![]()
|
|
||||||||
J Biol Chem, Vol. 274, Issue 16, 11115-11124, April 16, 1999
§,
**
From the
Department of Pathology, ¶ Howard
Hughes Medical Institute, and
Departments of Medicine and
Molecular Genetics and Cell Biology, the University of Chicago,
Chicago, Illinois 60637
| |
ABSTRACT |
|---|
|
|
|---|
SPI-B is a B lymphocyte-specific Ets
transcription factor that shares a high degree of similarity with
PU.1/SPI-1. In direct contrast to PU.1 Hematopoiesis represents the coordinated development of all blood
cell lineages (granulocytes, monocytes, lymphocytes, erythrocytes, and
platelets), which arise from a self-renewing, pluripotent stem cell.
This complex developmental process is guided by interactions between
extracellular signals, cell-surface receptors, cell-cell interactions,
and the regulation of gene expression by transcription factors
(reviewed in Refs. 1 and 2). Transcription factors play a crucial role
in hematopoiesis due to their ability to regulate gene expression
controlling the eventual differentiation and development of distinct
cell types.
One family of transcription factors thought to play a pivotal role in
hematopoiesis is the Ets DNA-binding proteins. This family of
transcription factors consists of approximately 30 different proteins
that bear a high degree of similarity to the founding member, Ets-1.
Ets proteins are monomeric transcription factors that bind to the
purine-rich element of GGA(A/T) through their Ets domain (3-6). Based
upon differences within the Ets and other domains, Ets proteins can be
divided into a series of subfamilies consisting of the Ets-1, PU.1,
Elf-1, Fli-1, and GABP In addition to having a distinct DNA binding domain compared with other
Ets family members, PU.1 possesses several protein motifs unique among
Ets proteins (Fig. 1). PU.1 has a
C-terminal Ets domain that is involved in both DNA binding as well as
protein-protein interactions involving AP-1 family members (8, 9),
NF-IL6
/
mice that die in utero and lack monocytes, neutrophils, B
cells, and T cells, Spi-B
/
mice are viable
and exhibit a severe B cell proliferation defect. Since PU.1 is
expressed at wild type levels in Spi-B
/
B
cells, the mutant mice provide genetic evidence that SPI-B and PU.1
have at least some non-redundant roles in B lymphocytes. To begin to
understand the molecular basis for these defects, we delineated
functional domains of SPI-B for comparison to those of PU.1. By using a
heterologous co-transfection system, we identified two independent
transactivation domains in the N terminus of SPI-B. Interestingly, only
one of these domains (amino acids 31-61), a
proline/serine/threonine-rich region, unique among Ets proteins, is
necessary for transactivation of the immunoglobulin
light chain
enhancer. This transactivation motif is in marked contrast to PU.1,
which contains acidic and glutamine-rich domains. In addition, we
describe a functional PU.1 site within the c-FES promoter
which SPI-B fails to bind efficiently and transactivate. Finally, we
show that SPI-B interacts with the PU.1 cofactors Pip, TBP, c-Jun and
with lower affinity to nuclear factor interleukin-6
and
retinoblastoma. Taken together, these data suggest that SPI-B binds DNA
with a different affinity for certain sites than PU.1 and harbors
different transactivation domains. We conclude that SPI-B may activate
unique target genes in B lymphocytes and interact with unique, although
currently unidentified, cofactors.
![]()
INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES
groups. The PU.1 subgroup consists of
PU.1/SPI-1 and SPI-B and represents the most divergent members of the
Ets family due to many differences in the Ets domain (40% similarity
to Ets-1). In contrast to other Ets proteins, both PU.1 and SPI-B can
bind the non-canonical DNA sequence GCAGAA (7).
1 (C/EBP
) (10),
and other Ets proteins (8, 11, 12). Immediately adjacent to the Ets
domain is a proline-, glutamic acid-, serine-, and threonine-rich
(PEST) region, which is involved in protein-protein interactions with
the lymphoid-specific co-activator Pip/IRF4/NF-EM5 and other IRF
proteins (13, 14), but does not destabilize protein as other PEST
sequences do (15). The PU.1-Pip interaction is crucial for the
transcription of immunoglobulin light chain loci (13) and CD20 (16) and
requires PU.1 binding to DNA with subsequent recruitment of Pip via a
phosphorylated serine residue (Ser-148) in the PEST region (17, 18). At
the N terminus of PU.1 resides a series of three independent
transcriptional activation domains, including two acidic subdomains and
one glutamine-rich domain (19). In addition to activating
transcription, the N terminus of the protein has been shown to interact
with Rb and TBP (20).

View larger version (18K):
[in a new window]
Fig. 1.
Important functional domains of PU.1 and
SPI-B for DNA binding, protein-protein interactions, and
transactivation. Critical phosphorylation sites in the two
proteins are also shown. * indicates this domain is weakly
acidic.
