![]()
|
|
||||||||
J Biol Chem, Vol. 274, Issue 17, 11593-11598, April 23, 1999
andFrom the Cancer Research Center, The Burnham Institute, La Jolla, California 92037
| |
ABSTRACT |
|---|
|
|
|---|
In vivo phage display is a powerful
method to study organ- and tissue-specific vascular addresses. Using
this approach, peptides capable of tissue-specific homing can be
identified by performing a selection for that trait in
vivo. We recently showed that the CGFECVRQCPERC (termed GFE-1)
peptide can selectively bind to mouse lung vasculature after an
intravenous injection. Our aim in the present study was to identify the
receptor for this lung-homing peptide. By using affinity
chromatography, we isolated a 55-kDa lung cell-surface protein that
selectively binds to the GFE-1 peptide. Protein sequencing established
the identity of the receptor as membrane dipeptidase (MDP), a
cell-surface zinc metalloprotease involved in the metabolism of
glutathione, leukotriene D4, and certain Phage display libraries are used to obtain defined peptide
sequences interacting with a particular molecule (1-5). We recently used phage display libraries to select in vivo for peptides
capable of homing to the vasculature of a given organ or tissue (6-8). This approach consists of intravenously injecting a phage library into
a mouse, allowing the phage to circulate in vivo, and then collecting phage bound to the vascular bed of interest. By using this
strategy, we identified phage-displayed peptides capable of homing to
the vasculature of brain, kidney, lung, skin, pancreas, intestine,
uterus, adrenal gland and
prostate1 (6, 7). We also
identified peptides that selectively home to blood vessels of
experimental tumors in nude mice (8). When coupled to the anti-cancer
drug doxorubicin, these tumor-homing peptides enhanced the efficacy of
doxorubicin against human breast cancer xenografts and reduced its
overall toxicity (8).
There are many reports of tissue-specific interactions between blood
cells and endothelial cells. Most of the cases studied at a molecular
level involve lymphocyte homing and are generally mediated by classical
cell-cell adhesion molecules (9). Another example of vascular
bed-specific recognition is the preference of metastasizing tumor cells
for certain organs (10, 11). In the lung, several vascular receptors
mediate adhesion of metastatic cells. For example, Elble et
al. (12) showed that lung endothelial cell adhesion molecule-1, an
endothelial surface protein with sequence homology to chloride
channels, mediates adhesion of malignant melanoma cells to lung
endothelium. The same group also showed that a protease, lung
endothelial dipeptidyl peptidase IV, is responsible for homing of
metastatic breast and prostate carcinoma cells to lung (13). These
results suggest that organ-selective homing can be mediated by
molecules that are not necessarily classical cell adhesion molecules.
Our identification by in vivo phage display of peptides
homing selectively to the vasculature of all the organs we have tested
so far provides further evidence for the widespread molecular
heterogeneity of the endothelium and offers tools to understand
vascular bed-specific interactions at a molecular level.
We recently reported the identification of several lung-homing peptides
(7). These phage-displayed peptides were selected for their ability to
home to mouse lung vasculature within 5 min after an intravenous
injection. We used several peptide phage libraries in our screens, such
as
CX3CX3CX3C,
CX6C, and CX7C (C indicates cysteine; X indicates any amino acid). One of the
most potent lung-homing phage was isolated from the
CX3CX3CX3C
library. This phage, CGFECVRQCPERC
(GFE-1),2 displays a 13-amino
acid peptide potentially containing two disulfide bonds. This GFE-1
phage shows more than 35-fold selectivity in lung homing relative to a
control phage. Homing of the GFE-1 phage was blocked by the cognate
peptide. Immunohistochemical studies performed on tissues of mice
intravenously injected with the GFE-1 phage showed strong phage
staining in the alveolar capillaries of the lung, whereas mice injected
with the same amount of a control phage showed no staining. Mice
injected with the GFE-1 phage showed no staining in skin, kidney,
brain, heart, muscle, lymph nodes, pancreas, intestine, and uterus.
Interestingly, another lung-homing peptide, CGFELETC (GFE-2), was
isolated in an independent screen and shares the tripeptide "GFE"
motif with GFE-1 (7). The phage displaying the GFE-2 peptide was also
found to bind to lung microvasculature, and its homing to lung was
inhibited by the GFE-1 peptide. These results led us to conclude that
GFE-1 and GFE-2 peptides both bind to the same receptor and that this
receptor is selectively expressed in lung vasculature.
