JBC

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Rajotte, D.
Right arrow Articles by Ruoslahti, E.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Rajotte, D.
Right arrow Articles by Ruoslahti, E.

J Biol Chem, Vol. 274, Issue 17, 11593-11598, April 23, 1999


Membrane Dipeptidase Is the Receptor for a Lung-targeting Peptide Identified by in Vivo Phage Display*

Daniel RajotteDagger and Erkki Ruoslahti§

From the Cancer Research Center, The Burnham Institute, La Jolla, California 92037

    ABSTRACT
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

In vivo phage display is a powerful method to study organ- and tissue-specific vascular addresses. Using this approach, peptides capable of tissue-specific homing can be identified by performing a selection for that trait in vivo. We recently showed that the CGFECVRQCPERC (termed GFE-1) peptide can selectively bind to mouse lung vasculature after an intravenous injection. Our aim in the present study was to identify the receptor for this lung-homing peptide. By using affinity chromatography, we isolated a 55-kDa lung cell-surface protein that selectively binds to the GFE-1 peptide. Protein sequencing established the identity of the receptor as membrane dipeptidase (MDP), a cell-surface zinc metalloprotease involved in the metabolism of glutathione, leukotriene D4, and certain beta -lactam antibiotics. Phage particles displaying the GFE-1 peptide selectively bind to COS-1 cells transfected with the murine MDP cDNA. Moreover, the synthetic GFE-1 peptide could inhibit MDP activity. By establishing MDP as the receptor for the GFE-1 peptide, our results suggest potential applications for both MDP and the GFE-1 peptide in delivery of compounds to the lungs. This work also demonstrates that cell-surface proteases can be involved in tissue-specific homing.

    INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

Phage display libraries are used to obtain defined peptide sequences interacting with a particular molecule (1-5). We recently used phage display libraries to select in vivo for peptides capable of homing to the vasculature of a given organ or tissue (6-8). This approach consists of intravenously injecting a phage library into a mouse, allowing the phage to circulate in vivo, and then collecting phage bound to the vascular bed of interest. By using this strategy, we identified phage-displayed peptides capable of homing to the vasculature of brain, kidney, lung, skin, pancreas, intestine, uterus, adrenal gland and prostate1 (6, 7). We also identified peptides that selectively home to blood vessels of experimental tumors in nude mice (8). When coupled to the anti-cancer drug doxorubicin, these tumor-homing peptides enhanced the efficacy of doxorubicin against human breast cancer xenografts and reduced its overall toxicity (8).

There are many reports of tissue-specific interactions between blood cells and endothelial cells. Most of the cases studied at a molecular level involve lymphocyte homing and are generally mediated by classical cell-cell adhesion molecules (9). Another example of vascular bed-specific recognition is the preference of metastasizing tumor cells for certain organs (10, 11). In the lung, several vascular receptors mediate adhesion of metastatic cells. For example, Elble et al. (12) showed that lung endothelial cell adhesion molecule-1, an endothelial surface protein with sequence homology to chloride channels, mediates adhesion of malignant melanoma cells to lung endothelium. The same group also showed that a protease, lung endothelial dipeptidyl peptidase IV, is responsible for homing of metastatic breast and prostate carcinoma cells to lung (13). These results suggest that organ-selective homing can be mediated by molecules that are not necessarily classical cell adhesion molecules. Our identification by in vivo phage display of peptides homing selectively to the vasculature of all the organs we have tested so far provides further evidence for the widespread molecular heterogeneity of the endothelium and offers tools to understand vascular bed-specific interactions at a molecular level.

We recently reported the identification of several lung-homing peptides (7). These phage-displayed peptides were selected for their ability to home to mouse lung vasculature within 5 min after an intravenous injection. We used several peptide phage libraries in our screens, such as CX3CX3CX3C, CX6C, and CX7C (C indicates cysteine; X indicates any amino acid). One of the most potent lung-homing phage was isolated from the CX3CX3CX3C library. This phage, CGFECVRQCPERC (GFE-1),2 displays a 13-amino acid peptide potentially containing two disulfide bonds. This GFE-1 phage shows more than 35-fold selectivity in lung homing relative to a control phage. Homing of the GFE-1 phage was blocked by the cognate peptide. Immunohistochemical studies performed on tissues of mice intravenously injected with the GFE-1 phage showed strong phage staining in the alveolar capillaries of the lung, whereas mice injected with the same amount of a control phage showed no staining. Mice injected with the GFE-1 phage showed no staining in skin, kidney, brain, heart, muscle, lymph nodes, pancreas, intestine, and uterus. Interestingly, another lung-homing peptide, CGFELETC (GFE-2), was isolated in an independent screen and shares the tripeptide "GFE" motif with GFE-1 (7). The phage displaying the GFE-2 peptide was also found to bind to lung microvasculature, and its homing to lung was inhibited by the GFE-1 peptide. These results led us to conclude that GFE-1 and GFE-2 peptides both bind to the same receptor and that this receptor is selectively expressed in lung vasculature.

In the present study, our objective was to isolate the receptor for the GFE-1 peptide. By using affinity chromatography, we isolated a 55-kDa cell-surface protein from lung that selectively binds to the GFE-1 peptide. The purified protein was shown to be membrane dipeptidase (MDP, reviewed in Ref. 14). GFE-1 and the GFE-2 peptides showed specific binding to cells transfected with MDP. In addition, the GFE-1 peptide shares sequence homology to natural MDP substrates and inhibits membrane dipeptidase activity.

