|
J Biol Chem, Vol. 274, Issue 16, 11390-11398, April 16, 1999
Posttranslational Removal of the Carboxyl-terminal KDEL of
the Cysteine Protease SH-EP Occurs Prior to Maturation of the
Enzyme*
Takashi
Okomoto §,
Takao
Minamikawa ,
Gerald
Edward¶,
Vikram
Vakharia¶, and
Eliot
Herman
From the Department of Biological Sciences, Tokyo
Metropolitan University, Minami-osawa, Hachioji, Tokyo, 192-0397 Japan, the ¶ Center for Agricultural Biotechnology, University of
Maryland, College Park, Maryland 20742, and the Climate
Stress Laboratory, United States Department of Agriculture/Agricultural
Research Service, Beltsville, Maryland 20705
 |
ABSTRACT |
SH-EP is a cysteine protease from
germinating mung bean (Vigna mungo) that possesses a
carboxyl-terminal endoplasmic reticulum (ER) retention sequence, KDEL.
In order to examine the function of the ER retention sequence, we
expressed a full-length cDNA of SH-EP and a minus-KDEL control in
insect Sf-9 cells using the baculovirus system. Our observations on the
synthesis, processing, and trafficking of SH-EP in Sf-9 cells suggest
that the KDEL ER-retention sequence is posttranslationally removed
either while the protein is still in the ER or immediately after its
exit from the ER, resulting in the accumulation of proSH-EP minus its
KDEL signal. It is this intermediate form that appears to progress
through the endomembrane system and is subsequently processed to form mature active SH-EP. The removal of an ER retention may regulate protein delivery to a functional site and present an alternative role
for ER retention sequences in addition to their well established role
in maintaining the protein composition of the ER lumen.
 |
INTRODUCTION |
SH-EP is a thiol protease expressed in germinating mung bean
(Vigna mungo) cotyledons (1-3) that is among a large number of similar cysteine proteases that are synthesized after germination in
order to degrade seed storage proteins (2, 4-10). All cysteine proteases are initially synthesized as larger precursor proteins with
NH2-terminal prodomains of approximately 120 amino acids (11). The prodomain is an inhibitor of the protease (12) and is
essential in the correct folding of the protein (13). Processing of the
proenzyme occurs by self-catalysis (14) in post-Golgi compartments of
the secretory system. With intracellular proteases, this processing
occurs in the lytic compartment (lysosomes or vacuoles) (15); with
extracellular proteases, the processing occurs during secretion (16).
Targeting to the correct compartment for processing is mediated by a
peptide (17) or phosphomannose (18) targeting signal on the
NH2-terminal precursor domain that is recognized by a
specific receptor that is presumed to be localized in the Golgi
apparatus (19, 20) to target the protein to the activating compartment.
SH-EP is unusual because it and a few closely related thiol proteases
(21-23) are the only cysteine proteases known to possess a
carboxyl-terminal ER1
retention sequence KDEL (24-26). Although papain superfamily proteases are widely distributed among eukaryotes (27, 28), only these plant
cysteine proteases have been identified as possessing a carboxyl-terminal ER retention sequence. Several other legume cysteine
proteases have been cloned that do not possess a KDEL tail (28-34),
indicating that even among legumes and more broadly in plants these
KDEL-proteases appear to constitute a special class. Plant cells
utilize both HDEL and KDEL as ER retention sequences (35-38). The
presence of a carboxyl-terminal KDEL in SH-EP raises a question as to
whether this sequence is functional in vivo. A papain
superfamily cysteine protease would appear to be an unusual putative
constituent of the ER lumen, which is the site of glycosylation and
folding in the initial steps of protein assembly. SH-EP is a general
protein hydrolase whose activity is lytic and not a protein that would
be expected to be retained in the ER lumen. Moreover, although cysteine
proteases are self-processed (39-42), other enzymes such as the
asparaginyl endopeptidase (43, 44) or vacuolar processing enzyme (VPE)
(45, 46) may also be required. The necessary acid/reducing conditions
for activation are available in the vacuolar lytic compartment (47) and
within secretory vesicles exiting the trans-Golgi; however,
these conditions are absent in the ER lumen. Consequently,
KDEL-mediated retention of SH-EP in the pre-Golgi endomembrane system
would be expected to inhibit its processing and activation, resulting
in the accumulation of the inactive precursor enzyme in the ER lumen.
In this paper, we describe the processing of SH-EP expressed in Sf-9
cells. We demonstrate that although the proSH-EP is synthesized with a
KDEL sequence, this sequence is posttranslationally removed from the
proSH-EP. The proSH-EP without KDEL is subsequently processed to form
mature SH-EP in a multistep process as observed in seeds (2, 43) that
results in a KDEL-minus mature 33-kDa active protease (48). We
hypothesize the KDEL sequence on the inactive proSH-EP functions to
permit the seed cells to build up an inventory of precursor protein in
the ER that can then be delivered to the vacuole to rapidly mobilize
the stored protein. We propose that the temporary sequestration of a
KDEL-tailed protease precursor has been evolved to exploit the
ER-retention system store proSH-EP as a "transient zymogen."
 |
EXPERIMENTAL PROCEDURES |
Expression of SH-EP in Escherichia coli--
SH-EP lacking
putative signal peptide was expressed in E. coli BL21(DE3)
and purified as described (44).
Preparation of Recombinant Baculovirus--
The DNA insert of
full-length SH-EP cDNA was cut out of pBLUESCRIPT II
KS+ vector by PstI and BamHI, and was
subcloned into pVL1393 baculovirus transfer vector cut by the same
enzymes. Using the pVL1393 vector harboring SH-EP cDNA and
BaculoGoldTM transfection kit (PharMingen), recombinant
baculovirus containing KDEL-plus SH-EP was prepared and amplified
according to manufacturer's instructions. To prepare recombinant
baculovirus for KDEL-minus SH-EP, two kinds of mutagenic primers
(TCCTAGGAACAGTAGAGGGATTCTACTTGA and CCCTCTACTGTTCCTAGGACAACCTAACAG) and
pBLUESCRIPT II KS+ vector harboring SH-EP cDNA as a
template were used for recombination PCR. The PCR reaction was
proceeded in 100 µl for 30 cycles (94 °C for 1 min, 55 °C for 2 min, 72 °C for 2 min), and following the last cycle, the reaction
was incubated at 72 °C for 5 min. After gel electrophoresis, the
amplified fragment was cut from the gel and transformed directly to
E. coli JM109. The recombinant baculovirus containing
KDEL-minus SH-EP was prepared as KDEL plus SH-EP. After isolation of
plasmids, the introduce of mutation was checked by digestion with
BamHI, which is contained the in primer sequence and the
mutant DNA was sequenced by dye termination cycle sequencing kit (ABI,
Foster City, CA) and analyzed using an ABI 373A sequencer.
Active Site Cysteine Was Mutated to Glycine by PCR--
Two
primers (TGTGGTAGCGCTCTGGGCGTTTTC and AACGCCCAGCCGCTACCACATTG) were
used for mutation of the cysteine residue to glycine (C26G) and the
pBLUESCRIPT II KS+ vector with SH-EP cDNA as template.
The condition of PCR, isolation of mutant DNA, and the DNA sequencing
were run as same as above. The SH-EP (C26G) cDNA was excised from
the vector by PstI and BamHI and introduced into
the PstI-BamHI site of pVL1393 vector. The
sequence alteration was verified by DNA sequencing.
Production of KDEL Plus or Minus SH-EP and Cys-26 to Gly (C26G)
Mutants in Sf-9 Cells--
Sf-9 cells were grown at 27 °C in TNM-FH
medium (49) supplemented with 10% fetal bovine serum. Cultures were
grown in 25-cm2 culture dishes. Cells at the density of
5 × 105 cells/cm2 were infected with
recombinant baculovirus at a multiplicity of infection of 2. One to 4 days after infection, the media were collected and centrifuged at
200 × g for 5 min, and supernatants were retained.
Remaining cells attached to culture dishes were peeled off with
serum-free Grace's medium (Life Technologies, Inc.). The resuspended
cells were centrifuged at 200 × g for 5 min, and the
pellet was washed with serum-free Grace's medium and centrifuged
again. The pellet was then resuspended with 0.1 M Tris-Cl
(pH 8.0) and subjected to sonication (5 × 30 s, 30 watts, UR-20P, Tomy Seiko Co., Ltd.). The sonicated cells were centrifuged at
20,000 × g for 5 min, and the supernatants were used
as cell fractions. Protein content was measured with the Bradford
method using bovine serum albumin as a standard.
SDS-PAGE, Immunoblots, NH2-terminal Protein
Sequencing, and Activity Staining--
SDS-PAGE was conducted on
12.5% gel, and immunoblotting using a rabbit antiserum raised against
SH-EP was performed as described elsewhere (2). A monoclonal antibody
(1D3) was provided from Dr. S. Fuller, European Molecular Biology
Laboratory, Heidelberg (50). Non-denaturing PAGE and activity staining
was carried out as described previously (4). Automated
NH2-terminal protein sequencing was obtained by analysis of
43- and 42-kDa proSH-EP excised from Coomassie Blue-stained
polyvinylidene difluoride membrane blot of SDS-PAGE as described
(51).
Sucrose Gradient Centrifugation of Sf-9 Cell
Lysates--
Isopycnic sucrose centrifugation was accomplished by
lysing 3 day postinfection Sf-9 cells in 17% w/v sucrose in 25 mM HEPES pH 7.4, 2 mM EGTA, 1 mM
dithiothreitol, 0.1 mM phenylmethylsulfonyl fluoride with a
glass hand homogenizer. The lysate was centrifuged at 5,000 rpm for 5 min in a Sorvall RC-2b centrifuge. The supernatant was layered on a
continuous 17-45% sucrose gradient and centrifuged for 16 h at
7 °C in a Beckman SW-41 rotor at 30,000 rpm. After the run was
completed, the gradient was fractionated into 0.7-ml fractions and to
an aliquot of each an equal volume of 20% trichloroacetic acid was
added to precipitate total proteins. The resulting precipitate was
washed with cold acetone and processed for SDS-PAGE immunoblot as
described above.
Electron Microscopy and Immunocytochemistry--
Sf-9 cell
samples (3 day postinfection) of KDEL-plus and KDEL-minus SH-EP for
electron microscopy were fixed in 2% glutaraldehyde, 4% formaldehyde,
50 mM potassium phosphate, pH 7.4. The fixed cells were
dehydrated in a graded ethanol series and embedded in LR White resin.
Immunogold labeling of thin sections was accomplished by blocking in
10% fetal bovine serum in Tris-buffered saline with Tween (20 mM Tris-HCl, pH 7.4, 0.15 M NaCl, 0.5% Tween
20) for 15 min at room temperature. The sections were then labeled in
primary anti-SH-EP sera diluted 1:25 in blocking solution for 30 min at
room temperature. The bound IgGs were indirectly labeled by 10-nm goat
anti-rabbit IgG-colloidal gold (Ted Pella, CA) solution diluted 1:1 in
the blocking solution for 5 min at room temperature. After labeling the
sections were washed with Tris-buffered saline with Tween and distilled
water and then stained with 5% (w/v) uranyl acetate for 20 min. The
samples were visualized in a Phillips 400 electron microscope and the
images captured by Photometerics Sensys 1400 CCD camera interfaced to a
Power Macintosh computer.
Sucrose Gradient Centrifugation of Microsomes from Cotyledon
Cells--
V. mungo seeds were germinated on layers of wet
filter paper at 27 °C in darkness, and cotyledons were collected on
day 3 post-imbibition. Day 3 cotyledons (25 g) of V. mungo
seedlings were gently ground in a mortar and pestle with 62.5 ml of 0.2 M Tris-Cl, pH 7.4, containing 0.44 M sucrose, 1 mM EDTA, and 0.1 mM MgCl2. The
homogenate was centrifuged at 800 × g for 10 min and
then at 4,500 × g for 30 min. The supernatant was
again centrifuged at 100,000 × g for 60 min, and the
precipitate was used as a microsomal fraction. The fraction was washed
twice with the homogenization buffer and resuspended with 1.5 ml of the
buffer. The dissolved solution was centrifuged at 200 × g for 5 min, and the supernatant was layered on a continuous
0.6-1.6 M sucrose gradient and centrifuged at 100,000 × g for 17 h. After the run was completed, the
gradient was fractionated into 0.9-ml fractions and each fraction was
analyzed by SDS-PAGE immunoblotting with antiserum against SH-EP or
maize BiP (52).
 |
RESULTS |
Heterologous Expression of SH-EP in Sf-9 Cells--
Prior
research has demonstrated that papain can be expressed in insect Sf-9
cells using the baculovirus system (53). All members of the papain
superfamily of cysteine proteases are highly homologous, which suggests
that Sf-9 expression would be a suitable heterologous system to
elucidate the processing steps and would allow us to compare the
process of SH-EP activation with observations on the papain archetype.
Other plant proteins including seed storage proteins have been
successfully produced in baculovirus (54). The exposure of KDEL
sequences has been evaluated by expression of auxin-binding protein in
Sf-9 cells (55), indicating that heterologous expression would be
useful to evaluate the exposure of SH-EP's KDEL sequence. cDNAs of
the full-length plus-KDEL SH-EP and a minus-KDEL mutant were cloned
into a transfer vector and used to form a recombinant infective
particle in vivo using vectors and protocols from a
commercial vendor (PharMingen). The minus-KDEL control consisted of a
mutating the wild type cDNA by site-directed mutagenesis using PCR
to change the Lys residue in the carboxyl-terminal KDEL from AAA (Lys)
to TAA (stop).
Time Course of Expression of Plus-KDEL and Minus-KDEL cDNAs of
SH-EP--
The synthesis and processing of plus-KDEL and minus-KDEL
SH-EP was monitored by infecting Sf-9 cells with the recombinant baculovirus and then conducting a time-course assay of the Sf-9 cells
and the surrounding medium by SDS-PAGE immunoblot. Fig. 1A shows a comparison of the
distribution of SH-EP immunoreactive polypeptides in the cells and
medium for both plus-KDEL and minus-KDEL. The cells expressing
plus-KDEL at 1 day postinfection contain a prominent 43-kDa
immunoreactive polypeptide that continued to accumulate through day 3 postinfection, and decreases slightly in abundance by day 4. The 43-kDa
band appeared to broaden to a doublet on day 3 postinfection, and by
day 4 only the lower half of the doublet remained. On the second day,
the 39-kDa intermediate polypeptide was detected. By the fourth day,
little of the 39-kDa polypeptide remained, whereas the amount of 37-kDa
polypeptide appeared unchanged. Mature 33-kDa SH-EP was not observed
until the third day postinfection and increased by the fourth day.
Parallel analysis of the culture supernatant indicated that secretion
of SH-EP was delayed until the third day, with increasing quantities of
the enzyme observed by the fourth day. Only mature 33-kDa SH-EP was
secreted, although a faint band corresponding to the position of
proSH-EP can be discerned. The presence of this protein may result from
lysis of Sf-9 cells that occurs at increasing rate by the fourth
day.