In the present study, our objective was to isolate the receptor for the
GFE-1 peptide. By using affinity chromatography, we isolated a 55-kDa
cell-surface protein from lung that selectively binds to the GFE-1
peptide. The purified protein was shown to be membrane dipeptidase
(MDP, reviewed in Ref. 14). GFE-1 and the GFE-2 peptides showed
specific binding to cells transfected with MDP. In addition, the GFE-1
peptide shares sequence homology to natural MDP substrates and inhibits
membrane dipeptidase activity.
Materials--
BALB/c mice were purchased from Harlan
Sprague-Dawley (San Diego, CA). Frozen rat lungs were from Pel-Freez
Biologicals (Rogers, AR). The K91Kan bacterial strain and fd-tet phage
were gifts from G. Smith (1). Bovine serum albumin was from Intergen
(Purchase, NY). Dulbecco's modified Eagle's medium (DMEM) was from
Irvine Scientific (Santa Ana, CA). Fetal calf serum was purchased from Tissue Culture Biologicals (Tulare, CA). Cell strainers (70 µM pore) were from Becton Dickinson (Franklin Lake, NJ).
Units for concentration of protein solutions (Centricon 10,000 molecular weight cut-off columns) were purchased from Amicon (Beverly,
MA). CNBr-activated Sepharose 4B was obtained from Pharmacia Biotech (Uppsala, Sweden). N-Octyl- Phage Binding on Primary Cells--
BALB/c mice were
anesthetized with 0.017 ml/g of Avertin (15). Under deep anesthesia,
the mice were perfused through the heart with 10 ml of DMEM. The lungs,
kidneys, and brain were then collected, minced, placed in 2 ml of DMEM
containing 0.5% bovine serum albumin and 0.5 µg/ml collagenase V,
and incubated at 37 °C for 25 min. Following collagenase treatment,
the tissue was forced through a 70 µM pore cell strainer.
The filtered cells were washed once with 10 ml of DMEM supplemented
with 10% serum. The phage particles used in the binding assay were
amplified and purified, and the phage-displayed inserts were sequenced
as described previously (1, 16). To ensure an equal input of the
different phage to be tested, phage were titered several times using
K91Kan bacteria (1, 16). For the binding reaction, 109
transducing units (TU) of phage were incubated with 5 × 106 cells in 1 ml of DMEM supplemented with 10% serum. The
binding was performed at 4 °C for 2 h with gentle agitation.
After the binding reaction, the cells were washed four times with 1 ml
of DMEM supplemented with 10% serum at room temperature for 5-10 min
each time. The cell pellet was resuspended in 100 µl of DMEM and
transferred to a new tube. The phage bound to the cells were rescued by
adding 1 ml of K91Kan bacterial culture (1, 16) and incubating at room
temperature for 30 min. The bacteria were then diluted in 10 ml of LB
culture media supplemented with 0.2 µg/ml tetracycline and incubated
for another 30 min at room temperature. Serial dilutions of this
bacterial culture were plated on LB plates containing 40 µg/ml
tetracycline. Plates were incubated at 37 °C overnight before
counting colonies (TU).
In Vivo Biotinylation of Endothelial Cell-surface
Proteins--
In vivo biotinylation was performed as
described previously (17), but with several modifications. BALB/c mice
were anesthetized with Avertin and perfused slowly through the heart
for 10-15 min with approximately 15 ml of PBS containing 0.5 mg/ml
sulfo-NHS-LC-biotin. Well perfused lungs or control tissues such as
brain were then collected and incubated on ice for 20 min. The tissues
were then homogenized as described below.
Preparation of Lung Extracts--
The lungs from mouse or rat
were first minced and then homogenized with a Brinkman homogenizer
(Brinkman; Wesbury, NY) in a minimal volume (2.5 ml/g of tissue) of
cold PBS containing 100 mM
N-octyl- GFE-1 Peptide Affinity Chromatography--
The peptide affinity
chromatographies were performed according to the general principles
established by Pytela et al. (18, 19) for the isolation of
integrins by RGD peptide chromatography. All steps were performed at
4 °C. Briefly, the GFE-1 or control peptides were coupled to
CNBr-activated Sepharose 4B according to the manufacturer's
instructions. The matrix contained approximately 2 mg/ml peptide. The
biotin-labeled extract from 2 mouse lungs was applied to 500 µl of
the affinity matrix (3 ml of affinity matrix was used for the larger
unlabeled rat lung extract) equilibrated in column buffer (PBS
containing 50 mM octyl glucoside and 1 mM PMSF). The extract was applied to the column, and the flow-through was
re-applied over a period of 90 min. The column was then washed with 20 volumes of column buffer. Elution with the synthetic GFE-1 peptide was
carried out by slowly washing the column over a period of 1 h with
2 volumes of column buffer supplemented with 1 mg/ml GFE-1 peptide. The
remaining proteins bound to the column were eluted with 8 M
urea. The eluates were dialyzed against column buffer and concentrated
5-fold using a Centricon 10,000 molecular weight cut-off column.