    EXPERIMENTAL PROCEDURES
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

Materials-- BALB/c mice were purchased from Harlan Sprague-Dawley (San Diego, CA). Frozen rat lungs were from Pel-Freez Biologicals (Rogers, AR). The K91Kan bacterial strain and fd-tet phage were gifts from G. Smith (1). Bovine serum albumin was from Intergen (Purchase, NY). Dulbecco's modified Eagle's medium (DMEM) was from Irvine Scientific (Santa Ana, CA). Fetal calf serum was purchased from Tissue Culture Biologicals (Tulare, CA). Cell strainers (70 µM pore) were from Becton Dickinson (Franklin Lake, NJ). Units for concentration of protein solutions (Centricon 10,000 molecular weight cut-off columns) were purchased from Amicon (Beverly, MA). CNBr-activated Sepharose 4B was obtained from Pharmacia Biotech (Uppsala, Sweden). N-Octyl-beta -D-glucopyranoside was purchased from Calbiochem. Sulfo-NHS-LC-Biotin was purchased from Pierce. Pre-cast polyacrylamide 4-12% gradient gels were from Novex (San Diego, CA). Polyvinylidene difluoride membranes for protein transfer were purchased from Millipore (Bedford, MA). Streptavidin-horseradish peroxidase was from Pierce. The ECL chemiluminescence system was from NEN Life Science Products. Peptides were synthesized by Anaspec (San Jose, CA). The RNA purification kit was from Qiagen (Santa Clarita, CA). The first strand cDNA synthesis kit and Taq polymerase were from Life Technologies, Inc. DNA restriction enzymes and T4 DNA ligase were from New England Biolabs (Beverly, MA). The pcDNA3 expression vector was from Invitrogen (Carlsbad, CA). Transfection of the COS-1 cells was done with the Superfect Reagent from Qiagen (Santa Clarita, CA). Gly-D-Phe, D-Phe, D-amino acid oxidase (type I), peroxidase (type VI), flavin adenine dinucleotide (FAD), p-hydroxyphenylacetic acid, aprotinin, leupeptin, phenylmethylsulfonyl fluoride (PMSF), and collagenase V were all from Sigma.

Phage Binding on Primary Cells-- BALB/c mice were anesthetized with 0.017 ml/g of Avertin (15). Under deep anesthesia, the mice were perfused through the heart with 10 ml of DMEM. The lungs, kidneys, and brain were then collected, minced, placed in 2 ml of DMEM containing 0.5% bovine serum albumin and 0.5 µg/ml collagenase V, and incubated at 37 °C for 25 min. Following collagenase treatment, the tissue was forced through a 70 µM pore cell strainer. The filtered cells were washed once with 10 ml of DMEM supplemented with 10% serum. The phage particles used in the binding assay were amplified and purified, and the phage-displayed inserts were sequenced as described previously (1, 16). To ensure an equal input of the different phage to be tested, phage were titered several times using K91Kan bacteria (1, 16). For the binding reaction, 109 transducing units (TU) of phage were incubated with 5 × 106 cells in 1 ml of DMEM supplemented with 10% serum. The binding was performed at 4 °C for 2 h with gentle agitation. After the binding reaction, the cells were washed four times with 1 ml of DMEM supplemented with 10% serum at room temperature for 5-10 min each time. The cell pellet was resuspended in 100 µl of DMEM and transferred to a new tube. The phage bound to the cells were rescued by adding 1 ml of K91Kan bacterial culture (1, 16) and incubating at room temperature for 30 min. The bacteria were then diluted in 10 ml of LB culture media supplemented with 0.2 µg/ml tetracycline and incubated for another 30 min at room temperature. Serial dilutions of this bacterial culture were plated on LB plates containing 40 µg/ml tetracycline. Plates were incubated at 37 °C overnight before counting colonies (TU).

In Vivo Biotinylation of Endothelial Cell-surface Proteins-- In vivo biotinylation was performed as described previously (17), but with several modifications. BALB/c mice were anesthetized with Avertin and perfused slowly through the heart for 10-15 min with approximately 15 ml of PBS containing 0.5 mg/ml sulfo-NHS-LC-biotin. Well perfused lungs or control tissues such as brain were then collected and incubated on ice for 20 min. The tissues were then homogenized as described below.

Preparation of Lung Extracts-- The lungs from mouse or rat were first minced and then homogenized with a Brinkman homogenizer (Brinkman; Wesbury, NY) in a minimal volume (2.5 ml/g of tissue) of cold PBS containing 100 mM N-octyl-beta -D-glucopyranoside, 1 mM PMSF, 20 µg/ml aprotinin, and 1 µg/ml leupeptin (PBS/octyl glucoside). The homogenized tissue was incubated on ice for 2 h and then centrifuged at 12,000 × g for 30 min to remove cell debris. For larger extracts (100 rat lungs), the pellet was extracted again with a minimal volume of PBS/octyl glucoside. The pooled supernatants were cleared of any debris and used immediately for affinity chromatography.

