![]()
|
|
||||||||
J Biol Chem, Vol. 274, Issue 17, 11505-11512, April 23, 1999
,
,
From the The myeloid restricted membrane glycoprotein,
CD33, is a member of the recently characterized "sialic acid-binding
immunoglobulin-related lectin" family. Although CD33 can mediate
sialic acid-dependent cell interactions as a recombinant
protein, its function in myeloid cells has yet to be determined.
Since CD33 contains two potential immunoreceptor
tyrosine-based inhibition motifs in its cytoplasmic tail, we
investigated whether it might act as a signaling receptor in myeloid
cells. Tyrosine phosphorylation of CD33 in myeloid cell lines was
stimulated by cell surface cross-linking or by pervanadate, and
inhibited by PP2, a specific inhibitor of Src family tyrosine kinases.
Phosphorylated CD33 recruited both the protein-tyrosine phosphatases,
SHP-1 and SHP-2. CD33 was dephosphorylated in vitro by the
co-immunoprecipitated tyrosine phosphatases, suggesting that it might
also be an in vivo substrate. The first CD33
phosphotyrosine motif is dominant in CD33-SHP-1/SHP-2 interactions,
since mutating tyrosine 340 in a CD33-cytoplasmic tail fusion protein
significantly reduced binding to SHP-1 and SHP-2 in THP-1 lysates,
while mutation of tyrosine 358 had no effect. Furthermore, the
NH2-terminal Src homology 2 domain of SHP-1 and SHP-2,
believed to be essential for phosphatase activation, selectively bound
a CD33 phosphopeptide containing tyrosine 340 but not one containing
tyrosine 358. Finally, mutation of tyrosine 340 increased red blood
cell binding by CD33 expressed in COS cells. Hence, CD33 signaling
through selective recruitment of SHP-1/SHP-2 may modulate its ligand(s)
binding activity.
Over the last few years, a novel family of sialic
acid-dependent recognition molecules has emerged. This
family, recently designated "siglecs" (sialic
acid-binding Ig-related lectins), is a
structurally related subgroup of the immunoglobulin superfamily that
includes CD22 (siglec-2), sialoadhesin (siglec-1), MAG (siglec-4), CD33
(siglec-3), and the newest member of the family, siglec-5 (1). All
siglecs have an NH2-terminal V-set Ig-like domain that
contains the sialic acid binding site, followed by varying numbers of
C2-set domains. In addition to common structural features that would
appear to adapt these molecules for functional protein-carbohydrate
cellular interactions, each member exhibits a very specific pattern of
tissue distribution. While CD22 is restricted to B cells, sialoadhesin
to macrophages, and myelin-associated glycoprotein (MAG) to myelinating
oligodendrocytes and Schwann cells, CD33 and siglec 5 are expressed
only on cells of the myelomonocytic lineage.
CD22 is perhaps the best characterized member of the siglec family. In
addition to being an adhesion receptor for sialic-acid bearing ligands
on leukocytes and erythrocytes, CD22 has an important regulatory role
as a signal transduction molecule in B cells (2, 3). The cytoplasmic
tail of CD22 has six tyrosines, two of which are encompassed within
sequences which conform with immunoreceptor tyrosine-based
activation motifs (ITAM),1
while the other four form potential immunoreceptor tyrosine-based inhibition motifs (ITIM). ITAMs and ITIMs are the consensus sequences determined to be necessary for Src homology 2 (SH2) domain binding to
phosphotyrosine. Phosphorylation of the ITAM sequence,
YXX(I/L)X6-8YXX(I/L), allows recruitment of SH2 domain-containing kinases, with greater selectivity conferred by interaction with tandem SH2 domains (4). On
the other hand, the proposed ITIM consensus sequence,
(I/V/L)XYXX(L/V), when phosphorylated, enables
association of SH2 domain-containing phosphatases, SHP-1, SHP-2, or
SHIP (5, 6). Phosphorylation of the ITIM sequences of CD22 and
subsequent recruitment of SHP-1 results in inhibition of BCR-mediated B
cell activation, which then modulates the antigen receptor threshold
(2, 3). Hence, CD22 is a member of an expanding superfamily of
ITIM-bearing negative co-receptors that also includes the killer-cell
inhibitory receptors (KIRs) and Fc CD33, the smallest member of the siglec family, is a 67-kDa
transmembrane glycoprotein with only one V-set and one C2-set Ig-like
domains (9). CD33 is expressed by the earliest myeloid progenitors and
continues to be present during myelomonocytic differentiation until it
is down-regulated on granulocytes, although retained on monocytes. This
specific expression pattern has meant that monoclonal antibodies (mAbs)
directed against CD33 are extremely useful clinical reagents. These
mAbs are extensively used both in the immunodiagnosis of leukemias and
for therapeutic targeting and purging in acute myeloid leukemia
(10-14). However, despite the clinical importance of CD33, little is
known of its role in myeloid cells, except that it may be involved in
sialic acid-dependent cell interactions. Determining the
function of CD33 has become of even greater relevance, since the recent
identification of novel molecules sharing high sequence homology to
CD33 indicates the existence of a distinct subfamily of CD33-like
molecules (15, 16).
Interestingly, the cytoplasmic tail of CD33 contains two tyrosine-based
motifs (LXY340XXL and
TXY358XXV), both potential ITIMs,
although only the first matches the consensus sequence exactly. This
raised the possibility that, similar to CD22 in B cells, CD33 might act
as an inhibitory receptor in myeloid cell signaling.
We report here that CD33 becomes tyrosine-phosphorylated in myeloid
cells after both pervanadate treatment and CD33 receptor cross-linking,
and these stimuli result in recruitment of the tyrosine phosphatases
SHP-1 and SHP-2. Furthermore, we show that the first cytoplasmic
tyrosine residue of CD33 is dominant in SHP-1/SHP-2 binding and that
mutation of this same tyrosine enhances CD33-mediated adhesion.
Materials--
SeeBlue-prestained SDS-PAGE markers were
purchased from Novex. The Hybond-P membrane, enhanced chemiluminescence
Western blotting detection kit, and Bulk GST Purification Module were
obtained from Amersham Pharmacia Biotech. Purified human recombinant
c-Src kinase came from Upstate Biotechnology, Inc. Tyrosine kinase
inhibitors specific to the Src and Syk family kinases, PP2 and
piceatannol, respectively, as well as genistein, were obtained from
Calbiochem. All other chemicals were obtained from Sigma.
