|
J Biol Chem, Vol. 274, Issue 16, 11399-11407, April 16, 1999
A Silencer Element in the Regulatory Region of Glutamine
Synthetase Controls Cell Type-specific Repression of Gene Induction by
Glucocorticoids*
Noa
Avisar,
Liora
Shiftan,
Iris
Ben-Dror,
Nadav
Havazelet, and
Lily
Vardimon
From the Department of Biochemistry, George S. Wise Faculty of Life
Sciences, Tel Aviv University, 69978 Tel Aviv, Israel
 |
ABSTRACT |
Glutamine synthetase is a key enzyme in the
recycling of the neurotransmitter glutamate. Expression of this enzyme
is regulated by glucocorticoids, which induce a high level of glutamine
synthetase in neural but not in various non-neural tissues. This is
despite the fact that non-neural cells express functional
glucocorticoid receptor molecules capable of inducing other target
genes. Sequencing and functional analysis of the upstream region of the
glutamine synthetase gene identified, 5' to the glucocorticoid response element (GRE), a 21-base pair glutamine synthetase silencer element (GSSE), which showed considerable homology with the neural restrictive silencer element NRSE. The GSSE was able to markedly repress the induction of gene transcription by glucocorticoids in non-neural cells
and in embryonic neural retina. The repressive activity of the GSSE
could be conferred on a heterologous GRE promoter and was orientation-
and position-independent with respect to the transcriptional start
site, but appeared to depend on a location proximal to the GRE.
Gel-shift assays revealed that non-neural cells and cells of early
embryonic retina contain a high level of GSSE binding activity and that
this level declines progressively with age. Our results suggest that
the GSSE might be involved in the restriction of glutamine synthetase
induction by glucocorticoids to differentiated neural tissues.
 |
INTRODUCTION |
Glutamine synthetase
(GS1;
L-glutamate:ammonia ligase (ADP-forming); EC 6.3.1.2) is a
"housekeeping" enzyme that is expressed at a particularly high
level in neural tissues (1, 2). High levels of GS expression are
restricted to glial cells (1, 3-5) and are essential for the recycling
of the neurotransmitter glutamate. Synaptically released glutamate is
taken up into glial cells, where it is converted by GS into glutamine,
which re-enters the neurons and is hydrolyzed by glutaminase to form
glutamate again (6, 7). In this way, the neurotransmitter pool is
replenished and glutamate neurotoxicity is prevented.
Studies in the chicken neural retina showed that GS expression is
regulated by systemic glucocorticoids, which induce in this tissue a
very high level of GS by directly stimulating the transcription of the
gene (8-10). The ability of glucocorticoids to induce GS expression is
developmentally controlled. Glucocorticoids can induce a high level of
GS expression in neural retina at late embryonic ages, but not in early
embryonic retina (2, 11-13). The direct involvement of glucocorticoids
in the control of GS gene transcription is evidenced by the nuclear
run-on transcription assay, as well as by the finding that the upstream
region of the GS gene contains a glucocorticoid response element (GRE)
that can bind the glucocorticoid receptor protein and confer
responsiveness to glucocorticoids on an attached reporter gene (8-10,
14, 15). This mode of regulation, which is dependent on the presence of active glucocorticoid receptor molecules, explains the cell type specificity of GS expression in the neural retina; GS expression is
always restricted to Müller glial cells, which are the only cells
in the tissue that express a detectable level of the glucocorticoid receptor protein (1, 16). It does not, however, explain why various
non-neural cells, which contain functional glucocorticoid receptor
molecules capable of inducing other target genes, are not responsive to
the hormone and express only low levels of GS.
Neural-specific gene expression is often achieved by the action of
negative transcriptional regulation. A prominent example is the neural
restrictive silencer element (NRSE/RE-1) found in the regulatory
regions of a number of genes expressed exclusively in the nervous
system, including SCG10 (17), type II sodium channel (NaII) (18),
synapsin I (19), the II subunit of the nicotinic acetylcholine
receptor (20), the muscarinic M4 receptor (21, 22), and the
neural-glial cell adhesion molecule (23). This element binds to a
zinc-finger transcriptional repressor protein known as neural
restrictive silencer factor (NRSF; Ref. 24) or RE-1-silencing
transcription factor (REST; Ref. 25), which is ubiquitously expressed
in non-neural tissues and in neuronal precursors of the central nervous
system. Experiments involving targeted mutation of the NRSF-encoding
gene or inhibition of NRSF by a dominant negative form of the protein
indicated that NRSF is required in vivo to repress
neural genes in non-neural or in undifferentiated neural
tissues (26).
In the present study, we demonstrate that the regulatory region of the
GS gene contains a NRSE-like element, and that this element can repress
the induction of gene transcription by glucocorticoids. Our results
suggest that a neural restrictive silencing activity may be directly
involved in the repression of GS induction in non-neural tissues and in
the prevention of precocious expression of GS in early embryonic neural retina.
 |
EXPERIMENTAL PROCEDURES |
DNA Sequencing and Plasmid Constructions--
A set of plasmids
containing complementary regions of the GS upstream sequence from +13
to 2899 was prepared by subcloning the genomic GS clone GS113 (11)
into the pBluescript SK+ vector (Stratagene). The sequence
was determined by the chain termination method (27) using the Sequenase
II kit (U. S. Biochemical Corp.). Both strands were sequenced using a
series of oligonucleotide primers. To construct chloramphenicol
acetyltransferase (CAT) vectors that are controlled by the upstream
sequence of the GS gene, the coding region of CAT was excised with
ClaI from pSVO-CAT (28) and ligated into the
ClaI site in the linker region of Bluescript clones
containing the following GS upstream sequences: +13 to 1725 (1.7 GS);
+13 to 2117 (2.1 GS); +13 to 2375 (2.3 GS); +13 to 2821 (2.8 GS).
The constructs 2.4 GS and 2.5 GS were generated by deletion using the
Erase-a-Base System (Promega) as follows; the 2.8 GS construct was
first linearized with KpnI, which generates a 3' overhang,
and with SalI, which generates a 5' overhang, both cleaving
in the linker region of the vector, 5' to the GS sequence, and thus
ensuring the correct direction of the deletion process. Linearized DNA
was digested with exonuclease III (30 units/µg DNA) for up to 6 min.
