![]()
|
|
||||||||
J Biol Chem, Vol. 274, Issue 17, 11549-11556, April 23, 1999
From the Howard Hughes Medical Institute and Department of Biochemistry, University of Texas Southwestern Medical Center, Dallas, Texas 75235
| |
ABSTRACT |
|---|
|
|
|---|
We report here the reconstitution of the de
novo procaspase-9 activation pathway using highly purified
cytochrome c, recombinant APAF-1, and recombinant
procaspase-9. APAF-1 binds and hydrolyzes ATP or dATP to ADP or dADP,
respectively. The hydrolysis of ATP/dATP and the binding of cytochrome
c promote APAF-1 oligomerization, forming a large
multimeric APAF-1·cytochrome c complex. Such a complex
can be isolated using gel filtration chromatography and is by itself
sufficient to recruit and activate procaspase-9. The stoichiometric
ratio of procaspase-9 to APAF-1 is approximately 1 to 1 in the complex.
Once activated, caspase-9 disassociates from the complex and becomes
available to cleave and activate downstream caspases such as
caspase-3.
Several well characterized morphological features of apoptosis are
caused by caspase activity. These include nuclear membrane breakdown,
chromatin condensation and fragmentation, cell membrane blebbing, and
formation of apoptotic bodies (1, 2). Caspases cleave a variety of
cellular substrates after aspartic acid residues such as nuclear
lamins, fodrin, DFF45/ICAD, gelsolin, and PAK2, leading to apoptosis
(3-8).
Caspases that are involved in the execution of apoptosis are present in
living cells as inactive zymogens that become activated through
intracellular caspase cascades. There are two relatively well
characterized caspase cascades as follows: one is initiated by the
activation of cell-surface death receptors, such as Fas and tissue
necrosis factor, leading to caspase-8 activation, which in turn cleaves
and activates downstream caspases such as caspase-3, -6, and -7 (9-11); and the other is triggered by cytochrome c released
from mitochondria, which promotes the activation of caspase-9 through
APAF-11 (12).
APAF-1 is a 130-kDa protein consisting of a CED-4 homologous domain
flanked by a caspase recruitment domain (CARD) and 12 WD-40 repeats
(13). CED-4 is a Caenorhabditis elegans protein that plays a central role in the apoptotic program in that organism (14). The function of APAF-1 as an important apoptosis activator has
been recently confirmed by knock-out experiments in mice (15-16). Animals lacking the Apaf-1 gene show excessive number of
neurons in their brain, defects in facial features, and delayed
recession of interdigital webbing, owing to a defect in apoptosis
(15-16). Cells derived from these animals show resistance to a variety of apoptotic stimuli such as chemotherapeutic agents, UV and
Details of the biochemical mechanism of procaspase-9 activation by
APAF-1 is sketchy. Previous studies have shown that APAF-1 forms a
complex with caspase-9 in the presence of dATP and cytochrome c, two co-factors for APAF-1 function (12). APAF-1 protein
truncated at the COOH-terminal WD-40 repeats is constitutively active
in vitro, independent of cytochrome c and dATP
(17-18). In addition, truncated APAF-1 interacts with itself as
detected by a co-immunoprecipitation and a yeast two-hybrid experiment,
suggesting that oligomerization might be an important step for its
function (17-18). Similar experiments with CED-4 protein suggest that
the oligomerization of CED-4 is also important for activating CED-3,
the C. elegans caspase (19). However, there has been no
direct evidence either for APAF-1 oligomerization or for the roles of
dATP/ATP and cytochrome c in such a process.
In the current report, we reconstituted the procaspase-9 activation
pathway using highly purified cytochrome c, recombinant APAF-1, and recombinant procaspase-9. By using such a system, we are
able to analyze the role of dATP/ATP hydrolysis, cytochrome c binding to APAF-1, and APAF-1 oligomerization in the
de novo activation of procaspase-9. The results demonstrate
a multi-stage reaction with the formation of a multi-subunit
APAF-1·cytochrome c complex as the key commitment step.
General Methods and Materials--
We obtained dATP and other
nucleotides and radioactive materials from Amersham Pharmacia Biotech,
and molecular weight standards for SDS-PAGE and gel filtration
chromatography were from Bio-Rad. General molecular biology methods
were used as described in Sambrook et al. (20).
Construction of Alternatively Spliced Transcripts of APAF-1 in a
Baculovirus Expression Vector and Site-directed Mutagenesis of
APAF-1--
The [
A 3.63-kilobase pair cDNA encoding the full-length APAF-1 fused
with a 9-histidine tag at the COOH terminus was subcloned into
NotI/KpnI sites of the baculovirus expressing
vector pFastBacI (Life Technologies, Inc.). To insert APAF-1L into the
APAF-1-pFastBacI vector, a 425-bp 5' region of APAF-1 cDNA was
removed by enzymatic digestion with NotI and
BstEII from APAF-1-pFastBacI construct and replaced with a
458-bp DNA fragment excised out of the same enzyme digestion from the
5' part of APAF-1L including the 33 nucleotides.
To test if APAF-1 has another alternative transcript that
encodes an additional WD-40 motif, the first strand cDNA was
carried using a first strand cDNA synthesis kit (Amersham Pharmacia
Biotech) with the specific primer (5'TTTCACTGTTTCCTGATGGC3') designed
from 3' region of APAF-1 cDNA. An aliquot of 200 ng of this first
strand cDNA mixture was then PCR amplified by two primers P3/P4
(5'ATGCGACATCAGCAAATGAG 3' and 5'ACCTTTGAACGTGAGTCTG 3'). Both PCR
products (187 and 316 bp) were subcloned into the PCRII vector using
the TA cloning kit (Invitrogen) and the sequences confirmed by DNA
sequencing. This additional WD-40 motif was subcloned in frame into the
full-length APAF-1L by using PCR-SOEing method (21). The full-length
APAF-1L-WD13 with 9-His tag was subcloned into pFastBac I vector at
NotI and KpnI sites. The nucleotide-binding site
mutations (G159E and K160T in Walker's A Box, D243A and D244A in
Walker's B Box) were generated by a PCR-SOEing method. The mutants
were confirmed by DNA sequencing.
Caspase-9 cleavage site (D315A) and active site (C287A) mutants were
also generated by the PCR-SOEing method and confirmed by DNA
sequencing. Wild type caspase-9 with or without a 9-histidine tag at
COOH termini and both the cleavage site and active site mutant
procaspase-9 fused with 9-His tag at the COOH termini were subcloned
into pFastBacI vector at BamHI and EcoRI sites.