Antibodies--
The murine anti-CD33 monoclonal antibodies 1C7/1
and 3D6/1 were produced by the Imperial Cancer Research Fund (London,
United Kingdom) using CD33-Fc recombinant protein as the immunogen. The mouse IgG1 control was purchased from Becton Dickinson. Goat anti-mouse IgG came from Sigma. Monoclonal anti-phosphotyrosine antibody, PY20,
and monoclonal anti-SHP-1 were obtained from Transduction Laboratories.
A polyclonal rabbit anti-SHP-2 (C-18) antibody was purchased from Santa
Cruz Biotechnology. Polyclonal antibodies recognizing the
NH2- and COOH-terminal SH2 domains of SHP-1 and SHP-2
(N-16) were obtained from Upstate Biotechnology, Inc. and Santa Cruz
Biotechnology, respectively. A polyclonal goat anti-GST antibody, and
sheep anti-mouse and donkey anti-rabbit horseradish peroxidase-conjugated secondary antibodies were obtained from Amersham
Pharmacia Biotech. Rabbit anti-goat horseradish peroxidase-conjugated antibody was from Sigma.
Cell Culture--
All cell lines originated from the Imperial
Cancer Research Fund Cell Bank. Myeloid cell lines were cultured in
RPMI medium containing 10% fetal calf serum and supplemented with
antibiotics. COS-1 cells were maintained in Dulbecco's modified
Eagle's medium containing 5% fetal calf serum and supplemented with antibiotics.
Immunoprecipitation and Immunoblotting--
Control and
stimulated cells (typically 107) were lysed in 1 ml of
ice-cold lysis buffer (20 mM Tris-HCl, pH 8, 150 mM NaCl, 1% Triton X-100, 1 mM
Na3VO4, 1 mM AEBSF, and 10 µg/ml
leupeptin) for 20 min at 4 °C. Insoluble material was removed by
centrifugation at 10,000 × g for 10 min at 4 °C.
The Triton-soluble fraction was precleared with 60 µl of a 50%
slurry of protein G-Sepharose for 30 min at 4 °C. Precleared cell
lysates were incubated with 40 µl of 50% slurry of either anti-CD33
IgG1 or mouse IgG1 precoupled to protein G-Sepharose overnight at
4 °C. After three washes with ice-cold lysis buffer, bound proteins
were eluted from the beads by boiling for 10 min in SDS non-reducing
(for samples to be immunoblotted with CD33 antibodies) or reducing
buffer (for samples to be immunoblotted with other antibodies). Eluted
proteins were then resolved on 10% SDS-polyacrylamide gels,
transferred on to Hybond-P membrane, probed with relevant antibodies,
and detected with horseradish peroxidase-conjugated secondary
antibodies using chemiluminescence according to the manufacturer's instructions.
Phosphatase Activity Assay--
Phosphorylation of CD33 was
stimulated by cross-linking CD33 on the surface of THP-1 cells. THP-1
cells (107) were incubated with anti-CD33 monoclonal
antibody 1C7/1 (10 µg/ml in phosphate-buffered saline plus 1% bovine
serum albumin) for 20 min at room temperature, pelleted, and
resuspended in in phosphate-buffered saline plus 1% bovine serum
albumin containing 200 µM Na3VO4
at 37 °C. Anti-mouse IgG (20 µg/ml) was added and cross-linking
allowed to occur for 1 min at 37 °C. Cells were immediately placed
on ice, and lysed by addition of an equal volume of ice-cold 2× Triton
lysis buffer. The Triton-soluble fraction was incubated with 80 µl of
50% slurry of protein G-Sepharose overnight at 4 °C. The beads were
washed three times with ice-cold phosphatase assay buffer (80 mM MOPS, 10 mM EDTA, 10 mM
dithiothreitol, pH 7), and resuspended in 40 µl of phosphatase assay
buffer ± 1 mM Na3VO4 and
incubated for 30 min at 37 °C or 4 °C. The beads were boiled in
the presence of an equal volume of 2× SDS reducing sample buffer, and
the proteins resolved by 10% SDS-PAGE and immunoblotting.
Preparation and Expression of GST Fusion Proteins--
The
cytoplasmic tail portion of CD33 was amplified by polymerase chain
reaction from CD33 cDNA in pCDM8 (donated by Dr. D. L. Simmons
(SmithKline Beecham Pharmaceuticals) (16)) using the primers tf
(5'-AGCGAATTCAAGACCCACAGGAGGAAAG-3') and tr
(5'-AATAGCGGCCGCTCACTGGGTCCTGACCTCTGA-3'), containing EcoRI and
NotI restriction sites, respectively, and cloned into
pGEX-4T-1. Single and double tyrosine point mutations were introduced
into the constructs by polymerase chain reaction using primers tfY340A
(5'-GAGCTGCATGCCGCTTCCCTCAACTTTCATG-3'), trY340A
(5'-GAGGGAAGCGGCATGCAGCTCCTCATCCATC-3'), and trY358A
(5'-AATAGCGGCCGCTCACTGGGTCCTGACCTCTGAGGCTTC-3').
The segments encoding amino acid residues 1-106
(NH2-terminal SH2 domain), 105-213 (COOH-terminal SH2
domain), or 1-213 (NH2- and COOH-terminal SH2 domains) of
SHP-1 and the segments encoding amino acid residues 1-105
(NH2-terminal SH2 domain), 112-213 (COOH-terminal domain),
or 1-213 (NH2- and COOH-terminal SH2 domains) of SHP-2 were amplified by polymerase chain reaction from SHP-1 cDNA (kindly donated by Dr. Benjamin Neel, Beth Israel Hospital, Boston, MA) and
cloned into pGEX-4T-1. The sequences of all DNA constructs were
verified by DNA sequence analysis. The resulting bacterial expression
constructs, GST-CD33, GST-Y340A, GST-Y358A and GST-Y340/358A, and
GST-N-SH2-SHP1, GST-C-SH2-SHP1, and GST-N-SH2-C-SH2-SHP1, were used to
transform Escherichia coli BL21 cells. GST fusion proteins were produced by inducing log-phase 500-ml cultures with 0.2 mM isopropyl-1-thio- Tyrosine Phosphorylation of GST-CD33 Fusion Construct--
100
µg of GST or GST-CD33 fusion protein were incubated with 15 units of
c-Src kinase in 500 µl of tyrosine kinase assay buffer (50 mM Hepes, pH 7.4, 50 mM NaCl, 0.1 mM Na3VO4, 5 mM
MgCl2, 5 mM MnCl2, 5 mM
ATP) at room temperature for 2 h. Phosphorylated proteins were
stored at Immunoprecipitations with GST-CD33 Cytoplasmic Tail
Constructs--
10 µg of GST fusion protein ± tyrosine
phosphorylation were incubated with 1 ml of cell lysate (Triton-soluble
fraction of 107 unstimulated cells) at 4 °C overnight.