View larger version (41K):
[in this window]
[in a new window]
|
Fig. 1.
Changes with time in molecular mass and
endopeptidase activity that accompany expression of plus- or minus-KDEL
SH-EP in Sf-9 cells. Sf-9 cells were infected with plus- or
minus-KDEL SH-EP baculovirus, and cell and medium fractions were
prepared after one to four days postinfection. A, cellular
fraction (10 µg of protein) and medium fraction (5 µl) were
separated by 12.5% SDS-PAGE and analyzed by immunoblotting with an
antiserum against SH-EP. V.m., lysate
from V. mungo seeds which provides control polypeptides for
SH-EP and its processing intermediates. B, cellular fraction
(10 µg of protein) was separated by 10% nondenaturing-PAGE, and
endopeptidase activity in the gel was visualized with gelatin plate
method (2). Purified mature SH-EP from V. mungo cotyledons
was loaded on SH-EP lanes.
|
|
Parallel expression of the minus-KDEL resulted in a similar pattern of
initial accumulation of the precursor, followed by progressive
processing and accumulation of the mature form during the 4-day time
course. However, the minus-KDEL was processed more quickly than the
plus-KDEL. By the fourth day postinfection, little proSH-EP or
intermediate forms remained in the cell; all of the SH-EP appeared to
be either intracellular or secreted 33-kDa mature SH-EP. Enhanced
processing and secretion of minus-KDEL indicates that the presence of
the KDEL functions to retard SH-EP in the endomembrane system in
location(s) where it is unable to be processed to the mature active
enzyme. In controls using uninfected Sf-9 cells, no immunoreactive
polypeptides were detected using anti-SH-EP antiserum in either
cellular or medium fractions (data not shown). Time course experiments
of expression of KDEL-plus and -minus SH-EP in Sf-9 cells were
independently performed in triplet, and the results of synthesis and
processing of SH-EPs were almost same (data not shown).
The Presence of the KDEL Sequence Does Not Influence Maturation and
Activity of Mature SH-EP--
In order to test whether the KDEL is
necessary for folding the SH-EP to result in an active mature protein
the activity of the recombinant SH-EP initially synthesized with and
without KDEL was compared. Cellular fractions were prepared from Sf-9
cells from 1 to 4 days postinfection, and the samples were assayed
using a gel-based activity staining for proteolysis (Fig.
1B). This shows that the control purified 33-kDa mature
SH-EP is visualized as a single digested band on the activity gel
(SH-EP lane). The cDNA clones encoding both the plus-
and minus-KDEL proteins also yielded active proteolytic enzymes with
the same mobility as the purified protein (plus-KDEL
lanes 1-4; minus-KDEL lanes
1-4). The accumulation of activity is directly in accord
with the pattern of accumulation of immunoreactive 33-kDa mature SH-EP.
The SH-EP protein initially synthesized as minus-KDEL yields
proteolytically active mature SH-EP on days 3 and 4, whereas the SH-EP
protein initially synthesized as plus KDEL yields a proteolytically
active protein only weakly in day 3 and at the same level as the
minus-KDEL protein on day 4. Thus, the KDEL is not required to produce
a correctly folded protein that undergoes maturation to an
enzymatically active form.
Posttranslational Processing of SH-EP in Sf-9 Cells Occurs in a
Series of Steps Similar to That in Mung Bean Cells--
To determine
whether heterologously expressed SH-EP would be processed analogously
to SH-EP from V. mungo, we compared the molecular mass of
SDS-PAGE fractionated lysates from each using immunoblots (Fig.
2). V. mungo SH-EP is
initially observed as a 43-kDa precursor that is processed through
intermediate forms of 39 and 36 kDa to a final product of 33-kDa. Sf-9
cell-expressed SH-EP is also initially observed as a 43-kDa
polypeptide; it is then observed as 42-, 39-, and 37-kDa intermediates
and finally as a mature 33-kDa form. These differences between the
V. mungo and Sf-9 processing pattern are shown in the
middle lane of Fig. 2, which shows
cofractionation of mixed lysates of V. mungo and Sf-9 cells.
The 43-, 39-, and 33-kDa bands clearly merge showing an apparent
identity of the processing forms. However, the 36-kDa band from mung
bean lysate and the 42- and 37-kDa band from the Sf-9 stand out as
specific forms.