In contrast to PU.1, very little is known about the functional domains
of SPI-B (Fig. 1). The two proteins are 60% similar overall, with the
N terminus of SPI-B being highly diverged from PU.1 (20% similarity)
but presumed to contain the transcriptional activation domain. The
SPI-B Ets domain is 90% similar to that of PU.1, whereas the PEST
region exhibits 70% similarity (21). SPI-B binds to the same DNA
elements as PU.1 in vitro and interacts with Pip to
transactivate a target site in the
enhancer (21-23). Furthermore,
SPI-B has been shown to bind Rb via its N terminus which requires a
single threonine residue (Thr-56) whose phosphorylation by ERK1
abolishes this interaction (24). It has not been determined if SPI-B
can also bind to other PU.1 interacting proteins such as c-Jun, TBP,
NF-IL6
, or other Ets proteins.
The highly related PU.1 and SPI-B proteins share overlapping patterns
of expression. PU.1 is expressed in granulocytes, monocytes, immature
erythroid cells, mast cells, megakaryocytes, B cells, and early in T
cells (21, 25, 26). Although previously thought to have a similar
tissue distribution as PU.1 (21), it has been shown that SPI-B is
expressed only in B cells and immature T cells but not monocytes or
neutrophils (23, 27). PU.1-binding sites are important for the
transcriptional activity of a large number of myeloid genes such as
CD11b (28, 29), MCSF-R (30), interleukin 1
(31), GM-CSFR (32), scavenger receptor (33), and macrophage mannose receptor (34) as well as B cell targets such as the immunoglobulin light chain loci (14, 35), mb-1 (36), µ heavy chain (37), and J chain (7). In contrast to PU.1, the only confirmed mammalian target gene of SPI-B is the
2-4
enhancer (23).
To address the in vivo functional differences between PU.1
and SPI-B, we have generated mice with targeted mutations in both loci.
PU.1
/
mice die at approximately day 16.5 of
gestation (38) and lack monocytes, neutrophils, B, and T cells but do
possess erythroid cells, megakaryocytes, and immature mast cells. Mice
with a different PU.1
/
allele display a
similar but less severe phenotype (39-41). The loss of both lymphoid
and myeloid cells suggests that PU.1 is required for the survival
and/or differentiation of a multipotential lymphoid/myeloid precursor
(42). In contrast to PU.1
/
mice,
Spi-B
/
animals are viable and display a
normal number of B and T cells (43). However, upon stimulation of B
cells either in vitro or in vivo, they exhibit a
proliferation defect (43) due to decreased signaling through the B cell
receptor and inappropriate
apoptosis.2 One interesting
issue raised by the Spi-B
/
mice is that PU.1
is obviously unable to complement this defect since it is present at
wild type levels (43).
The genetic evidence that SPI-B and PU.1 are not completely redundant
implies that they (i) regulate different target genes and/or (ii) bind
different cofactors. To distinguish between these two possibilities, we
attempt to elucidate differences between SPI-B and PU.1 which may alter
their transcriptional activity. These studies reveal that SPI-B
contains two N-terminal activation domains which are highly divergent
from PU.1. In addition, the affinity of SPI-B for certain DNA sites
appears to be different from PU.1, affecting the ability of SPI-B to
transactivate the c-FES promoter, a known PU.1 target gene.
Finally, SPI-B is shown to interact with Pip as well as other proteins
in a manner similar to PU.1, suggesting that these interactions are
critical for the proper function of the PU.1/SPI-B Ets subfamily but
that interactions with other cofactors may contribute to differences in
their ability to activate target genes.
| |
EXPERIMENTAL PROCEDURES |
|---|
|
|
|---|
Plasmids and Site-directed Mutagenesis--
A tetrameric
2-4 enhancer element (referred to as the
B site)
(13) was subcloned immediately upstream of a TK (2) promoter in the
pTKGH plasmid (Nichols Institute) to form the reporter construct
B4TKGH. The 450-base pair promoter element from the human
c-FES gene (44) was subcloned into the promoterless p
GH
vector (Nichols Institute) to form the reporter construct c-FES GH. The pGAL4GH (45) reporter and the Pip-CMV vector
(23) have been previously described. The human SPI-B (21) and murine PU.1 (25) cDNAs have also been previously reported. Of note, the
human SPI-B is 95% similar to the murine form, with only conservative differences in the Ets domain.
All plasmids for cDNA expression in mammalian cells used the CMV
promoter-based pCDNA3 vector (Invitrogen). Constructs were generated by PCR and confirmed by sequencing. Deletion mutants are
named based upon the amino acids that are missing from the protein.
Hemagglutinin (HA) epitope-tagged cDNAs were generated by cloning
PCR-generated fragments into the previously described vector
pcDNA3-HA (18). SPI-B/PU.1 Ets and PU.1/SPI-B Ets contain XhoI and HindIII linkers between domains which
insert two in-frame codons (LG and KL, respectively).
PEST (aa
107-165),
31-62,
31-106,
64-106,
Ets (aa 166-257), and
257-262 contain an internal XhoI site within the deleted region.