The GST fusion protein complexes were captured with 60 µl of 50%
slurry of glutathione-Sepharose beads (Amersham Pharmacia Biotech) for
1 h at 4 °C. The beads were washed three times with ice-cold
lysis buffer, and bound proteins were eluted by boiling in SDS reducing
sample buffer and resolved by 10% SDS-PAGE and immunoblotting.
Peptide Precipitation Analysis--
Biotinylated CD33
phosphopeptides, CD33(335-345) (pY340) and CD33(353-363) (pY358),
were produced by Alta Bioscience (Birmingham University, UK). pY340 is
biotin-DEELHpYASLNF, and pY358 is biotin-DTSTEpYSEVRT, where pY is phosphotyrosine.
10 µg of peptide was incubated with 5 µg of GST alone,
GST-N-SH2-C-SH2-SHP-1, GST-N-SH2-SHP-1, GST-C-SH2-SHP-1,
GST-N-SH2-C-SH2-SHP-2, GST-N-SH2-SHP-2, or GST-C-SH2-SHP-2 in 1 ml of
ice-cold Triton lysis buffer overnight at 4 °C. The biotinylated
peptides were captured by addition of 40 µl of Ultralink-Immobilized
NeutrAvidin Plus beads (Pierce) for 1 h at 4 °C. The beads were
washed four times with lysis buffer, and bound proteins were eluted by
boiling in SDS reducing sample buffer, and resolved by 10% SDS-PAGE
and immunoblotting.
Preparation of CD33 cDNA Constructs for Transfection of COS
Cells--
Site-directed mutagenesis by two-step polymerase chain
reaction was used to generate full-length CD33 mutants:
CD33R103A, CD33Y340A, CD33Y358A, and double mutant CD33Y340A/CD33Y358A.
CD33 arginine 103-to-alanine mutation was introduced using the primer pair fR103A (5'-TCTTTGCGATGGAGAGAGGAAG) and rR103A
(5'-CCATCGCAAAGAAGTATGAACC).
Single and double tyrosine point mutations were introduced into CD33
wild type cDNA using primers tfY340A, trY340A, and trY358A described above. Wild type CD33 with the last 28 amino acids truncated (CD33 Red Blood Cell Binding Assay--
COS-1 cells were transiently
transfected by electroporation with the different CD33 constructs and
replated 24 h later at 2 ×105 cells/well in six-well
tissue culture plates (Falcon) in Dulbecco's modified Eagle's medium
containing 0.5% fetal calf serum. Occasionally cells were incubated
with 2 mM sodium butyrate overnight prior to the assays to
enhance expression. Transfection efficiency was checked by flow
cytometry prior to all assays. Binding assays with human red blood
cells were performed 48-72 h after transfection as described
previously (17) with sialidase pretreatment of COS cells. To quantify
binding, the percentage of COS cell rosettes (defined as COS cell
binding more than 20 red blood cells) was scored from counting at least
200 COS cells.
CD33 Is Tyrosine-phosphorylated and Recruits Both SHP-1and SHP-2
after Pervanadate Treatment--
Pervanadate, a protein-tyrosine
phosphatase inhibitor, has previously been shown to induce tyrosine
phosphorylation of proteins involved in proximal signal transduction
pathways. We used pervanadate to determine whether CD33 is a target for
tyrosine kinases and therefore could function as a tyrosine
phosphorylated signaling molecule in myeloid cells.
Pervanadate stimulated tyrosine phosphorylation of CD33 in various
leukemic myeloid cell lines, including U937 (promonocytic), THP-1
(monocytic) (Fig. 1), and the more
immature KGI (CD33+, CD34-) and HL60 (myelomonocytic) cells (data not
shown).
An additional tyrosine-phosphorylated protein, running at approximately
65 kDa, was co-immunoprecipitated with CD33. The two tyrosines in the
cytoplasmic tail of CD33 form potential ITIM motifs, allowing the
possible recruitment of the SH2 domain-containing cytoplasmic
phosphatases SHP-1, SHP-2, or SHIP. The phosphoprotein co-immunoprecipitated with CD33 was too small for the inositol phosphatase SHIP (145 kDa) but could be SHP-1 (68 kDa) or the closely
related SHP-2 (72 kDa). To determine whether CD33 indeed associates
with either of these tyrosine phosphatases, CD33 immunoprecipitates from lysates of pervanadate-treated U937 and THP-1 cells were analyzed
by immunoblotting (Fig. 2). In both
myeloid cell lines, SHP-1 and SHP-2 were co-immunoprecipitated with
tyrosyl-phosphorylated CD33.
Cell Surface Cross-linking of CD33 Also Results in Its Tyrosine
Phosphorylation and Recruitment of Both SHP-1 and SHP-2--
Having
established that pervanadate stimulation results in tyrosine
phosphorylation of CD33 and its specific interaction with SHP-1 and
SHP-2, we next examined the effect of cross-linking CD33 on THP-1
cells. This induced rapid and transient tyrosine phosphorylation of
CD33, apparent by 1 min (Fig.
3A) and decreasing to basal
levels within 10 min (data not shown). As with pervanadate treatment,
cross-linking resulted in recruitment of both SHP-1 and SHP-2 by the
phosphorylated CD33.
CD22 (Siglec-2) acts as an inhibitory receptor in B cell signaling via
its recruitment of SHP-1 (2, 3). From the above results, CD33 might
have a similar role in myeloid cells. CD22 becomes
tyrosine-phosphorylated and associates with SHP-1 following BCR
engagement. In myeloid cells, aggregation of Fc receptors for IgG
(Fc
Other myeloid cell stimuli, including cytokines (CSF-1, GM-CSF),
chemotactic peptide (fMLP), or phorbol esters, also failed to induce
CD33 tyrosine phosphorylation. Therefore, in view of the results from
antibody cross-linking, physiological activation of CD33 signaling is
most likely brought about by aggregation of CD33 by as yet unidentified ligand(s).