Production of Recombinant APAF-1 and Proaspase-9 Proteins in a
Baculovirus Expression System--
The expression plasmids were
transformed into DH10Bac Escherichia coli cells (Life
Technologies, Inc.). The recombinant viral DNA, bacmids, were purified
according to the Bac-To-Bac Baculovirus Expression procedure (Life
Technologies, Inc.) and confirmed by PCR amplification analysis. The
DNA was then used to transfect the insect cells, Sf21 using
CellFECTIN reagent (Life Technologies, Inc.). The cells were grown in
IPL41 medium supplemented with 10% fetal calf serum, 2.6 g/liter
tryptose phosphate, 4 g/liter yeastolate, and 0.1% Pluronic F-68 plus
penicillin (100 units/ml), streptomycin (100 µg/ml), and fungizone
(0.25 g/ml). The expression of recombinant protein was analyzed by
Western blot. The virus stocks were amplified to 100 ml and used to
infect 1 liter of Sf21 cells at a density of 2 × 106 cells/ml. The infected cells were harvested after
40 h for APAF-1 and 22 h for procaspase-9 by centrifugation
and resuspended in 5 volumes of buffer A (20 mM Hepes-KOH,
pH 7.5, 10 mM KCl, 1.5 mM MgCl2, 1 mM NaEDTA, 1 mM NaEGTA, 1 mM
dithiothreitol, and 0.1 mM PMFS). The resuspended cells
were lysed in buffer A by homogenization. After centrifugation at
10,000 × g for 1 h, the supernatant was loaded
onto a 3-ml nickel affinity column. The column was washed with 300 ml
of buffer A containing 1 M NaCl and 20 mM
imidazole for APAF-1 or buffer A containing 1 M NaCl and 15 mM imidazole for procaspase-9. After equilibrating the
column with 20 ml of buffer A, the column was eluted with buffer A
containing 250 mM imidazole. The eluted APAF-1 protein were
stored in multiple aliquots at
The eluted wild type procaspase-9 was further purified by diluting the
nickel column eluate with 10 volumes of buffer A and loaded onto a Mono
Q column (Amersham Pharmacia Biotech) equilibrated with buffer A
containing 50 mM NaCl. The column was eluted with 20-ml
linear gradient from 50 mM NaCl to 300 mM NaCl
in buffer A. The procaspase-9 protein was eluted at 150 mM
NaCl in buffer A. After dialyzing against buffer A, the protein was
stored in multiple aliquots in
The non-His-tagged procaspase-9 was expressed as described above and
purified according to a procedure described in Ref. 12.
Western Blot Analysis--
CED-4 homologous domain of APAF-1 was
PCR-amplified and subcloned in frame into the
NdeI-XhoI sites of the bacterial expression vector pET-15b (Novagen). The fusion protein was purified as described (13) and was used to immunize rabbits to generate a polyclonal antibody. Procaspase-9 (C287A) mutant was subcloned in frame into BamHI-XhoI sites of pET-15b vector. The fusion
protein was generated as described previously (12), and a polyclonal
anti-caspase-9 antibody was generated by immunizing rabbits with this
protein. Immunoblot analysis was performed with a horseradish
peroxidase-conjugated goat anti-rabbit (APAF-1, caspase-9) or goat
anti-mouse (cytochrome c) immunoglobulin G using enhanced
chemiluminescence Western blotting detection reagents (Amersham
Pharmacia Biotech).
Assay for Caspase-9 and Caspase-3 Activation--
Aliquots of
0.5 µl (0.2 µg) of His-tagged recombinant procaspase-9 and 5 µl
(0.8 µg) of recombinant APAF-1 were incubated in the presence or
absence of 10 ng/ml cytochrome c and 0.1 mM dATP
and 1 mM additional MgCl2 at 30 °C for
1 h in a final volume of 20 µl of buffer A (13). After
incubation, the samples were subjected to a 15% SDS-PAGE and
transferred to a nitrocellulose filter, which was blotted with
anti-caspase-9 antibody. Procaspase-3 was translated and purified as
described (12). A 1-µl aliquot of in vitro translated
caspase-3 was incubated with the mixture of procaspase-9 activation
reaction as described above. The samples were subjected to a 15%
SDS-PAGE, and then the gel was transferred to a nitrocellulose filter,
which was subsequently exposed to a phosphorimaging plate and
visualized in a Fuji BAS-1500 PhosphorImager.
Assay for ATP Hydrolysis--
Aliquots of 2 µg of wild type or
nucleotide-binding sites mutant APAF-1 were incubated with 100 nM ATP plus 2 µCi of [ Analysis of APAF-1·Cytochrome c·Caspase-9
Complexes--
HeLa cells were set at 2× 106 per 150-mm
dish in medium A (Dulbecco's modified Eagle's medium containing 100 units/ml penicillin and 100 µg/ml streptomycin sulfate) supplemented
with 10% (v/v) fetal calf serum and grown in a monolayer at 37 °C
in an atmosphere of 6-7% CO2. After incubation for
24 h, two of the four dishes were added with staurosporine to a
final concentration of 2 µM. After treatment for 8 h, both treated and non-treated cells were harvested, and the S-100
fractions were prepared as described in Liu et al. (22). An
aliquot of 50 µl of the S-100 fraction (0.1 mg) was directly loaded
onto a Smart System Superdex-200 gel filtration column (2 ml) (Amersham
Pharmacia Biotech) equilibrated with buffer A and eluted with the same
buffer. Fractions of 100 µl were collected. Aliquots of 30 µl of
the fractions were directly subjected to 10% SDS-PAGE followed by
Western blotting analysis using a rabbit antibody against APAF-1.
Multiple Spliced Forms of APAF-1--
APAF-1 was originally
described as a 130-kDa protein consisting of 1194 amino acids (13).
During the course of cDNA cloning, several alternatively spliced
forms were also detected. One alternative splicing event uses a
different splicing donor site at exon 3 to insert an additional 11 amino acids in between the CARD and the CED-4 homologous domain of
APAF-1 (Fig. 1A). This spliced form was designated as APAF-1L. Another alternative splicing event produces an additional exon between exon 17 and 18 encoding 43 amino
acids, creating one more WD-40 repeat after the fifth WD-40 repeat. We
designated this spliced form as APAF-1-WD13. To confirm that these
alternatively spliced APAF-1s were indeed expressed in cells, we
performed RT-PCR using mRNA isolated from HeLa cells as templates.