Aliquots of each elution were then separated by SDS-PAGE. For the
experiments done with biotin-labeled extracts, the proteins were
transferred to a polyvinylidene difluoride membrane, blotted with
streptavidin-horseradish peroxidase, and developed with the ECL
chemiluminescence system. For the large scale preparation of MDP from
100 rat lungs, the proteins were directly detected by Coomassie
staining on a fixed gel.
Protein Sequencing--
Sequence analysis of a tryptic digest of
the rat 55-kDa protein was performed at the Harvard University
Microchemistry Facility (Boston) by microcapillary reverse phase high
pressure liquid chromatography tandem mass spectrometry (µLC/MS/MS)
on a Finnigan LCQ quadrupole ion trap mass spectrometer.
Membrane Dipeptidase Assay--
The membrane dipeptidase assay
and the fluorimetric detection of D-Phe were performed
exactly as described by Heywood and Hooper (20). Briefly, the samples
were first incubated at 37 °C for 3 h with the MDP substrate
Gly-D-Phe (1 mM). The released D-Phe was then converted to
6,6'-dihydroxy-(1,1'-biphenyl)-3,3'-diacetic acid in the presence of
D-amino acid oxidase and peroxidase (20). The fluorescence
was measured using an fmax fluorescence
microplate reader from Molecular Devices (Sunnyvale, CA).
Cloning of Murine MDP cDNA in pcDNA3 Expression
Vector--
Total mouse lung RNA was isolated using Qiagen RNA
purification columns and subjected to first strand cDNA synthesis
with reverse transcriptase and a mixture of random hexamers and
poly(dT) oligonucleotides. Mouse MDP cDNA was amplified from the
cDNA pool by polymerase chain reaction using the following
oligonucleotide pair: CCGCTGGTACCGCAGATCCCTGGGGACCTTG (modified to
contain a KpnI adaptor) and TCTTTCTAGAGCTCAGAGAGCACTGGAGGAG
(modified to contain an XbaI adaptor). The amplified
1.3-kilobase pair fragment was digested with KpnI and
XbaI and inserted into the same sites of the pcDNA3
expression vector. Successful cloning of the murine MDP cDNA was
confirmed by DNA sequencing.
Phage Binding on COS-1 Cells Transfected with MDP--
The COS-1
cell line was transiently transfected using the Superfect Reagent
(Qiagen) as recommended by the manufacturer. Briefly, 107
COS-1 cells were transfected with 10 µg of either the MDP expression vector or the vector alone. After 48 h, cells were scraped gently from the dish, washed once, and subjected to the phage binding assay or
membrane dipeptidase activity assay described above. For the phage
binding assay, 5 × 106 cells and 1010 TU
of phage input were used. For measurement of membrane dipeptidase activity, 106 cells were lysed in 100 µl of PBS/octyl
glycoside without protease inhibitors. A 10-µl aliquot of this
extract was used to measure MDP activity.
The GFE-1 Phage Binds to Lung Primary Cells--
We reported
previously that the GFE-1 phage binds to mouse lung vasculature when
injected in vivo (7). We first sought to determine if
binding of the GFE-1 phage to lung in vivo could be
reconstituted in vitro by performing a phage binding assay on lung primary cells. Fig. 1A
shows that primary lung cells bound about 60-fold more GFE-1 phage than
insertless fd-tet phage. The binding of the GFE-1 phage to kidney cells
was also higher than fd-tet binding (t test,
p < 0.02). However, this binding was much lower than
the GFE-1 binding on lung cells. In our previous in vivo
studies, we detected no specific phage homing to kidney when the GFE-1
phage was injected intravenously (7). The GFE-1 phage showed no
specific binding to primary brain cells.
The GFE-1 phage binding to lung cells was inhibited by almost 70% in
the presence of 150 µM of GFE-1 peptide, whereas the same
concentration of a control peptide (GRGESP) had no effect (Fig.
1B). The nonspecific binding of the fd-tet phage was not affected by the presence of GFE-1 or control peptides. These results demonstrate that the selective in vivo binding of the GFE-1
peptide to lung endothelium that we described previously (7) can be reconstituted in an in vitro assay on total lung primary
cells. Therefore, whole lung cell extracts contain sufficient amounts of GFE-1 receptor for isolation.
The GFE-1 Peptide Binds a 55-kDa Surface Protein--
To detect
only the cell-surface molecules that bind to the GFE-1 peptide, we
biotinylated mouse lung endothelial surface proteins in vivo
before preparing a total lung extract. The labeled extract was first
fractionated on a GFE-1 peptide affinity column; the column was washed,
and bound proteins were eluted with a GFE-1 peptide solution. Fig.