Aliquots were taken at 30-s intervals, added to solution containing S1
nuclease (6 units/µg DNA), and incubated for 30 min at room
temperature. The series of nuclease-digested DNAs were ligated by T4
ligase and transfected into bacterial cells. Colonies were analyzed by
the colony PCR procedure (29), which allows determination of the size
of the cloned fragment. The 21-bp sequence in the 2.3 GS construct (2.3 21GS) was deleted by PCR amplification, using oligonucleotides that
correspond to the appropriate 5' and 3' sequences and contain restriction sites for recloning into 2.3 GS. The deletion was confirmed
by DNA sequence analysis. The construct GRE-TK was derived from pG46TCO
(14). It contains two copies of the GRE sequence linked to the TK-CAT
fusion gene. To generate the 258-GRE-TK construct, the 258 fragment
( 2375 to 2117) was excised from 2.3 GS with ApaI and
SacI, blunt-ended with the Klenow fragment of DNA polymerase I, and ligated into the similarly blunted HindIII and
AccI sites of GRE-TK. Orientation was confirmed by
restriction enzyme analysis. Complementary oligonucleotides were
synthesized (sense strand shown), containing one
(AGCTTGAGCACCGCGGTCCTCCAG) or two
(GAGCTCTGCACTTGAGCACCGCGGTCCTCCAGCTTCTGCTCTGCACTTGAGCACCGCGGTCCTCCAGCTTCT) copies of the 21-bp GSSE sequence or two copies of the NRSE sequence of
the SCG10 gene
(CAAAGCCATTTCAGCACCACGGAGAGTGCCTCTGCCAAAGCCATTTCAGCACCACGGAGAGTGCCTCTGCAG) (17). Oligonucleotides containing a single copy of the GSSE were
constructed such that, when annealed, they contained AccI and HindIII cohesive ends, while oligonucleotides containing
two copies of the GSSE or NRSE were constructed such that, when
annealed, they contained blunt ends. The construct GSSE-GRE-TK was
generated by insertion of the oligonucleotides containing a single copy of the GSSE into HindIII- and AccI-restricted
GRE-TK. The oligonucleotides containing two copies of the GSSE were
ligated into the blunted HindIII site of GRE-TK to generate
GSSE2-GRE-TK and ESSG2-GRE-TK or into SmaI-restricted GRE-TK
to generate FGSSE2-GRE-TK. The oligonucleotides containing two copies
of the NRSE were ligated into the blunted HindIII site of
GRE-TK to generate NRSE2-GRE-TK. Orientation was confirmed by
restriction enzymes or DNA sequence analysis. The luciferase reporter
gene RSVL(SEL) (30) and the GR expression vector p6RGR (31) are under
the transcriptional control of the Rous sarcoma virus (RSV). Plasmid
DNA was prepared using the Qiagen plasmid preparation kit.
Tissue and Cell Culture and Transfection Procedures--
Retinal
tissue was isolated under sterile conditions from eyes of chicken
embryos (White Leghorn) at day 10 of embryonic development (E10). The
tissue was organ-cultured in Erlenmeyer flasks in Dulbecco's modified
Eagle's medium (DMEM) with 10% fetal calf serum on a gyratory shaker
at 38 °C. Plasmid DNA was transfected into pieces of intact retinal
tissue by electroporation using a Bio-Rad Gene Pulser with voltage and
capacitance settings of 400 V and 960 microfarads, respectively, as
described (32). Following electroporation, retinas transfected in the
same cuvette were placed in two Erlenmeyer flasks and cultured for 24 or 48 h in the absence or presence of 0.33 µg/ml cortisol
(Sigma). HeLa and C6 cells were grown in DMEM supplemented with 10%
fetal calf serum. PC-12 cells were grown in DMEM with 8% fetal calf
serum and 8% horse serum. The cells were grown in six-well plates and
transfected with DNA using LipofectAMINE (Life Technologies, Inc.)
according to the manufacturer's instructions. Following transfection,
the cells were incubated for 24 h with or without 0.33 µg/ml cortisol.
CAT and Luciferase Assays--
CAT and luciferase activities
were determined in tissue sonicates. CAT activity was determined as
described (28). In all experiments, the CAT assay was adjusted to
include an equal amount of luciferase activity originating from
co-transfected RSVL(SEL). CAT activity was determined by scanning of
the TLC plates with a PhosphorImager Instrument and TINA version 2.07d
software, and calculation of the percentage of substrate
(chloramphenicol) converted to the acetylated products. Luciferase
activity was assayed as described (30) and recorded by a LKB
luminometer (LKB, Rockville, MD).
Preparation of Nuclear Extracts and Gel Mobility Shift
Assays--
Nuclear extracts were prepared from HeLa, C6, and PC12
monolayer cells at 80% confluence according to Lee et al.
(33) with minor modifications. Briefly, cells were harvested using a
rubber policeman and washed in 30 volumes of ice-cold
phosphate-buffered saline. The packed cell volume was determined by
pelleting for 5 min at 1200 × g. Packed cells were
resuspended in the equivalent of two packed cell volumes of buffer A
(10 mM HEPES, pH 7.9, 1.5 mM MgCl2,
10 mM KCl, 0.5 mM phenylmethylsulfonyl fluoride
(PMSF), and 1 mM dithiothreitol (DTT)) and allowed to swell
on ice for 15 min. Cells were then lysed by five strokes through a
25-gauge needle or by five strokes of pestle A and five strokes of
pestle B in a Dounce homogenizer. The cell homogenate was then
centrifuged for 20 s in an Eppendorf microcentrifuge (12,000 × g), and the crude nuclear pellet was resuspended in the
equivalent of one packed cell volume of buffer C (20 mM
HEPES pH 7.9, 25% glycerol, 0.42 M NaCl, 1.5 mM MgCl2, 0.2 mM EDTA, 0.5 mM PMSF, and 1 mM DTT), followed by incubation
on ice with stirring for 30 min. The nuclear debris was then pelleted
by spinning for 5 min at 12,000 × g, and the
supernatant (nuclear extract) was divided into aliquots and
quick-frozen by dry ice with ethanol. The extracts were stored at
70 °C. Retinal cell extracts were similarly prepared, except for
the following differences. The tissue was lysed by homogenization by
means of five strokes of pestle A and five strokes of pestle B in a
Dounce homogenizer. The nuclear extract was prepared from the nuclear
crude pellet in two steps: the nuclei were suspended in the equivalent
of one packed cell volume of low salt buffer C (20 mM
HEPES, pH 7.9, 1.5 mM MgCl2, 10 mM
KCl, 25% glycerol, 0.5 mM PMSF, and 1 mM DTT),
followed by slow addition of the equivalent of a half packed cell
volume of high salt buffer C (20 mM HEPES, pH 7.9, 1.5 mM MgCl2, 0.6 M KCl, 25% glycerol,
0.5 mM PMSF, and 1 mM DTT). Protein
concentration in the nuclear extracts was determined using the Bradford
assay (Bio-Rad). Gel mobility shift assays were performed in a 20-µl
final volume of reaction buffer containing 20 mM HEPES, pH
7.6, 0.1% Nonidet P-40, 10% glycerol, 1 mM DTT, 2.5 mM MgCl2, and 1 mg/ml poly(dI-dC). Equal
amounts of nuclear extracts (5-10 µg) were added to the reaction
buffer and preincubated with or without DNA competitors for 10 min on
ice. End-labeled DNA probes (about 2 × 104
cpm/reaction) were added, followed by incubation for 15 min at room
temperature. The samples were resolved on a 5% nondenaturating acrylamide gel in 0.25 × TBE for 2 h at 70 V. The gels were
dried and exposed for 18 h at 70 °C with an intensifying
screen. Oligonucleotides used for competition or end-labeled and used
as DNA probes were those used for cloning (see above): double-stranded
oligonucleotide containing two copies of the GSSE, double-stranded
oligonucleotide containing two copies of the NRSE, the sense strand of
the oligonucleotide containing two copies of the NRSE (single-stranded
DNA probe), and nonspecific double-stranded oligonucleotide derived
from a mutated octamer-binding sequence (34).