After first strand cDNA synthesis, the templates were amplified by
two sets of primers flanking these two alternative spliced regions
(Fig. 1A). As shown in Fig. 1B, each set of
primers yielded two PCR products with the predicted sizes corresponding to the two alternatively spliced messages. The identity of all four PCR
products was subsequently confirmed by direct DNA sequencing. The WD13
spliced form of APAF-1 has been reported (GenBankTM accession number
AB007873) and exists in the mouse version of APAF-1 cDNA (15).
All three spliced forms of APAF-1 were expressed in Sf21 insect
cells using a baculovirus expression vector that fused APAF-1 to a
9-histidine tag at the COOH termini. Each recombinant protein was
purified through a nickel affinity column and subjected to SDS-PAGE
followed by Coomassie Blue staining. As shown in Fig. 2A, each recombinant protein
has an estimated size between 130 and 140 kDa with APAF-1L-WD13 being
slightly larger than the other two. The purified proteins were tested
for procaspase-9 activation in the presence of dATP and cytochrome
c. We found that among the proteins encoded by the three
alternatively spliced mRNAs, APAF-1L-WD13 has the most stable
cytochrome c and dATP-dependent caspase-3
activating activity (data not shown). Thus, we used this recombinant
protein in all of the following experiments and refer to it as
APAF-1.
Reconstitution of Caspase-3 Activation with Recombinant APAF-1 and
Procaspase-9--
To study the biochemical mechanism of caspase
activation, we established the caspase-3 activation reaction using
purified, recombinant APAF-1 and procaspase-9. It has been a technical
challenge to generate recombinant procaspases in large enough
quantities for biochemical analysis since overexpression of procaspases
often results in their auto-activation. In order to overcome this
difficulty, we infected SF21 cells with a baculoviral vector containing
the cDNA of human caspase-9 or human caspase-9 fused with a
9-histidine tag. The cells were grown in the presence of 10% bovine
calf serum and were harvested 24 h after infection before
auto-processing occurs. The procaspase-9 was purified either by a
nickel affinity column followed by a Mono Q column or by conventional
chromatography described previously (12). As shown in Fig.
2B, purified wild type procaspase-9 (1st
lane), or procaspase-9 with a cysteine to alanine
substitution at its active site (2nd lane), or
aspartic acid to alanine substitution at its cleavage site (3rd
lane) migrated as a ~50-kDa polypeptide band on an SDS gel.
The recombinant APAF-1 and procasepase-9 were then tested for their
respective functions by incubating them with or without dATP and
cytochrome c. As shown in Fig. 2C, wild type
procaspase-9 was processed to the 35- and 10-kDa active form only when
incubated with APAF-1, dATP, and cytochrome c (lane
3). No processing was observed when cytochrome c or
APAF-1 was omitted (lanes 1 and 2). In contrast,
the cleavage site mutant D315A, or the active site mutant C287A, could
not be processed even in the presence of APAF-1, cytochrome
c, and dATP (lanes 4 and 5). This
experiment indicated that the processing of procaspase-9 by APAF-1,
dATP, and cytochrome c occurs after Asp-315 as previously
demonstrated (17), and the activation is through auto-catalysis since
the active site mutant failed to be processed. Interestingly, that mixing D315A and C287A mutants did not result in any cleavage, suggesting inter-molecular cleavage does not happen (lane
6).
To confirm that recombinant APAF-1-catalyzed procaspase-9 processing is
functional, we incubated the procaspase-9 activation reaction with
35S-labeled, affinity purified procaspase-3, a caspase
downstream of caspase-9 (12, 22-23). As shown in Fig. 2D,
caspase-3 became activated only when APAF-1, procaspase-9, dATP, and
cytochrome c were all present (lane 6). Omitting
either APAF-1 (lane 1), procaspase-9 (lane 2),
cytochrome c (lane 5), or dATP (lane
4) resulted in loss of procaspase-3 cleavage. dADP, which is
functional in the crude system (24), does not have any activity in the purified system (lane 7), indicating the high energy bond of
dATP is critical for its function.
dATP/ATP Binding and Hydrolysis by APAF-1--
APAF-1 contains in
its CED-4 homologous domain consensus Walker A and B boxes for
nucleotide binding (13). The nucleotide-binding sites are conserved
between CED-4 and APAF-1, suggesting the importance of nucleotide
binding in their function (13, 25-26). To confirm that APAF-1 indeed
binds ATP or dATP, purified APAF-1 protein was incubated with
The above data suggest that the binding and hydrolysis of ATP/dATP to
ADP/dADP are important for APAF-1 function. To confirm this hypothesis,
increasing amounts of a non-hydrolyzable ATP analog, ATP Interactions Between Caspase-9, APAF-1, and Cytochrome
c--
Previous studies have demonstrated that APAF-1 interacts with
caspase-9 only in the presence of dATP/ATP and cytochrome c (12). To study further the interaction between these three proteins, we
incubated purified APAF-1 (His-tagged), procaspase-9 (without tag), and
cytochrome c in different combinations, and we precipitated APAF-1 with nickel resin. The supernatants and pellets were probed with
antibodies against these three proteins. Shown in Fig.
4C, the same amounts of APAF-1
were precipitated by the nickel resin independent of cytochrome
c, dATP, or procaspase-9. No APAF-1 was detected in the
supernatants (data not shown). On the other hand, caspase-9 was
pelleted only in the presence of APAF-1, dATP, and cytochrome
c (Fig. 4B, lane 6). Interestingly, the majority of pelleted caspase-9 was already processed into the 35-kDa active form, indicating that procaspase-9 was rapidly auto-activated once
bound to APAF-1. When dATP, APAF-1, or cytochrome c was
omitted in the reaction, procaspase-9 stayed in the supernatant (Fig. 4A, lanes 5 and 7-9). Noticeably,
some of the processed caspase-9 was also in the supernatant (Fig.
4A, lane 6), suggesting that once processed,
caspase-9 can be released from APAF-1. Consistent with the previous
finding, cytochrome c was co-precipitated with APAF-1 in the
absence and presence of dATP (13) (Fig. 4D). However, the
amount of cytochrome c that was co-precipitated with APAF-1 was consistently increased in the presence of dATP, suggesting that
dATP may stabilize the binding of cytochrome c to
APAF-1.