GAL4 fusion proteins were constructed by inserting PCR-generated fragments of SPI-B into the pGAL4 vector (45) that contains the DNA binding domain of the GAL4 protein (aa 1-147) followed by a multiple cloning site and in-frame stop codons. Point mutations were introduced by overlapping PCR mutagenesis (46). The mutations are named by the normal amino acid, position, and the new amino acid.
Cells, Transfections, and Reporter Assays--
Cells were
cultured in Dulbecco's modified Eagle's medium with 10% fetal bovine
serum, 100 units of penicillin, and 100 µg of streptomycin. NIH 3T3
fibroblasts were transfected with Lipofectin (Life Technologies, Inc.)
according to manufacturer's protocol. For co-transfection experiments,
2 µg of reporter plasmid and 2 µg of a
-galactosidase expressing
plasmid (pMSV
gal) were used. Transfections using the B4TKGH and
c-FES GH reporters utilized 20 µg of expression plasmid; 8 µg of expression plasmid were used for the transfections with the
GAL4GH reporter. 48 h after transfections, supernatants were
collected for human growth hormone assay using a commercially available
radioimmunoassay (Nichols Institute). Transfection efficiencies were
measured by
-galactosidase activity in cell extracts as described
previously (47).
COS-7 cells were transfected with Lipofectin and 20 µg of expression plasmid. Nuclear extracts were prepared 48 h after transfection using the method of Andrews and Faller (48).
In Vitro Transcription and Translation-- [35S[Methionine incorporated IVT proteins were generated using a commercially available TNT-coupled rabbit reticulocyte lysate kit (Promega). Proteins were resolved by SDS-PAGE and quantitated by PhosphorImager analysis (Molecular Dynamics).
Electrophoretic Mobility Shift Assays-- Binding reactions were performed at room temperature for 30 min and contained equimolar amounts of IVT protein or 10 µg of nuclear extracts, 10 mM Tris, 1 mM EDTA, 1 mM dithiothreitol, 75 mM KCl, 4% Ficoll, 12.5 mg/ml poly(dI·dC) (Amersham Pharmacia Biotech), and 5 × 105 cpm/ml of 32P-labeled double-stranded oligonucleotide probe. Protein-DNA complexes were resolved on a 6% (19:1) acrylamide:bisacrylamide (Bio-Rad), 0.5× TBE gel at 200 V for 4.5 h, dried, and subjected to autoradiography.
The following double-stranded synthetic oligonucleotides were used (top
strand):
B, 5' CTAGCGAGAAATAAAAGGAAGTGAAACCAAGT 3'; GAL4, 5'
GAGCGGAGTACTGTCCTCCGAG 3'; c-FES, 5' CGGAATCAGGAACTGGCCGGGG 3'.
GST Affinity Chromatography--
The GST fusion proteins were
created by inserting the entire coding sequence of SPI-B or PU.1 into
the pGEX vector multiple cloning site (Amersham Pharmacia Biotech).
DH5
cultures expressing the fusion proteins were grown to
saturation, diluted 1:10 in Luria broth, grown for 1 h at
30 °C, and induced with 1 mM
isopropyl-1-thio-
-D-galactopyranoside for 4 h at
30 °C. Cells were then pelleted, washed once with NETN buffer (20 mM Tris, 100 mM NaCl, 1 mM EDTA,
0.2% Nonidet P-40), and sonicated on ice with 3-15-s bursts. Cell
debris was then pelleted, and the fusion proteins were bound to
pre-swelled glutathione-agarose beads (Sigma) for 30 min at 4 °C.
Beads were then washed 3 times with NETN.
[35S[Methionine-incorporated IVTs were pre-cleared for 1 h with glutathione-agarose beads at 4 °C. Equivalent amounts of fusion protein as judged by Coomassie staining were incubated with equal counts of IVT proteins for 1 h at 4 °C in NETN buffer. Beads were then washed 5 times with NETN, boiled in loading dye, fractionated by 10% (37.5:1) acrylamide:bisacrylamide (National Diagnostics) SDS-PAGE, and subjected to autoradiography.
Western Blot--
3T3 cells were transfected with 24 µg of
expression plasmids coding for HA epitope-tagged versions of each
construct (18), and protein extracts were made 24 h
post-transfection. Extracts were subjected to Western blot analysis
using standard techniques and probed with an anti-HA antibody (Babco).
| |
RESULTS |
|---|
|
|
|---|
Identification of Independent Transactivation Domains--
To
identify regions of the SPI-B protein that could function as
independent transactivation domains, portions of the SPI-B cDNA
were fused in frame to the C terminus of the GAL4 DNA binding domain
and tested for their ability to transactivate five linked copies of the
GAL4 DNA-binding site upstream of a minimal TK promoter and the human
growth hormone cDNA (pGAL4GH) when co-transfected into NIH 3T3
cells (Fig. 2A). As
demonstrated in Fig. 2A, the PEST region of SPI-B exhibited
no transactivation potential (GAL4/PEST), but the N-terminal 108 amino
acids (aa, GAL4-(1-108)) potently activated the expression of the
pGAL4GH reporter. C-terminal deletions within this region revealed that
even the very N-terminal 30 aa (GAL4-(1-31)) could function as an
independent transcriptional activator. N-terminal truncations of this
region showed that aa 31-108 could also function as a transcriptional
activator (data not shown), but aa 63-108 (GAL4-(63-108)) were unable
to activate transcription. The small stretch of aa contained in the
GAL4-(31-61) was able to transactivate the reporter, thereby
localizing two independent transactivation domains of SPI-B to aa 1-31
and aa 31-61.