 |
RESULTS |
The 5'-Flanking Region of the GS Gene Is Subject to Differential
Selective Constraints--
The nucleotide sequence of the 5'-flanking
region of the GS gene ( 1 to 2657) has been determined by others
(15) and by us (Fig. 1A) using
genomic clones isolated from two independent libraries of White Leghorn
chicken. Comparison of the two sequences revealed a considerable number
of sequence differences, including substitutions, insertions, and
deletions. The most striking phenomenon, however, was the fact that
these sequence changes were not evenly distributed along the DNA, but
rather were concentrated in two distinct regions. Of 38 sequence
changes, 19 were located in the region between 868 and 1700 (region
2 in Fig. 1B) and 17 in the region between 2287 and 2657
(region 4 in Fig. 1B). The region proximal to the
transcriptional start site, from 1 to 868 (region 1 in Fig.
1B), contained only two sequence differences, while in the
more distal region, between 1700 and 2287, no change was detected
(region 3 in Fig. 1B). This dramatic variation in the rate
of mutational events among the different DNA regions correlated with
two other sequence parameters, attributed to differential selective
constraints: G+C content and the ratio (observed to expected) of the
dinucleotide CG (35). As shown in Table
I, the DNA regions 2 and 4, which contain
a high ratio of sequence changes, were found to have a significantly
lower G+C content and CG dinucleotide ratio than the DNA regions 1 and
3, which contain few sequence changes or none at all. In light of the
fact that differential selective constraints can often distinguish between functional and functionless DNA (36, 37), this finding raised
the possibility that the regulatory elements of the GS gene are
predominantly located in regions 1 and 3 and not in regions 2 and
4.

View larger version (44K):
[in this window]
[in a new window]
|
Fig. 1.
Distribution of mutational events along the
upstream sequence of the GS gene. A, nucleotide
sequence of the 5' upstream region of the GS gene. Numbers
appearing in the left margin refer to the first
nucleotide listed in each line. The first nucleotide upstream of the
transcription start site was given the number 1. The upper
line presents the sequence determined in this study. The
lower line indicates the differences between this
sequence and the sequence of a GS clone isolated from an independent
White Leghorn chicken library (43). B, schematic
representation of the upstream sequence of the GS gene. The
short vertical lines indicate the
relative locations of the mutational events. The sequence was divided
into four regions according to the density of the mutational
events.
|
|
View this table:
[in this window]
[in a new window]
|
Table I
Number of mutational events, G+C content, and CG dinucleotide ratio in
the different regions of the GS upstream sequence
The number of mutational events in each DNA region (see Fig. 1) was
calculated by considering changes of several adjacent nucleotides as
one mutational event. G+C content is the percentage of G+C bases in the
sequence of each DNA region. Observed (obs) CG is the number of the
dinucleotide CG in each region. Expected (exp) CG is the expected
number of CG in each region, calculated according to Pupko and Grauer
(44). The percentage of deviation from expected is calculated according
to the formula: 100 × (observed expected)/expected.
|
|
Functional Analysis of the 5'-Flanking Region of the GS
Gene--
In order to learn whether differential selective constraints
reflect the location of regulatory elements, we decided to focus on
regions 3 and 4, which represent a highly conserved and a highly mutated DNA region, respectively (Fig. 1B). Region 3 has
been already shown to contain two functional elements that are directly involved in the responsiveness of the GS gene to glucocorticoids: a
glucocorticoid response element (GRE) at 2086 to 2100 (14, 15) and
an AP1/ATF/CRE-like site at 2110 to 2117 (15, 38). To determine
whether the sequence located in region 4 might also contain regulatory
functions, we generated a construct containing 2.8 kb (2.8 GS) of
5'-flanking region of the GS gene fused to the reporter gene CAT.
Constructs of the GS upstream region, which contain (2.1 GS) or lack
(1.7 GS) the GRE sequence, were used as a control. The various
constructs were transfected into E10 retina and the ability of cortisol
to induce CAT expression was assayed (Fig.
2). In all experiments, the measured CAT
activity was normalized to the luciferase activity derived from a
co-transfected internal control plasmid RSVL(SEL) to correct for
differences in transfection efficiency. As expected, the 1.7 GS
construct, which does not contain the GRE sequence, was not inducible
by cortisol, whereas the 2.1 GS construct, which contains the GRE, was
highly inducible. Analysis of the 2.8 GS construct revealed that the
sequence further upstream of the GRE contains a putative regulatory
element that can markedly repress the hormonal response. To identify
this apparent silencing element, we generated a series of constructs
containing varying lengths of the upstream sequence and tested their
expression. Partial or complete deletion of the 5'-most 0.6 kb did not
diminish the repressive effect. These data therefore localized the
repressive activity to a 258-bp domain lying immediately upstream of
the GRE site.

View larger version (17K):
[in this window]
[in a new window]
|
Fig. 2.