Formation of APAF-1·Cytochrome c·Caspase-9 Complex in the
Presence of dATP--
The co-precipitation experiments with either
nickel resin (Fig. 4) or antibody against caspase-9 (12) indicate that
caspase-9 interacts with APAF-1 in the presence of cytochrome
c and dATP. To characterize further the biochemical nature
of this APAF-1·caspase-9 complex formed in the presence of cytochrome
c and dATP, we separated these proteins and the complex on a
gel filtration column. In the absence of dATP, the mixture of APAF-1,
procaspase-9, and cytochrome c were separated by the sizing
column (Fig. 5A). The protein
peaks of APAF-1, procaspase-9, and cytochrome c were found at fractions 14, 16, and 21, respectively. Each protein migrates at the
position corresponding to its monomeric size compared with the
molecular size standard. No stable association was observed between
these proteins. All three proteins migrated at the identical positions
if run individually (data not shown). In contrast, if the mixture was
preincubated in the presence of dATP, all three proteins were observed
at fraction 11, indicating that they now form a large complex (Fig.
5B). Caspase-9 was processed under this condition and showed
two peaks in the column. The first peak was at fraction 11 correlating
with the complex form, whereas the second peak was at fraction 16, indicating again that the processed caspase-9 was released from the
complex.
To confirm that this large complex (>1.3 million-dalton exclusion
volume of this column) forms in vivo when cells undergo apoptosis, we prepared cell extracts from normally growing HeLa cells
and cells that were undergoing apoptosis induced by staurosporine. The
apoptosis in staurosporine-treated cells was confirmed by characteristic morphological changes observed under a microscope (data
not shown). These extracts were analyzed by the same gel filtration
column. Shown in Fig. 5C, APAF-1 in normal cell extract migrated at peak fraction 14, corresponding to its monomeric inactive form, whereas a significant amount of APAF-1 in apoptotic extracts had
been shifted to fraction 11, corresponding to a large complex.
Both dATP and Cytochrome c Are Required to Form a
Caspase-9-activating APAF-1·Cytochrome c Complex--
To dissect
further the individual steps leading to the formation of this
multimeric protein complex, recombinant APAF-1 protein was analyzed on
the same gel filtration column either alone (Fig. 6A), or preincubated with
cytochrome c plus ATP
Strikingly, when APAF-1 was preincubated with dATP and cytochrome
c, the peak of APAF-1 was shifted around fraction 11 and associated with cytochrome c (Fig. 6D). This
APAF-1·cytochrome c complex was now fully functional in
activating procaspase-3 when purified procaspase-9 was added (Fig.
6D, lower panel). dATP and cytochrome c were no
longer required for such a reaction.
APAF-1 and Procaspase-9 Are At a 1:1 Ratio in the Complex--
To
estimate the molar ratio of APAF-1 and procaspase-9 in the complex, we
incubated APAF-1 with an excessive amount of procaspase-9 with the
D315A mutation (~5 to 1 molar ratio). This mutant cannot be processed
within this complex and therefore cannot be released. The
APAF-1·caspase-9 D315A complex was isolated from the fraction 10-11
of the gel filtration column after preincubating with dATP and
cytochrome c and subjected to SDS-PAGE together with the
known amounts of APAF-1 and procaspase-9 followed by Coomassie Blue staining (Fig. 6E). No cytochrome c was detected
by this staining method even though it can be detected by Western blot
analysis (data not shown). The bands corresponding to APAF-1 and
procaspase-9 were scanned by a densitometer. The results suggest that
APAF-1 and procaspase-9 are present at an approximately 1:1 ratio in this complex.
The reconstitution of the procaspase-9 activation pathway with
highly purified, recombinant APAF-1 and procaspase-9 described above
revealed that caspase-9 activation was achieved by a three-step reaction as illustrated in Fig. 7. First,
dATP/ATP binds to APAF-1 through its consensus nucleotide binding
domain and is hydrolyzed to dADP or ADP, respectively; second,
cytochrome c binds to APAF-1 and promotes the
multimerization of APAF-1·cytochrome c complex when the
dATP/ATP bound to APAF-1 is being hydrolyzed; third, once the
multimeric complex is formed, procaspase-9 is recruited to the complex
in a 1:1 molar ratio to APAF-1, and it becomes activated through
auto-catalysis. The activated caspase-9 is then released from the
complex, allowing it to cleave downstream caspases and new procaspase-9
to come into the complex to be processed.
![]()
INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES
-irradiation, ceramide, and dexamethasone (15-16).
![]()
EXPERIMENTAL PROCEDURES
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES
-32P]dCTP-labeled 285-bp PCR product
was used to screen the HeLa
Exlox cDNA library as described
(13). A 1.4-kilobase pair clone was characterized by DNA sequencing and
assembled with APAF-1 cDNA using DNASTAR program. An additional 33 nucleotides encoding 11 more amino acids between the CARD and CED-4
homologous domain of APAF-1 was found. To confirm the existence of this
alternatively spliced transcript, HeLa poly(A)+ mRNA
was purified using a rapid mRNA purification kit (Amersham Pharmacia Biotech), and the first strand cDNA was carried out using
a first strand cDNA synthesis kit (Amersham Pharmacia Biotech) with
the specific primer (5'AACACTTCACTATCACTTCC3'), designed from WD-40
region of APAF-1 cDNA. An aliquot of 400 ng of this first strand
cDNA mixture was amplified by two primers P1/P2
(5'TAATGATTCCTACGTATCATTCTACAATGC3' and 5'GAATGATCTCTAACAGCTTC3') (Fig.
1). The resulting 316- and 283-bp PCR products were subcloned into the
PCR II vector using the TA cloning kit (Invitrogen) and sequenced.
80 °C.
80 °C.
-32P]ATP (Amersham
Pharmacia Biotech) or 100 nM dATP plus 2 µCi of [
-32P]dATP (Amersham Pharmacia Biotech) and additional
0.5 mM MgCl2 in the presence or absence of 0.4 µg of cytochrome c at 30 °C for 1 h in a final
volume of 50 µl of buffer A. After incubation, the reaction mixtures
were incubated with nickel beads (Qiagen), and the bound APAF-1s were
eluted as described in the legend of Fig. 2. The eluted samples were
directly loaded on a TLC plate, and ATP/dATP hydrolysis was analysis as
described in the legend of Fig. 2.