2 (left panel) shows that a
55-kDa biotinylated protein is selectively eluted by the GFE-1 peptide.
Prior to elution, the washes from the column showed no detectable
biotinylated proteins; subsequent addition of 8 M urea
eluted many biotinylated proteins that were retained nonspecifically in
the column. We detected no proteins in the 55-kDa range after
performing the same procedure on a control peptide (GRGESP) column
(Fig. 2, right panel). As an additional control, we
fractionated a biotinylated brain cell extract through a GFE-1 peptide
column under the same conditions. No biotinylated proteins from this
extract specifically bound to the GFE-1 peptide column (data not
shown). These results suggest that the GFE-1 peptide specifically binds
to a 55-kDa lung vascular surface protein. As shown in Fig.
3, the 55-kDa protein migrated as a
110-kDa band under non-reducing conditions, suggesting that the protein
is a disulfide-linked homodimer.
The 55-kDa GFE-1 Receptor Is Membrane Dipeptidase--
The GFE-1
phage can selectively target rat lung blood vessels when injected in
the circulation.3 To purify a
larger amount of the 55-kDa protein than could be obtained from mouse
tissues, we prepared a non-biotinylated extract from 100 rat lungs and
fractionated this extract on a GFE-1 peptide affinity column. A 55-kDa
protein (detected by Coomassie Blue staining) was eluted from the
column by the GFE-1 peptide (data not shown). This protein, which
co-migrated with the 55-kDa surface protein isolated from mouse lung,
was subjected to tryptic digestion and sequenced by mass spectrometry
as described under "Experimental Procedures." Two peptides
(YPDLIAELLR and TTPVIDGHNDLPWQMLTLFNNQLR) showed complete identity with
rat membrane dipeptidase (EC 3.4.13.19), also known as microsomal
dipeptidase, dehydropeptidase-1, or MDP. Several other peptide
sequences indicated the presence of rat IgG in the sample.
Contamination of the sample with IgG is expected at this molecular
weight range, given the abundance of IgG in an extract from unperfused lungs.
Depending on the species, the molecular mass of MDP ranges from 48 to
59 kDa. MDP is a plasma membrane glycosylphosphatidylinositol-anchored glycoprotein (reviewed in Ref. 14), which, consistent with our observations (Figs. 2 and 3), forms a disulfide-linked homodimer (21).
MDP is a zinc metalloprotease expressed mainly in lung and the kidney
brush border. It is involved in the metabolism of glutathione,
leukotrienes, and certain
To confirm that MDP is the GFE-1 peptide-binding protein, we tested if
the 55-kDa protein has membrane dipeptidase activity. Samples from the
affinity chromatography wash fraction and the GFE-1 peptide eluate
(Fig. 2) were incubated in the presence of the specific MDP substrate
Gly-D-Phe (14, 20), and the level of D-Phe
produced was measured. Fig. 4 shows a
time course of the conversion of D-Phe into a fluorescent
compound in those samples. The wash fraction showed only a base-line
level of fluorescence. In contrast, the GFE-1 peptide eluate contained
high membrane dipeptidase activity as illustrated by the
time-dependent conversion of D-Phe. The GFE-1
peptide eluate isolated from the rat lung extract also showed strong
MDP activity (data not shown). As expected, we could detect MDP
activity in the total lung extract. The specific activity was about
600-fold higher for the GFE-1 peptide eluate (200 nmol
D-Phe/min/mg) than for the total rat lung extract (0.34 nmol D-Phe/min/mg).
The GFE-1 and GFE-2 Phage Bind to Cells Transfected with
MDP--
The COS-1 cell line, which is known to have low or no
detectable level of MDP activity, has been used extensively to study MDP structure and function (14, 22). As shown in Fig.
5A, COS-1 cells transfected
with murine MDP showed at least 15-fold higher MDP activity than
mock-transfected cells. We tested if the GFE-1 phage could bind to
COS-1 cells transfected with MDP. Fig. 5B shows that the
GFE-1 phage bound 4-fold more to the MDP-transfected cells than to the
mock-transfected cells. As controls, the fd-tet phage and a skin-homing
phage (CVALCREACGEGC, shp-1) displaying a peptide with structural
features similar to those of the GFE-1 peptide (7) showed no specific
binding to cells expressing MDP, compared with mock-transfected cells.
