domain,
ALK-3/T
R-I(TM) (Fig. 1). In order to
eliminate signaling through endogenous TGF-
receptors, the chimeric
receptors were transfected into one of two mink lung cell derivatives,
R-1B or DR-26, which are deficient for T
R-I and T
R-II,
respectively (32, 42). We observed that in transiently transfected R-1B
or DR-26 cells, all ALK-3 chimeric receptors were able to induce a
significant increase of luciferase activity over basal level after
incubation with either BMP-2 or BMP-7. The highest activity was
observed in DR-26 cells with the ALK-3/ActRIB chimera (Fig.
2A).

View larger version (41K):
[in a new window]
Fig. 1.
Schematic illustration of chimeric type I
receptors. The extracellular and intracellular domains were
exchanged either in the GS domain or just adjacent to the transmembrane
domain (TM). Chimeric receptors were tested for their
ability to activate the luciferase reporter construct p3TP-Lux in mink
lung cells upon the induction of different ligands.

View larger version (22K):
[in a new window]
Fig. 2.
BMP and activin A-induced signaling in DR-26
cells via chimeric receptors. DR-26 cells were transiently
transfected with the indicated chimeric receptors or the empty
expression vector pCMV5. A fixed amount of the reporter p3TP-Lux was
included in all transfections. Luciferase activity in cell lysates was
plotted as the average and standard deviation for transfections done in
triplicate. Only data from the chimeras exchanged in the GS domain are
shown. A, cells were incubated overnight with either 15 nM BMP-2 or 15 nM BMP-7 or without BMP
(w/o). B, cells were incubated overnight without
ligand (w/o), or with 150 µl of conditioned medium
(activin) of COS cells transfected with an activin A expression
construct, or with 150 µl of conditioned medium (IMD
medium) of COS cells not transfected with the activin A expression
construct.
R-I chimera showed a 21-fold increase in activity (Fig.
2B). When we tested activin A-induced signaling activity for
the two ALK-1 chimeras ALK-1/ActR-IB(GS) and ALK-1/T
R-I(GS), there
was an increase of only 3-4-fold over the ALK-1 chimera basal level.
This level was no more than the endogenous background level observed
with vector alone. These data indicate that activin A is not a ligand
for ALK-1.
1, -2, and -3 on the ALK-1 Chimeric
Receptors--
We next examined the ability of TGF-
ligand to
induce signaling through the ALK-1 chimeras. As a positive control we
tested T
R-I-transfected R-1B cells, which lack endogenous T
R-I.
These transfectants responded to TGF-
1, TGF-
2, or TGF-
3 with a
significant increase of luciferase activity compared with
mock-transfected cells (Fig. 3). Despite
the high background, the ALK-1/T
R-I(GS) chimera also showed a clear
response to TGF-
1 and TGF-
3, although only half that of T
R-I.
Significantly, the chimera did not respond to TGF-
2. The
ALK-1/T
R-I(TM) chimera also showed a similar ligand-specific response although the magnitude of the response was lower (data not
shown). This response was specific to the ALK-1 extracellular domain as
ALK-3/T
R-I(GS) showed no response to any of the TGF-
ligands
(data not shown). These combined results indicate that TGF-
1 and
-
3 can induce a specific signal via the ALK-1 chimeras. The binding
specificity for the TGF-
isoforms resembles that of endoglin (46),
consistent with the idea that endoglin and ALK-1 are in the same
signaling pathway.

View larger version (20K):
[in a new window]
Fig. 3.
TGF-
1 and
-
3 induced
ALK-1/T
R-I(GS) signaling in R-1B cells.
Cells were transiently transfected with p3TP-Lux and either the TGF-
type I receptor, the ALK-1 chimeric receptor ALK-1/T
R-I(GS), or
pCMV5. Cells were incubated overnight with 4 ng/ml TGF-
1, -
2,
-
3, or without TGF-
(w/o). Luciferase activity in cell
lysates was plotted as the average and standard deviation for
transfections done in triplicate.