|
To delineate further the domain contained between aa 31-61 (which
conferred transcriptional activity at the
B site, see below), a
series of smaller fusion proteins were generated. As demonstrated in
Fig. 2A, GAL4-(31-51) and GAL4-(41-61) still functioned as transcriptional activators, and in fact only 10 aa (GAL4-(41-51)) retained some transactivation potential even though the flanking aa
(GAL4-(31-41) and GAL4-(52-62)) did not. However, due to the strong
potential exhibited by GAL4-(41-61) over GAL4-(41-51), it appears
that the full transcriptional activation domain resides between aa 41 and 61. To ensure that all constructs were stably expressed and capable
of binding to the GAL4 DNA element, nuclear extracts were prepared from
COS cells transfected with all constructs shown in Fig. 2A
and assayed for their ability to bind DNA in an electrophoretic
mobility shift assay (EMSA lanes 2-14, Fig. 2B).
Based upon the GAL4 fusion protein analyses, it appears that SPI-B contains two independent transcriptional activation domains. The N-terminal domain (aa 1-31) has a calculated pI of 3.8, making it an acidic domain, similar to a motif found in PU.1 (19) and other Ets proteins (49). However, aa 41-61 most resemble a proline-, serine-, and Threonine (PST)-rich domain since they comprise almost 40% of the amino acids in this region, although it also has some acidic characteristics. PST activation domains have also been identified in GATA factors (45) as well as the homeodomain protein Pax6 (50). Interestingly, computer based alignment of the PST activation domain of SPI-B yielded no similarity with PU.1 or any other Ets family member (data not shown).
Transcriptional Activity at the
Enhancer--
It has
previously been demonstrated that PU.1 or SPI-B in conjunction with the
lymphoid-specific co-activator Pip (13) effectively transactivates a
DNA element from the
2-4 enhancer (5' AAAAGGAAGTGAAACC 3'), termed the
B site, which is
required for maximal activity of the enhancer (23). Full-length PU.1,
SPI-B, and N-terminal deletions of SPI-B were tested for their ability to transactivate a tetramer of the
B site upstream of a minimal TK
promoter driving growth hormone expression (pB4TKGH). As shown in Fig.
3A, both PU.1 and SPI-B, in
combination with Pip, efficiently transactivated (15-20-fold over the
empty mammalian expression vector pCDNA3) pB4TKGH. Deletion of the
entire N terminus of the protein, leaving only a PEST and Ets domain
(
2-106), produced a construct that did not transactivate pB4TKGH.
Deletion of the first 30 aa of SPI-B (
2-30) yielded a construct
with almost wild type levels of transactivation, but subsequent
deletion of the first 61 aa (
2-62) resulted in a construct with no
transactivation potential (Fig. 3A). This implies that only
aa 31-61 are required for transactivation at the
enhancer.
|
To define further the
B transactivation domain, small deletions were
generated in the N terminus of SPI-B. Deletion of aa 31-62 (
31-62)
or 31-107 (
31-107) sharply reduced transactivation, whereas
deletions adjacent to aa 31-62 (
64-107) only modestly affected
transactivation potential. These data demonstrate that aa 31-62 of
SPI-B function as the primary transcriptional activation domain at the
enhancer. The residual activity observed in
31-62 and
31-107 is most likely due to the N-terminal acidic domain defined
by the GAL4 analysis, although it cannot compensate for the loss of the
PST domain contained in aa 31-62.
To analyze the importance of other SPI-B domains for transactivation of
the
B site, further deletions were made within the PEST (
PEST)
and Ets (
Ets) regions. Deletion of the PEST region reduced the
transactivation potential to levels detected if full-length SPI-B were
transfected without Pip (data not shown). This loss of transactivation
potential could be due to the inability of this construct to recruit
Pip to the
enhancer that requires an intact PEST sequence (14).
However, we determined that
PEST was poorly expressed in 3T3 cells,
making it difficult to interpret these results (Fig. 3D). As
expected, deletion of the Ets domain, which blocks the ability to bind
DNA, completely abolished transactivation. Finally, deletion of the
very C terminus of SPI-B (
257-262), which is not conserved with
PU.1, did not significantly alter transactivation from the full-length
SPI-B.