Inducibility of the GS constructs in
embryonic retinal tissue. Retinal tissue was transfected with the
various GS-CAT constructs (5 µg of DNA/8 × 106
cells) together with the luciferase reporter construct RSVL(SEL) (0.6 µg of DNA/8 × 106 cells). The transfected cultures
were maintained for 48 h in the presence (black
bars) or absence (striped bars) of cortisol. CAT
and luciferase activities were then examined. The CAT assays were
adjusted to include an equal amount of luciferase activity. The
percentage of CAT conversion was calculated by scanning of the TLC
plates with a PhosphorImager instrument. In each experiment, the value
of CAT conversion in the retina transfected with the 2.1 GS construct
and induced by cortisol was given the arbitrary number of 100 and used
to normalize all other results. The data shown are the means ± S.E. of at least three separate experiments.
|
|
The repressive activity of this 258-bp domain was not restricted to the
retinal tissue, but was also exerted in HeLa cells. In these cells,
however, inducibility of the GS promoter constructs was dependent on
co-transfection of a glucocorticoid receptor expression vector. As in
the retina, cortisol induced a marked increase in CAT activity in HeLa
cells transfected with the 2.1 GS construct, but not in those
transfected with either the 2.8 or the 2.3 GS construct (Fig.
3). By visual inspection of the 258-bp
domain, we identified a sequence of 21 nucleotides with considerable
homology (13/21) to the consensus sequence of the NRSE (39). This
element is found in the regulatory region of several neural-specific
genes and represses their expression in non-neural cells. To determine
whether this sequence is responsible for the observed repression of the
GS promoter activity, we examined whether an internal deletion of the
21-bp sequence, in the context of the 2.3 GS construct, eliminates the
silencing activity. Our results clearly demonstrated that deletion of
the 21-bp sequence from the 2.3 GS construct (2.3 21GS) resulted in
almost complete elimination of the silencing activity in both HeLa
(Fig. 3) and embryonic retinal cells (data not shown), indicating that
this sequence represents a functional silencer element.

View larger version (31K):
[in this window]
[in a new window]
|
Fig. 3.
Inducibility of the GS and GRE-TK constructs
in HeLa cells. HeLa cells were transfected with the various GS-CAT
constructs (1.5 µg of DNA/8 × 105 cells) together
with the GR expression vector p6RGR (0.2 µg of DNA/8 × 105 cells) or with the various GRE-TK constructs (1.5 µg
of DNA/8 × 105 cells). Transfection efficiency was
controlled by co-transfection with the luciferase reporter construct
RSVL(SEL) (0.5 µg of DNA/8 × 105 cells). The
transfected cells were maintained for 24 h in the presence
(black bars) or absence (striped
bars) of cortisol. CAT and luciferase activities were then
examined. CAT activity was calculated as described in the legend to
Fig. 2. The data shown are the means ± S.E. of at least three
separate experiments. The upper sequence is the
consensus NRSE sequence (39).
|
|
The location of this 21-bp sequence, between 2176 and 2196, is
within region 3 of the GS upstream sequence, the region which also
contains other regulatory elements and in which no mutational events
were identified. In contrast, region 4, which contains a high ratio of
mutational events, did not show any significant regulatory activity.
These findings suggest that the distribution of mutational events along
the upstream sequence of the GS gene reflects the location of DNA
elements involved in gene control. They also indicate that the
regulatory region of the GS gene includes, in addition to positive
regulatory elements, a silencing element that can repress the hormonal response.
Effect of the Silencer Element on a Heterologous GRE
Promoter--
To further characterize the functional properties of the
21-bp GSSE, we examined its ability to confer negative control upon a
heterologous glucocorticoid-regulated promoter. The 258-bp domain (258-GRE-TK) or the 21-bp sequence (GSSE-GRE-TK) was fused immediately upstream of a "minimal" GRE-TK promoter, which contains two copies of a synthetic GRE sequence and is linked to the reporter gene CAT
(14). The constructs were transfected into HeLa cells, and their
activity in the presence or absence of cortisol was assessed. The
258-bp domain and the 21-bp sequence showed little or no effect on
basal activity, but both of them greatly repressed the hormonal response. Addition of one more copy of the GSSE sequence (GSSE2-GRE-TK) did not increase the repressive effect. The repressive activity of the
GSSE sequences was orientation-independent (ESSG2-GRE-TK), but
relocation of the two GSSE copies to a remote site, 2433 nucleotides upstream of the GRE, almost completely eliminated the silencing of the
hormonal response.
As mentioned above, the GSSE sequence shows considerable homology with
the consensus sequence of the NRSE (Fig. 3). However, the 4-5- fold
activation observed upon removal of the GSSE from the regulatory region
of the GS gene was relatively weak compared with that observed with
NaII and SCG10 genes, in which deletion or mutation of the NRSE
resulted in a 16-40-fold increase of their promoter activities in HeLa
cells (17, 18). To compare the silencing activity of the GSSE with that
of the NRSE, we constructed a NRSE2-GRE-TK plasmid in which two copies
of SCG10-NRSE replaced those of the GSSE immediately upstream of the
GRE-TK promoter. The results of transfection experiments clearly
indicated that, in the context of the GRE-TK promoter, the silencing
activities of the NRSE and the GSSE were similar (Fig. 3). These
findings suggest that the GSSE is a NRSE-like element, which, when
located proximally to the GRE, has little or no effect on basal
transcription, but can repress induction by glucocorticoids.
Identification of a GSSE-binding Protein--
The silencing
activity of the NRSE is mediated by a NRSE-binding protein, known as
NRSF (24) or REST (25). This protein is expressed in non-neural cells
and silences the expression of NRSE-containing genes. To learn whether
the GSSE also interacts with a cellular protein(s), we performed a
series of electrophoretic mobility shift assays on nuclear extracts
from HeLa cells using the oligonucleotide that contains two copies of
the GSSE sequence as a probe (Fig. 4).
The specificity of the gel shift was established by a series of
competition experiments. Specific competition was obtained with a
50-fold excess of the GSSE, but not with a similar excess of an
unrelated oligonucleotide derived from a mutated octamer-binding
sequence (34). As expected from the sequence homology and functional
similarity, the oligonucleotide that contains two copies of the NRSE
sequence (17) could also competitively inhibit the formation of the
GSSE complex, although the NRSE competition was less efficacious than
that observed with the homologous GSSE. As in the case of the NRSE (17,
18), the GSSE binding activity was cell type-specific. This was
demonstrated by gel-shift analysis of nuclear extracts prepared from
the non-neural cell line HeLa, the neuronal cell line PC12 and the
glial cell line C6. GSSE binding activity was detected in HeLa extracts
and was competed by excess of GSSE, but not by a similar excess of an
unrelated oligonucleotide. By contrast, no GSSE binding activity was
detected in extracts prepared from PC12 or C6 cells (Fig.