R-I/ActR-IB, did not respond to any of the
TGF-
s (Fig. 3), although the chimeric protein was expressed. This
was surprising, since the exchanged ActR-IB kinase domain is nearly
identical to the kinase domain of T
R-I, particularly in the L45
region of kinase subdomains IV and V, which are responsible for the
TGF-
specificity (47). These results suggest that the type I
receptor is not solely responsible for the signaling specificity and
that another requirement may be the correct combination of type I and
II receptors in the complex. Consistent with this, Persson and
colleagues (34) showed that the chimeric T
R-I/BMPR-IB receptor is
able to signal in combination with the chimeric T
R-II/ActR-IIB receptor upon TGF-
addition but not with the wild-type TGF-
type II receptor T
R-II.
ligand specificity, we determined whether
they could form a receptor complex. We also determined whether ALK-1
can form a ligand-independent complex with either T
R-II or ActR-II,
which might explain the high basal level of luciferase activity for the
ALK-1 chimeras, even in the absence of any ligand. COS cells were
co-transfected with endoglin and ALK-1 (HA-tagged), lysed, and
immunoprecipitated with either the monoclonal HA antibody or
rabbit anti-endoglin sera. The immunoprecipitations were separated by
SDS-PAGE and immunostained with the reciprocal antibody. Fig.
4, A and B, shows that endoglin and ALK-1 can be immunoprecipitated in a
ligand-independent complex. However, a different anti-endoglin
antibody, P1D3, did not co-immunoprecipitate ALK-1, although endoglin
was immunoprecipitated (data not shown). P1D3 is directed against an
epitope encoded by exons 2 and 3 (48). This region may also be critical
for the endoglin/ALK-1 interaction, which may be blocked by P1D3.

View larger version (27K):
[in a new window]
Fig. 4.
Ligand-independent endoglin/type I receptor
and ALK-1/type II receptor complex formation. A,
ligand-independent endoglin/ALK-1 interaction revealed by type I
receptor immunoprecipitation. COS cells were transiently transfected
with the indicated combinations of endoglin and different type I
receptors (HA-tagged). Cells were lysed, and type I receptors were
immunoprecipitated with the monoclonal HA antibody. Precipitates were
resolved by SDS-PAGE and blotted, and co-precipitated endoglin was
visualized by immunoblot staining with rabbit anti-endoglin sera. To
assess the type I receptor precipitation efficiency, the blot was
restained with the monoclonal HA antibody. To assess the transfection
efficiency, an aliquot of the cell lysates prior to the precipitation
was resolved by SDS-PAGE, blotted, and the expressed receptors were
visualized by immunoblot staining with the appropriate antibody.
B, ligand-independent endoglin/ALK-1 interaction revealed by
anti-endoglin immunoprecipitation. COS cells were transiently
transfected as in A. Cell lysates were immunoprecipitated
using anti-endoglin serum and electrophoretically resolved and
visualized as in A. C, ligand-independent
ALK-1/T
R-II and ALK-1/ActR-II interaction. COS cells were
transiently transfected with the indicated receptor combinations.
T
R-II and ActR-II are HA-tagged. Cells were lysed and ALK-1 was
immunoprecipitated with rabbit anti-ALK-1 sera. Precipitates were
resolved by SDS-PAGE and blotted, and the co-precipitated type II
receptors were visualized by immunoblot staining with the monoclonal HA
antibody.
R-I or ActR-IB
demonstrate that these two type I receptors are also able to
co-immunoprecipitate endoglin, although these interactions were weaker
than for ALK-1 (Fig. 4A). Co-immunoprecipitations for
endoglin and the type II receptors T
R-II and ActR-II did not reveal
any interactions among these receptors (data not shown).