To confirm the ability of these SPI-B plasmids to be expressed in
mammalian cells, nuclear extracts were prepared from COS cells
transfected with each of the above constructs and tested for their
ability to bind to a single copy of the
B DNA site by EMSA. As
demonstrated in Fig. 3B (lanes 2-13), all
constructs, except for the Ets deletion mutant (
166-256, lane
12), produced a protein-DNA complex not observed in COS cells
transfected with empty expression vector (pCDNA3, lane
2), and these constructs migrated more rapidly than the
full-length SPI-B. All mutant proteins (except for
PEST and
Ets)
were found to interact equivalently with Pip using in vitro
transcribed and translated (IVT) plasmids and EMSA (Fig.
3C). Finally, all constructs that failed to transactivate the
B reporter element were assayed for stable expression in 3T3
cells by HA epitope tagging (Fig. 3D, lanes 2-10). All
proteins (with the exception of
PEST) were found to be expressed at
least as well as the positive control PU.1 protein (Fig.
3D). Of note, HA
31-62, which defines the minimal domain
required for transactivation of the
B reporter element, was
expressed at levels identical to HA SPI-B (Fig. 3D, lanes 3 and 6). Thus, SPI-B seems to require not only its PEST and
Ets domains for transactivation of the
enhancer, but also a small
number of amino acids (31-61) in its N terminus which corresponds to
the PST activation domain.
Importance of Specific Amino Acids for Transactivation Potential of
SPI-B--
To identify important residues of SPI-B required for
interactions with Pip, DNA, and other factors, a series of
non-conservative mutations in SPI-B were created by site-directed
mutagenesis. One important residue in the PEST domain of PU.1 is
Ser-148, whose phosphorylation by casein kinase II is critical for
proper recruitment of Pip and transactivation of the
enhancer (13,
14, 17, 18). The analogous residue in SPI-B (Ser-144) was mutated to alanine to test whether phosphorylation of this residue is also critical for the SPI-B-Pip interaction. Much like the PU.1 S148A construct, the SPI-B S144A protein reduced the transactivation from the
wild type protein by approximately 2-fold (Fig.
4A). However, this
transactivation is still higher than when the entire PEST region of
SPI-B is deleted (
PEST, Fig. 3A). This implies that there
may be contacts other than Ser-144/Ser-148 made between SPI-B or PU.1
with Pip that are important for transactivation in this system.
|
Next, the importance of a specific amino acid in SPI-B for contact with
DNA and proper transactivation of the
B element was tested by
mutating Lys-242 to glycine. Based on the co-crystal data of the Ets
domain of PU.1 with DNA (51), this mutation in the Ets domain of SPI-B
should abolish DNA binding by preventing DNA bending toward the
recognition helix. As demonstrated (Fig. 4B), the K242G
mutation completely abolishes transactivation at the
enhancer,
implying that DNA binding is prevented (see below). Importantly, K242G
is expressed at wild type levels (see Fig. 3D).
Further analysis of important phosphorylation events was performed by
the creation of two separate point mutations within the PST domain that
have been shown to affect SPI-B or PU.1 function. To test the
importance of the interaction of SPI-B with Rb, Thr-56 was mutated to
alanine to block its phosphorylation by ERK1, thereby allowing Rb to
interact with SPI-B constitutively (24). This mutation had no effect on
transactivation (Fig. 4A), implying that this amino acid
does not play a role in the transcriptional activation of SPI-B at the
B site. Finally, mutation of two phosphorylation sites in the N
terminus of PU.1 (Ser-41 and Ser-45) to alanine have been shown to
inhibit macrophage proliferation in vitro (52). A similar
phosphorylation site in SPI-B (S37), when mutated to alanine, caused no
change in transactivation. All proteins were expressed in 3T3 cells,
based on Western blot analysis (Fig. 3D, lanes 2, 3, 11, and
12) and bound DNA (except K242G, lane 7) in EMSAs
(Fig. 4B, lanes 2-9). Single mutations of all other
possible phosphorylation sites to alanine between aa 31 and 61 (Ser-32, Ser-33, Tyr-34, Ser-43, Thr-48, and Tyr-58) of SPI-B showed only minor
changes in transcriptional activity at the
B element (data not shown).
To investigate further the interactions between SPI-B and Pip at the
B DNA element, IVT proteins were generated, and equimolar amounts
were used in an EMSA assay at the
B site to test their ability to
bind DNA and interact with Pip. Pip has previously been shown to bind
very poorly to this site and requires recruitment via PU.1 (13, 14,
18). As shown in Fig. 4C, PU.1 efficiently binds to this DNA
site (lane 2) and recruits Pip (lane 3) to form a
ternary PU.1-Pip-DNA complex that migrates more slowly. A S148A mutation in PU.1 greatly reduces the recruitment of Pip to this site
(lanes 4 and 5). Like PU.1, SPI-B is able to form
a ternary complex with Pip (lanes 6 and 7) at
this site, and the mutation S144A blocks the recruitment of Pip
(lanes 8 and 9). Deletion of the entire PEST
region of SPI-B (
PEST) does not prevent DNA binding (lane
12) but does inhibit the recruitment of Pip to the site
(lane 13).