GFE-1 Peptide Affinity Chromatography-- The peptide affinity chromatographies were performed according to the general principles established by Pytela et al. (18, 19) for the isolation of integrins by RGD peptide chromatography. All steps were performed at 4 °C. Briefly, the GFE-1 or control peptides were coupled to CNBr-activated Sepharose 4B according to the manufacturer's instructions. The matrix contained approximately 2 mg/ml peptide. The biotin-labeled extract from 2 mouse lungs was applied to 500 µl of the affinity matrix (3 ml of affinity matrix was used for the larger unlabeled rat lung extract) equilibrated in column buffer (PBS containing 50 mM octyl glucoside and 1 mM PMSF). The extract was applied to the column, and the flow-through was re-applied over a period of 90 min. The column was then washed with 20 volumes of column buffer. Elution with the synthetic GFE-1 peptide was carried out by slowly washing the column over a period of 1 h with 2 volumes of column buffer supplemented with 1 mg/ml GFE-1 peptide. The remaining proteins bound to the column were eluted with 8 M urea. The eluates were dialyzed against column buffer and concentrated 5-fold using a Centricon 10,000 molecular weight cut-off column. Aliquots of each elution were then separated by SDS-PAGE. For the experiments done with biotin-labeled extracts, the proteins were transferred to a polyvinylidene difluoride membrane, blotted with streptavidin-horseradish peroxidase, and developed with the ECL chemiluminescence system. For the large scale preparation of MDP from 100 rat lungs, the proteins were directly detected by Coomassie staining on a fixed gel.

Protein Sequencing-- Sequence analysis of a tryptic digest of the rat 55-kDa protein was performed at the Harvard University Microchemistry Facility (Boston) by microcapillary reverse phase high pressure liquid chromatography tandem mass spectrometry (µLC/MS/MS) on a Finnigan LCQ quadrupole ion trap mass spectrometer.

Membrane Dipeptidase Assay-- The membrane dipeptidase assay and the fluorimetric detection of D-Phe were performed exactly as described by Heywood and Hooper (20). Briefly, the samples were first incubated at 37 °C for 3 h with the MDP substrate Gly-D-Phe (1 mM). The released D-Phe was then converted to 6,6'-dihydroxy-(1,1'-biphenyl)-3,3'-diacetic acid in the presence of D-amino acid oxidase and peroxidase (20). The fluorescence was measured using an fmax fluorescence microplate reader from Molecular Devices (Sunnyvale, CA).

Cloning of Murine MDP cDNA in pcDNA3 Expression Vector-- Total mouse lung RNA was isolated using Qiagen RNA purification columns and subjected to first strand cDNA synthesis with reverse transcriptase and a mixture of random hexamers and poly(dT) oligonucleotides. Mouse MDP cDNA was amplified from the cDNA pool by polymerase chain reaction using the following oligonucleotide pair: CCGCTGGTACCGCAGATCCCTGGGGACCTTG (modified to contain a KpnI adaptor) and TCTTTCTAGAGCTCAGAGAGCACTGGAGGAG (modified to contain an XbaI adaptor). The amplified 1.3-kilobase pair fragment was digested with KpnI and XbaI and inserted into the same sites of the pcDNA3 expression vector. Successful cloning of the murine MDP cDNA was confirmed by DNA sequencing.

Phage Binding on COS-1 Cells Transfected with MDP-- The COS-1 cell line was transiently transfected using the Superfect Reagent (Qiagen) as recommended by the manufacturer. Briefly, 107 COS-1 cells were transfected with 10 µg of either the MDP expression vector or the vector alone. After 48 h, cells were scraped gently from the dish, washed once, and subjected to the phage binding assay or membrane dipeptidase activity assay described above. For the phage binding assay, 5 × 106 cells and 1010 TU of phage input were used. For measurement of membrane dipeptidase activity, 106 cells were lysed in 100 µl of PBS/octyl glycoside without protease inhibitors. A 10-µl aliquot of this extract was used to measure MDP activity.

    RESULTS
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

The GFE-1 Phage Binds to Lung Primary Cells-- We reported previously that the GFE-1 phage binds to mouse lung vasculature when injected in vivo (7). We first sought to determine if binding of the GFE-1 phage to lung in vivo could be reconstituted in vitro by performing a phage binding assay on lung primary cells. Fig. 1A shows that primary lung cells bound about 60-fold more GFE-1 phage than insertless fd-tet phage. The binding of the GFE-1 phage to kidney cells was also higher than fd-tet binding (t test, p < 0.02). However, this binding was much lower than the GFE-1 binding on lung cells. In our previous in vivo studies, we detected no specific phage homing to kidney when the GFE-1 phage was injected intravenously (7). The GFE-1 phage showed no specific binding to primary brain cells.


View larger version (26K):
[in this window]
[in a new window]
 
Fig. 1.   Binding of the GFE-1 phage to primary cells. A, primary cells isolated from mouse lung, kidney, and brain were incubated in the presence of equal amounts of the fd-tet phage (black bars) or GFE-1 phage (dotted bars). Phage bound to the cells were rescued by infection with K91Kan bacteria. The total number of phage-transducing units recovered is shown. B, lung primary cells were incubated with the fd-tet phage (black bars) or the GFE-1 phage (dotted bars) in the absence or presence of 150 µM of the GFE-1 peptide or the control GRGESP peptide. The total number of transducing units recovered is shown. Error bars indicate standard deviation of the mean from triplicate platings.

The GFE-1 phage binding to lung cells was inhibited by almost 70% in the presence of 150 µM of GFE-1 peptide, whereas the same concentration of a control peptide (GRGESP) had no effect (Fig. 1B). The nonspecific binding of the fd-tet phage was not affected by the presence of GFE-1 or control peptides. These results demonstrate that the selective in vivo binding of the GFE-1 peptide to lung endothelium that we described previously (7) can be reconstituted in an in vitro assay on total lung primary cells. Therefore, whole lung cell extracts contain sufficient amounts of GFE-1 receptor for isolation.