In our previous report on the characterization of several lung-homing
phage, we proposed that the GFE-1 and GFE-2 peptides share the same
receptor (7). Fig. 5B shows that the GFE-2 phage binds to
MDP-transfected cells; the binding was weaker than the GFE-1 binding,
but this is in agreement with the in vivo lung homing data
we reported previously (7). The binding of both GFE-1 and GFE-2 phage
to MDP-transfected cells could be completely inhibited by the GFE-1
peptide (data not shown).
The GFE-1 Peptide Inhibits MDP Activity--
The metabolism of the
tripeptide glutathione involves cleavage by Our aim in the present study was to isolate the receptor for a
peptide that homes to lung vasculature. We show here the isolation from
a whole lung cell extract of a single molecule with the ability to bind
the GFE-1 peptide. Proof that this surface molecule is MDP is based on
the following evidence. (i) The mobility of the purified protein under
reducing and non-reducing conditions is similar to MDP. (ii) Protein
sequencing showed identity with MDP. (iii) Using a specific assay, the
GFE-1 peptide-binding protein was shown to have MDP activity. (iv) We
could detect binding of the GFE-1 phage on cells transfected with MDP.
The GFE-2 phage, known from our previous experiments to share the GFE-1
receptor (7), also bound to MDP-expressing cells. Finally, (v) the
GFE-1 peptide has sequence similarity with known substrates of MDP and could inhibit MDP enzymatic activity.
Although MDP expression can be detected in several tissues, it is
expressed mainly in the lung and kidney (14). In the mouse, four
distinct MDP mRNAs are present and they are differentially expressed in several organs (23). Organ-specific differences in the
nature and extent of pig MDP N-linked glycosylation have also been reported (24). In the kidney, MDP expression is concentrated in the brush border region of the proximal tubules, and in the lung,
MDP expression has been reported on the epithelial cells of the
conducting airways, epithelial cells of the alveolar ducts, capillaries, and the basement membrane of alveoli and terminal bronchioles (23, 25). MDP expression has also been observed on the
endothelial cells of submucosal microvessels in the human trachea (26).
The level of MDP activity was shown to be highest in the lung (27,
28).
Injecting the GFE-1 phage into the mouse circulation results in rapid
binding of the phage to lung microvasculature with some diffuse
staining on neighboring alveolar epithelial cells (7). The same results
were obtained by injecting the GFE-1 phage into rats.3 The
pronounced expression of MDP in the lung correlates with the strong
lung homing of the GFE-1 phage. We postulate that in our in
vivo experiments, the GFE-1 phage could not access and bind the
MDP present on the brush border of the kidney proximal tubules because
we injected the phage into the bloodstream and assayed for it a few
minutes after injection. However, the weak but significant binding of
the GFE-1 phage to kidney primary cells in vitro that we
observed in the present study (Fig. 1) may be due to binding of the
GFE-1 phage to the MDP present in the kidney. These results illustrate
an interesting characteristic of in vivo phage display; it
selects for molecules that are specific for a given vascular bed but
may be expressed by other types of cells in a manner that is not
tissue-specific.
Because Cys-Gly is a natural substrate for MDP, it is possible that the
GFE-1 peptide inhibits MDP enzymatic activity by binding to the active
site of MDP through its N-terminal Cys-Gly residues. The GFE-1 peptide
would not be hydrolyzed because MDP can cleave only dipeptides.
Interestingly, the GFE-2 (CGFELETC) lung-homing phage also contains the
Cys-Gly dipeptide in its N terminus, suggesting that these residues are
important for MDP binding. We previously showed that homing of the
GFE-2 phage to the lung can be inhibited by the GFE-1 peptide,
suggesting that they share the same receptor (7). However, the
MDP-binding properties of these two phage cannot be solely attributed
to the Cys-Gly dipeptide, because the GFE-1 peptide homes more
efficiently to the lung than GFE-2. The inhibition of MDP activity by
the GFE-1 peptide demonstrates the ability of in vivo
peptide phage display to select for peptides that bind to functional
sites in the target molecule. This property of peptide phage display
has been observed previously by our group when screening for integrin-
or fibronectin-binding peptides in vitro (4, 29, 30). In
these studies, most of the isolated peptides bound to integrins,
inhibited cell adhesion (29), and contained an RGD integrin-binding
motif (30). Conversely, a peptide isolated by biopanning on fibronectin
was shown to be a functional mimic of an RGD-binding site on integrins
(4). The tendency of peptides to bind to functionally important regions of their target proteins differs from antibodies and may be an advantage in some situations.