Finally, two mutations that affect SPI-B DNA binding ability were
tested for their ability to recruit Pip. First, the K242G mutation in
SPI-B was found not to bind DNA by itself (lane 10), but a
small amount of the ternary complex was formed when Pip was added
(lane 11). This implies that a low affinity DNA-Pip interaction may be enough to allow the lower affinity K242G mutation to
bind DNA. This type of mechanism has been observed with PU.1 and Pip at
the CD20 promoter (16). However, a complete deletion of the Ets domain
of SPI-B (
Ets) prevents both DNA binding (lane 14) and
formation of the ternary complex with Pip (lane 15).
Thus, while it appears that DNA binding and recruitment of Pip through
a phosphorylated Ser-144 of SPI-B are important events for
transactivation of the
B site, the mutation of any single Ser, Thr,
or Tyr residue between aa 31 and 61 to alanine did not dramatically
affect transactivation by SPI-B.
SPI-B Activity at the c-FES Promoter--
To investigate the
ability of SPI-B to transactivate a native promoter element that does
not require Pip, a 450-base pair element derived from the
c-FES promoter was tested. This promoter has been shown to
require PU.1 (44) for maximal activity, as well as to be activated by
SPI-B (21, 22). However, in our hands, SPI-B was unable to
transactivate this promoter to the same levels as PU.1 (Fig.
5A). To test which domain(s)
of SPI-B was responsible for this difference, a pair of chimeric
molecules was generated where the PU.1 and SPI-B Ets domains were
swapped. Thus, PU.1/SPI-B Ets is PU.1 with the SPI-B Ets domain, and
SPI-B/PU.1 Ets is SPI-B with the PU.1 Ets domain. As demonstrated in
Fig. 5A, the ability to transactivate this promoter
segregated with the PU.1 Ets domain. This implies that either a
difference in DNA binding or protein-protein interaction through the
Ets domain of PU.1 are required for maximal activity of the
c-FES promoter. Importantly, both the SPI-B/PU.1 Ets and
PU.1/SPI-B Ets proteins efficiently transactivated the
B reporter
plasmid (data not shown). These results are surprising because we
assumed that the transcriptional activation domains of SPI-B, not its
Ets domain, would prevent it from transactivating the c-FES
promoter. To ensure that all constructs were capable of binding DNA,
nuclear extracts from COS cells transfected with PU.1, SPI-B, and the
two chimeric molecules were shown to contain proteins that bound to the
B site (Fig. 5B, lanes 2-5). Furthermore,
each protein could also be detected by Western blot assay at levels
comparable to the positive control PU.1 (Fig. 3D, lanes 2, 3, 13, and 14).
|
To examine this further, equimolar amounts of IVT proteins were used in
an EMSA (Fig. 5C) with oligonucleotides from both the
B
site as well as the PU.1 site from the c-FES
promoter (
11 to +11, 5' TCAGGAACTG 3'). All four
proteins, PU.1, SPI-B, SPI-B/PU.1 Ets, and PU.1/SPI-B Ets, bound to the
B site efficiently (lanes 2-5) and interacted with Pip
to form a ternary complex with DNA (lanes 6-10). However,
only the PU.1 and SPI-B/PU.1 Ets constructs were able to efficiently
bind to the c-FES site (lanes 12-15). By
calculating binding constants for PU.1 and SPI-B at the
B and
c-FES sites, PU.1 binds to the
B site 2-fold better than SPI-B but greater than 10-fold better to the c-FES site
(data not shown). Together, these data indicate that although the SPI-B Ets domain seems to bind to the
B site, it binds at a much lower efficiency than PU.1 to the c-FES site. Therefore it appears
that SPI-B has an overlapping but not identical DNA binding affinity to
PU.1.
Protein-Protein Interactions of SPI-B and PU.1--
PU.1 has been
shown to interact with multiple proteins such as c-Jun (9), IRF family
members (18), NF-IL6
(10), TBP (20), and other Ets proteins (8, 11,
12) to more potently activate transcription. GST affinity
chromatography was utilized to explore which of the PU.1 interaction
partners SPI-B could also bind. Full-length PU.1 and SPI-B cDNAs
were fused to the C terminus of the GST protein, bound to
glutathione-agarose beads, and tested for their ability to interact
with [35S[methionine-incorporated IVT forms of Rb, TBP,
NF-IL6
, c-Jun, PU.1, and SPI-B. Although PU.1 and SPI-B appeared to
react equivalently with TBP and c-Jun, SPI-B reproducibly did not bind
NF-IL6
or Rb as well as PU.1 (Fig. 6
and data not shown). The most likely explanation for NF-IL6
is that
while the Ets domain is required for interaction with C/EBP family
members, sequences on the very C terminus of PU.1, which are not
present in SPI-B, increase the affinity of this interaction. For Rb, it
has been shown that the two strongly acidic domains of PU.1 are
required for this interaction (20), whereas SPI-B has a single, weakly
acidic domain. None of the IVT proteins bound significantly to GST
alone; 1/10 the IVT used in each binding reaction is shown as input for
comparison. A similar binding pattern was observed in the presence of
50 µg/ml of the DNA intercalating agent ethidium bromide (data not
shown), proving that all observed interactions are DNA-independent.