The GFE-1 Peptide Binds a 55-kDa Surface Protein-- To detect only the cell-surface molecules that bind to the GFE-1 peptide, we biotinylated mouse lung endothelial surface proteins in vivo before preparing a total lung extract. The labeled extract was first fractionated on a GFE-1 peptide affinity column; the column was washed, and bound proteins were eluted with a GFE-1 peptide solution. Fig. 2 (left panel) shows that a 55-kDa biotinylated protein is selectively eluted by the GFE-1 peptide. Prior to elution, the washes from the column showed no detectable biotinylated proteins; subsequent addition of 8 M urea eluted many biotinylated proteins that were retained nonspecifically in the column. We detected no proteins in the 55-kDa range after performing the same procedure on a control peptide (GRGESP) column (Fig. 2, right panel). As an additional control, we fractionated a biotinylated brain cell extract through a GFE-1 peptide column under the same conditions. No biotinylated proteins from this extract specifically bound to the GFE-1 peptide column (data not shown). These results suggest that the GFE-1 peptide specifically binds to a 55-kDa lung vascular surface protein. As shown in Fig. 3, the 55-kDa protein migrated as a 110-kDa band under non-reducing conditions, suggesting that the protein is a disulfide-linked homodimer.


View larger version (30K):
[in this window]
[in a new window]
 
Fig. 2.   A 55-kDa cell-surface protein from lung extracts binds specifically to a GFE-1 peptide affinity column. An in vivo biotinylated lung extract was fractionated on a GFE-1 peptide column or on a control peptide column (GRGESP). The columns were washed and then subjected to elution with the GFE-1 peptide. Aliquots (30 µl) from the wash fraction (-), GFE-1 peptide elution, and 8 M urea elution were resolved by SDS-PAGE under reducing conditions. Molecular mass markers (in kDa) are indicated on the right side of each panel.


View larger version (26K):
[in this window]
[in a new window]
 
Fig. 3.   The 55-kDa protein forms a dimer under non-reducing SDS-PAGE. An aliquot (20 µl) of the GFE-1 peptide eluate from the GFE-1 peptide affinity column shown in Fig. 2 was resolved by SDS-PAGE under non-reducing conditions. The molecular mass markers (in kDa) are shown in lane 1, and the GFE-1 peptide eluate is shown in lane 2.

The 55-kDa GFE-1 Receptor Is Membrane Dipeptidase-- The GFE-1 phage can selectively target rat lung blood vessels when injected in the circulation.3 To purify a larger amount of the 55-kDa protein than could be obtained from mouse tissues, we prepared a non-biotinylated extract from 100 rat lungs and fractionated this extract on a GFE-1 peptide affinity column. A 55-kDa protein (detected by Coomassie Blue staining) was eluted from the column by the GFE-1 peptide (data not shown). This protein, which co-migrated with the 55-kDa surface protein isolated from mouse lung, was subjected to tryptic digestion and sequenced by mass spectrometry as described under "Experimental Procedures." Two peptides (YPDLIAELLR and TTPVIDGHNDLPWQMLTLFNNQLR) showed complete identity with rat membrane dipeptidase (EC 3.4.13.19), also known as microsomal dipeptidase, dehydropeptidase-1, or MDP. Several other peptide sequences indicated the presence of rat IgG in the sample. Contamination of the sample with IgG is expected at this molecular weight range, given the abundance of IgG in an extract from unperfused lungs.

Depending on the species, the molecular mass of MDP ranges from 48 to 59 kDa. MDP is a plasma membrane glycosylphosphatidylinositol-anchored glycoprotein (reviewed in Ref. 14), which, consistent with our observations (Figs. 2 and 3), forms a disulfide-linked homodimer (21). MDP is a zinc metalloprotease expressed mainly in lung and the kidney brush border. It is involved in the metabolism of glutathione, leukotrienes, and certain beta -lactam antibiotics (14).

To confirm that MDP is the GFE-1 peptide-binding protein, we tested if the 55-kDa protein has membrane dipeptidase activity. Samples from the affinity chromatography wash fraction and the GFE-1 peptide eluate (Fig. 2) were incubated in the presence of the specific MDP substrate Gly-D-Phe (14, 20), and the level of D-Phe produced was measured. Fig. 4 shows a time course of the conversion of D-Phe into a fluorescent compound in those samples. The wash fraction showed only a base-line level of fluorescence. In contrast, the GFE-1 peptide eluate contained high membrane dipeptidase activity as illustrated by the time-dependent conversion of D-Phe. The GFE-1 peptide eluate isolated from the rat lung extract also showed strong MDP activity (data not shown). As expected, we could detect MDP activity in the total lung extract. The specific activity was about 600-fold higher for the GFE-1 peptide eluate (200 nmol D-Phe/min/mg) than for the total rat lung extract (0.34 nmol D-Phe/min/mg).


View larger version (12K):
[in this window]
[in a new window]
 
Fig. 4.   Time course of the fluorimetric detection of D-Phe produced by the hydrolysis of Gly-D-Phe. Samples from the wash fraction (open circle ) and the GFE-1 peptide eluate (), of the GFE-1 peptide affinity column, were assayed for MDP activity with a Gly-D-Phe substrate. The time-dependent conversion of D-Phe into a fluorescent compound is shown.