5A). These results were
consistent with the repressive activity of the GSSE in these cells. In
the context of the GRE-TK construct, the GSSE caused a 6-fold decline in hormonal induction in HeLa cells but only a 1.4- and a 1.7-fold decline in PC12 and C6 cells, respectively (Fig. 5B). The
repressive activity in PC12 and C6 cells might be attributable to low
levels of NRSF, which are hardly detectable by gel-shift analysis, but whose existence has been demonstrated by Northern blot analysis or upon
long exposure of Western blots (18, 24, 25). Thus, it is possible that
the GSSE represses hormonal induction of gene transcription by binding
to the silencing factor NRSF. The fact that NRSF is expressed
predominantly in non-neural cells may explain why glucocorticoids
induce a high level of GS expression in neural tissues only.

View larger version (62K):
[in this window]
[in a new window]
|
Fig. 4.
Nuclear extracts from HeLa cells contain GSSE
binding activity. Gel-shift assays were performed using nuclear
extracts from HeLa cells and 32P-labeled GSSE-containing
oligonucleotide as the probe. The GSSE-specific binding complex is
indicated by an arrow. Competitors used (in the molar excess
indicated) were unlabeled GSSE-containing oligonucleotide in
lanes 2-4, nonspecific (NS) oligonucleotide in
lanes 5-7 and NRSE-containing oligonucleotide in
lanes 8 to 10. Lane
1 shows binding in the absence of competitor.
|
|

View larger version (32K):
[in this window]
[in a new window]
|
Fig. 5.
GSSE binding and repressive activities are
cell type-specific. A, gel-shift assays were performed
using nuclear extracts (7 µg) from non-neural HeLa cells
(lanes 1-10), neuronal cell line PC12
(lane 11), and glioma cell line C6
(lane 12). 32P-Labeled
GSSE-containing oligonucleotide was used as a probe. Competitors used
were unlabeled GSSE-containing oligonucleotide (lanes
2-5), and nonspecific oligonucleotide (lanes
6-9). The GSSE-specific binding complex is indicated by an
arrow. B, HeLa, PC12, and C6 cells were
transfected with the GRE-TK construct (1.5 µg of DNA/8 × 105 cells) or with the GSSE-GRE-TK construct (1.5 µg of
DNA/8 × 105 cells). Transfection efficiency was
controlled by co-transfection with the luciferase reporter construct
RSVL(SEL) (0.5 µg of DNA/8 × 105 cells). The
transfected cells were maintained for 24 h in the presence or
absence of cortisol. CAT and luciferase activities were then examined.
CAT assays were adjusted to include an equal amount of luciferase
activity. The percentage of CAT conversion was calculated by scanning
of the TLC plates with a PhosphorImager instrument. Fold repression was
calculated by comparing the inducibility of the GRE-TK construct with
that of the GSSE-GRE-TK in each cell line. The data shown are the
means ± S.E. of at least three separate experiments.
|
|
GSSE Binding Activity Is Inversely Correlated with GS Expression
during Embryonic Development of the Neural Retina--
Expression of
GS in the neural retina is developmentally regulated. It is low at
early embryonic ages and increases progressively with age. To assess
the possible involvement of the GSSE-mediated silencing activity in the
developmental control of GS expression, we identified the protein(s)
that interact with the GSSE in the chick neural retina and examined its
binding activity at different developmental ages. We performed a series
of electrophoretic mobility shift assays on nuclear extracts from
retinal tissue at day 7 of embryonic development, a stage at which GS
expression is very low (Fig.
6A). Specific competition was
obtained with a 100-fold excess of the GSSE, but not with a similar
excess of an unrelated oligonucleotide. As with HeLa cell extracts, the
NRSE sequence could competitively inhibit the formation of the GSSE
complex and vice versa (Fig. 6B). The complexes
formed by the GSSE or NRSE were similar in size, but had in retinal
extracts more retarded mobility than those formed in HeLa extracts
(Fig. 6C). These findings support the possibility that GSSE
silencing activity is mediated by NRSF and that human and chicken NRSF
differ in size. Next we performed mobility shift assays on nuclear
extracts from retinal tissues at different developmental ages. As shown
in Fig. 7A, GSSE binding
activity was high in early embryonic retina and declined progressively
with age. No binding activity was detected in adult retina. This is in
contrast to single-stranded DNA binding activity, which did not alter
with age (Fig. 7B). The pattern of GSSE binding activity
correlates inversely with the level of GS expression as evidenced both
by GS mRNA accumulation and by GS activity (Fig. 7C).
These findings suggest that down-regulation of NRSF might be
functionally related to the developmentally dependent increase in GS
expression.

View larger version (79K):
[in this window]
[in a new window]
|
Fig. 6.
Nuclear extracts from retinal tissue contain
GSSE binding activity. A, gel-shift assays were
performed using nuclear extracts from E7 retina and
32P-labeled GSSE containing oligonucleotide as the probe.
Competitors used (in the molar excess indicated) were unlabeled
GSSE-containing oligonucleotide (lanes 3-6) and
nonspecific (NS) oligonucleotide (lanes
7-10). Lane 1 shows the probe without
nuclear extract, and lane 2 shows binding in the
absence of competitor. B, gel-shift assays were performed
using nuclear extracts from E7 retina and 32P-labeled
GSSE-containing oligonucleotide (lanes 1-9) or
32P-labeled NRSE-containing oligonucleotide
(lanes 10-18) as the probe. Competitors used
were unlabeled GSSE-containing oligonucleotide (lanes
2-4 and 16-18), nonspecific (NS)
oligonucleotide (lanes 5, 6,
14, and 15) and NRSE-containing oligonucleotide
(lanes 7-9 and 11-13).
Lanes 1 and 10 show binding in the
absence of competitor. C, gel-shift assays were performed
using nuclear extracts from E7 retina (lanes 1 and 2) or HeLa cells (lanes 3 and
4) and 32P-labeled GSSE-containing
oligonucleotide (lanes 1 and 3) or
32P-labeled NRSE-containing oligonucleotide
(lanes 2 and 4) as the probe. The
GSSE- or NRSE-specific complex is indicated by an
arrow.
|
|

View larger version (34K):
[in this window]
[in a new window]
|
Fig. 7.
GSSE binding activity and GS expression in
the developing retinal tissue are inversely correlated. Gel-shift
assays were performed using nuclear extracts from E7 (lane
1), E12 (lane 2), E19 (lane
3), and adult (lane 4) retina.
32P-Labeled GSSE-containing oligonucleotide (A)
or 32P-labeled single-stranded oligonucleotide, which
contains two copies of the NRSE (B), were used as the probe.