View larger version (62K):
[in this window]
[in a new window]
|
Fig. 2.
Comparison of molecular masses of SH-EP
related polypeptides expressed in Sf-9 cells with those in V. mungo cotyledon. Extracts prepared from 3-day-old
cotyledons (0.2 mg of protein) and 3-day postinfection Sf-9 cells after
infection with plus-KDEL SH-EP baculovirus (10 µg of protein) were
separated by 12.5% SDS-PAGE and analyzed by immunoblotting with an
antiserum against SH-EP. V.m., extract from cotyledons;
Sf9, extract from Sf-9 cells;
V.m.+Sf9, mixture from extracts from cotyledons and
Sf-9.
|
|
The KDEL Is Apparently Removed from ProSH-EP--
Mature 33-kDa
SH-EP isolated from V. mungo cotyledons lacks the KDEL
sequence (48), suggesting that the KDEL sequence of SH-EP is removed
during the maturation process. A time course of plus-KDEL SH-EP
baculovirus expression in Sf-9 cells was analyzed by probing parallel
SDS/PAGE-immunoblots with anti-SH-EP antibody and with a monoclonal
antibody 1D3 specific for the KDEL (50). As Fig.
3, recombinant 43-kDa proSH-EP produced
in E. coli reacts with both anti-SH-EP and anti-KDEL. On the
second day postinfection with the plus-KDEL SH-EP baculovirus, a
prominent band at 43 kDa is immunolabeled by both SH-EP and KDEL
antibodies, indicating that the proprotein possesses the KDEL retention
sequence. In contrast, the 39-kDa partial processing step of SH-EP
observed with the anti-SH-EP is not labeled by the anti-KDEL antibody. A parallel control expression of the minus-KDEL baculovirus at day 2 postinfection is labeled only by the anti-SH-EP antibody. On day 3 postinfection with the plus-KDEL baculovirus, the anti-SH-EP antibody
labels a doublet at 42/43 kDa as well as the partial and mature
processing products of 39, 37, and 33 kDa. The parallel blot labeled
with the anti-KDEL antibody exhibited only a weak immunoreaction that
is associated with the upper band of the 43/42-kDa proSH-EP doublet.
The transition from the 43- to 42-kDa band within the doublet is
associated with the loss of the carboxyl-terminal KDEL, and this
appears to be initial step in the maturation of plus-KDEL SH-EP
expressed in Sf-9 cells. NH2-terminal sequencing of both
the 43- and 42-kDa polypeptides purified from Sf-9 lysates from the
third day postinfection by SDS-PAGE and blotting onto a polyvinylidene
difluoride membrane showed that both polypeptides had identical FDFHE
sequences, which result from cleavage of the signal sequence after
amino acid 22. This is identical to the NH2-terminal
sequence of 43-kDa proSH-EP purified from V. mungo cotyledons (data not shown). This indicates that the processing of
proSH-EP from 43 to 42 kDa does not result from alteration of the
protein at the NH2-terminal end and that the difference between the 43 and 42 kDa must be elsewhere on the polypeptide. On the
fourth day postinfection with the plus-KDEL SH-EP baculovirus, the
anti-SH-EP antibody labels 42-, faint 39-, 37-, and 33-kDa polypeptides
representing the proSH-EP and intermediate steps resulting in
maturation of the protease. In contrast, the anti-KDEL antibody does
not label any of the SH-EP polypeptides on day 4, indicating that the
KDEL sequence was removed from all of the polypeptides. The
anti-KDEL-labeled blot also shows a prominent band at approximately 60 kDa in lanes analyzed from Sf-9 extracts from both plus- and minus-KDEL
SH-EP baculovirus infection. Although we did not identify the protein
labeled by the anti-KDEL antibody, its molecular mass is consistent
with its being a reticuloplasmin that serves as an internal control for
the immunological cross-reactivity of the anti-KDEL antibody.