The GFE-1 and GFE-2 Phage Bind to Cells Transfected with MDP-- The COS-1 cell line, which is known to have low or no detectable level of MDP activity, has been used extensively to study MDP structure and function (14, 22). As shown in Fig. 5A, COS-1 cells transfected with murine MDP showed at least 15-fold higher MDP activity than mock-transfected cells. We tested if the GFE-1 phage could bind to COS-1 cells transfected with MDP. Fig. 5B shows that the GFE-1 phage bound 4-fold more to the MDP-transfected cells than to the mock-transfected cells. As controls, the fd-tet phage and a skin-homing phage (CVALCREACGEGC, shp-1) displaying a peptide with structural features similar to those of the GFE-1 peptide (7) showed no specific binding to cells expressing MDP, compared with mock-transfected cells. In our previous report on the characterization of several lung-homing phage, we proposed that the GFE-1 and GFE-2 peptides share the same receptor (7). Fig. 5B shows that the GFE-2 phage binds to MDP-transfected cells; the binding was weaker than the GFE-1 binding, but this is in agreement with the in vivo lung homing data we reported previously (7). The binding of both GFE-1 and GFE-2 phage to MDP-transfected cells could be completely inhibited by the GFE-1 peptide (data not shown).


View larger version (21K):
[in this window]
[in a new window]
 
Fig. 5.   Binding of the GFE-1 and GFE-2 phage on COS-1 cells expressing MDP. A, COS-1 cells were transfected with the MDP expression vector or the vector alone. Two days after the transfection, cell extracts were prepared and analyzed for MDP activity. B, COS-1 cells transfected with either the MDP expression vector or the vector alone were subjected to a binding assay in the presence of equal amounts of either the fd-tet, skin-homing (shp-1), GFE-1, or GFE-2 phage. In each case, the total number of phage transducing units rescued from these cells is shown. Error bars indicate standard deviation of the mean from triplicate platings.

The GFE-1 Peptide Inhibits MDP Activity-- The metabolism of the tripeptide glutathione involves cleavage by gamma -glutamyl transpeptidase to form glutamate and cysteinyl-glycine (Cys-Gly). The dipeptide Cys-Gly is then recognized and cleaved by MDP, which can cleave only dipeptides. Interestingly, the amino acid sequence of glutathione is similar to the N-terminal portion of the GFE-1 peptide; the first two amino acids of the GFE-1 peptide are Cys and Gly. Given this homology, we asked if the GFE-1 peptide could inhibit the hydrolysis of Gly-D-Phe by MDP. Fig. 6 shows that the GFE-1 peptide inhibits the hydrolysis of the Gly-D-Phe substrate (0.5 mM) in a dose-dependent manner. Another cyclic peptide (CARAC) did not inhibit the enzyme. These results suggest that the GFE-1 peptide can act as a competitive inhibitor of MDP.


View larger version (13K):
[in this window]
[in a new window]
 
Fig. 6.   Inhibition of MDP activity by the GFE-1 peptide. Extracts from MDP-expressing COS-1 cells were assayed for MDP activity in the presence of increasing concentrations of either the GFE-1 peptide () or CARAC control peptide (open circle ).


    DISCUSSION
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

Our aim in the present study was to isolate the receptor for a peptide that homes to lung vasculature. We show here the isolation from a whole lung cell extract of a single molecule with the ability to bind the GFE-1 peptide. Proof that this surface molecule is MDP is based on the following evidence. (i) The mobility of the purified protein under reducing and non-reducing conditions is similar to MDP. (ii) Protein sequencing showed identity with MDP. (iii) Using a specific assay, the GFE-1 peptide-binding protein was shown to have MDP activity. (iv) We could detect binding of the GFE-1 phage on cells transfected with MDP. The GFE-2 phage, known from our previous experiments to share the GFE-1 receptor (7), also bound to MDP-expressing cells. Finally, (v) the GFE-1 peptide has sequence similarity with known substrates of MDP and could inhibit MDP enzymatic activity.

Although MDP expression can be detected in several tissues, it is expressed mainly in the lung and kidney (14). In the mouse, four distinct MDP mRNAs are present and they are differentially expressed in several organs (23). Organ-specific differences in the nature and extent of pig MDP N-linked glycosylation have also been reported (24). In the kidney, MDP expression is concentrated in the brush border region of the proximal tubules, and in the lung, MDP expression has been reported on the epithelial cells of the conducting airways, epithelial cells of the alveolar ducts, capillaries, and the basement membrane of alveoli and terminal bronchioles (23, 25). MDP expression has also been observed on the endothelial cells of submucosal microvessels in the human trachea (26). The level of MDP activity was shown to be highest in the lung (27, 28).

Injecting the GFE-1 phage into the mouse circulation results in rapid binding of the phage to lung microvasculature with some diffuse staining on neighboring alveolar epithelial cells (7). The same results were obtained by injecting the GFE-1 phage into rats.3 The pronounced expression of MDP in the lung correlates with the strong lung homing of the GFE-1 phage. We postulate that in our in vivo experiments, the GFE-1 phage could not access and bind the MDP present on the brush border of the kidney proximal tubules because we injected the phage into the bloodstream and assayed for it a few minutes after injection. However, the weak but significant binding of the GFE-1 phage to kidney primary cells in vitro that we observed in the present study (Fig. 1) may be due to binding of the GFE-1 phage to the MDP present in the kidney. These results illustrate an interesting characteristic of in vivo phage display; it selects for molecules that are specific for a given vascular bed but may be expressed by other types of cells in a manner that is not tissue-specific.