CD33 Is Associated with Protein-tyrosine Phosphatase
Activity--
Having shown that cross-linking CD33 results in
association of SHP-1 and SHP-2 with tyrosine-phosphorylated CD33, we
wanted to determine whether these recruited phosphatases were active and, if so, whether CD33 itself might be a target substrate. Proteins co-immunoprecipitated with CD33 from lysates of cells stimulated by
CD33 cross-linking were incubated at 37 °C in phosphatase assay buffer. CD33 tyrosine phosphorylation was virtually abolished after 45 min (Fig. 4). Therefore, protein-tyrosine
phosphatases associated with CD33 are active and can catalyze CD33
dephosphorylation. Although in vivo CD33 may be only one of
several target substrates of SHP-1 and SHP-2, this result suggests a
potential inhibitory feedback control of CD33 signaling.
CD33 Tyrosine Phosphorylation Is Inhibited by a Src Family
Kinase-specific Inhibitor--
Src family kinases are involved in many
leukocyte signal transduction pathways and therefore might be
responsible for CD33 tyrosine phosphorylation. To test this, we
examined whether the Src family-specific tyrosine kinase inhibitor PP2
(18) could inhibit phosphorylation of CD33 induced by cross-linking
(Fig. 5). Genistein, a broad range
tyrosine kinase inhibitor, and piceatannol, the Syk family-specific
tyrosine kinase inhibitor, were used in comparison. Tyrosine
phosphorylation of CD33 was significantly reduced in the presence of
PP2 at 5 µM, and virtually abolished with PP2 at 50 µM, unlike piceatannol at the same concentration. Genistein also reduced CD33 phosphorylation, but was much less potent
than PP2. The specific inhibition of CD33 phosphorylation by PP2
suggests that the Src family kinases are strong candidates for
mediating tyrosine phosphorylation. of CD33.
The First Tyrosine Phosphorylation Site of CD33 Is Dominant in
Binding to SHP-1 and SHP-2--
To define which tyrosine
phosphorylation binding site(s) on CD33 are required for SHP-1 and
SHP-2 association, GST-CD33 cytoplasmic tail fusion proteins were made
with one or both of the tyrosines mutated (CD33Y340A, CD33Y358A,
CD33Y340A/Y358A) and phosphorylated with Src kinase. As expected, with
the loss of both tyrosines, CD33 failed to bind SHP-1 and SHP-2 from
THP-1 lysates. Interestingly, mutation of the first tyrosine (Y340A)
significantly reduced the amounts of both SHP-1 and SHP-2 bound while
mutation of the second tyrosine (Y358A) had no effect, with levels of
SHP-1 and SHP-2 binding comparable to wild-type (Fig.
6). These results are in agreement with
what would be predicted from the sequences of the two
phosphotyrosine motifs. The first motif
(LXY340XXL) conforms
exactly with the ITIM consensus sequence,
(I/V/LXYXXL/V) (6) and therefore would be
expected to constitute a higher affinity binding site for
SHP-1/SHP-2 than the second motif
(TXY358XXV), which only partially
fulfils the consensus criteria.
Differential Binding of CD33 Phosphopeptides to the Individual SH2
Domains of SHP-1 and SHP-2--
In order to dissect the binding
orientation of the SH2 domains of SHP-1 and SHP-2 to the phosphorylated
tyrosines of CD33, recombinant GST fusion proteins expressing
individual SH2 domains of SHP-1 and SHP-2 were prepared and incubated
with biotinylated phosphopeptides corresponding to CD33(335-345)
(pY340) and CD33(353-363) (pY358).
While both peptides associated with GST-N-SH2-C-SH2-SHP-1, and
GST-C-SH2-SHP-1, the GST protein containing the single
NH2-terminal SH2 domain of SHP-1 bound only to the CD33
peptide encompassing Tyr-340 (Fig.
7A). Thus, the N-SH2 domain of
SHP-1 displays much greater binding specificity than the C-SH2
domain.
In the case of SHP-2, only the CD33 peptide encompassing Tyr-340 bound
significantly to the GST protein containing the single NH2-terminal SH2 domain of SHP-2, as well as to the tandem
SH2 domain-containing protein (Fig. 7B). Surprisingly, both
peptides bound very weakly, if at all, to the COOH-terminal SH2 domain of SHP-2. Since removal of Tyr-340 from the CD33 tail did not entirely
abolish its association with SHP-2 in cells (Fig. 6), this suggests
that there is a weak but significant interaction of Tyr-358 with SHP-2,
more readily detectable with the cytoplasmic tail constructs than with
the simple peptide structures.
Binding the NH2-terminal SH2 domain of SHP-1 and SHP-2 is
believed to be essential for activation of these phosphatases (19). Hence the selective interaction of tyrosine 340 with the N-SH2 domains
of both SHP-1 and SHP-2 is likely to be critical for CD33 mediated
stimulation of SHP-1 and SHP-2 protein-tyrosine phosphatase activity.
CD33 Transiently Expressed in COS Cells Is Phosphorylated and
Recruits SHP-2--
In order to analyze the effects of mutating the
CD33 tyrosine phosphorylation sites in vivo, COS cells
transiently expressing either wild type CD33 or constructs with single
or double tyrosine point mutations were treated with pervanadate.
Pervanadate stimulated strong phosphorylation of CD33 expressed in COS
cells (running at approximately 62 kDa, probably due to glycosylation
differences) (Fig. 8). Although
predictably weaker, phosphorylation of the CD33 constructs containing a
single tyrosine, CD33Y340A and CD33Y358A, was also observed. As
expected, with loss of both tyrosines, CD33Y340/358A was not
phosphorylated. COS cells express substantial amounts of SHP-2 but very
little SHP-1. SHP-2 (and tiny amounts of SHP-1) were
co-immunoprecipitated with CD33Y358A, as well as with wild type CD33.
Loss of Tyr-340 dramatically reduced the recruitment of SHP-2 (and
SHP-1) by CD33, reflecting the results with the GST-CD33 constructs
(Fig. 6).