View larger version (54K):
[in this window]
[in a new window]
|
Fig. 3.
Immunoreactivity of SH-EP and its
intermediates expressed in Sf-9 cells to the monoclonal antibody 1D3
against the KDEL epitope. Sf-9 cells were infected with plus- or
minus-KDEL SH-EP baculovirus and the cellular fraction was prepared
after 2-4 days postinfection. The cellular fraction (10 µg of
protein) was separated by 12.5% SDS-PAGE, followed by immunoblotting
with an antiserum against SH-EP or a monoclonal antibody 1D3. rSH-EP is
E. coli-produced proSH-EP to provide a control.
|
|
ProSH-EP with and without KDEL Is Localized in a Different
Subcellular Fractions--
To examine the cellular localization of
proSH-EP and intermediates Sf-9 cells infected with the plus-KDEL SH-EP
baculovirus were lysed 3 days after infection and fractionated on a
17-45% continuous sucrose gradient by isopycnic centrifugation. The
resulting fractions were analyzed by SDS-PAGE immunoblot using the
SH-EP antibody as a probe (Fig. 4). The
42-kDa proSH-EP band was located at in fractions 2 and 3 and was well
separated from the 43-kDa proSH-EP that retains the KDEL in fractions
3-6. The isopycnic density of the 43-kDa peptide-containing fraction
is consistent with it containing ER derived microsomes. The 43-kDa
SH-EP has been found in ER fractions prepared from lysates of cotyledon cells (48). The separation of the 43- and 42-kDa proSH-EP based on
isopycnic density may indicate the possibility that the processing of
the 43-kDa proSH-EP to remove the KDEL is coordinated with the
protein's exit from the ER and its transfer to another cellular compartment. The 43-kDa proSH-EP is also observed in the fraction near
the bottom of the gradient. Whether this fraction constitutes a dense
cellular fraction or aggregates of cellular materials remains to be
determined.

View larger version (46K):
[in this window]
[in a new window]
|
Fig. 4.
Sucrose density gradient analysis of the
distribution of 43/42-kDa proSH-EP doublet in Sf-9 cells. The
extract prepared from the 3-day Sf-9 cells after infection with
plus-KDEL SH-EP baculovirus was separated with 12 ml of 17-45% (w/v)
sucrose gradient. The gradient fractions were analyzed by SDS-PAGE
immunoblotting with an antiserum against SH-EP.
|
|
Immunogold Localization of SH-EP in Sf-9 Cells--
To determine
what compartments the different forms of SH-EP localize to, immunogold
EM localization assays were conducted on plus- and minus-KDEL SH-EP
expressed in Sf-9 cells. To maximize the levels of protein, the assays
were conducted on 3-day cells. At this point, the lysis of cells is
minimized and the population of Sf-9 cells exhibits intact subcellular
structures that have not yet been disrupted. Expression of the plus-
and minus-KDEL SH-EP in the Sf-9 cells results in similar intracellular
distribution of the accumulated gene products. Most of the
intracellular immunogold labeling was observed to be associated with
large lytic compartments (lysosomes) containing disperse protein
deposits (Fig. 5 for KDEL-plus and Fig.
6 for KDEL-minus). The presence of
abundant SH-EP cross-reactive protein within lytic compartments is
consistent with the pattern of processing observed in time-course
immunoblots and the accumulation of cellular 33-kDa mature SH-EP. The
immunocytochemical observations also provide evidence on the mechanism
of mature 33-kDa secretion from the Sf-9 cells. Immunogold labeling of
SH-EP associated with the plasma membrane appears to be specific for a
surface-associated protein, possibly that adhered to the cell after
secretion. The contents of lytic compartments appear to be expelled
from the cell by fusion of exosomes to the plasma membrane that appear to be derived from lysosomes (Figs. 7 and
8).

View larger version (166K):
[in this window]
[in a new window]
|
Fig. 5.
EM immunogold analysis of the cellular
distribution of plus-KDEL SH-EP in Sf-9 cells. Immunogold labeling
is primarily localized within lysosomes and associated with the
exterior of the plasma membrane (PM).
|
|

View larger version (170K):
[in this window]
[in a new window]
|
Fig. 6.
EM immunogold analysis of the cellular
distribution of minus-KDEL SH-EP in Sf-9 cells. Immunogold
labeling is primarily localized within lysosomes and associated with
the exterior of the plasma membrane (PM), which appears to
be similar to the distribution of SH-EP expressed as plus-KDEL.
Mit, mitochondria.
|
|

View larger version (164K):
[in this window]
[in a new window]
|
Fig. 7.
EM immunogold assay of apparent secretion of
plus-KDEL SH-EP into extracellular space by expulsion of material in an
exosome. The exosomes appear to be identical to putative lysosomes
shown in Figs. 5 and 6. These organelles appear to fuse to the plasma
membrane to release its contents into extracellular space
(arrow).
|
|

View larger version (154K):
[in this window]
[in a new window]
|
Fig. 8.
Apparent secretion of minus-KDEL SH-EP into
extracellular space mediated by vesicles (exosomes) fusing to the
plasma membrane (arrow). A second vesicle
containing SH-EP is located adjacent to the exosome that appears to be
in position for a subsequent secretion event.
|
|
The 42-kDa SH-EP Was Also Detected in Cotyledon Cells and Localized
in Subcellular Fraction Distinct from ER--
In order to test for the
presence of the 42-kDa SH-EP in cotyledon cells, microsomes
fractionated by continuous sucrose gradients were analyzed. SDS-PAGE
immunoblotting analysis of the fractions using anti-SH-EP antiserum was
resulted in detection of the 42-kDa SH-EP near the bottom fraction
(fractions 3 and 4) (Fig. 9B). When BiP antibody was used for SDS-PAGE immunoblot analysis, an intense
band labeling BiP was observed in fractions 5, 6, and 7 (Fig.
9A). This indicates that the 42-kDa SH-EP localizes in a
more dense cell compartment than main compartment of the ER, whereas
band corresponding to the 43-kDa SH-EP was primarily detected in the
same fractions with BiP, suggesting that the 43-kDa SH-EP localized in
ER (Fig. 9, A and B). Although the 42-kDa SH-EP
was not observed in crude extract from cotyledons (Fig. 2), the
procedures for concentration of the subcellular compartment by
ultracentrifugation and sucrose gradient resulted in the detection of
the 42-kDa SH-EP, probably by enhancing its concentration. The low
level of 42-kDa SH-EPs in cotyledon suggests that it is quickly
processed to the 39- and 36-kDa SH-EP in cotyledons. This further
suggests that the 42-kDa SH-EP is quite transient and may be restricted
to a transport compartment bridging the ER where the 43-kDa SH-EP is accumulated and the vacuole where the 42-kDa SH-EP is processed to the
mature active 33-kDa form through two intermediates. Immunogold EM
studies are in progress to identify all of the cellular compartments sequestering SH-EP forms. Through such investigations, we hope to
identify and characterize the compartment containing the 42-kDa form.
The presence of 42-kDa SH-EP in cotyledon cells as well as in the Sf-9
cells indicates that the initial step of processing of proSH-EP, the
removal of KDEL, is not an artifact of expression on the heterologous
Sf-9 cells.