C, to quantitate the level of GSSE binding activity at the
different developmental ages, autoradiograms were scanned with a
PhosphorImager instrument and the relative labeling of the bands was
calculated. The level of binding activity in E7 retina was given the
arbitrary number of 100. Relative levels of GS mRNA accumulation
(9) and GS activity (9, 12) at the different developmental ages are
presented.
|
|
 |
DISCUSSION |
GS is a key enzyme in the recycling of the neurotransmitter
glutamate, a task that requires a high level of GS expression in neural
tissues. However, unlike many neural-specific genes that are expressed
exclusively in neural tissues, GS is also a housekeeping enzyme that is
expressed at a low basal level in non-neural tissues. Since there
appears to be only one copy of the GS gene (2, 40), it is reasonable to
expect that GS is controlled by a modular regulatory mechanism that
allows constitutive expression in most cell types and specific
induction in neural tissues.
In an attempt to understand the molecular mechanism underlying GS
regulation, we sequenced and functionally analyzed the upstream region
of the gene. By comparing the sequences of two independent genomic
clones, we could identify a considerable number of mutational events
along the DNA sequence. These events were not evenly distributed but
rather were concentrated in distinct regions that also differed in
their G+C content and CG dinucleotide ratio (observed to expected). Differences of this type are often found between exons and introns or
between coding regions and pseudogenes or intergenic spacer regions,
and are attributed to differential selective constraints (35-37).
Functional analysis of the 5' upstream region of the GS gene revealed
that the DNA region between 2287 and 2657, which contained a high
ratio of mutational events, did not show any significant regulatory
activity, whereas the region between 1700 and 2287, in
which no mutational events were identified, contained several
regulatory elements. These findings suggest that DNA regions involved
in the regulation of gene transcription might exert a counteracting
effect of selection pressure similar to that of coding regions in the
gene. They also suggest that a comparative analysis of sequencing data
might allow prediction of the location of putative regulatory elements
in the upstream sequence of a given gene.
The regulatory region of the GS gene was found to contain, in addition
to positive regulatory elements that confer responsiveness to
glucocorticoid, a silencer element that can repress the hormonal response. By performing deletion and addition experiments, we narrowed
the location of the silencer to a 21-bp region located 76 bp upstream
of the GRE and 2176 bp upstream of the transcription start site. This
GSSE sequence is closely related to the silencer element NRSE/RE1,
which is present in several neural-specific genes, and represses their
expression in undifferentiated neural tissues and in non-neural cells.
The following lines of evidence suggested that the GSSE is a putative
NRSE sequence that can bind the silencing factor NRSF and mediate
repression of gene induction in a cell type-specific manner. 1) The
GSSE was found to be capable of repressing hormonal induction of gene
transcription both in embryonic retinal tissue and in the non-neural
HeLa cells. 2) The repressive activity of the GSSE was not restricted
to the GS promoter but could also be conferred on a heterologous GRE promoter (GRE-TK). Replacement of the GSSE sequence, in the context of
the GRE-TK promoter, with the sequence of the NRSE of the SCG10 gene
resulted in a comparable repression of the hormonal response. 3) Using
a gel-shift assay, we were able to identify in both HeLa and embryonic
retinal cells a factor that interacts with the GSSE, and to demonstrate
that this factor also interacts with the NRSE. 4. Formation of a
GSSE-protein complex was cell type-specific; it was detected in the
non-neural HeLa cells, but hardly or not at all in the neuronal cell
line PC12 or the glioma cell line C6. Consistent with this, GSSE
repressive activity in HeLa cells was significantly higher than in PC12
or C6 cells. A similar cell type specificity has also been demonstrated
for several other NRSE-containing promoters (17-19, 21, 25). The
ability of the GSSE to repress the hormonal induction of gene
transcription and the ubiquitous expression of NRSF in non-neural cell
types suggests that the GSSE might be directly involved in the
restriction of GS induction to neural tissues. It is important to note
that the cell type specificity of GS induction can also be controlled
by the glucocorticoid receptor itself. Induction of gene expression requires a threshold level of active glucocorticoid receptor molecules; below that level, cells are not responsive to the hormone (41). This is
the case in retinal neurons that do not express the receptor molecules,
or express them only at low levels (1, 16). In these cells GS is not
inducible by glucocorticoids, despite the fact that NRSF is not
expressed. Glucocorticoid receptor molecules are, however, expressed in
many non-neural cell types, and in these cells the repressive activity
of the GSSE might be crucial for maintaining a low basal level of GS expression.
The GSSE might also be involved in prevention of the premature
expression of GS in early embryonic retina. This is suggested by the
finding that the levels of GSSE binding activity and GS expression
during embryonic development are inversely correlated. GS expression
increases with age, whereas GSSE binding activity declines. While the
repressive activity of the GSSE might play an important role in the
developmental control of GS expression, it is evidently not the only
mechanism involved in this process. We and others have demonstrated
that changes in glucocorticoid receptor transcription activity play a
role in the developmental control of GS expression (14, 32, 42).
Transcription activity of the glucocorticoid receptor, which is
modulated by a mechanism involving the c-Jun protein (32), is low in
early embryonic retina and increases progressively with age. It is
therefore possible that a low level of transcriptionally active
receptor molecules, in conjunction with a high level of NRSF in early
embryonic retina, ensures that GS would not be precociously induced.
Several models can be envisaged to explain how NRSF protein might
silence the hormonal response. Two general categories of transcriptional repression can be considered. NRSF might silence by
binding directly to the initiation complex or indirectly through co-repressor proteins. Alternatively, NRSF might block induction by
interacting directly or indirectly with the glucocorticoid receptor
protein or by competing for limiting amounts of a co-activator in the
cell. In this study we examined the repressive activity of the GSSE in
the context of two different promoter constructs. The distance of the
GSSE sequence from the GRE site in the GS promoter construct and in the
GRE-TK construct was 76 and 34 nucleotides, respectively, while its
distance from the transcription start site was 2176 and 236 nucleotides, respectively. Nevertheless, in both constructs the GSSE
caused a 5-fold decline in gene induction. This might suggest that the
GSSE confers repression of gene induction in a position-independent
manner. However, relocation of the GSSE, in the context of the GRE-TK
construct, to a position that is 2433 nucleotides upstream of the GRE
and 2635 nucleotides upstream of the transcription start site almost
completely eliminated the silencing of the hormonal response. Thus, it
is possible that repression of the hormonal response is
position-independent with respect to the transcription start site, but
requires a location proximal to the GRE. Our findings also indicate
that in the context of a GRE promoter, the GSSE has little or no effect
on basal activity. Under these conditions the repressive activity of
the GSSE is restricted to the hormonal response, allowing the basal
transcription machinery to express a low level of GS.