R-II or
ALK-1 and ActR-II. Immunoprecipitation for ALK-1 brought down both type
II receptors (Fig. 4C). Reciprocal immunoprecipitations for
the type II receptors brought down ALK-1 (data not shown). These
results confirm that ALK-1 and these type II receptors are in a
ligand-independent receptor complex and suggest that T
R-II and
ActR-II can both act as type II receptors for ALK-1.
present in the serum, R-1B cells were
transfected with T
R-I or ALK-1/T
R-I(GS) and incubated with either
TGF-
1 or 20% human serum in the presence or absence of a TGF-
1
neutralizing antibody. The neutralizing antibody reduced the level of
luciferase activity by more than half for T
R-I-transfected cells
incubated with TGF-
1 (Fig. 5B). However, it had no effect
on the human serum-induced signaling activity of the ALK-1/T
R-I(GS)
transfectants.

View larger version (18K):
[in a new window]
Fig. 5.
Human serum-induced ALK- 1 chimera
signaling in R-1B and DR-26 cells. Luciferase activity in cell
lysates was plotted as the average and standard deviation for
transfections done in triplicate. A, R-1B cells were
transiently transfected with p3TP-Lux and the indicated receptor or
pCMV5. Cells were incubated overnight with the indicated amount of
heat-inactivated human serum or without serum (w/o).
B, R-1B cells were transiently transfected as in
A. Cells were incubated overnight with either 4 ng/ml
TGF-
1 or 20% heat-inactivated human serum, or without ligand
(w/o). Neutralizing antibody to TGF-
1 was added where
indicated at 1 µg/ml. C, DR-26 cells were transiently
transfected with p3TP-Lux and the indicated receptors or pCMV5. Cells
were incubated overnight with either 4 ng/ml TGF-
1, 20%
heat-inactivated human serum, or without ligand (w/o).
D, inhibin A does not induce ALK-1 chimera signaling. R-1B
cells were transiently transfected with p3TP-Lux and the indicated
receptor or pCMV5. Cells were incubated overnight with either the
indicated amount of recombinant human inhibin A or without ligand
(w/o). Luciferase activity in cell lysates was plotted as
the average and standard deviation for transfections done in
triplicate.
R-II, they
responded strongly to TGF-
1 incubation yet showed no induction with
the human serum (Fig. 5C). R-1B cells transfected with
ActR-IB or the ALK-3 chimeras also showed no response to the human
serum (data not shown). These combined data show that the serum-induced
reporter activity observed with ALK-1 chimera-transfected cells is not
due to the presence of TGF-
, activin A, or BMP in the serum.
R-I(TM) chimera, and their effect on the serum-induced signaling activity was determined. The insertional mutation served as a
negative control as it introduces a frameshift early in the extracellular (ligand binding) domain, leading to a premature stop
codon. Examination of serum-induced luciferase activity demonstrated that the insG140 and C51Y mutations both showed no measurable signaling
(Fig. 6). The signaling activity for the
W50C and R67Q mutations was almost completely abolished, with only a
slight increase upon serum induction (Fig. 6). Significantly, for all of the mutations, the usually high basal level of luciferase activity for the ALK-1 chimeras was comparable to the basal level of
mock-transfected cells. The W50C and R67Q amino acid substitutions were
also examined for TGF-
1-dependent induction of the
luciferase reporter. The signaling activity of these mutant ALK-1
chimeras was also abrogated (data not shown). These data are the first
demonstration that any of the ALK-1 missense mutations identified in
HHT patients have deleterious consequences for ALK-1 signaling.

View larger version (12K):
[in a new window]
Fig. 6.
Effect of HHT-associated mutations on ALK-1
signaling. R-1B cells were transiently transfected with p3TP-Lux
and the indicated receptors or pCMV5. Cells were incubated overnight
with either 20% heat-inactivated human serum or without ligand
(w/o).