![]()
RESULTS
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

View larger version (28K):
[in a new window]
Fig. 1.
Alternatively spliced transcripts of
APAF-1. A, a diagram of APAF-1L-WD13. The
CARD, CED-4 homologous region, Walker's A and B box consensus
sequences for nucleotide-binding sites (31), and WD-40 repeats are
indicated. The additional 11 amino acids in between the CARD and CED-4
homologous domain and an additional WD-40 repeat in between the fifth
and sixth WD-40 repeat are indicated. P1/P2 and P3/P4 denote the PCR
primers used for RT-PCR to detect the alternatively spliced APAF-1
transcripts. B, the RT-PCR products using mRNA from HeLa
cells as templates and P1/P2 and P3/P4 as primers were analyzed by a
2% agarose gel electrophoresis and visualized by ethidium bromide
staining.

View larger version (39K):
[in a new window]
Fig. 2.
Purified recombinant APAF-1 and procaspase-9
have dATP and cytochrome c-dependent
caspase-3 cleavage activity. Recombinant APAF-1, APAF-1L,
APAF-1L-WD13, and procaspase-9 were prepared as described
under "Experimental Procedures." A, aliquots (2.5 µg)
of APAF-1, APAF-1L, and APAF-1L-WD13 were subjected to 10% SDS-PAGE,
and the gel was subsequently stained with Coomassie Blue. B,
aliquots (2 µg) of wild type procasepase-9, C287A active site mutant,
and D315A cleavage site mutant were subjected to 15% SDS-PAGE followed
by staining with Coomassie Blue. C, aliquots of recombinant
procaspase-9 (2 µg) with wild type sequence (lanes 1-3),
or cleavage site mutant (D315A, lanes 5 and 6),
or active site mutant (C287A, lanes 4 and 6), and
recombinant APAF-1L-WD13 (0.8 µg) were incubated
individually (lane 1) or together (lanes 2-6),
in the presence (lanes 3-6) or absence (lanes 1 and 2) of 0.2 µg of cytochrome c plus 100 µM dATP at 30 °C for 1 h in a final volume of 20 µl of buffer A. The samples were subjected to 15% SDS-PAGE and
transferred to a nitrocellulose filter. The filter was probed with a
rabbit antibody against caspase-9. The antigen-antibody complexes were
visualized by an ECL method as described under "Experimental
Procedures." The filter was then exposed to a x-ray film for 10 s. D, aliquots of recombinant procaspase-9 (2 µg) and
recombinant APAF-1L-WD13 (0.8 µg) were incubated
individually (lanes 1 and 2) or together
(lanes 3-7), in the presence (lanes 1 and
2, 4, 6, and 7) or absence (lanes 3 and 5) of 0.2 µg of cytochrome c plus 100 µM dATP (lanes 1 and 2 and
5 and 6) or 100 µM dADP (lane
7) with 1 µl of 35S-labeled affinity purified
procaspase-3 at 30 °C for 1 h in a final volume of 20 µl of
buffer A. The samples were then subjected to 15% SDS-PAGE and
transferred to a nitrocellulose filter, followed by exposing to a
phosphorimaging plate for 12 h at room temperature.
-32P-labeled ATP or dATP, and the nucleotide bound to
APAF-1 was pelleted by nickel affinity resin and analyzed by thin layer
chromatography (TLC). As shown in Fig.
3A, radiolabeled nucleotides
were co-precipitated with APAF-1, indicating that APAF-1 indeed bound
nucleotides. Interestingly, the majority of nucleotide bound to APAF-1
was ADP or dADP, rather than ATP, or dATP. This finding suggests that the nucleotides bound to APAF-1 are hydrolyzed. Incubation with cytochrome c did not affect dATP binding or hydrolysis
(lanes 6 and 7). A mutant APAF-1 protein with
four amino acids substitution in the conserved Walkers A and B boxes
did not bind any nucleotide (lanes 4 and 6)
even though the same amount of protein was precipitated (Fig.
3B).

View larger version (22K):
[in a new window]
Fig. 3.
ATP binding and hydrolysis by APAF-1.
Recombinant wild type (W) and nucleotide-binding sites
mutant (M) APAF-1 were purified as described under
"Experimental Procedures." A, aliquots of 2 µg of wild
type or mutant APAF-1 were incubated with 100 nM ATP plus 2 µCi of [
-32P]ATP (lanes 3 and
4), or 100 nM dATP plus 2 µCi of
[
-32P]dATP (lanes 5 and 6) in
the presence of 0.4 µg of cytochrome c (lane 7)
at 30 °C for 1 h at a final Mg2+ concentration of 2 mM and final volumes of 50 µl of buffer A. After 1 h
incubation, the samples were mixed with 400 µl of buffer A and an
aliquot of 50 µl of nickel beads. After incubation at 4 °C for
2 h in a rotator, the mixtures were pelleted by centrifugation,
and the beads were washed five times with buffer A. The beads were then
resuspended in 50 µl of buffer A containing 250 mM
imidazole, and the beads were pelleted by centrifugation. Aliquots of
10 µl of the supernatants were collected and loaded on a TLC plate
and developed in 1 M formic acid plus 0.5 M
LiCl. For the control (lanes 1 and 2), aliquots
of [
-32P]ATP or [
-32P]dATP in 50 µl
of buffer A were incubated at 30 °C for 1 h, followed by
directly loading the TLC plate together with the above samples.
B, aliquots of 5 µl of resulting supernatants as in
A were subjected to 10% SDS-PAGE followed by Western
blotting analysis using a rabbit antibody against the CED-4 homologous
domain of APAF-1 (1:2000). The antigen-antibody complexes were
visualized by an ECL method as described under "Experimental
Procedures." The film was exposed for 10 s. C,
aliquots of 0.8 µg of recombinant APAF-1L-WD13 were
incubated with aliquots of 0.2 µg of recombinant procaspase-9
purified as described under "Experimental Procedures," 1 µl of
in vitro translated 35S-labeled caspase-3, 0.2 µg of cytochrome c, 100 µM dATP (lanes
1-4) or 1 mM ATP (lanes 5-8), and
increasing amounts of ATP
s in a final volume of 20 µl in buffer A. After 1 h incubation at 30 °C, the samples were subjected to
15% SDS-PAGE and transferred to a nitrocellulose filter followed by
exposing to a phosphorimaging plate for 12 h at room
temperature.