The regulatory system of the GS gene might have evolved to meet the
specific requirements for a particularly high level of GS expression in
glial cells in order to allow recycling of the neurotransmitter
glutamate, and a low basal level in most other cells for housekeeping
duties. A plausible mode for cell type-specific control of GS
expression is presented in Fig. 8. In
non-neural cells, which express active glucocorticoid receptor
molecules, NRSF represses hormonal induction and thus maintains a low
basal level of GS expression. Glial cells express a high level of
active glucocorticoid receptor molecules and do not express NRSF;
therefore, GS expression in these cells is high. Neurons do not express
NRSF, nor do they express the glucocorticoid receptor; therefore, GS expression in neurons is low. Thus, cell type specificity of GS expression might be achieved by utilizing the positive and negative regulatory elements, the GRE and the GSSE, which are not glial-specific by themselves, but which may establish a glial-specific pattern of GS
expression through their mutual activity.

View larger version (22K):
[in this window]
[in a new window]
|
Fig. 8.
A schematic model for cell type-specific
control of GS expression. A, in non-neural cells, which
express active glucocorticoid receptor molecules, NRSF represses
hormonal induction and thus maintains a low basal level of GS
expression. B, glial cells express a high level of active
glucocorticoid receptor molecules and do not express NRSF; in these
cells, GS expression is high. C, neurons that do not express
either NRSF or the glucocorticoid receptor express a low level of
GS.
|
|
 |
ACKNOWLEDGEMENTS |
We thank Dr. Y. Weisman for the adult retina,
Dr. M. Horowitz for the oligonucleotide probe, Dr. D. Grauer and T. Pupko for help with the sequence analysis, and S. Smith for editorial assistance.
 |
FOOTNOTES |
*
This work was supported by the Tel Aviv University Basic
Research Fund and by the Israeli Science Foundation.The costs of publication of this
article were defrayed in part by the
payment of page charges. The article
must therefore be hereby marked
"advertisement" in
accordance with 18 U.S.C. Section
1734 solely to indicate this fact.
The nucleotide sequence(s) reported in this paper has been submitted to the GenBankTM/EMBL Data Bank with accession number(s) AF105022.
To whom correspondence and reprint requests should be addressed.
Tel.: 972-3-640-7019; Fax: 972-3-640-6834; E-mail:
vardi{at}post.tau.ac.il.
 |
ABBREVIATIONS |
The abbreviations used are:
GS, glutamine
synthetase;
GRE, glucocorticoid response element;
GSSE, glutamine
synthetase silencer element;
NRSE, neural restrictive silencer element;
NRSF, neural restrictive silencer factor;
CAT, chloramphenicol
acetyltransferase;
PCR, polymerase chain reaction;
PMSF, phenylmethylsulfonyl fluoride;
DTT, dithiothreitol;
bp, base pair()s);
kb, kilobase pair(s);
DMEM, Dulbecco's modified Eagle's medium;
TK, thymidine kinase;
RSV, Rous sarcoma virus;
REST, RE-1-silencing
transcription factor.
 |
REFERENCES |
-
Grossman, R.,
Fox, L. E.,
Gorovits, R.,
Ben-Dror, I.,
Reisfeld, S.,
and Vardimon.
(1994)
Brain Res. Mol. Brain Res.
21,
312-320[Medline]
[Order article via Infotrieve]
-
Patejunas, G.,
and Young, A. P.
(1987)
Mol. Cell. Biol.
7,
1070-1077[Abstract/Free Full Text]
-
Linser, P.,
and Moscona, A. A.
(1979)
Proc. Natl. Acad. Sci. U. S. A.
76,
6476-6480[Abstract/Free Full Text]
-
Martinez, H. A.,
Bell, K. P.,
and Norenberg, M. D.
(1977)
Science
195,
1356-1358[Abstract/Free Full Text]
-
Linser, P.,
and Moscona, A. A.
(1981)
Dev. Brain Res.
1,
103-119
-
Van-den-Berg, C. J.
(1970)
in
Handbook of Neurochemistry (Lajtha, A., ed), pp. 355-379, Plenum, New York
-
Kennedy, A. J.,
Voaden, M. J.,
and Marshall, J.
(1974)
Nature
252,
50-52[CrossRef][Medline]
[Order article via Infotrieve]
-
Vardimon, L.,
Fox, L. E.,
Degenstein, L.,
and Moscona, A. A.
(1988)
Proc. Natl. Acad. Sci. U. S. A.
85,
5981-5985[Abstract/Free Full Text]
-
Gorovits, R.,
Yakir, A.,
Fox, L. E.,
and Vardimon, L.
(1996)
Brain Res. Mol. Brain Res.
43,
321-329[Medline]
[Order article via Infotrieve]
-
Patejunas, G.,
and Young, A. P.
(1990)
J. Biol. Chem.
265,
15280-15285[Abstract/Free Full Text]
-
Vardimon, L.,
Fox, L. E.,
and Moscona, A. A.
(1986)
Proc. Natl. Acad. Sci. U. S. A.
83,
9060-9064[Abstract/Free Full Text]
-
Moscona, A. A.
(1983)
in
Progress in Retinal Research (Osborne, N., and Chader, G., eds), pp. 111-135, Pergamon, Oxford
-
Moscona, M.,
and Moscona, A. A.
(1979)
Differentiation
13,
165-173[Medline]
[Order article via Infotrieve]
-
Ben-Dror, I.,
Havazelet, N.,
and Vardimon, L.
(1993)
Proc. Natl. Acad. Sci. U. S. A.
90,
1117-1121[Abstract/Free Full Text]
-
Zhang, H. Y.,
and Young, A. P.
(1991)
J. Biol. Chem.
266,
24332-24338[Abstract/Free Full Text]
-
Gorovits, R.,
Ben-Dror, I.,
Fox, L. E.,
Westphal, H. M.,
and Vardimon, L.
(1994)
Proc. Natl. Acad. Sci. U. S. A.
91,
4786-4790[Abstract/Free Full Text]
-
Mori, N.,
Schoenherr, C.,
Vandenbergh, D. J.,
and Anderson, D. J.
(1992)
Neuron
9,
45-54[CrossRef][Medline]
[Order article via Infotrieve]
-
Kraner, S. D.,
Chong, J. A.,
Tsay, H. J.,
and Mandel, G.
(1992)
Neuron
9,
37-44[CrossRef][Medline]
[Order article via Infotrieve]
-
Li, L.,
Suzuki, T.,
Mori, N.,
and Greengard, P.
(1993)
Proc. Natl. Acad. Sci. U. S. A.
90,
1460-1464[Abstract/Free Full Text]
-
Bessis, A.,
Salmon, A. M.,
Zoli, M.,
Le-Novere, N.,
Picciotto, M.,
and Changeux.
(1995)
Neuroscience
69,
807-819[CrossRef][Medline]
[Order article via Infotrieve]
-
Wood, I. C.,
Roopra, A.,
and Buckley, N. J.