-induced T
R-I
Signaling--
Although ALK-1 and T
R-I bind TGF-
1 and TGF-
3
and can form a ligand-independent complex with endoglin, they do not
activate the same genes (22, 25, 31). Thus, we hypothesized that wild-type ALK-1 may have an opposing effect on TGF-
signaling through T
R-I. In order to induce ALK-1 signaling independent of
TGF-
addition, we designed a constitutively active form of ALK-1.
For other type I receptors, the substitution of either Glu or Asp for a
critical residue in the kinase domain creates a constitutively active
type I receptor able to signal without ligand or corresponding type II
receptor (18, 44). Therefore, we created an "activated" form of
ALK-1 by replacing Gln (wild type) with Asp at the equivalent position
in ALK-1 (ALK-1Q201D). The effect of the activated ALK-1
receptor in the luciferase assay was determined.
R-I and wild-type ALK-1 yielded a 20% decrease of
TGF-
-induced signaling in comparison to T
R-I alone (Fig.
7A). This effect is seen both
for TGF-
1 and -
2. Furthermore, when activated ALK-1 is
co-expressed with T
R-I, TGF-
-induced signaling is decreased by
33% in comparison to T
R-I alone. Since constitutively activated
receptors do not always signal with the same intensity as the wild-type
receptor when induced by ligand, we determined whether serum-activated
ALK-1 might have a more potent effect on T
R-I signaling through
TGF-
1. R-1B cells were co-transfected with T
R-I and ALK-1 and
incubated with either TGF-
1 or TGF-
1 plus human serum. The
resulting signaling data were compared with cells transfected with
T
R-I alone. Co-incubation of T
R-I-transfected cells with TGF-
1
and serum shows a 31% reduction in signaling compared with TGF-
1
alone (Fig. 7B). This may be due to serum components that
bind to TGF-
1 and sequester it or otherwise inhibit its function.
The ALK-1 and T
R-I co-transfection showed a 10% reduction in
luciferase activity after TGF-
1 induction. However, the TGF-
1
plus human serum co-incubation resulted in a 70% reduction in
signaling (Fig. 7B). These data demonstrate that in this
system, ALK-1 signaling opposes the T
R-I-induced pathway. It is
unclear whether ALK-1-mediated signaling actively inhibits the
PAI-1 promoter or if the ALK-1-induced pathway is competing
for components of the T
R-I-signaling pathway, such as Smad4.

View larger version (23K):
[in a new window]
Fig. 7.
Effect of ALK-1 signaling on
TGF-
-induced T
R-I
signaling. Luciferase activity in cell lysates was plotted as the
average and standard deviation for transfections done in triplicate.
A, R-1B cells were transiently transfected with p3TP-Lux and
the indicated receptors or pCMV5. Cells were incubated overnight with
either 4 ng/ml TGF-
1, 4 ng/ml TGF-
2, or without ligand
(w/o). B, R-1B cells were transiently transfected
with p3TP-Lux and the indicated receptors or pCMV5. Cells were
incubated overnight with either 4 ng/ml TGF-
1, 20% heat-inactivated
human serum (h.serum), or 4 ng/ml TGF-
1 and 20%
heat-inactivated human serum (beta1+h.serum), or without
ligand (w/o).
![]()
DISCUSSION
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES
1- and -
3-binding protein expressed primarily on the surface of endothelial cells, and ALK-1 is a type I TGF-
superfamily receptor also expressed on the surface of endothelial cells. However, the role
of these receptors in the pathogenesis of HHT is unclear.
is known to play a key role in angiogenesis, especially after
injury or inflammation (56-58). In addition, the phenotypes of the
TGF-
1 (ligand) and the T
R-II (receptor) knock-out mice suggest a
critical role in early yolk sac vasculogenesis and hematopoiesis (59,
60). Intriguingly, the vascular defects in the TGF-
1 null mice share
some histological similarities to the vascular lesions seen in HHT
patients (59). ALK-1 expression in the developing mouse embryo
parallels that of TGF-
1 (61), and ALK-1 knock-out mice are also
embryonic-lethal due to defects in yolk sac vasculogenesis and
hematopoiesis.2
The data from these mouse mutations might suggest that ALK-1 and
endoglin act in the same angiogenic pathway involving TGF-
.