Mutation of CD33 Tyrosine 340 Increases CD33-mediated Red Blood
Cell Binding--
CD33, like all other characterized members of the
Siglec subgroup of the Ig superfamily, is able to mediate sialic
acid-dependent binding of human red blood cells as well as
of other specific cell populations (9). We therefore used red blood
cell binding to CD33 transiently expressed in COS cells as a convenient
model to examine CD33 tyrosine phosphorylation in CD33-mediated sialic acid-dependent cell interactions. Tyrosine phosphorylation
of CD33 was not detected following the 20-30-min incubation required for red cell binding to the transfected COS cells. This is presumably due to the rapid and transient kinetics of CD33 phosphorylation.
The importance of the CD33 tyrosine phosphorylation sites in red cell
binding was determined by an alternative approach. We analyzed the
effects of loss or mutation of Tyr-340 and/or Tyr-358 on adhesion. As a
control for sialic acid-dependent binding the arginine
residue in the F strand of the NH2-terminal V-set domain of
CD33 was mutated (CD33R103A). This arginine is conserved in all siglecs
and has been shown to be essential for sialic acid binding by site
directed mutagenesis studies of other siglecs and x-ray crystallography
of sialoadhesin (20-22). As expected, wild type CD33 binding of RBC
was completely abolished by this mutation. Interestingly, truncation of
the last 28 amino acids of the cytoplasmic tail (CD33
In order to dissect this further, we examined red blood cell binding to
full-length CD33 containing single tyrosine mutations (CD33Y34OA and
CD33Y358A). Mutation of tyrosine 358 alone resulted in wild type
binding levels. However, mutation of tyrosine 340 alone increased
binding to the levels observed with CD33
Our previous data suggest that the first cytoplasmic tyrosine (Tyr-340)
of CD33 is critical for recruiting SHP-2 and SHP-1 both in
vitro and in vivo. These findings show that mutation of this same tyrosine significantly increases CD33-mediated red blood cell
adhesion. Therefore, it is tempting to postulate that the observed
increase in red blood cell binding results from a reduction in CD33
recruitment of SHP-2 and/or SHP-1.
Pretreatment of wild type CD33 transfected COS cells with the Src
family kinase specific inhibitor (PP2), which inhibited phosphorylation
of CD33 in THP-1 cells (Fig. 5), resulted in increased red blood cell
binding (110-150% of wild type binding levels; data not shown). The
inhibitor had no such effect on binding of red blood cells by COS cells
expressing CD33 with both tyrosines mutated (CD33Y340/358A). This
further suggests that there is a direct link between phosphorylation of
CD33 and its ability to bind sialic acid-bearing ligands.
Recent rapid progress in the characterization of an increasing
number of ITIM-bearing receptors has emphasized their important regulatory role in various signal transduction pathways and subsequent cellular responses. Critical to the function of all these molecules is
the recruitment of SH2-containing phosphatases by their phosphorylated ITIMs. This report shows that tyrosine phosphorylation of the myeloid-specific receptor CD33 triggers recruitment of SHP-1 and SHP-2
in vivo and in vitro. We therefore propose that
CD33 might be considered as a new member of the superfamily of
ITIM-bearing coreceptors, potentially forming with CD22 a distinct
sialic acid-binding Ig-related lectin (siglec) subgroup.
Tyrosine phosphorylation of CD33 could be stimulated both by its
aggregation on the cell surface and by pervanadate, but not by ligation
of the Fc How CD33 regulates myeloid cell signaling through its association with
SHP-1 and SHP-2 has yet to be determined. Many ITIM-bearing molecules
act as inhibitory co-receptors; for example, KIRs suppress activation
of NK cytotoxic function (8), while both CD22 and Fc Although no other signaling intermediates appeared to associate with
CD33 (data not shown), phosphorylation of CD33 was specifically inhibited by a Src family tyrosine kinase inhibitor. Neither of the two
phosphotyrosine motifs of CD33 conform to the preferred binding
sequence of the SH2 domain of the SRC family kinases, and CD33 lacks
any proline-rich region for SH3 domain binding. Therefore, it seems
unlikely that active SRC-family kinases actually form a stable
association with CD33. CD33 may be phosphorylated by activated
aggregated kinases in close proximity, or during transient, unstable
interactions. Precisely which SRC family members are able to
phosphorylate CD33 and how the kinase(s) is itself activated remains to
be determined.
Selective recruitment of SHP-1/SHP-2 and SHIP by ITIM-bearing receptors
is achieved through the binding site preferences of the component
protein modules of these phosphatases and, possibly, by differential
cell expression. There are two ITIM motifs in the cytoplasmic tail of
CD33 suitable for the binding of the SH2 domains of SHP-1 and SHP-2.
The preferred binding motif of the SH2 domains of these two
phosphatases is the consensus sequence (I/V/L)XYXX(L/V). The SH2 domains of SHP-1 and
SHP-2 are notable in their requirement for a hydrophobic residue at the
pY-2 position (5, 29). A highly conserved arginine residue at the We have demonstrated that CD33 can recruit SHP-1 and SHP-2 through
specific binding to its ITIM motifs and thus could modulate downstream
signaling events associated with cell activation. It has previously
been shown that CD33, like other members of the siglec family, can
mediate sialic acid-dependent binding of specific cell
populations as a recombinant protein (9). This suggests that CD33 on
myeloid cells participates in cellular interactions, binding specific
as yet unidentified sialic acid-bearing ligand(s) either in
cis on the same cell surface or in trans on
opposing cells. The adhesion assay using CD33 transfected COS cells and human red blood cells was used as a convenient model for these postulated interactions. Significantly, CD33-mediated cell adhesion was
up-regulated by deletion or mutation of the tyrosine (Tyr-340) contained within its first ITIM. Since this ITIM is dominant in SHP-1
and SHP-2 binding both in vitro and in vivo, the
observed increase in red blood cell adhesion could be correlated with a reduction in SHP-1 and/or SHP-2 recruitment. Hence, it is tempting to
speculate that the role of CD33 as a sialic acid-dependent cell interaction molecule is regulated inside-out by its capacity to
transmit signals through SHP-1 and SHP-2. CD33 phosphorylation could be
induced by ligand occupancy and subsequent clustering, as mimicked by
antibody cross-linking. The recruited tyrosine phosphatase might then
trigger downstream signaling events that limit further CD33
interactions and potentiate other changes in myeloid cell function. An
important step in testing this model is the identification of CD33 ligand(s).