|
Finally, SPI-B and PU.1 both seem to interact with themselves in a
DNA-independent manner. However, an interaction between SPI-B and PU.1
was only detected with GST-SPI-B and IVT PU.1 but not GST-PU.1 and IVT
SPI-B. One explanation for this observation is that GST-PU.1 may
strongly dimerize with itself on the agarose beads and block the
binding of IVT SPI-B. We were unable to reproducibly detect an
interaction between either PU.1 or SPI-B with Ets-1 (data not shown).
Based upon these results, SPI-B is able to interact with similar
proteins as PU.1, although not with the same affinity in the case of
NF-IL6
and Rb. However, we cannot rule out differences in
interactions with other unknown cofactors that may contribute to the
in vivo function of these two proteins.
| |
DISCUSSION |
|---|
|
|
|---|
We reasoned, based on the phenotypes of the
PU.1
/
and
Spi-B
/
mice, that differences in
DNA-binding sites, transactivation domains, or interactions with
cofactors would exist between PU.1 and SPI-B. To define better these
structural and functional differences, we have delineated functional
domains of SPI-B that allow it to activate transcription, as well as to
investigate its interactions with known cofactors of PU.1. Initial
studies based upon GAL4 fusion proteins and activation studies at a
GAL4 DNA site have allowed us to map two independent activation domains
in the N terminus of SPI-B. The first domain, located between amino
acids 1 and 31, displays potent activation potential in the GAL4 system and represents a weakly acidic motif similar to that of PU.1 and most
other Ets proteins (49) (see Fig. 7).
Interestingly, this region is dispensable for the ability of SPI-B to
transactivate the
B site of the lambda enhancer. In direct contrast,
the second activation domain of SPI-B located between amino acids 41 and 61 as defined by the GAL4 system is essential for transactivation of the
B site. A similar example of transactivation domain
selectivity has been observed for PU.1 at the J chain promoter in which
the glutamine-rich region of PU.1 is required for maximal activity, but
the acidic domains are dispensable (7). The important difference is
that the transactivation domain required for SPI-B activity is a PST
domain, a motif not observed in PU.1 or any other Ets family member
(49). Although it is not surprising that SPI-B and PU.1 have different
activation domains given the lack of similarity (only 20%) in the N
terminus, it is unexpected that the two proteins contain activation
domains containing widely divergent amino acids. Thus, differences in
which genes are activated by PU.1 and SPI-B may rest upon which
cofactors are recruited by a glutamine-rich versus PST
domain.
|
To investigate further the ability of SPI-B to transactivate the
B
DNA element, we explored the interactions of SPI-B with Pip at this
element. First, like PU.1, SPI-B must bind to the DNA element and
subsequently recruit Pip to the element. This recruitment, based upon
our EMSA data, requires a phosphorylated Ser-144. Interestingly, our
transfection data imply that whereas the PU.1 or SPI-B interaction via
Ser-148/Ser-144 is important for maximal activity, it is not absolutely
required as has been previously reported by some (13, 17, 18). The most
likely explanation for these data is that the conditions of our
transient transfections promote high level expression of the cDNA
constructs and reporter, allowing lower affinity interactions between
SPI-B or PU.1 and Pip to compensate for the loss of phosphorylated
Ser-144/Ser-148 at the interaction site, as reported by Brass et
al. (18). These interactions are difficult to detect by EMSA
because very small amounts of each IVT protein (
10 fmol) are used in
each binding.
The inability of SPI-B to transactivate the myeloid c-FES
promoter is perhaps most puzzling based upon the similarities in the
Ets domain between PU.1 and SPI-B. Although it has been reported that
PU.1 and SPI-B can transactivate this element (22), our data do not
support this conclusion for SPI-B. One explanation is that Ray-Gallet
et al. (22) observed lower transactivation (2-fold
transactivation versus 12-fold from our data for PU.1) due
to lower transfection efficiencies that may mask differences between
constructs due to experimental error. Another explanation we cannot
exclude is that the HeLa cells used by Ray-Gallet et al.