Dipeptidyl peptidase IV (CD26) has been identified as a lung
endothelial surface molecule involved in lung metastasis of breast cancer cells (13). Recently, the fibronectin present on the surface of
the metastatic cells was shown to be the ligand for dipeptidyl
peptidase IV-dependent homing of the breast cancer cells to
lung vasculature (31). The involvement of dipeptidyl peptidase IV in
homing of tumor cells to the lung parallels our identification of MDP
as the receptor for the GFE-1 lung-homing peptide. MDP and dipeptidyl
peptidase IV are different proteins with no structural similarity, but
their related peptidase activities indicate a selective requirement for
peptidase activities in the lung endothelium. MDP is the first receptor
identified for our phage that detect specialization in vascular beds
(6-8). As receptors for additional vascular homing peptides are
identified, the molecular basis of tissue-specific vascular
specialization will become better understood.
-lactam
antibiotics. Phage particles displaying the GFE-1 peptide selectively
bind to COS-1 cells transfected with the murine MDP cDNA. Moreover,
the synthetic GFE-1 peptide could inhibit MDP activity. By establishing
MDP as the receptor for the GFE-1 peptide, our results suggest
potential applications for both MDP and the GFE-1 peptide in delivery
of compounds to the lungs. This work also demonstrates that
cell-surface proteases can be involved in tissue-specific homing.
![]()
INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES
![]()
EXPERIMENTAL PROCEDURES
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES
-D-glucopyranoside
was purchased from Calbiochem. Sulfo-NHS-LC-Biotin was purchased from
Pierce. Pre-cast polyacrylamide 4-12% gradient gels were from Novex
(San Diego, CA). Polyvinylidene difluoride membranes for protein
transfer were purchased from Millipore (Bedford, MA).
Streptavidin-horseradish peroxidase was from Pierce. The ECL
chemiluminescence system was from NEN Life Science Products. Peptides
were synthesized by Anaspec (San Jose, CA). The RNA purification kit
was from Qiagen (Santa Clarita, CA). The first strand cDNA
synthesis kit and Taq polymerase were from Life
Technologies, Inc. DNA restriction enzymes and T4 DNA ligase were from
New England Biolabs (Beverly, MA). The pcDNA3 expression vector was
from Invitrogen (Carlsbad, CA). Transfection of the COS-1 cells was
done with the Superfect Reagent from Qiagen (Santa Clarita, CA).
Gly-D-Phe, D-Phe, D-amino acid
oxidase (type I), peroxidase (type VI), flavin adenine dinucleotide
(FAD), p-hydroxyphenylacetic acid, aprotinin, leupeptin,
phenylmethylsulfonyl fluoride (PMSF), and collagenase V were all from Sigma.
-D-glucopyranoside, 1 mM
PMSF, 20 µg/ml aprotinin, and 1 µg/ml leupeptin (PBS/octyl
glucoside). The homogenized tissue was incubated on ice for 2 h
and then centrifuged at 12,000 × g for 30 min to
remove cell debris. For larger extracts (100 rat lungs), the pellet was
extracted again with a minimal volume of PBS/octyl glucoside. The
pooled supernatants were cleared of any debris and used immediately for
affinity chromatography.
![]()
RESULTS
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

View larger version (26K):
[in a new window]
Fig. 1.
Binding of the GFE-1 phage to primary
cells. A, primary cells isolated from mouse lung,
kidney, and brain were incubated in the presence of equal amounts of
the fd-tet phage (black bars) or GFE-1 phage (dotted
bars). Phage bound to the cells were rescued by infection with
K91Kan bacteria. The total number of phage-transducing units recovered
is shown. B, lung primary cells were incubated with the
fd-tet phage (black bars) or the GFE-1 phage (dotted
bars) in the absence or presence of 150 µM of the
GFE-1 peptide or the control GRGESP peptide. The total number of
transducing units recovered is shown. Error bars indicate
standard deviation of the mean from triplicate platings.

View larger version (30K):
[in a new window]
Fig. 2.
A 55-kDa cell-surface protein from lung
extracts binds specifically to a GFE-1 peptide affinity column. An
in vivo biotinylated lung extract was fractionated on a
GFE-1 peptide column or on a control peptide column (GRGESP). The
columns were washed and then subjected to elution with the GFE-1
peptide. Aliquots (30 µl) from the wash fraction (
), GFE-1 peptide
elution, and 8 M urea elution were resolved by SDS-PAGE
under reducing conditions. Molecular mass markers (in kDa) are
indicated on the right side of each panel.

View larger version (26K):
[in a new window]
Fig. 3.
The 55-kDa protein forms a dimer under
non-reducing SDS-PAGE. An aliquot (20 µl) of the GFE-1 peptide
eluate from the GFE-1 peptide affinity column shown in Fig. 2 was
resolved by SDS-PAGE under non-reducing conditions. The molecular mass
markers (in kDa) are shown in lane 1, and the GFE-1
peptide eluate is shown in lane 2.