S, was
incubated with APAF-1 and procaspase-9, in the presence of dATP (Fig.
3C, lanes 1-4) or ATP (Fig. 3C,
lanes 5-8) in a procaspase-3 activation reaction.
Consistent with the previous observation, 100 µM dATP, or
1 mM ATP, is the optimal concentration in such a reaction.
The presence of ATP
S inhibited the caspase-3 activation reaction in
a concentration-dependent fashion with 1 mM
ATP
S completely inhibiting the reaction. It is interesting to note
that even at concentrations much lower than ATP or dATP present,
ATP
S shows noticeable inhibitory effects (Fig. 3C,
lanes 2, 3, 6, and 7).

View larger version (24K):
[in a new window]
Fig. 4.
Interactions between procaspase-9, APAF-1,
and cytochrome c. Recombinant APAF-1 and procaspase-9 (not
tagged) were purified as described under "Experimental Procedures."
Aliquots of 4 µg of APAF-1, 0.5 µg of procaspase-9, and 0.8 µg of
cytochrome c were incubated individually (lanes 1 and 2) or in combinations of two (lanes 3 and
4 and 7-9) or all three (lanes 6), in
the presence or absence of 100 µM dATP at 30 °C for
1 h in a final volume of 100 µl of buffer A. After incubation,
the samples were mixed with 400 µl of buffer A, 60 µl of nickel
beads and incubated at 4 °C for 3 h in a rotator. The mixtures
were then pelleted by centrifugation, and the supernatants were
collected and concentrated to about 40 µl. The pellets were washed
five times with buffer A and eluted with 250 mM imidazole
in 80 µl of buffer A. A, 20-µl aliquots of the resulting
supernatants were subjected to 15% SDS-PAGE and transferred to a
nitrocellulose filters. The filters were probed with a rabbit antibody
against caspase-9. The antigen-antibody complexes were visualized by an
ECL method as described under "Experimental Procedures." The filter
was then exposed to a x-ray film for 30 s. B, the
resulting pellets were washed five times with buffer A and then eluted
with 250 mM imidazole in 80 µl of buffer A. Aliquots of
35 µl of the eluates were subjected to 15% SDS-PAGE and transferred
to a nitrocellulose filter. The filter was probed with a rabbit
anti-caspase-9 antibody and then exposed to x-ray film for 1 min.
C, the resulting eluates as in B were subjected
to 10% SDS-PAGE followed by Western blotting analysis using a rabbit
antibody against APAF-1 (1:2000), and the antigen-antibody complexes
were visualized by an ECL method. The film was exposed for 5 s.
D, the same filter as in B was erased and
reprobed with a monoclonal anti-cytochrome c antibody
followed by ECL detection and exposure to x-ray film for 1 min.

View larger version (30K):
[in a new window]
Fig. 5.
Formation of an APAF-1, caspase-9, and
cytochrome c complex. APAF-1 was purified from
HeLa-S100 as described previously (13). The histidine-tagged
recombinant procaspase-9 was purified as described under
"Experimental Procedures." A and B, an
aliquot of 2.5 µg of APAF-1 was incubated with 15 µl (0.5 µg) of
recombinant procaspase-9 and 0.8 µg of cytochrome c in the
absence (A) or presence (B) of 100 µM dATP in 30 °C for 1 h in a final volume of 60 µl in buffer A. After incubation, the reaction mixtures were
fractionated by a Superdex-200 gel filtration column in a Smart System
(Amersham Pharmacia Biotech) as described under "Experimental
Procedures." The fractions of 100 µl were collected, and aliquots
of 30 µl were subjected to 15% or 1% SDS-PAGE followed by Western
blotting analysis using monoclonal antibody against cytochrome
c, a rabbit polyclonal antibody against caspase-9 (1:2000),
and a rabbit polyclonal antibody against APAF-1 as indicated. The
antigen-antibody complexes were visualized by an ECL method as
described under "Experimental Procedures." The filters was exposed
to a x-ray film for 30 s for APAF-1 blot and 1 min for caspase-9
and cytochrome c blots. C, four dishes of HeLa
cells grown in monolayer as described under "Experimental
Procedures." Two dishes of cells were treated with staurosporine at a
final concentration of 2 µM for 8 h. S-100 fractions
were prepared from both treated and non-treated cells as described
under "Experimental Procedures" and fractionated by the
Superdex-200 gel filtration column as described in A and
B. Aliquots of 30-µl column fractions were subjected to
10% SDS-PAGE followed by Western blotting analysis using a rabbit
antibody against APAF-1 (1:2000). The filters was exposed to an x-ray
film for 30 s.
S (Fig. 6B), or dATP
(Fig. 6C), or dATP plus cytochrome c (Fig.
6D). Preincubation of APAF-1 with cytochrome c
plus nonhydrolyzable ATP or dATP alone did not cause significant change
in their column behavior. In addition, after preincubating APAF-1 with
dATP, the reaction mixture was loaded on the same gel filtration
column, and the resulting column fractions were assayed for APAF-1
activity in the absence or presence of dATP. The APAF-1 activity was
only observed in the presence of dATP and the activity peak was
observed at fraction 14, correlating with the monomeric form of APAF-1
(Fig. 6C, lower panel). The APAF-1 protein that migrated
larger than fraction 14 was not active and therefore most likely
represents nonspecific protein aggregates. Indeed, recombinant APAF-1
alone was found to have a tendency to self-aggregate into
non-functional complexes (data not shown). These data suggest that
incubation of APAF-1 with dATP, or cytochrome c, was not
sufficient to drive APAF-1 into the functional multimeric complex nor
forgo the requirement for dATP in activating procaspase-9 (Fig.
6C, lower panel).

View larger version (44K):
[in a new window]
Fig. 6.
Both dATP and cytochrome c
are required for APAF-1 multimerization. A, an
aliquot of 4 µg of recombinant APAF-1 was fractionated by a
Superdex-200 gel filtration column in a Smart System (Amersham
Pharmacia Biotech) as described under "Experimental Procedures."