Recently, other proteins sharing high sequence homology to CD33 have
been identified, indicating the existence of a subgroup of CD33-like
molecules within the siglec family. A placenta-specific molecule
composed of three Ig-like domains (CD33L) shares 70% identity with
CD33 (15). Siglec-5, another myeloid-restricted membrane glycoprotein,
also exhibits a high degree of sequence homology with CD33.
Interestingly, not only does Siglec-5 appear at a later stage of
myeloid differentiation than CD33, it is also retained at relatively
high levels on neutrophils (17). Like CD33, the cytoplasmic tails of
both of these molecules contain two potential phosphotyrosine binding
motifs, but with increased spacing between the tyrosines. Studying
these receptors would yield important information on the molecular and
spatial requirements for selective recruitment of SH2-containing
phosphatases. In addition, further insight into the regulatory role of
CD33 may be gained since these molecules, although expressed in
distinct cell subsets, are likely to have similar signaling functions.
We thank Dr. Benjamin Neel (Beth Israel
Hospital, Boston, MA) for providing the SHP-1 cDNA.
*
This work was supported by grants from the Medical Research
Council.The costs of publication of this
article were defrayed in part by the
payment of page charges. The article
must therefore be hereby marked
"advertisement" in
accordance with 18 U.S.C. Section
1734 solely to indicate this fact.
The abbreviations used are:
ITIM, immunotyrosine-based inhibition motif;
ITAM, immunotyrosine-based
activation motif;
Ig, immunoglobulin;
SH2, Src homology 2;
N-SH2, NH2-terminal SH2 domain;
C-SH2, COOH-terminal SH2 domain;
GST, glutathione S-transferase;
PAGE, polyacrylamide gel electrophoresis;
BCR, B cell receptor;
NK, natural killer, KIR, killer inhibitory
receptor;
MOPS, 4-morpholinepropanesulfonic acid.
Cell Adhesion Laboratory,
![]()
ABSTRACT
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES
![]()
INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES
RIIB (6-8).
![]()
EXPERIMENTAL PROCEDURES
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES
-D-galactopyranoside,
and purified using the Bulk GST Purification Module following the
manufacturer's instructions.
20 °C.
336-364) was generated by introducing a stop codon (primer r
336-364: 5'- TCACTCATCCATCTCCACAGT) by polymerase chain reaction. All constructs including CD33 wild type were subcloned into expression vector pcDNA3 (Invitrogen). The sequences of all DNA constructs were verified by DNA sequence analysis.
![]()
RESULTS
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

View larger version (35K):
[in a new window]
Fig. 1.
Tyrosine phosphorylation of CD33 after
pervanadate treatment. U937 and THP-1 cells were either treated
with 1 mM pervanadate for 15 min at 37 °C (+)
or left unstimulated (
). Lysates were precipitated (IP)
either with mouse IgG1 control (mIgG1) or with anti-CD33,
1C7/1 (CD33), both antibodies precoupled to protein
G-Sepharose. The immunoprecipitated proteins were separated by SDS-PAGE
and analyzed by immunoblotting with anti-phosphotyrosine
(PY20) or anti-CD33 (1C7/1+3D6/1).

View larger version (40K):
[in a new window]
Fig. 2.
Association of both SHP-1 and SHP-2, with
CD33 in pervanadate-treated myeloid cells. U937 and THP-1 cells
were either treated with 1 mM pervanadate for 15 min at
37 °C (+) or left unstimulated (
). Lysates were
precipitated (IP) with either mouse IgG1 (mIgG1),
or anti-CD33, 1C7/1 (CD33), both antibodies precoupled to
protein G-Sepharose. Immunoprecipitated proteins were resolved by
SDS-PAGE and analyzed by immunoblotting with anti-SHP-1 or polyclonal
anti-SHP-2 (C-18). The amount of CD33 and phosphorylated proteins were
controlled for by immunoblotting with anti-CD33 and
anti-phosphotyrosine, respectively (data not shown).

View larger version (44K):
[in a new window]
Fig. 3.
Cross-linking CD33, but not
Fc
RIIA (CD32), induces CD33 tyrosine
phosphorylation and recruitment of SHP-1 and SHP-2. A,
THP-1 cells were incubated either without primary antibody (
) or with
anti-CD33 (CD33) at 10 µg/ml for 20 min at room
temperature, followed by addition of polyclonal anti-mouse IgG at 20 µg/ml for 1 min at 37 °C. Cells were immediately lysed and
proteins precipitated (IP) with protein G-Sepharose
(1), separated by SDS-PAGE, and analyzed by immunoblotting
using anti-phosphotyrosine (PY20), anti-CD33, anti-SHP-1 and
polyclonal anti-SHP-2. B, THP-1 cells were incubated without
primary antibody (
) or with anti-CD32 (IV.3) (CD32), at 10 µg/ml for 20 min at room temperature, followed by addition of
polyclonal goat anti-mouse IgG at 20 µg/ml for 1 min at 37 °C.
Cells were immediately lysed and proteins precipitated (IP)
with protein G-Sepharose (1), or anti-CD33 + protein
G-Sepharose (2), separated by SDS-PAGE, and analyzed by
immunoblotting using anti-phosphotyrosine (PY20), anti-CD33,
anti-SHP-1 and polyclonal anti-SHP-2 (C-18). Positions of CD32 and
immunoglobulin heavy chain (Ig(H)) (not seen with polyclonal
anti-SHP-2) are indicated by arrows.
R) activates signal transduction pathways through tyrosine
phosphorylation of various cellular proteins (6, 7). This results in
the triggering of multiple myeloid effector functions. Since CD33 might
be a potential target for tyrosine kinase activity stimulated by Fc
R
aggregation, we cross-linked Fc
RIIA (CD32) on THP-1 cells to
determine whether this gave rise to CD33 association with CD32 and/or
CD33 tyrosine phosphorylation (Fig. 3B). Although CD32
itself became tyrosine-phosphorylated along with a number of other
proteins, CD33 immunoprecipitated from these cell lysates was not
phosphorylated and neither CD33 nor SHP-1/SHP-2 were detected in the
CD32 complex. Similarly, cross-linking Fc
RI had no effect (data not shown).