View larger version (73K):
[in this window]
[in a new window]
|
Fig. 9.
Sucrose density gradient analysis of the
distribution of 43/42-kDa proSH-EP doublet in cotyledon cells. The
microsomal fraction prepared from the germinated cotyledons was
separated with 11 ml 0.6-1.6 M sucrose gradient. The
gradient fractions were analyzed by SDS-PAGE immunoblotting with an
antiserum against maize BiP (A) or SH-EP (B).
Tubes 1 and 12 correspond to 1.6 and
0.6 M sucrose concentration, respectively. Cr,
crude extracts prepared from germinated cotyledons.
|
|
Mutation of the SH-EP Active Site Cysteine Does Not Inhibit
Posttranslational KDEL Removal but Does Alter the Pattern of Precursor
Sequence Processing--
To assess which processing steps of SH-EP
maturation are the consequence of self-catalyzed events the cysteine 26 active site sulfhydryl was mutated to a glycine (C26G mutant). This
produces a protein that would presumably be proteolytically inactive
and similar to a cysteine protease-related protein found in soybean seeds (P34) (31). A time course of C26G mutant expression in Sf-9 cells
was analyzed by SDS-PAGE immunoblots (Fig.
10). The processing of proSH-EP-C26G to
mature 33-kDa protein proceeds much more slowly than either plus- or
minus-KDEL SH-EP in parallel expression experiments. On day 3 postinfection, the 43/42-kDa doublet is observed in the C26G form,
indicating that the processing of the 43-kDa proSH-EP possessing KDEL
to the 42-kDa minus-KDEL form can occur in the absence of the catalytic
cysteine. Using the anti-KDEL monoclonal antibody 1D3, we confirmed the
presence of KDEL in the 43-kDa form, and the absence of the KDEL in the 42-kDa form. Intermediate 39- and 37-kDa processing steps of SH-EP were
not observed in the C26G mutant at any time point postinfection, suggesting that these intermediate processing products are only produced when the catalytic cysteine is available.

View larger version (40K):
[in this window]
[in a new window]
|
Fig. 10.
SDS-PAGE-immunoblot analysis of the
expression of C26G mutant SH-EP that removes the catalytic amino
acid. A time course of 1-4 days postinfection of the mutant of
the cellular and secreted proteins. The mutant SH-EP is initially
synthesized as a full-length 43-kDa protein that accumulated throughout
the time course and is secreted in small quantities by day 4. Posttranslational processing of the 43-kDa to the 42-kDa polypeptide is
observed by day 3 and continues to accumulate through day 4. Mature
33-kDa SH-EP also accumulates during days 3 and 4 in the cells and on
day 4 in the medium without the parallel accumulation of the 39- and
37-kDa processing intermediates. Parallel SDS-PAGE immunoblots assayed
with anti-KDEL monoclonal antibody 1D3 demonstrate that the initial
43-kDa polypeptide possesses KDEL and that the KDEL signal is gradually
lost during days 2-4 as the 42-kDa polypeptide accumulates. An
additional polypeptide that is probably a reticuloplasmin is observed
and functions as an internal control for the anti-KDEL
immunoreactivity. V.m. is lysate from 3 day V. mungo, which provides control polypeptides for SH-EP and its
processing intermediates. rSH-EP is E. coli-produced proSH-EP to provide a control.
|
|
 |
DISCUSSION |
The removal of KDEL from SH-EP in homologous V. mungo
cells and in heterologous Sf-9 cells is so far unique among the
retention sequence-bearing proteins that have been studied. There have
been a number of studies that have added K/HDEL sequences to proteins and expressed these in transgenic plants (35, 38, 56-58). For the most
part, these studies have shown partial or enhanced retention within the
ER/nuclear envelope lumen with eventual progression to distal sites in
the endomembrane system. These results would appear to indicate that
the retention sequence of itself is insufficient to introduce complete
retention of these proteins. However, in none of these studies was the
fate of the retention signal examined, and the possibility remains that
posttranslational processing of the retention sequence might explain
their progression through the endomembrane system. In contrast, the
KDEL-bearing protein auxin-binding protein was examined by Jones and
Herman (59), who found that the secreted protein retained its KDEL
sequence assayed by immunoreactivity with the same monoclonal antibody 1D3 used in the present study.
The ER-resident lumen proteins or reticuloplasmins with their
carboxyl-terminal KDEL and HDEL retention sequences are conserved among
eukaryotic cells. Each type of reticuloplasmin is highly similar among
plant, animal, and fungal cells. Examples of these proteins include
well characterized molecular chaperones BiP and GRP94 and protein
disulfide isomerase (25, 26). The reticuloplasmins are primarily
localized within the ER/nuclear envelope lumen, although there are
studies that have indicated that at least under some circumstances
these proteins may escape the ER-retention system and are secreted
(60-63).
Plant cells possess two proteins, SH-EP and auxin-binding protein, that
are not obvious members of the class of reticuloplasm proteins but do
possess carboxyl-terminal KDEL sequences. The function of auxin-binding
protein remains unknown, although it is widely assumed that the protein
may be involved in signal transduction of plant hormone auxin.
Auxin-binding protein is localized primarily in the ER as if it were a
reticuloplasmin (64, 65), although a small fraction of the
auxin-binding protein is secreted to the cell surface (59, 66, 67) with
its KDEL sequence intact (59). The binding of ligand, auxin, may alter
the exposure of the KDEL sequence, and this could change the
trafficking of the protein (68) so that its removal is not necessary to
allow its exit from the ER. It is possible that auxin binding shuttles
reversibly between the cell surface and the endomembrane system by
exploiting the ER-retention system for targeting and transport.
The crystal structure of cathepsin B (69), papain (70), actinidin
(71), and procathepsin L (72) have been elucidated. The approximately
120-amino acid prosegment functions to occlude the active site with an
antiparallel peptide chain (72) that is an inhibitor of the enzyme
(73). The position of the prosegment on the papain precursor is folded
so it is oriented close to the carboxyl terminus. Assuming that
proSH-EP with its high sequence homology to papain is structurally
homologous to the propapain crystal structure, the only way to
determine whether the carboxyl-terminal KDEL sequence of SH-EP is
exposed to be functionally presented is to test the proSH-EP protein's
retention in an eukaryotic heterologous expression system. We found
that plus-KDEL proSH-EP is processed more slowly than the minus-KDEL
proSH-EP, indicating that the KDEL sequence of the proSH-EP is properly
displayed to be recognized by the ER-retention system. That is because
processing of the SH-EP is a post-Golgi event, retarding the protein in
the pre-Golgi endomembrane system will retard the rate at which it is
processed to the mature enzyme. This interpretation may be supported by the sucrose gradient fractionation experiment of the plus-KDEL SH-EP
expressing Sf-9 cells, which shows that the 43-kDa proSH-EP that
possesses the KDEL is in a distinct membrane compartment compared with
the 42-kDa partially processed minus-KDEL proSH-EP. In cotyledon cells
of V. mungo seedlings, the 42-kDa SH-EP was present in cell
compartment distinct from primary fraction of ER. This result may
support our proposal that the KDEL sequence of the SH-EP functions to
retard the exit from ER in cotyledon cells.
The 43-kDa C26G SH-EP mutant expressed in Sf-9 cells is processed to
remove the carboxyl-terminal KDEL sequence, producing the 42-kDa
proSH-EP. Thus, the autocatalytic activity of SH-EP is not required for
removal of the KDEL sequence. Whether the KDEL sequence removal is the
consequence of an alternate self-catalyzed reaction or the exogenous
enzyme activity of another protein remains to be determined. Our
experiments with the SH-EP mutant lacking the catalytic cysteine 26 residue indicates that the processing of the 42-kDa proSH-EP to 39- and
37-kDa intermediate precursors and mature 33-kDa is the result of
autocatalytic self-processing. The C26G mutant is processed to a mature
form in the insect cells without the accumulation of the 39- and 37-kDa
intermediate precursors and at a much slower rate. This processing is
likely to be the consequence of an endogenous insect or viral cysteine
protease that processes the SH-EP protein in a single step. Experiments on in vitro processing of the recombinant proSH-EP mutant
lacking the catalytic cysteine by mature active wild-type SH-EP
resulted in conversion of the proprotein to a mature molecular mass
without the accumulation of intermediate processing
products.2 These findings
indicate that exogenous thiol protease activity including those thiol
proteases found in Sf-9 cells will process the proSH-EP to its mature
molecular mass but that only self-processing will yield intermediate
processing products.
That a lytic protease possesses an ER retention sequence and is
retained within the ER lumen is curious. Such potentially destructive
proteases would not seem to be candidates to be ER lumen resident
proteins. The ER lumen is well established as a compartment involved in
folding and processing newly synthesized proteins for export into the
endomembrane system (74, 75). However, our results clearly demonstrate
that only the inactive proSH-EP possesses the KDEL retention sequence.
The KDEL sequence on proSH-EP is removed either in the ER or shortly
after the protein's exit from the ER. The removal of the retention
sequence in the ER is an obvious mechanism by which the proprotein
could be changed from an ER-retained (or ER-retarded form) to a
secretion-competent form that would pass by the cis-Golgi
ERD-2 retention sequence receptor in the bulk secretory flow to its
final destination. Plant cells have been shown to possess an ERD-2-type
K/HDEL receptor protein that is highly similar to forms characterized
in yeast and animal cells (76-80). We suggest that proSH-EP with its
KDEL sequence intact constitutes an inactive form of the protein that is functionally stored by continuous retrieval within the ER. If SH-EP
was processed in bulk removing the retention sequence that would permit
efficient and pulse-like progression to its destination and functional
activation in the vacuole. The proSH-EP with its KDEL by recycling
within the pre-Golgi endomembrane lumen is then functionally equivalent
to a zymogen (81) of proteases and is perhaps best described as a
"transient zymogen."
The posttranslational processing of carboxyl-terminal KDEL sequence in
SH-EP expressed in the homologous plant and heterologous Sf-9 cells
suggests a previously unrecognized means of utilizing the information
content of the ER retention sequence. An outline of the proposed
sequence of processing events is shown in Fig. 11. The regulated removal of the KDEL
sequence offers the opportunity to permit a protein to progress through
the endomembrane system to either the lytic compartment or secretion.
This could allow a protein to serve dual roles within the ER and
elsewhere in the cell. The removal of the ER retention sequence could
allow the protein to be transported to the lytic compartment for
disposal, or in the case of SH-EP for activation as an acid protease.
We speculate that the selective removal of KDEL sequences will not be
restricted to SH-EP but might also include reticuloplasmins to permit
efficient turnover of the proteins during normal growth and during
recovery from stress overexpression. Experiments are currently in
progress in our laboratories to examine whether retention sequence
processing and removal is a characteristic of reticuloplasmins.