Aliquots of 10-µl column fractions were subjected to 10% SDS-PAGE
followed by Western blotting analysis using a rabbit antibody against
APAF-1 (1:2000), and the antibody-antigen complexes were visualized by
an ECL method as described under "Experimental Procedures." The
film was exposed for 10 s. The positions of molecular weight
standards (Bio-Rad) migrated in this column were marked at the
top. B, an aliquot of 4 µg of recombinant
APAF-1 was incubated with 0.8 µg of cytochrome c and 1 mM ATP
s at 30 °C for 1 h in a final volume of 60 µl in buffer A. The reaction mixture was analyzed by the gel
filtration column as in A. Aliquots of 10-µl column
fractions were subjected to 10% SDS-PAGE followed by Western blotting
analysis using a rabbit antibody against APAF-1 and then followed by
ECL detection and exposure to x-ray film for 10 s. C,
an aliquot of 4 µg of recombinant APAF-1 was incubated with 100 µM dATP at 30 °C for 1 h in a final volume of 60 µl in buffer A. The reaction mixture was analyzed in the gel
filtration column as in A. Aliquots of 10-µl column
fractions were subjected to 10% SDS-PAGE followed by Western blotting
analysis as in A. The film was exposed for 10 s
(upper panel). In the lower panel, aliquots of
25-µl column fractions were incubated with 5 µl (0.17 µg) of
recombinant procaspase-9, 1 µl of in vitro translated
35S-labeled procaspase-3, and 0.2 µg of cytochrome
c in the absence or presence of 100 µM dATP as
indicated at 30 °C for 1 h in a final volume of 35 µl of
buffer A. The samples were then subjected to 15% SDS-PAGE and
transferred to a nitrocellulose filter. The filter was exposed to a
phosphorimaging plate for 14 h at room temperature. D,
an aliquot of 4 µg of recombinant APAF-1 was incubated with 0.8 µg
of cytochrome c and 100 µM dATP in a final
volume of 60 µl in buffer A. After incubated in 30 °C for 1 h, the sample was analyzed in the gel filtration column as in
A. Aliquots of 10-µl column fractions were subjected to
10% SDS-PAGE followed by Western blotting analysis using a rabbit
antibody against APAF-1, or a monoclonal antibody against cytochrome
c followed by ECL detection and exposure to x-ray film for
10 and 30 s, respectively (upper panel). In the
lower panel, aliquots of 25-µl column fractions were incubated with 5 µl (0.17 µg) of recombinant
procaspase-9 and 1 µl of in vitro translated
35S-labeled procaspase-3 in the presence or absence of 100 µM dATP and 0.2 µg of cytochrome c at
30 °C for 1 h in a final volume of 35 µl of buffer A. The
samples were then subjected to 15% SDS-PAGE and transferred to a
nitrocellulose filter. The filter was exposed to a phosphorimaging
plate for 14 h at room temperature. E, recombinant
cleavage site mutant (D315A) procaspase-9 was purified as described
under "Experimental Procedures." The APAF-1 and procaspase-9
(Asp-315) standards were quantified by amino acid analysis. An aliquot
of 150 µl (25 µg) of recombinant APAF-1 was incubated with aliquots
of 180 µl (45 µg) of recombinant procaspase-9 (D315A), 4.8 µg of
cytochrome c, and 100 µM dATP in the final
volume of 360 µl in buffer A. After 1 h incubation in 30 °C,
the sample was then fractionated in the gel filtration column as in
A. The fraction 10 and fraction 11 were concentrated to a
final volume of 30 µl and subjected to 10% SDS-PAGE. The gel was
subsequently stained with Coomassie Blue and scanned in a
densitometer.
![]()
DISCUSSION
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

View larger version (24K):
[in a new window]
Fig. 7.
Model of caspase-9 activation. See the
text for details. APAF-1, cytochrome c, caspase-9, dATP, and
dADP are indicated.
Role of ATP/dATP Hydrolysis--
The direct demonstration that
APAF-1 binds to and hydrolyzes dATP/ATP confirms the notion that the
evolutionarily conserved nucleotide-binding sites are important for its
function. Mutations at the conserved nucleotide-binding site diminished
the nucleotide binding capacity of APAF-1 and rendered the protein
inactive (Fig. 3A, and data not shown). The inhibitory
effect of a non-hydrolyzable ATP analog for both caspase activation
(Fig. 3C) and ATP binding to APAF-1 (data not shown)
indicates that both the binding of ATP/dATP to APAF-1 and their
hydrolysis to ADP/dADP are important for its function. Interestingly,
ATP
S showed an inhibitory effect even at concentrations much lower
than the ATP present (Fig. 3C). One interpretation for this
observation is that each subunit of APAF-1 must hydrolyze ATP/dATP to
form the functional complex. The subunit that bound ATP
S not only
inactivates itself but also effectively inhibits other ATP-bound APAF-1
molecules that were going to form a complex with it. This observation
supports the importance of APAF-1 multimerization.
The effects of binding and hydrolysis of ATP/dATP seem to be transient since preincubation of dATP with APAF-1 did not bypass the requirement of dATP (Fig. 6C, lower panel). Since intracellular ATP and dATP concentrations are around 10 mM and 10 µM, respectively (27), it is conceivable that ATP/dATP is hydrolyzed by APAF-1 constantly. This hydrolysis, however, does not have any functional consequence since cytochrome c is usually sequestered away from APAF-1 in mitochondria.
Neer et al. (28) compared all the known WD-40 repeat-containing proteins and noted that most are regulatory, but none is an enzyme. ATP/dATP hydrolysis activity by APAF-1 proved it to be an exception.
Role of Cytochrome c in Promoting APAF-1 Multimerization-- Holocytochrome c exists exclusively in the intermembrane space of mitochondria in living cells. The newly translated apocytochrome c in cytosol does not have apoptosis promoting activity (29). However, when cells undergo apoptosis in response to a variety of stimuli, cytochrome c is released from mitochondria to cytosol, where APAF-1 is located (30). No detectable amount of APAF-1 is found in the membrane fraction in both living or apoptotic cells (data not shown). Cytochrome c was found to interact with APAF-1 in the absence or presence of dATP as shown by co-immunoprecipitation experiment (13) (Fig. 4D). However, when subjected to gel filtration chromatography, the cytochrome c and APAF-1 complex was only detected in the presence of dATP, indicating that the interaction between APAF-1 and cytochrome c in the absence of dATP is not stable and can be easily separated. The binding and hydrolysis of dATP did not seem to be influenced by the presence of cytochrome c, suggesting that the function of cytochrome c is not to regulate the dATP binding and hydrolysis by APAF-1 (Fig. 3A). In the presence of dATP, cytochrome c promotes the multimerization of APAF-1 from a monomeric form to a large complex that consists at least 8 subunits of APAF-1 (calculated based on its size >1.3 million daltons). Such a complex is fully functional in activating procaspase-9 and neither dATP nor cytochrome c is required any longer (Fig. 6D, lower panel). These data are consistent with a model that cytochrome c bound to APAF-1 will stabilize the transient conformational change of APAF-1 resulting from dATP/ATP hydrolysis, allowing them to multimerize. The functions of both dATP and cytochrome c are probably accomplished once the multimerized APAF-1/cytochrome c is formed (Fig. 6D). However, because cytochrome c is still detected in the functional caspase-9-activating complex, it is still possible that cytochrome c plays an additional role in procaspase-9 activation such as stabilizing this complex.