View larger version (34K):
[in a new window]
Fig. 4.
CD33 is associated with protein-tyrosine
phosphatase activity. THP-1 cells were cross-linked with anti-CD33 + goat anti-mouse IgG (CD33), or goat anti-mouse IgG alone
(
), as described for Fig. 3. Immunoprecipitated proteins bound to
protein G-Sepharose were incubated in phosphatase assay buffer at
4 °C in the presence of 1 mM sodium orthovanadate
(Na3VO4), or at 37 °C in the
absence of sodium orthovanadate, for 45 min. Proteins were separated by
SDS-PAGE, and analyzed by immunoblotting with anti-phosphotyrosine
(PY20). The amount of CD33 was controlled for by
immunoblotting with anti-CD33 (data not shown).

View larger version (55K):
[in a new window]
Fig. 5.
Tyrosine phosphorylation of CD33 is inhibited
by a SRC family kinase-specific inhibitor. THP-1 cells were
incubated alone (untreated) or in the presence of 5 µM
PP2, 50 µM PP2, 50 µM piceatannol, or 0.5 mM genistein at 37 °C for 1 h. Cells were then
cross-linked with anti-CD33 + goat anti-mouse IgG (CD33) or,
as control, secondary alone (
). Lysis and immunoprecipitation were
performed as described for Fig. 3A, followed by
immunoblotting with anti-phosphotyrosine (PY20) and
anti-CD33.

View larger version (43K):
[in a new window]
Fig. 6.
Importance of the first tyrosine
phosphorylation site in the binding of CD33 to SHP-1 and SHP-2. 10 µg of GST-CD33wt, GST-CD33Y340A, GST-CD33Y358A, GST-CD33Y340/358A, or
GST alone, were phosphorylated (-P) with Src kinase or left
untreated, and then incubated with 1 ml of THP-1 lysate. GST proteins
and associated proteins were recovered by binding to
glutathione-Sepharose, separated by SDS-PAGE, and analyzed by
immunoblotting with anti-phosphotyrosine, anti-SHP-1, or polyclonal
anti-SHP-2 (C-18).

View larger version (56K):
[in a new window]
Fig. 7.
Binding of CD33 phosphopeptides to individual
SH2 domains of SHP-1 and SHP-2. 10 µg of biotinylated
phosphopeptide CD33 (335-345) (pY340) or CD33 (353-363) (pY358) were
incubated with 5 µg of GST alone, GST-N-SH2-C-SH2-SHP1,
GST-N-SH2-SHP1, GST-C-SH2-SHP1, GST-N-SH2-SHP2, GST-C-SH2-SHP2, or
GST-N-SH2-C-SH2-SHP2 in 1 ml of Triton lysis buffer. The biotinylated
peptides were recovered by binding to NeutrAvidin-agarose. Any bound
GST-proteins were eluted, resolved by SDS-PAGE, and analyzed by
immunoblotting with polyclonal anti-SHP-1 or anti-SHP-2 (N-16). Binding
of GST to the peptides was controlled for by probing identical blots
with anti-GST (only GST control lanes shown). Arrows
indicate the positions of the single and double SH2 domain GST fusion
proteins. SH2 domains are represented by boxes.

View larger version (59K):
[in a new window]
Fig. 8.
Tyrosine phosphorylation of CD33 transiently
expressed in COS cells, and recruitment of SHP-1 and SHP-2. 48-72
h after transient transfection, 107 COS cells expressing
CD33wt, CD33Y340A, CD33Y358A, or CD33Y340/358A were either treated with
1 mM pervanadate for 15 min at 37 °C (+) or
left unstimulated (
). Lysates were immunoprecipitated (IP)
with either mouse IgG1 (mIgG1) or anti-CD33, 1C7/1
(CD33), both antibodies pre-coupled to protein G-Sepharose.
Immunoprecipitated proteins were resolved by SDS-PAGE and analyzed by
immunoblotting with anti-phosphotyrosine (PY20), anti-CD33,
anti-SHP-1 or anti-SHP-2 (C-18). It should be noted that due to the
tiny amounts of SHP-1 in COS cells, a extended exposure of the
anti-SHP-1 blot is shown (10 min rather than 30 s).
336-364) which
deletes both tyrosines (Tyr-340/Tyr-358), increased red blood cell
binding to about 150% of the wild type level. A similar result was
observed when both tyrosines were mutated in full-length CD33
(CD33Y340A/Y358A) (Fig. 9). Therefore,
the ITIM-like motifs appear to have a negative regulatory role in
CD33-mediated sialic acid-dependent cell interactions.

View larger version (25K):
[in a new window]
Fig. 9.
Loss of the first CD33 phosphotyrosine motif
increases CD33 binding of red blood cells. 48-72 h after
transient transfection, human red blood cells were added to
sialidase-pretreated COS cells, expressing CD33wt, CD33-R103A,
CD33
336-364, CD33-Y340A, CD33-Y358A, or CD33-Y340/358A, and allowed
to bind for 30 min at 37 °C. After washing, cells were fixed and the
percentage of COS cells with red blood cell rosettes (defined as COS
cell binding more than 20 red bllod cells) was scored by counting at
least 200 COS cells/well. All constructs were expressed at equivalent
levels as determined by flow cytometry analysis prior to assays (data
not shown). Results shown are mean ± S.D. of triplicate wells
from one representative experiment of at least three performed.
336-364 and CD33Y340A/Y358A
(Fig. 9).
![]()
DISCUSSION
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES
receptors CD32 or CD64. Although the effects of other
myeloid immune receptors, for example CD89 (IgA receptor), have yet to
be tested, these initial results suggest that CD33 is not directly
"activated" by immune receptor engagement and therefore unlikely to
have an equivalent function to CD22. The latter conclusion is further
supported by the finding that CD33 can associate with SHP-1 in
combination with SHP-2, while CD22 binds SHP-1 only (2, 3). Recruitment
of both SHP-1 and SHP-2 has previously been demonstrated for other
ITIM-bearing receptors (7, 23-27); however, in many cases this has
been based on in vitro studies, often using ITIM peptides
only. In view of the possible discrepancies between in vivo
and in vitro binding capacities, we used a
combination of approaches. We have shown CD33 association with SHP-1
and SHP-2 both in vivo and in vitro.