-lactam antibiotics (14).

View larger version (12K):
[in a new window]
Fig. 4.
Time course of the fluorimetric detection of
D-Phe produced by the hydrolysis of
Gly-D-Phe. Samples from the wash fraction (
) and
the GFE-1 peptide eluate (
), of the GFE-1 peptide affinity column,
were assayed for MDP activity with a Gly-D-Phe substrate.
The time-dependent conversion of D-Phe into a
fluorescent compound is shown.

View larger version (21K):
[in a new window]
Fig. 5.
Binding of the GFE-1 and GFE-2 phage on COS-1
cells expressing MDP. A, COS-1 cells were transfected
with the MDP expression vector or the vector alone. Two days after the
transfection, cell extracts were prepared and analyzed for MDP
activity. B, COS-1 cells transfected with either the MDP
expression vector or the vector alone were subjected to a binding assay
in the presence of equal amounts of either the fd-tet, skin-homing
(shp-1), GFE-1, or GFE-2 phage. In each case, the total number of phage
transducing units rescued from these cells is shown. Error
bars indicate standard deviation of the mean from triplicate
platings.
-glutamyl transpeptidase
to form glutamate and cysteinyl-glycine (Cys-Gly). The dipeptide
Cys-Gly is then recognized and cleaved by MDP, which can cleave only
dipeptides. Interestingly, the amino acid sequence of glutathione is
similar to the N-terminal portion of the GFE-1 peptide; the first two
amino acids of the GFE-1 peptide are Cys and Gly. Given this homology,
we asked if the GFE-1 peptide could inhibit the hydrolysis of
Gly-D-Phe by MDP. Fig. 6
shows that the GFE-1 peptide inhibits the hydrolysis of the
Gly-D-Phe substrate (0.5 mM) in a
dose-dependent manner. Another cyclic peptide (CARAC) did
not inhibit the enzyme. These results suggest that the GFE-1 peptide
can act as a competitive inhibitor of MDP.

View larger version (13K):
[in a new window]
Fig. 6.
Inhibition of MDP activity by the GFE-1
peptide. Extracts from MDP-expressing COS-1 cells were assayed for
MDP activity in the presence of increasing concentrations of either the
GFE-1 peptide (
) or CARAC control peptide (
).
![]()
DISCUSSION
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES
| |
ACKNOWLEDGEMENTS |
|---|
We thank R. Pasqualini, W. Arap, J. Hoffman, and J. T. Pai for helpful comments and discussions.
| |
FOOTNOTES |
|---|
* This work was supported in part by Grants CA 74238 and CA 78804 to (E. R.) and the Cancer Center support Grant CA 30199.The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
Research fellow of the National Cancer Institute of Canada
supported with funds provided by the Terry Fox Run.
§ To whom correspondence should be addressed: The Burnham Institute, 10901 N. Torrey Pines Rd., La Jolla, CA 92037. Tel.: 619-646-3125; Fax: 619-646-3198; E-mail: ruoslahti{at}burnham-inst.org.
1 W. Arap, R. Pasqualini, D. Rajotte, and E. Ruoslahti, unpublished observations.
3 D. Rajotte and E. Ruoslahti, unpublished observations.
| |
ABBREVIATIONS |
|---|
The abbreviations used are: GFE-1, CGFECVRQCPERC; GFE-2, CGFELETC; PBS, phosphate-buffered saline; MDP, membrane dipeptidase; DMEM, Dulbecco's modified Eagle's medium; CNBr, cyanogen bromide; MS, mass spectrometry; TU, transducing units; PMSF, phenylmethylsulfonyl fluoride.