View larger version (33K):
[in this window]
[in a new window]
|
Fig. 11.
A model for posttranslational processing and
intracellular transport of SH-EP and its intermediates in Sf-9
cells. The SH-EP mRNA coding 45-kDa polypeptide is translated
on membrane-bound polysomes to a 43-kDa intermediate through
co-translational cleavage of a signal sequence. A carboxyl-terminal
propeptide of 1 kDa containing KDEL sequence is processed from the
43-kDa intermediate in the ER lumen or immediately after exit from the
ER. The 42-kDa intermediate is autocatalytically
converted to the 33-kDa mature enzyme via 39- and 37-kDa
intermediates.
|
|
 |
ACKNOWLEDGEMENTS |
We thank Dr. S. Fuller, European Molecular
Biology Laboratory, Heidelberg, for providing monoclonal antibody 1D3.
We also thank Dr. T. Aigaki and Dr. K.-H. Seong, Tokyo Metropolitan
University, for their useful discussions and technical advice in
experiments with Sf-9 cells.
 |
FOOTNOTES |
*
This work was supported in part by Grants-in-aid for
Scientific Research 10740374 (to T. O.) and 09640776 (to T. M.) from the Ministry of Education, Science and Culture of Japan, and
U. S.-Israel Binational Agricultural Research and Development Fund (BARD) Grant US-2334-93 (to E. H.).The costs of publication of this
article were defrayed in part by the
payment of page charges. The article
must therefore be hereby marked
"advertisement" in accordance with 18 U.S.C. Section
1734 solely to indicate this fact.
§
To whom correspondence should be addressed. Fax: 81-426-77-2559;
E-mail: okamoto-takashi{at}c.metro-u.ac.jp.
2
T. Okomoto, A. Yuki, N. Mitsuhashi, and T. Minamikawa, submitted for publication.
 |
ABBREVIATIONS |
The abbreviations used are:
ER, endoplasmic
reticulum;
PCR, polymerase chain reaction;
PAGE, polyacrylamide gel
electrophoresis;
EM, electron microscopy.
 |
REFERENCES |
-
Akasofu, H.,
Yamauchi, D.,
Mitsuhashi, W.,
and Minamikawa, T.
(1989)
Nucleic Acids Res.
17,
6733[Free Full Text]
-
Mitsuhashi, W.,
and Minamikawa, T.
(1989)
Plant Physiol.
89,
274-279[Abstract/Free Full Text]
-
Yamauchi, D.,
Akasofu, H.,
and Minamikawa, T.
(1992)
Plant Cell Physiol.
33,
789-797[Abstract/Free Full Text]
-
Mitsuhashi, W.,
Koshiba, T.,
and Minamikawa, T.
(1986)
Plant Physiol.
80,
628-634[Abstract/Free Full Text]
-
Boylan, M. T.,
and Sussex, I. M.
(1987)
Planta
170,
343-352[CrossRef]
-
Baumgartner, B.,
and Chrispeels, M. J.
(1977)
Eur. J. Biochem.
77,
223-233[Medline]
[Order article via Infotrieve]
-
Baumgartner, B.,
Tokuyasu, K. T.,
and Chrispeels, M. J.
(1978)
J. Cell Biol.
79,
10-19[Abstract/Free Full Text]
-
Chrispeels, M. J.,
and Boulter, D.
(1975)
Plant Physiol.
55,
1031-1037[Abstract/Free Full Text]
-
Chrispeels, M. J.,
Baumgartner, B.,
and Harris, N.
(1976)
Proc. Natl. Acad. Sci. U. S. A.
73,
3168-3172[Abstract/Free Full Text]
-
Müntz, K.
(1996)
J. Exp. Bot.
298,
605-622
-
North, M. J.
(1986)
Br. J. Lett.
238,
623-624
-
Carmona, E.,
Dufour, E.,
Plouffe, C.,
Takabe, S.,
Manson, P.,
Mort, J. S.,
and Menard, R.
(1996)
Biochemistry
35,
8149-8157[CrossRef][Medline]
[Order article via Infotrieve]
-
Tao, K,
Stearns, N. A.,
Dong, J.,
Wu, Q.,
and Sahagian, G. G.
(1994)
Arch. Biochem. Biophys.
311,
19-27[CrossRef][Medline]
[Order article via Infotrieve]
-
Mason, R. W.,
Gal, S.,
and Gottesman, M. M.
(1987)
Biochem. J.
248,
449-454[Medline]
[Order article via Infotrieve]
-
Holwerda, B. C.,
Galvin, N. J.,
Baranski, T. J.,
and Rogers, J. C.
(1990)
Plant Cell
2,
1091-1106[Abstract/Free Full Text]
-
Koehler, S. M.,
and Ho, T.-H. D.
(1990)
Plant Cell
2,
769-783[Abstract/Free Full Text]
-
Holwerda, B. C,
Padgett, H. S.,
and Rogers, J. C.
(1992)
Plant Cell
4,
307-318[Abstract/Free Full Text]
-
Cuozzo, J. W.,
Tao, K.,
Wu, Q.,
Young, W.,
and Sahagian, G. G.
(1995)
J. Biol. Chem.
270,
15611-15619[Abstract/Free Full Text]
-
McIntyre, G. F.,
and Erikson, A. H.
(1993)
Proc. Natl. Acad. Sci. U. S. A.
90,
10588-10592[Abstract/Free Full Text]
-
Paris, N.,
Rogers, S. N.,
Jiang, L.,
Kirsch, T.,
Beevers, L.,
Phillips, T. E.,
and Rogers, J. C.
(1997)
Plant Physiol.
115,
29-39[Abstract]
-
Becker, C.,
Shutov, A. D.,
Nong, V. H.,
Senyuk, V. I.,
Jung, R.,
Horstmann, C.,
Fischer, J.,
Nielsen, N. C.,
and Müntz, K.
(1995)
Eur. J. Biochem.
228,
456-462[Medline]
[Order article via Infotrieve]
-
Guerrero, C.,
de la Calle, M.,
Reid, M. S.,
and Valpuesta, V.
(1998)
Plant. Mol. Biol.
36,
565-571[CrossRef][Medline]
[Order article via Infotrieve]
-
Tanaka, T.,
Yamauchi, D.,
and Minamikawa, T.
(1991)
Plant Mol. Biol.
16,
1083-1084[CrossRef][Medline]
[Order article via Infotrieve]
-
Munro, S.,
and Pelham, H. R. B.
(1987)
Cell
48,
899-907[CrossRef][Medline]
[Order article via Infotrieve]
-
Pelham, H. R. B.
(1988)
EMBO J.
7,
913-918[Medline]
[Order article via Infotrieve]
-
Pelham, H. R. B.
(1989)
Annu. Rev. Cell Biol.
5,
1-23[CrossRef]
-
Berti, P. J.,
and Storer, A. C.
(1995)
J. Mol. Biol.
246,
273-283[CrossRef][Medline]
[Order article via Infotrieve]
-
Rawlings, N. D.,
and Barrett, A. J.
(1994)
Methods Enzymol.
244,
461-486[Medline]
[Order article via Infotrieve]
-
Guerro, F. D.,
Jones, J. T.,
and Mullet, J. T.
(1990)
Plant Mol. Biol.
15,
11-26[CrossRef][Medline]
[Order article via Infotrieve]
-
Jones, C. G.,
Tucker, G. A.,
and Lycett, G. W.
(1996)
Biochim. Biophys. Acta
1296,
13-15[CrossRef][Medline]
[Order article via Infotrieve]
-
Kalinski, A. J.,
Melroy, D. L.,
Dwivedi, R. S.,
and Herman, E. M.
(1992)
J. Biol. Chem.
267,
12068-12076[Abstract/Free Full Text]
-
Kalinski, A. J,
Rowley, D.,
Dwivedi, R. S.,
and Herman, E. M.
(1997)
Plant Physiol. Biochem.
35,
795-802
-
Kardailsky, I. V.,
and Berwin, N. J.
(1996)
Mol. Plant Microbe Interact.
9,
689-695[Medline]
[Order article via Infotrieve]
-
Nong, V. H.,
Becker, C.,
and Müntz, K.
(1995)
Biochim. Biophys. Acta
1261,
435-438[Medline]
[Order article via Infotrieve]
-
Herman, E. M.,
Tague, B. W.,
Hoffman, L. M.,
Kjemtrup, S. E.,
and Chrispeels, M. J.
(1990)
Planta
182,
305-312
-
Napier, R. M.,