Because Cys-Gly is a natural substrate for MDP, it is possible that the GFE-1 peptide inhibits MDP enzymatic activity by binding to the active site of MDP through its N-terminal Cys-Gly residues. The GFE-1 peptide would not be hydrolyzed because MDP can cleave only dipeptides. Interestingly, the GFE-2 (CGFELETC) lung-homing phage also contains the Cys-Gly dipeptide in its N terminus, suggesting that these residues are important for MDP binding. We previously showed that homing of the GFE-2 phage to the lung can be inhibited by the GFE-1 peptide, suggesting that they share the same receptor (7). However, the MDP-binding properties of these two phage cannot be solely attributed to the Cys-Gly dipeptide, because the GFE-1 peptide homes more efficiently to the lung than GFE-2. The inhibition of MDP activity by the GFE-1 peptide demonstrates the ability of in vivo peptide phage display to select for peptides that bind to functional sites in the target molecule. This property of peptide phage display has been observed previously by our group when screening for integrin- or fibronectin-binding peptides in vitro (4, 29, 30). In these studies, most of the isolated peptides bound to integrins, inhibited cell adhesion (29), and contained an RGD integrin-binding motif (30). Conversely, a peptide isolated by biopanning on fibronectin was shown to be a functional mimic of an RGD-binding site on integrins (4). The tendency of peptides to bind to functionally important regions of their target proteins differs from antibodies and may be an advantage in some situations.

Dipeptidyl peptidase IV (CD26) has been identified as a lung endothelial surface molecule involved in lung metastasis of breast cancer cells (13). Recently, the fibronectin present on the surface of the metastatic cells was shown to be the ligand for dipeptidyl peptidase IV-dependent homing of the breast cancer cells to lung vasculature (31). The involvement of dipeptidyl peptidase IV in homing of tumor cells to the lung parallels our identification of MDP as the receptor for the GFE-1 lung-homing peptide. MDP and dipeptidyl peptidase IV are different proteins with no structural similarity, but their related peptidase activities indicate a selective requirement for peptidase activities in the lung endothelium. MDP is the first receptor identified for our phage that detect specialization in vascular beds (6-8). As receptors for additional vascular homing peptides are identified, the molecular basis of tissue-specific vascular specialization will become better understood.

    ACKNOWLEDGEMENTS

We thank R. Pasqualini, W. Arap, J. Hoffman, and J. T. Pai for helpful comments and discussions.

    FOOTNOTES

* This work was supported in part by Grants CA 74238 and CA 78804 to (E. R.) and the Cancer Center support Grant CA 30199.The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

Dagger Research fellow of the National Cancer Institute of Canada supported with funds provided by the Terry Fox Run.

§ To whom correspondence should be addressed: The Burnham Institute, 10901 N. Torrey Pines Rd., La Jolla, CA 92037. Tel.: 619-646-3125; Fax: 619-646-3198; E-mail: ruoslahti{at}burnham-inst.org.

1 W. Arap, R. Pasqualini, D. Rajotte, and E. Ruoslahti, unpublished observations.

3 D. Rajotte and E. Ruoslahti, unpublished observations.

    ABBREVIATIONS

The abbreviations used are: GFE-1, CGFECVRQCPERC; GFE-2, CGFELETC; PBS, phosphate-buffered saline; MDP, membrane dipeptidase; DMEM, Dulbecco's modified Eagle's medium; CNBr, cyanogen bromide; MS, mass spectrometry; TU, transducing units; PMSF, phenylmethylsulfonyl fluoride.