R-I and ActR-IB signal in mink lung cells
through the PAI-1 promoter reporter system, ALK-1 does not signal in a TGF-
1- or activin A-specific manner (22). Furthermore, ALK-1 does not mediate TGF-
1-like responses such as growth
inhibition or elevated expression of extracellular matrix proteins (23, 25, 31). These data suggest distinct roles for ALK-1- and TGF-
-mediated signaling.
R-I
kinase domains, and neither exhibited any evidence of signaling in our
reporter system. Furthermore, a positive control chimera,
ActR-IB/T
R-I(GS), demonstrated an even higher activin-induced
signaling activity than the natural activin type I receptor ActR-IB.
Thus, we conclude that activin A is not a signaling ligand for
ALK-1.
1 and
TGF-
3 incubation but not with TGF-
2. This ligand specificity parallels that of endoglin (46). Both ALK-1 and endoglin are also
expressed in trophoblasts during early stages of placenta development
(61, 62). These data and our endoglin/ALK-1 and ALK-1/T
R-II
co-immunoprecipitation results suggest that ALK-1 and endoglin are part
of a TGF-
signaling receptor complex. The TGF-
-induced ALK-1
signaling in R-1B cells is only half that of the T
R-I controls. This
might be due to a lower affinity of ALK-1 to TGF-
or due to the
presence of two different type II receptor binding partners for ALK-1.
The second type II receptor might be able to sequester ALK-1 resulting
in reduced ligand-induced signaling activity. Our serum and
co-immunoprecipitation data show that ALK-1 is able to use two
different type II receptors, both present in R-1B cells.
receptors and also among type II and I receptors but not among type III and II
receptors, which were ligand-dependent. Similarly, we
observed ligand-independent complexes of endoglin/ALK-1 (a type III-I
interaction), as well ALK-1/T
R-II and ALK-1/ActR-II (a type I-II
interaction) but not for endoglin/T
R-II or endoglin/ActR-II (a type
III-II interaction). They also tested the phosphorylation status of the T
R-I·T
R-II receptor complex after TGF-
addition and found an increase in T
R-I and T
R-II phosphorylation. When betaglycan was
added to this complex they observed an additional increase of
phosphorylation for both. The transmembrane and cytoplasmic domain of
endoglin is highly conserved among different species and shows high
homology (71%) to the corresponding region of the TGF-
type III
receptor betaglycan (38-40, 46, 52, 53). The combined data suggest
that type III receptors (either betaglycan or endoglin) promote
efficient type I receptor signaling.
cross-linking studies in porcine aortic endothelial cells and
pre-B leukemic cells have demonstrated endoglin in a complex with
T
R-I and T
R-II (52, 65). In both studies the immunoprecipitation was performed with either an endoglin- or T
R-II-specific antibody after TGF-
1 cross-linking and resulted in the co-precipitation of a
protein of approximately 70 kDa, the predicted size for a type I
receptor. The authors concluded that this was the TGF-
type I
receptor. However, since ALK-1 is expressed in endothelial cells, the
co-precipitated type I receptor in porcine aortic endothelial cells may
actually have been ALK-1. One possibility is that ALK-1 and T
R-I are
expressed on different subsets of cells which would allow for unique
and specific responses to TGF-
. This hypothesis has also been
proposed by Panchenko et al. (66). They showed that the rat
ALK-1 is highly expressed in adult lung, whereas T
R-I is not, and
that the two receptors are also differentially expressed in the fetal
lung. Therefore, it is possible that some of the well documented
endothelial responses to TGF-
(56-58) are due to signaling through
ALK-1 and not T
R-I.
family members, can act as a third signaling ligand for ALK-1.