Fowke, L. C.,
Hawes, C. R.,
Lewis, M.,
and Pelham, H. R. B.
(1992)
J. Cell Biol.
102,
261-271
-
Denecke, J.,
Goldman, M. H. S.,
Demolder, J.,
and Botterman, J.
(1991)
Plant Cell
3,
1025-1035[Abstract/Free Full Text]
-
Denecke, J.,
De Rycke, R.,
and Botterman, J.
(1992)
EMBO J.
11,
2345-2355[Medline]
[Order article via Infotrieve]
-
Mason, R. W.,
and Massey, S. D.
(1992)
Biochem. Biophys. Res. Commun.
189,
1659-1666[CrossRef][Medline]
[Order article via Infotrieve]
-
Rowan, A. D.,
Mason, P.,
Mach, L.,
and Mort, J. S.
(1992)
J. Biol. Chem.
267,
15993-15999[Abstract/Free Full Text]
-
Smith, S. M.,
and Gottesman, M. M.
(1989)
J. Biol. Chem.
264,
20487-20495[Abstract/Free Full Text]
-
Vernet, T.,
Berti, P. J.,
deMontigny, C.,
Musil, R.,
Tessier, D. C.,
Menard, R.,
Magny, M. C.,
Storer, A. C.,
and Thomas, D. Y.
(1995)
J. Biol. Chem.
270,
10838-10846[Abstract/Free Full Text]
-
Okomoto, T.,
and Minamikawa, T.
(1995)
Eur. J. Biochem.
231,
300-305[Medline]
[Order article via Infotrieve]
-
Okamoto, T.,
and Minamikawa, T.
(1999)
Plant Mol. Biol.
39,
63-73[CrossRef][Medline]
[Order article via Infotrieve]
-
Hara-Nishimura, I.,
Inoue, K.,
and Nishimura, M.
(1991)
FEBS Lett.
294,
89-93[CrossRef][Medline]
[Order article via Infotrieve]
-
Hara-Nishimura, I.,
Takeuchi, Y.,
and Nishimura, M.
(1993)
Plant Cell
5,
1651-1659[Abstract]
-
Nishimura, M.
(1982)
Plant Physiol.
70,
742-744[Abstract/Free Full Text]
-
Okomoto, T.,
Nakayama, H.,
Seta, K.,
Isobe, T.,
and Minamikawa, T.
(1994)
FEBS Lett.
351,
31-34[CrossRef][Medline]
[Order article via Infotrieve]
-
Hink, W. F.
(1970)
Nature
226,
466-467
-
Vaux, D.,
Tooze, J.,
and Fuller, S.
(1992)
Nature
345,
495-502
-
Hirano, H.,
Komatsu, S.,
Takakura, H.,
Sakiyama, F.,
and Tsunasawa, S.
(1992)
J. Biochem. (Tokyo)
111,
754-757[Abstract/Free Full Text]
-
Kalinski, A. J.,
Rowley, D. L.,
Loer, D. S.,
Foley, C.,
Butta, G.,
and Herman, E. M.
(1994)
Planta
195,
611-621
-
Vernet, T.,
Khouri, H. E.,
LaFlamme, P.,
Tessier, D. C.,
Musil, R.,
Gour-Salin, B. J.,
Storer, A. C.,
and Thomas, D. Y.
(1991)
J. Biol. Chem.
266,
21451-21457[Abstract/Free Full Text]
-
Bustos, M. M.,
Luckkow, V. A.,
Griffing, L. R.,
Summers, M. D.,
and Hall, T. C.
(1988)
Plant Mol. Biol.
10,
475-488
-
Macdonald, H.,
Henderson, J.,
Napier, R. M.,
Venis, M. A.,
Hawes, C.,
and Lazarus, C. M.
(1994)
Plant Physiol.
105,
1049-1057[Abstract]
-
Gomord, V.,
Denmat, L. A.,
Fichette-Laine, A.-C.,
Satiat-Jeunemaitrr, B.,
Hawes, C.,
and Faye, L.
(1997)
Plant J.
11,
313-325[CrossRef][Medline]
[Order article via Infotrieve]
-
Pueyo, J. J.,
Chrispeels, M. J.,
and Herman, E. M.
(1995)
Planta
196,
586-596[Medline]
[Order article via Infotrieve]
-
Wandelt, C. I.,
Khan, M. R. I.,
Craig, S.,
Schroeder, H. E.,
Spencer, D.,
and Higgins, T. J. V.
(1992)
Plant J.
2,
181-192[Medline]
[Order article via Infotrieve]
-
Jones, A. M.,
and Herman, E. M.
(1993)
Plant Physiol.
101,
595-606[Abstract]
-
Booth, C.,
and Koch, G. L. E.
(1989)
Cell
59,
729-737[CrossRef][Medline]
[Order article via Infotrieve]
-
Yoshimori, T.,
Semba, T.,
Takemoto, H.,
Akagi, S.,
Yamamoto, A.,
and Tashiro, Y.
(1990)
J. Biol. Chem.
265,
15984-15990[Abstract/Free Full Text]
-
Weist, D. L.,
Burgess, W. H.,
McKean, D.,
Kearse, K. P.,
and Singer, A.
(1995)
EMBO J.
14,
3425-3433[Medline]
[Order article via Infotrieve]
-
Weist, D. L.,
Bhandoola, A.,
Punt, J.,
Kreibich, G.,
McKean, D.,
and Singer, A.
(1997)
Proc. Natl. Acad. Sci. U. S. A.
94,
1884-1889[Abstract/Free Full Text]
-
Hesse, T.,
Feldwisch, J.,
Balshusemann, D.,
Bauw, G.,
Puype, M.,
Vanderkerckhove, E. J.,
Lobler, M.,
Klambt, D.,
Schell, J.,
and Palme, K.
(1989)
EMBO J.
8,
2453-2461[Medline]
[Order article via Infotrieve]
-
Inohara, N.,
Shimomura, S.,
Fukui, T.,
and Futai, M.
(1989)
Proc. Natl. Acad. Sci. U. S. A.
86,
3564-3568[Abstract/Free Full Text]
-
Hicks, G. R.,
Rayle, D. L.,
Jones, A. M.,
and Lomax, T. L.
(1989)
Proc. Natl. Acad. Sci. U. S. A.
86,
4948-4952[Abstract/Free Full Text]
-
Henderson, J.,
Bauly, J. M.,
Asford, D. A.,
Oliver, S. C.,
Hawes, C. R.,
Lazarus, C. M.,
Venis, M. A.,
and Napier, R. M.
(1997)
Planta
202,
313-23[CrossRef][Medline]
[Order article via Infotrieve]
-
Napier, R. M.,
and Venis, M. A.
(1990)
Planta
182,
313-318
-
Musil, D.,
Zucic, D.,
Turk, D.,
Engh, R. A.,
Mayr, I.,
Huber, R.,
Popovic, T.,
Turk, V.,
Towatari, T.,
Katunuma, N.,
and Bode, W.
(1991)
EMBO J.
10,
2321-2330[Medline]
[Order article via Infotrieve]
-
Drenth, J.,
Jansonius, J. N.,
Koekock, R.,
Swen, H. M.,
and Wolther, B. G.
(1968)
Nature
218,
929-933[CrossRef][Medline]
[Order article via Infotrieve]
-
Baker, E. N.
(1977)
J. Mol. Biol.
115,
263[CrossRef][Medline]
[Order article via Infotrieve]
-
Coulombe, R.,
Grochulski, P.,
Sivaraman, J.,
Menard, R.,
Mort, J. S.,
and Cygler, M.
(1996)
EMBO J.
15,
5492-5503[Medline]
[Order article via Infotrieve]
-
Cygler, M.,
Sivaraman, J.,
Grochulski, P.,
Columbe, R.,
Storer, A. C.,
and Mort, J. S.
(1996)
Structure
4,
405-416[Abstract/Free Full Text]
-
Okita, T. W.,
and Rogers, J. C.
(1996)
Annu. Rev. Plant Physiol. Plant Mol. Biol.
47,
327-350[CrossRef]
-
Vitale, A.,
Ceriotti, A.,
and Denecke, J.
(1993)
J. Exp. Bot.
44,
390-394
-
Hardwick, K. G.,
Lewis, M. J.,
Semenza, J.,
Dean, N.,
and Pelham, H. R. B.
(1990)
EMBO J.
9,
623-630[Medline]
[Order article via Infotrieve]
-
Semenza, J. C.,
Hardwick, K. G.,
Dean, N.,
and Pelham, H. R. B.
(1990)
Cell
61,
1349-1357[CrossRef][Medline]
[Order article via Infotrieve]
-
Lewis, M. J.,
and Pelham, H. R. B.
(1990)
Nature
348,
162-163[CrossRef][Medline]
[Order article via Infotrieve]
-
Lewis, M. J.,
and Pelham, H. R. B.
(1992)
J. Mol. Biol.
226,
913-916[CrossRef][Medline]
[Order article via Infotrieve]
-
Lee, H. I.,
Gal, S.,
Newman, T. C.,
and Raikhel, N. V.
(1993)
Proc. Natl. Acad. Sci. U. S. A.
90,
11433-11437[Abstract/Free Full Text]
-
Kassell, B.,
and Kay, J.
(1973)
Science
180,
1022-1027[Free Full Text]
Copyright © 1999 by The American Society for Biochemistry and Molecular Biology, Inc.