(1996)
J. Biol. Chem.
271,
14221-14225[Abstract/Free Full Text]
-
Mieda, M.,
Haga, T.,
and Saffen, D. W.
(1996)
J. Biol. Chem.
271,
5177-5182[Abstract/Free Full Text]
-
Kallunki, P.,
Jenkinson, S.,
Edelman, G. M.,
and Jones, F. S.
(1995)
J. Biol. Chem.
270,
21291-21298[Abstract/Free Full Text]
-
Schoenherr, C. J.,
and Anderson, D. J.
(1995)
Science
267,
1360-1363[Abstract/Free Full Text]
-
Chong, J. A.,
Tapia-Ramirez, J.,
Kim, S.,
Toledo, A. J.,
Zheng, Y.,
Boutros, M. C.,
Altshuller, Y. M.,
Frohman, M. A.,
Kraner, S. D.,
and Mandel, G.
(1995)
Cell
80,
949-957[CrossRef][Medline]
[Order article via Infotrieve]
-
Chen, Z. F.,
Paquette, A. J.,
and Anderson, D. J.
(1998)
Nat. Genet.
20,
136-142[CrossRef][Medline]
[Order article via Infotrieve]
-
Sanger, F.,
Nicklen, S.,
and Coulson, A. R.
(1977)
Proc. Natl. Acad. Sci. U. S. A.
74,
5463-5467[Abstract/Free Full Text]
-
Gorman, C. M.,
Moffat, L. F.,
and Howard, B. H.
(1982)
Mol. Cell. Biol.
2,
1044-1051[Abstract/Free Full Text]
-
Dieffenbach, C. W.,
and Dveksler, G. S.
(1995)
PCR Primer: A Laboratory Manual, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY
-
de-Wet, J.,
Wood, K. V.,
DeLuca, M.,
Helinski, D. R.,
and Subramani, S.
(1987)
Mol. Cell. Biol.
7,
725-737[Abstract/Free Full Text]
-
Miesfeld, R.,
Rusconi, S.,
Godowski, P. J.,
Maler, B. A.,
Okret, S.,
Wikstrom, A. C.,
Gustafsson, J. A.,
and Yamamoto, K. R.
(1986)
Cell
46,
389-399[CrossRef][Medline]
[Order article via Infotrieve]
-
Berko-Flint, Y.,
Levkowitz, G.,
and Vardimon, L.
(1994)
EMBO J.
13,
646-654[Medline]
[Order article via Infotrieve]
-
Lee, K. A.,
Bindereif, A.,
and Green, M. R.
(1988)
Gene Anal. Tech.
5,
22-31[CrossRef][Medline]
[Order article via Infotrieve]
-
Moran, D.,
Galperin, E.,
and Horowitz, M.
(1997)
Gene (Amst.)
194,
201-213[CrossRef][Medline]
[Order article via Infotrieve]
-
Bulmer, M.
(1987)
Mol. Biol. Evol.
4,
395-405[Abstract]
-
Kimura, M.
(1983)
The Neutral Theory of Molecular Evolution, Cambridge University Press, Cambridge
-
Sharp, P. M.,
and Li, W. H.
(1987)
Mol. Biol. Evol.
4,
222-230[Abstract]
-
Ben-Or, S.,
and Okret, S.
(1993)
Mol. Cell. Biol.
13,
331-340[Abstract/Free Full Text]
-
Schoenherr, C. J.,
Paquette, A. J.,
and Anderson, D. J.
(1996)
Proc. Natl. Acad. Sci. U. S. A.
93,
9881-9886[Abstract/Free Full Text]
-
Magnuson, S. R.,
and Young, A. P.
(1988)
Dev. Biol.
130,
536-542[CrossRef][Medline]
[Order article via Infotrieve]
-
Vanderbilt, J. N.,
Miesfeld, R.,
Maler, B. A.,
and Yamamoto, K. R.
(1987)
Mol. Endocrinol.
1,
68-74[Abstract/Free Full Text]
-
Zhang, H.,
and Young, A. P.
(1993)
J. Biol. Chem.
268,
2850-2856[Abstract/Free Full Text]
-
Pu, H. F.,
and Young, A. P.
(1990)
Gene (Amst.)
89,
259-263[CrossRef][Medline]
[Order article via Infotrieve]
-
Pupko, T., and Graur, D. (1999) J. Mol Evol. 48,
in press
Copyright © 1999 by The American Society for Biochemistry and Molecular Biology, Inc.

CiteULike Complore Connotea Del.icio.us Digg Reddit Technorati What's this?
This article has been cited by other articles:

|
 |

|
 |
 
L. Abramovitz, T. Shapira, I. Ben-Dror, V. Dror, L. Granot, T. Rousso, E. Landoy, L. Blau, G. Thiel, and L. Vardimon
Dual Role of NRSF/REST in Activation and Repression of the Glucocorticoid Response
J. Biol. Chem.,
January 4, 2008;
283(1):
110 - 119.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. A. Trujillo, M. Sakagashira, and N. L. Eberhardt
The Human Growth Hormone Gene Contains a Silencer Embedded within an Alu Repeat in the 3'-Flanking Region
Mol. Endocrinol.,
October 1, 2006;
20(10):
2559 - 2575.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S.-L. Liang, G. C. Carlson, and D. A. Coulter
Dynamic Regulation of Synaptic GABA Release by the Glutamate-Glutamine Cycle in Hippocampal Area CA1.
J. Neurosci.,
August 15, 2006;
26(33):
8537 - 8548.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
B. Desvergne, L. Michalik, and W. Wahli
Transcriptional Regulation of Metabolism
Physiol Rev,
April 1, 2006;
86(2):
465 - 514.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
F. Gaunitz, K. Heise, and R. Gebhardt
A Silencer Element in the First Intron of the Glutamine Synthetase Gene Represses Induction by Glucocorticoids
Mol. Endocrinol.,
January 1, 2004;
18(1):
63 - 69.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
X.-P. Wang, Y.-J. Zhang, J.-H. Deng, H.-Y. Pan, F.-C. Zhou, and S.-J. Gao
Transcriptional Regulation of Kaposi's Sarcoma-associated Herpesvirus-encoded Oncogene Viral Interferon Regulatory Factor by a Novel Transcriptional Silencer, Tis
J. Biol. Chem.,
March 29, 2002;
277(14):
12023 - 12031.
[Abstract]
[Full Text]
[PDF]
|
 |
|
Copyright © 1999 by the American Society for Biochemistry and Molecular Biology.
|
Advertisement
Advertisement
|