Although TGF-
1- and
3-induced ALK-1 signaling occurs via
T
R-II, signaling induced by the "serum ligand" does not, since
serum-induced signaling via ALK-1 chimeras was observed in cells
lacking either T
R-I or T
R-II. An extensive PCR screen with
degenerate oligonucleotides for type II receptors could not identify
any novel type II receptor in endothelial
cells.3 Thus, the
serum ligand may instead signal through ActR-II. Although we cannot
exclude unknown candidates, these data suggest T
R-II and ActR-II are
the major type II receptors for ALK-1.
incubation (23). We have shown
that ALK-1 signaling is able to oppose TGF-
-induced PAI-1
promoter activity, although we cannot conclude if this is a direct
inhibitory effect of ALK-1 signaling on the PAI-1 promoter or if the T
R-I and ALK-1 pathways overlap and therefore compete for
common signaling mediators. In future studies of TGF-
signaling, it
will be critical to differentiate ALK-1 versus T
R-I
signaling, particularly in cells that co-express both receptors.
(particularly TGF-
1) can
be either a positive or negative regulator (reviewed in Ref. 56). A
biphasic effect of TGF-
on angiogenesis is dependent on TGF-
concentration (67). Therefore, endothelial response to TGF-
may also
be concentration-dependent (68). This biphasic effect may
be established by the use of two different receptors such as T
R-I
and ALK-1, which may have different affinities for TGF-
. Endoglin
might be required as a receptor-partner for both type I receptors in
order to maintain the balance between negative and positive regulation
of angiogenesis. This picture is complicated by the identification of a
third unknown ligand. ALK-1 antagonistic activity could be induced by
the ligand at different time points. Alternatively, ALK-1 signaling via
this novel ligand may result in other angiogenic responses that are TGF-
-independent. Future studies are required to identify the ligand
present in serum and to dissect the ALK-1/endoglin signaling pathway
and its role in angiogenesis and the pathogenesis of HHT.
| |
ACKNOWLEDGEMENTS |
|---|
We thank D. Klaus for technical assistance; T. Stenzel (Duke University) for making the endoglin polyclonal antibody; B. Cullen (Duke University) for the gift of the COS cell line; and H. Esche (Universitätsklinikum Essen, Germany) for the gift of the monoclonal HA hybridoma. Inhibin A was obtained from A. F. Parlow (Harbor-UCLA Medical Center) through the National Hormone and Pituitary Program.
| |
FOOTNOTES |
|---|
* This work was supported in part by National Institutes of Health Grant HL 49171 (to D. A. M.) and by a Medical Research Council grant (to L. A.).The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
§ Supported by the Deutsche Forschungsgemeinschaft.
Medical Research Council (Canada) scholar.
** Established Investigator Award of the American Heart Association. To whom correspondence should be addressed. Tel.: 919-684-3290; Fax: 919-681-9193; E-mail: march004{at}mc.duke.edu.
2 En Li, personal communication.
3 D. W. Johnson and D. A. Marchuk, unpublished data.
| |
ABBREVIATIONS |
|---|
The abbreviations used are:
HHT, hereditary
hemorrhagic telangiectasia;
ALK-1, activin receptor-like kinase 1;
TGF-
, transforming growth factor
;
PAI, plasminogen activator
inhibitor;
T
R-I or T
R-II, type I or type II TGF-
receptor;
ActR-I or ActR-II, type I or type II activin receptor;
BMP, bone
morphogenetic protein;
BMPR-I or II, type I or type II bone
morphogenetic protein receptor;
GS, glycine-serine domain;
TM, transmembrane domain;
PAGE, polyacrylamide gel electrophoresis;
HA, hemagglutinin;
ins, insertion;
PCR, polymerase chain reaction;
FBS, fetal bovine serum;
MEM, minimal essential medium;
NEAA, nonessential
amino acids.
| |
REFERENCES |
|---|
|
|
|---|