CiteULike Complore Connotea Del.icio.us Digg Reddit Technorati What's this?
This article has been cited by other articles:

|
 |

|
 |
 
A. Senatore, C. P. Trobacher, and J. S. Greenwood
Ricinosomes Predict Programmed Cell Death Leading to Anther Dehiscence in Tomato
Plant Physiology,
February 1, 2009;
149(2):
775 - 790.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
L. L. Swift, M.-Y. Zhu, B. Kakkad, A. Jovanovska, M. D. Neely, K. Valyi-Nagy, R. L. Roberts, D. E. Ong, and W. G. Jerome
Subcellular localization of microsomal triglyceride transfer protein
J. Lipid Res.,
October 1, 2003;
44(10):
1841 - 1849.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
T. Okamoto, T. Shimada, I. Hara-Nishimura, M. Nishimura, and T. Minamikawa
C-Terminal KDEL Sequence of A KDEL-Tailed Cysteine Proteinase (Sulfhydryl-Endopeptidase) Is Involved in Formation of KDEL Vesicle and in Efficient Vacuolar Transport of Sulfhydryl-Endopeptidase
Plant Physiology,
August 1, 2003;
132(4):
1892 - 1900.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. Tsuru-Furuno, T. Okamoto, and T. Minamikawa
Isolation of a Putative Receptor for KDEL-tailed Cysteine Proteinase (SH-EP) from Cotyledons of Vigna mungo Seedlings
Plant Cell Physiol.,
October 1, 2001;
42(10):
1062 - 1070.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. Schmid, D. J. Simpson, H. Sarioglu, F. Lottspeich, and C. Gietl
The ricinosomes of senescing plant tissue bud from the endoplasmic reticulum
PNAS,
April 5, 2001;
(2001)
61038298.
[Abstract]
[Full Text]
|
 |
|

|
 |

|
 |
 
M. J. Chrispeels and E. M. Herman
Endoplasmic Reticulum-Derived Compartments Function in Storage and as Mediators of Vacuolar Remodeling via a New Type of Organelle, Precursor Protease Vesicles
Plant Physiology,
August 1, 2000;
123(4):
1227 - 1234.
[Full Text]
|
 |
|

|
 |

|
 |
 
K. Toyooka, T. Okamoto, and T. Minamikawa
Mass Transport of Proform of a KDEL-tailed Cysteine Proteinase (SH-EP) to Protein Storage Vacuoles by Endoplasmic Reticulum-derived Vesicle Is Involved in Protein Mobilization in Germinating Seeds
J. Cell Biol.,
February 7, 2000;
148(3):
453 - 464.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
T. Okamoto, K. Toyooka, and T. Minamikawa
Identification of a Membrane-associated Cysteine Protease with Possible Dual Roles in the Endoplasmic Reticulum and Protein Storage Vacuole
J. Biol. Chem.,
January 5, 2001;
276(1):
742 - 751.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. Schmid, D. J. Simpson, H. Sarioglu, F. Lottspeich, and C. Gietl
The ricinosomes of senescing plant tissue bud from the endoplasmic reticulum
PNAS,
April 24, 2001;
98(9):
5353 - 5358.
[Abstract]
[Full Text]
[PDF]
|
 |
|
Copyright © 1999 by the American Society for Biochemistry and Molecular Biology.
|
Advertisement
Advertisement
|