(22) contained a cofactor required by the Ets domain of SPI-B for DNA
binding and/or transcriptional activity at the c-FES promoter which is absent in our NIH 3T3 cells. Nonetheless, the evidence that SPI-B does not bind to the
11 to +11 PU.1 site in the
c-FES promoter is surprising because multiple lines of evidence suggested that SPI-B had an identical DNA binding specificity to PU.1 in vitro (21, 23). However, based upon inspection of
the 3' flank for PU.1 and SPI-B consensus DNA-binding sites derived
from site-selection experiments (22), the CTG contained in the 3' flank
of our c-FES-derived site (5' TCAGGAACTG 3')
does not appear in any of the sequences recovered for SPI-B but is recovered for PU.1. This implies that differences in the 3' flank of
the GGAA core of the PU.1/SPI-B DNA-binding site may determine the
relative affinities of the two transcription factors for DNA. Based
upon these differences in the 3'-flanking sequences, our data suggest
that subtle differences in the
1 helix of the Ets domain may be
responsible for differences in DNA binding affinity. This helix
positions a critical arginine residue (Arg-173 in PU.1 and Arg-170 in
SPI-B) involved in neutralization of the phosphate backbone 3' to the
GGAA core which allows DNA bending toward the recognition helix (51,
53, 54). Further analysis is required to ensure that the observed
differences in DNA binding affinity between PU.1 and SPI-B is truly due
to a difference in specificity. Nonetheless, analysis of divergent
amino acids within this region of the PU.1 and SPI-B Ets domains may
provide biochemical explanations for differences of DNA binding
specificities of not just the PU.1 subfamily but other Ets proteins as well.
One proposed function of PU.1 is to act not only as a transcriptional
activator but as a "scaffolding protein" which binds DNA and then
allows other transcription factors to bind through protein-protein
interactions, thereby creating an activation complex that recruits the
basal transcription machinery to a promoter (33, 34, 55-57) for potent
transcription. In fact, recent reports have shown that some or all of
the activation domains of PU.1 are dispensable for transactivation, as
long as other factors such as c-Jun, Pip, bZIP proteins, or other Ets
proteins are also present (7, 12, 31, 55). Since these combinatorial
protein-protein interactions are important for proper tissue and
temporal gene expression, we chose to examine the ability of SPI-B to
interact with other proteins known to interact with PU.1. By using GST affinity chromatography, we have shown that SPI-B can interact with
similar proteins to PU.1, although perhaps with lower affinity in the
case of NF-IL6
and Rb. In addition, the ability of SPI-B to interact
with TBP most likely allows it to transactivate the TATA-less
c-FES promoter as long as it can bind to the promoter by
using a PU.1 Ets domain. Thus, as with PU.1, SPI-B may transactivate TATA-less promoters in B lymphocytes by recruiting TBP and interact with other transcription factors to form an activation complex similar
to PU.1.
Important differences in the transcriptional activation domains and DNA
binding activity of SPI-B and PU.1 suggest that they have different
target genes in vivo and therefore provide a framework to
understand the non-redundancy presented by the
PU.1
/
and Spi-B
/
animals. However, we cannot formally exclude the
possibility that the genetic evidence of non-redundancy is due in part
to post-translational modifications such as phosphorylation or
interactions with currently unknown cofactors that might the modulate
the activity of PU.1 and SPI-B in vivo. Future experiments
to understand the role of SPI-B as well as the different activation
domains of PU.1 will provide important insights into not only the
biology of these two proteins and how they are regulated but also how
the interactions between different transactivation motifs can interact
with the basal transcription machinery to cause gene expression.
| |
ACKNOWLEDGEMENTS |
|---|
We thank A. Brass and H. Singh for multiple
vectors and thoughtful advice; M. Atchison for the NF-IL6
cDNA;
and E. Morrisey and M. Parmacek for the pGAL4 and pGAL4GH vectors. We
thank L. Gottschalk, G. Schneider, and D. Wiler for expert preparation of the illustrations; Cheryl Small for secretarial assistance; and
Donna Fackenthal for automated sequencing analysis. We also thank E. Morrisey, H. Ip, and T. McKeithan for critical review of the manuscript.
| |
FOOTNOTES |
|---|
* The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
§ Fellow of the Medical Scientist Training Program at the University of Chicago.
** Supported by National Institutes of Health Grant HL5-2094 and a Howard Hughes Medical Institute Investigator. To whom correspondence should be addressed: Howard Hughes Medical Institute, University of Chicago, 5841 S. Maryland Ave., MC 1028, Chicago, IL 60637. Tel.: 773-702-4721; Fax: 773-702-2681; E-mail: csimon{at}medicine.bsd.uchicago.edu.
2 L. Garrett-Sinha, G. Su, S. Rao, Z. Hao, M. Clark, and M. C. Simon, submitted for publication.
| |
ABBREVIATIONS |
|---|
The abbreviations used are:
NF-IL6
, nuclear
factor interleukin-6
;
Rb, retinoblastoma protein;
PEST, proline-,
glutamic acid-, serine-, and threonine-rich, aa, amino acid(s);
B4, tetramerized
B element;
TK, herpes simplex virus thymidine kinase
promoter;
GH, human growth hormone protein;
PCR, polymerase chain
reaction;
CMV, cytomegalovirus;
GAL4, GAL4 DNA binding domain;
EMSA, electrophoretic mobility shift assay;
GST, glutathione
S-transferase protein;
IVT, in vitro transcribed
and translated protein;
HA, the hemagglutinin epitope YPYDVPPDYA;
PAGE, polyacrylamide gel electrophoresis.
| |
REFERENCES |
|---|
|
|
|---|