RIIB
down-modulate BCR-mediated signaling (6). However, both SHP-1 and SHP-2
could potentially act as negative or positive regulators depending on
the phosphatase target substrates. In addition, as SHP-1 and SHP-2 are
themselves tyrosine-phosphorylated when associated with CD33, they
might also act as adaptor/docking molecules. Since CD33 is
dephosphorylated in vitro by the recruited tyrosine
phosphatases, it may also be an in vivo substrate and hence
autoregulated by SHP-1 and/or SHP-2, as has been shown for CD72/SHP-1
(28) and SIRP
1/SHP-2 (23).
A2
position of most SH2 domains is replaced with glycine in the SH2
domains of SHP-1 and SHP-2. This forms a gap in the SH2 domain that is filled by the side chain of the pY-2 residue of the target peptide (29). The first tyrosine phosphorylation site of CD33
(LXY340XXL), which conforms exactly
to the consensus motif, was predictably dominant in binding to SHP-1
and SHP-2. Furthermore, the NH2-terminal SH2 domain of
SHP-1 was only able to bind to this first motif, whereas the
COOH-terminal SH2 domain was also able to bind the second, less well
conserved ITIM motif (TXY358XXV).
Therefore, the NH2-terminal SH2 domain of SHP-1 exhibits more selective binding than its COOH-terminal SH2 counterpart. This is
not unexpected since the engagement of the NH2-terminal SH2
domain of SHP-1 by the first ITIM motif of CD33 is required to convert
SHP-1 to its catalytically active conformation (19, 30). However,
COOH-terminal SH2 domain binding is also likely to be important, as the
association of the tandem SH2-domains of SHP-1 with the two
phosphotyrosines of CD33, either in trans or cis,
would be expected to confer the greatest specificity and affinity,
resulting in optimal signaling (30). In contrast, while the
NH2-terminal SH2 domain of SHP-2 exhibits the same
preference for Tyr-340, the COOH-terminal SH2 domain binds both ITIMs
very poorly. If association of tandem SH2 domains is indeed important, SHP-1 should show a higher affinity for CD33 than SHP-2, possibly biasing signaling through CD33 in favor of SHP-1. More detailed examination of the ITIM-SH2 domain binding could help understand how
receptors distinguish between SHP-1 and SHP-2.
![]()
ACKNOWLEDGEMENT
![]()
FOOTNOTES
To whom correspondence should be addressed. E-mail:
freemans{at}icrf.icnet.uk.
![]()
ABBREVIATIONS
![]()
REFERENCES
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES
Copyright © 1999 by The American Society for Biochemistry and Molecular Biology, Inc.
This article has been cited by other articles:
![]() |
R. B. Walter, B. W. Raden, R. Zeng, P. Hausermann, I. D. Bernstein, and J. A. Cooper ITIM-dependent endocytosis of CD33-related Siglecs: role of intracellular domain, tyrosine phosphorylation, and the tyrosine phosphatases, Shp1 and Shp2 J. Leukoc. Biol., January 1, 2008; 83(1): 200 - 211. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Tateno, H. Li, M. J. Schur, N. Bovin, P. R. Crocker, W. W. Wakarchuk, and J. C. Paulson Distinct Endocytic Mechanisms of CD22 (Siglec-2) and Siglec-F Reflect Roles in Cell Signaling and Innate Immunity Mol. Cell. Biol., August 15, 2007; 27(16): 5699 - 5710. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Zhang, T. Angata, J. Y. Cho, M. Miller, D. H. Broide, and A. Varki Defining the in vivo function of Siglec-F, a CD33-related Siglec expressed on mouse eosinophils Blood, May 15, 2007; 109(10): 4280 - 4287. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. J. Orr, N. M. Morgan, J. Elliott, J. F. Burrows, C. J. Scott, D. W. McVicar, and J. A. Johnston CD33 responses are blocked by SOCS3 through accelerated proteasomal-mediated turnover Blood, February 1, 2007; 109(3): 1061 - 1068. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Imhof, A.-S. Wavreille, A. May, M. Zacharias, S. Tridandapani, and D. Pei Sequence Specificity of SHP-1 and SHP-2 Src Homology 2 Domains: CRITICAL ROLES OF RESIDUES BEYOND THE pY+3 POSITION J. Biol. Chem., July 21, 2006; 281(29): 20271 - 20282. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Hernandez-Caselles, M. Martinez-Esparza, A. B. Perez-Oliva, A. M. Quintanilla-Cecconi, A. Garcia-Alonso, D. M. R. Alvarez-Lopez, and P. Garcia-Penarrubia A study of CD33 (SIGLEC-3) antigen expression and function on activated human T and NK cells: two isoforms of CD33 are generated by alternative splicing J. Leukoc. Biol., January 1, 2006; 79(1): 46 - 58. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Varki and T. Angata Siglecs--the major subfamily of I-type lectins Glycobiology, January 1, 2006; 16(1): 1R - 27R. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Yamaji, M. Mitsuki, T. Teranishi, and Y. Hashimoto Characterization of inhibitory signaling motifs of the natural killer cell receptor Siglec-7: attenuated recruitment of phosphatases by the receptor is attributed to two amino acids in the motifs Glycobiology, July 1, 2005; 15(7): 667 - 676. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Avril, S. D. Freeman, H. Attrill, R. G. Clarke, and P. R. Crocker Siglec-5 (CD170) Can Mediate Inhibitory Signaling in the Absence of Immunoreceptor Tyrosine-based Inhibitory Motif Phosphorylation J. Biol. Chem., May 20, 2005; 280(20): 19843 - 19851. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. Garnache-Ottou, L. Chaperot, S. Biichle, C. Ferrand, J.-P. Remy-Martin, E. Deconinck, P. D. de Tailly, B. Bulabois, J. Poulet, E. Kuhlein, et al. Expression of the myeloid-associated marker CD33 is not an exclusive factor for leukemic plasmacytoid dendritic cells Blood, February 1, 2005; 105(3): 1256 - 1264. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. B. Walter, B. W. Raden, D. M. Kamikura, J. A. Cooper, and I. D. Bernstein Influence of CD33 expression levels and ITIM-dependent internalization on gemtuzumab ozogamicin-induced cytotoxicity Blood, February 1, 2005; 105(3): 1295 - 1302. [Abstract] [Full Text] [PDF] |
||||