| |
REFERENCES |
|---|
|
|
|---|
This article has been cited by other articles:
![]() |
R. Robert, M.-J. Jacobin-Valat, D. Daret, S. Miraux, A. T. Nurden, J.-M. Franconi, and G. Clofent-Sanchez Identification of Human scFvs Targeting Atherosclerotic Lesions: SELECTION BY SINGLE ROUND IN VIVO PHAGE DISPLAY J. Biol. Chem., December 29, 2006; 281(52): 40135 - 40143. [Abstract] [Full Text] [PDF] |
||||
![]() |
Z. Li, R. Zhao, X. Wu, Y. Sun, M. Yao, J. Li, Y. Xu, and J. Gu Identification and characterization of a novel peptide ligand of epidermal growth factor receptor for targeted delivery of therapeutics FASEB J, December 1, 2005; 19(14): 1978 - 1985. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Oh, I. Mohiuddin, Y. Sun, J. B. Putnam Jr, W. K. Hong, W. Arap, and R. Pasqualini Phenotypic Diversity of the Lung Vasculature in Experimental Models of Metastases Chest, December 1, 2005; 128(6_suppl): 596S - 600S. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Oh, I. Mohiuddin, Y. Sun, J. B. Putnam Jr, W. K. Hong, W. Arap, and R. Pasqualini Phenotypic Diversity of the Lung Vasculature in Experimental Models of Metastases Chest, December 1, 2005; 128(6_suppl): 596S - 600S. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Zhang, J. A. Hoffman, and E. Ruoslahti Molecular Profiling of Heart Endothelial Cells Circulation, September 13, 2005; 112(11): 1601 - 1611. [Abstract] [Full Text] [PDF] |
||||
![]() |
V. J. Yao, M. G. Ozawa, M. Trepel, W. Arap, D. M. McDonald, and R. Pasqualini Targeting Pancreatic Islets with Phage Display Assisted by Laser Pressure Catapult Microdissection Am. J. Pathol., February 1, 2005; 166(2): 625 - 636. [Abstract] [Full Text] [PDF] |
||||
![]() |
B.-S. Ding, Y.-J. Zhou, X.-Y. Chen, J. Zhang, P.-X. Zhang, Z.-Y. Sun, X.-Y. Tan, and J.-N. Liu Lung Endothelium Targeting for Pulmonary Embolism Thrombolysis Circulation, December 9, 2003; 108(23): 2892 - 2898. [Abstract] [Full Text] [PDF] |
||||
![]() |
H.-C. Wu, M.-Y. Jung, C.-Y. Chiu, T.-T. Chao, S.-C. Lai, J.-T. Jan, and M.-F. Shaio Identification of a dengue virus type 2 (DEN-2) serotype-specific B-cell epitope and detection of DEN-2-immunized animal serum samples using an epitope-based peptide antigen J. Gen. Virol., October 1, 2003; 84(10): 2771 - 2779. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. E. Benson, E. B. Gottlin, D. J. Christensen, and P. T. Hamilton Intracellular Expression of Peptide Fusions for Demonstration of Protein Essentiality in Bacteria Antimicrob. Agents Chemother., September 1, 2003; 47(9): 2875 - 2881. [Abstract] [Full Text] [PDF] |
||||
![]() |
H.-C. Cheng, M. Abdel-Ghany, and B. U. Pauli A Novel Consensus Motif in Fibronectin Mediates Dipeptidyl Peptidase IV Adhesion and Metastasis J. Biol. Chem., June 27, 2003; 278(27): 24600 - 24607. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Koolpe, M. Dail, and E. B. Pasquale An Ephrin Mimetic Peptide That Selectively Targets the EphA2 Receptor J. Biol. Chem., November 27, 2002; 277(49): 46974 - 46979. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. E. Akerman, W. C. W. Chan, P. Laakkonen, S. N. Bhatia, and E. Ruoslahti Nanocrystal targeting in vivo PNAS, October 1, 2002; 99(20): 12617 - 12621. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. G. Kolonin, R. Pasqualini, and W. Arap Teratogenicity induced by targeting a placental immunoglobulin transporter PNAS, October 1, 2002; 99(20): 13055 - 13060. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Essler and E. Ruoslahti Molecular specialization of breast vasculature: A breast-homing phage-displayed peptide binds to aminopeptidase P in breast vasculature PNAS, February 19, 2002; 99(4): 2252 - 2257. [Abstract] [Full Text] [PDF] |
||||
![]() |
W. Arap, W. Haedicke, M. Bernasconi, R. Kain, D. Rajotte, S. Krajewski, H. M. Ellerby, D. E. Bredesen, R. Pasqualini, and E. Ruoslahti Targeting the prostate for destruction through a vascular address PNAS, February 5, 2002; 99(3): 1527 - 1531. [Abstract] [Full Text] [PDF] |
||||
![]() |
H.-C. Wu, C.-T. Yeh, Y.-L. Huang, L.-J. Tarn, and C.-C. Lung Characterization of Neutralizing Antibodies and Identification of Neutralizing Epitope Mimics on the Clostridium botulinum Neurotoxin Type A Appl. Envir. Microbiol., July 1, 2001; 67(7): 3201 - 3207. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. J. White, S. A. Nicklin, T. Sawamura, and A. H. Baker Identification of Peptides That Target the Endothelial Cell-Specific LOX-1 Receptor Hypertension, February 1, 2001; 37(2): 449 - 455. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. A. Nicklin, S. J. White, S. J. Watkins, R. E. Hawkins, and A. H. Baker Selective Targeting of Gene Transfer to Vascular Endothelial Cells by Use of Peptides Isolated by Phage Display Circulation, July 11, 2000; 102(2): 231 - 237. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||