    REFERENCES
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES
  1. Smith, G. P., and Scott, J. K. (1993) Methods Enzymol. 217, 228-257[Medline] [Order article via Infotrieve]
  2. Burritt, J. B., Bond, C. W., Doss, K. W., and Jesaitis, A. J. (1996) Anal. Biochem. 238, 1-13[CrossRef][Medline] [Order article via Infotrieve]
  3. Koivunen, E., Wang, B., Dickinson, C. D., and Ruoslahti, E. (1994) Methods Enzymol. 245, 346-369[Medline] [Order article via Infotrieve]
  4. Pasqualini, R., Koivunen, E., and Ruoslahti, E. (1995) J. Cell Biol. 130, 1189-1196[Abstract/Free Full Text]
  5. Wrighton, N. C., Farrell, F. X., Chang, R., Kashyap, A. K., Barbone, F. P., Mulcahy, L. S., Johnson, D. L., Barrett, R. W., Jolliffe, L. K., and Dower, W. J. (1996) Science 273, 458-464[Abstract]
  6. Pasqualini, R., and Ruoslahti, E. (1996) Nature 380, 364-366[CrossRef][Medline] [Order article via Infotrieve]
  7. Rajotte, D., Arap, W., Hagedorn, M., Koivunen, E., Pasqualini, R., and Ruoslahti, E. (1998) J. Clin. Invest. 102, 430-437[Medline] [Order article via Infotrieve]
  8. Arap, W., Pasqualini, R., and Ruoslahti, E. (1998) Science 279, 377-380[Abstract/Free Full Text]
  9. Salmi, M., and Jalkanen, S. (1997) Adv. Immunol. 64, 139-218[Medline] [Order article via Infotrieve]
  10. Auerbach, R., Lu, W. C., Pardon, E., Gumkowski, F., Kaminska, G., and Kaminski, M. (1987) Cancer Res. 47, 1492-1496[Abstract/Free Full Text]
  11. Johnson, R. C., Augustin-Voss, H. G., Zhu, D. Z., and Pauli, B. U. (1991) Cancer Res. 51, 394-399[Abstract/Free Full Text]
  12. Elble, R. C., Widom, J., Gruber, A. D., Abdel-Ghany, M., Levine, R., Goodwin, A., Cheng, H.-C., and Pauli, B. U. (1997) J. Biol. Chem. 272, 27853-27861[Abstract/Free Full Text]
  13. Johnson, R. C., Zhu, D. Z., Augustin-Voss, H. G., and Pauli, B. U. (1993) J. Cell Biol. 121, 1423-1432[Abstract/Free Full Text]
  14. Keynan, S., Hooper, N. M., and Turner, A. J. (1996) in Zinc Metalloproteases in Health and Disease (Hooper, N. M., ed), pp. 285-309, Taylor & Francis Ltd., London
  15. Gardner, D. J., Davis, J. A., Weina, P. J., and Theune, B. (1995) Lab. Anim. Sci. 45, 199-204[Medline] [Order article via Infotrieve]
  16. Pasqualini, R., Arap, W., Rajotte, D., and Ruoslahti, E. (1999) in Phage Display of Proteins and Peptides (Barbas, C., Burton, D., Silverman, G., and Scott, J., eds), Cold Spring Harbor Laboratory, Cold Spring Harbor, NY, in press
  17. De La Fuente, E. K., Dawson, C. A., Nelin, L. D., Bongard, R. D., McAuliffe, T. L., and Merker, M. P. (1997) Am. J. Physiol. 272, L461-L470[Abstract/Free Full Text]
  18. Pytela, R., Pierschbacher, M. D., and Ruoslahti, E. (1985) Cell 40, 191-198[CrossRef][Medline] [Order article via Infotrieve]
  19. Pytela, R., Pierschbacher, M. D., Argraves, S., Suzuki, S., and Ruoslahti, E. (1987) Methods Enzymol. 144, 475-489[Medline] [Order article via Infotrieve]
  20. Heywood, S. P., and Hooper, N. M. (1995) Anal. Biochem. 226, 10-14[CrossRef][Medline] [Order article via Infotrieve]
  21. Keynan, S., Habgood, N. T., Hooper, N. M., and Turner, A. J. (1996) Biochemistry 35, 12511-12517[CrossRef][Medline] [Order article via Infotrieve]
  22. Keynan, S., Hooper, N. M., and Turner, A. J. (1997) Biochem. J. 326, 47-51
  23. Habib, G. M., Barrios, R., Shi, Z. Z., and Lieberman, M. W. (1996) J. Biol. Chem. 271, 16273-16280[Abstract/Free Full Text]
  24. Hooper, N. M., Cook, S., Laine, J., and Lebel, D. (1997) Biochem. J. 324, 151-157
  25. Inamura, T., Pardridge, W. M., Kumagai, Y., and Black, K. L. (1994) Prostaglandins Leukot. Essent. Fatty Acids 50, 85-92[CrossRef][Medline] [Order article via Infotrieve]
  26. Yamaya, M., Sekizawa, K., Terajima, M., Okinaga, S., Ohrui, T., and Sasaki, H. (1998) Respir. Physiol. 111, 101-109[CrossRef][Medline] [Order article via Infotrieve]
  27. Hirota, T., Nishikawa, Y., Tanaka, M., Igarashi, T., and Kitagawa, H. (1986) Eur. J. Biochem. 160, 521-525[Medline] [Order article via Infotrieve]
  28. Habib, G. M., Shi, Z. Z., Cuevas, A. A., Guo, Q., Matzuk, M. M., and Lieberman, M. W. (1998) Proc. Natl. Acad. Sci. U. S. A. 95, 4859-4863[Abstract/Free Full Text]
  29. Koivunen, E., Wang, B., and Ruoslahti, E. (1995) Bio/Technology 13, 265-270[CrossRef][Medline] [Order article via Infotrieve]
  30. Ruoslahti, E. (1996) Annu. Rev. Cell Dev. Biol. 12, 697-715[CrossRef][Medline] [Order article via Infotrieve]
  31. Chen, H.-C., Abdel-Ghany, M., Elble, R. C., and Pauli, B. U. (1998) J. Biol. Chem. 273, 24207-24215[Abstract/Free Full Text]


Copyright © 1999 by The American Society for Biochemistry and Molecular Biology, Inc.



This article has been cited by other articles:


Home page
J. Biol. Chem.Home page
R. Robert, M.-J. Jacobin-Valat, D. Daret, S. Miraux, A. T. Nurden, J.-M. Franconi, and G. Clofent-Sanchez
Identification of Human scFvs Targeting Atherosclerotic Lesions: SELECTION BY SINGLE ROUND IN VIVO PHAGE DISPLAY
J. Biol. Chem., December 29, 2006; 281(52): 40135 - 40143.
[Abstract] [Full Text] [PDF]


Home page
FASEB J.Home page
Z. Li, R. Zhao, X. Wu, Y. Sun, M. Yao, J. Li, Y. Xu, and J. Gu
Identification and characterization of a novel peptide ligand of epidermal growth factor receptor for targeted delivery of therapeutics
FASEB J, December 1, 2005; 19(14): 1978 - 1985.
[Abstract] [Full Text] [PDF]