Oligomerized APAF-1·Cytochrome c Complex: a Functional Apoptosome?-- Several features of this stable APAF-1 and cytochrome c multimeric complex make it a candidate of apoptosome as follows: first, it is a big complex (>1.3 million daltons measured by gel filtration chromatography); second, the formation of this complex requires the hydrolysis of high energy bond of ATP, or dATP; and third, this complex is functional in term of activating procaspase-9. The formation of this complex will likely be the commitment step for cells to activate their caspases in response to stimuli that cause cytochrome c release. This complex is able to trigger many characteristic apoptotic features of dying cells through caspase activities. Future studies are needed to determine the exact molecular compositions of this complex.
Why multimeric complex? Since the full occupancy of procaspase-9 in the
apoptosome results in approximately 1:1 molar ratio of APAF-1 to
procaspase-9 (Fig. 6E), one obvious reason for apoptosome is
to bring multiple procaspase-9 in close proximity, allowing them to
cleave each other. Similar hypothesis have been proposed for CED-4 and
APAF-1 WD-40 truncation (17-19). However, there is no evidence that
inter-molecular cleavage indeed occurs, and simply mixing D315A and
C287A mutants did not result in the cleavage of C287A even though both
of them can be recruited onto the apoptosome (Fig. 3C and
data not shown). Another reason for the multimeric complex could be to
increase the threshold of apoptosis to ensure nonspecific leakage of
cytochrome c does not cause apoptotic response.
| |
ACKNOWLEDGEMENTS |
|---|
We thank our colleagues Lily Li, Mike Lutter, Deepak Nijhawan, Holt Oliver, and Imawati Budihardjo for helpful discussions and suggestions and Renee Harold for excellent technical assistance. We thank Dr. Xiaosong Xie for help with the ATP hydrolysis assay. We are grateful to our colleagues Drs. Joseph Goldstein and Michael Brown for critically reading the manuscript.
| |
FOOTNOTES |
|---|
* The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
Supported by American Cancer Society Research Grant Re258,
National Institutes of Health Grant GMRO1-57158, and Welch Foundation Grant I-1412. To whom correspondence should be addressed: Dept. of
Biochemistry, University of Texas Southwestern Medical Center, 5323 Harry Hines Blvd., Dallas, TX 75235. Tel.: 214-648-6713; Fax:
214-648-5419; E-mail: xwang{at}biochem.swmed.edu.
| |
ABBREVIATIONS |
|---|
The abbreviations used are:
APAF-1, apoptotic
protease activating factor-1;
ATP, adenosine 5'-triphosphate;
dATP, 2'-deoxyadenosine 5'-triphosphate;
PAGE, polyacrylamide gel
electrophoresis;
RT, reverse transcriptase;
PCR, polymerase chain
reaction;
CARD, caspase recruitment domain;
ATP
S, adenosine
5'-O-(thiotriphosphate).
| |
REFERENCES |
|---|
|
|
|---|
This article has been cited by other articles:
![]() |
T M Murphy, A S Perry, and M Lawler The emergence of DNA methylation as a key modulator of aberrant cell death in prostate cancer Endocr. Relat. Cancer, March 1, 2008; 15(1): 11 - 25. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. G. Abraham and A. Kappas Pharmacological and Clinical Aspects of Heme Oxygenase Pharmacol. Rev., March 1, 2008; 60(1): 79 - 127. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Li, E. Abdel Fattah, G. Cao, C. Ren, G. Yang, A. A. Goltsov, A. C. Chinault, W.-W. Cai, T. L. Timme, and T. C. Thompson Glioma Pathogenesis-Related Protein 1 Exerts Tumor Suppressor Activities through Proapoptotic Reactive Oxygen Species c-Jun NH2 Kinase Signaling Cancer Res., January 15, 2008; 68(2): 434 - 443. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. B. Gustafsson and R. A. Gottlieb Heart mitochondria: gates of life and death Cardiovasc Res, January 15, 2008; 77(2): 334 - 343. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Yin, W.-W. Huang, C. Lin, H. Chen, A. MacKenzie, and L. Ma Estrogen Suppresses Uterine Epithelial Apoptosis by Inducing Birc1 Expression Mol. Endocrinol., January 1, 2008; 22(1): 113 - 125. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Wang, P. Chanvorachote, D. Toledo, C. Stehlik, R. R. Mercer, V. Castranova, and Y. Rojanasakul Peroxide Is a Key Mediator of Bcl-2 Down-Regulation and Apoptosis Induction by Cisplatin in Human Lung Cancer Cells Mol. Pharmacol., January 1, 2008; 73(1): 119 - 127. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Deng, T. Shimamura, S. Perera, N. E. Carlson, D. Cai, G. I. Shapiro, K.-K. Wong, and A. Letai Proapoptotic BH3-Only BCL-2 Family Protein BIM Connects Death Signaling from Epidermal Growth Factor Receptor Inhibition to the Mitochondrion Cancer Res., December 15, 2007; 67(24): 11867 - 11875. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. J. Kuhn, Q. Chen, P. M. Voorhees, J. S. Strader, K. D. Shenk, C. M. Sun, S. D. Demo, M. K. Bennett, F. W. B. van Leeuwen, A. A. Chanan-Khan, et al. Potent activity of carfilzomib, a novel, irreversible inhibitor of the ubiquitin-proteasome pathway, against preclinical models of multiple myeloma Blood, November 1, 2007; 110(9): 3281 - 3290. [Abstract] [Full Text] [PDF] |
||||
![]() |
Z. Gao, Y. Tian, J. Wang, Q. Yin, H. Wu, Y.-M. Li, and X. Jiang A Dimeric Smac/Diablo Peptide Directly Relieves Caspase-3 Inhibition by XIAP: D |