Home page
ChestHome page
Y. Oh, I. Mohiuddin, Y. Sun, J. B. Putnam Jr, W. K. Hong, W. Arap, and R. Pasqualini
Phenotypic Diversity of the Lung Vasculature in Experimental Models of Metastases
Chest, December 1, 2005; 128(6_suppl): 596S - 600S.
[Abstract] [Full Text] [PDF]


Home page
ChestHome page
Y. Oh, I. Mohiuddin, Y. Sun, J. B. Putnam Jr, W. K. Hong, W. Arap, and R. Pasqualini
Phenotypic Diversity of the Lung Vasculature in Experimental Models of Metastases
Chest, December 1, 2005; 128(6_suppl): 596S - 600S.
[Abstract] [Full Text] [PDF]


Home page
CirculationHome page
L. Zhang, J. A. Hoffman, and E. Ruoslahti
Molecular Profiling of Heart Endothelial Cells
Circulation, September 13, 2005; 112(11): 1601 - 1611.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Pathol.Home page
V. J. Yao, M. G. Ozawa, M. Trepel, W. Arap, D. M. McDonald, and R. Pasqualini
Targeting Pancreatic Islets with Phage Display Assisted by Laser Pressure Catapult Microdissection
Am. J. Pathol., February 1, 2005; 166(2): 625 - 636.
[Abstract] [Full Text] [PDF]


Home page
CirculationHome page
B.-S. Ding, Y.-J. Zhou, X.-Y. Chen, J. Zhang, P.-X. Zhang, Z.-Y. Sun, X.-Y. Tan, and J.-N. Liu
Lung Endothelium Targeting for Pulmonary Embolism Thrombolysis
Circulation, December 9, 2003; 108(23): 2892 - 2898.
[Abstract] [Full Text] [PDF]


Home page
J. Gen. Virol.Home page
H.-C. Wu, M.-Y. Jung, C.-Y. Chiu, T.-T. Chao, S.-C. Lai, J.-T. Jan, and M.-F. Shaio
Identification of a dengue virus type 2 (DEN-2) serotype-specific B-cell epitope and detection of DEN-2-immunized animal serum samples using an epitope-based peptide antigen
J. Gen. Virol., October 1, 2003; 84(10): 2771 - 2779.
[Abstract] [Full Text] [PDF]


Home page
Antimicrob. Agents Chemother.Home page
R. E. Benson, E. B. Gottlin, D. J. Christensen, and P. T. Hamilton
Intracellular Expression of Peptide Fusions for Demonstration of Protein Essentiality in Bacteria
Antimicrob. Agents Chemother., September 1, 2003; 47(9): 2875 - 2881.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
H.-C. Cheng, M. Abdel-Ghany, and B. U. Pauli
A Novel Consensus Motif in Fibronectin Mediates Dipeptidyl Peptidase IV Adhesion and Metastasis
J. Biol. Chem., June 27, 2003; 278(27): 24600 - 24607.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
M. Koolpe, M. Dail, and E. B. Pasquale
An Ephrin Mimetic Peptide That Selectively Targets the EphA2 Receptor
J. Biol. Chem., November 27, 2002; 277(49): 46974 - 46979.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
M. E. Akerman, W. C. W. Chan, P. Laakkonen, S. N. Bhatia, and E. Ruoslahti
Nanocrystal targeting in vivo
PNAS, October 1, 2002; 99(20): 12617 - 12621.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
M. G. Kolonin, R. Pasqualini, and W. Arap
Teratogenicity induced by targeting a placental immunoglobulin transporter
PNAS, October 1, 2002; 99(20): 13055 - 13060.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
M. Essler and E. Ruoslahti
Molecular specialization of breast vasculature: A breast-homing phage-displayed peptide binds to aminopeptidase P in breast vasculature
PNAS, February 19, 2002; 99(4): 2252 - 2257.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
W. Arap, W. Haedicke, M. Bernasconi, R. Kain, D. Rajotte, S. Krajewski, H. M. Ellerby, D. E. Bredesen, R. Pasqualini, and E. Ruoslahti
Targeting the prostate for destruction through a vascular address
PNAS, February 5, 2002; 99(3): 1527 - 1531.
[Abstract] [Full Text] [PDF]


Home page
Appl. Environ. Microbiol.Home page
H.-C. Wu, C.-T. Yeh, Y.-L. Huang, L.-J. Tarn, and C.-C. Lung
Characterization of Neutralizing Antibodies and Identification of Neutralizing Epitope Mimics on the Clostridium botulinum Neurotoxin Type A
Appl. Envir. Microbiol., July 1, 2001; 67(7): 3201 - 3207.
[Abstract] [Full Text] [PDF]


Home page
HypertensionHome page
S. J. White, S. A. Nicklin, T. Sawamura, and A. H. Baker
Identification of Peptides That Target the Endothelial Cell-Specific LOX-1 Receptor
Hypertension, February 1, 2001; 37(2): 449 - 455.
[Abstract] [Full Text] [PDF]


Home page
CirculationHome page
S. A. Nicklin, S. J. White, S. J. Watkins, R. E. Hawkins, and A. H. Baker
Selective Targeting of Gene Transfer to Vascular Endothelial Cells by Use of Peptides Isolated by Phage Display
Circulation, July 11, 2000; 102(2): 231 - 237.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Rajotte, D.