![]()
|
|
||||||||
J Biol Chem, Vol. 274, Issue 17, 11679-11686, April 23, 1999
§,
,
,
,
, and
From
INSERM U.488, Lab hormones, 94276, Le
Kremlin-Bicêtre Cedex, France, ¶ INSERM U.142, Hôpital
St Antoine, 75571, Paris Cedex 12, France, and
INSERM U.327,
Faculté de Médecine Xavier Bichat, 75870, Paris Cedex 18, France
| |
ABSTRACT |
|---|
|
|
|---|
In vivo, insulin-like
growth factor-binding protein-1 (IGFBP-1) modulates the IGFs'
bioavailability and may contribute to their delivery to peripheral
tissues. In rat and human hepatocytes, glucocorticoids stimulate
IGFBP-1 gene transcription through homologous glucocorticoid response
units (GRU). Transfection experiments have shown that one of these,
GRU2 (nucleotide (nt) Insulin-like growth factor-binding protein-1
(IGFBP-1)1 belongs to a
family of six related proteins that bind the IGFs (IGF-I and -II) with
high affinity and thus modulate their bioavailability both in the serum
and in extracellular fluids, inhibit or potentiate their actions and
possibly confer tissue specificity (1, 2) (also reviewed in Ref.
3).
In vivo, serum IGFBP-1 is thought to play an important role
in the short term modulation of IGFs' bioavailability. Accordingly, its abundance is rapidly regulated and may vary by more than 10-fold in
normal subjects (4). In addition, perfusion studies point out a role
for circulating IGFBP-1 to deliver IGFs to peripheral tissues (5).
During the perinatal period and in adults, serum IGFBP-1 is primarily
synthesized in hepatocytes (6-9). In vivo and in
vitro, the hepatic production of IGFBP-1 is regulated by multiple
factors (glucocorticoids, cAMP agonists, insulin, and growth hormone)
(10-12) and appears to be correlated to the abundance of its mRNA;
IGFBP-1 transcripts increase after glucocorticoid treatment and in
diabetic animals and decrease after insulin treatment (13-15).
Regulation of IGFBP-1 and of its mRNA by glucocorticoids, cAMP, and
insulin have also been observed in rat (H4II) and human (HepG2)
hepatoma cell lines (16-20). In these cell lines, as well as in
hepatocytes, the modulation of IGFBP-1 gene expression has been shown
to be regulated at the transcriptional level (13, 14, 21), and
accordingly, hormone response elements (HREs) have been identified in
both rat and human IGFBP-1 5'-flanking sequences (19, 20, 22-25).
One glucocorticoid response unit (GRU2 hereafter) is highly homologous
in the human and rat IGFBP-1 promoters. It consists of a composite
cis-element, in which the glucocorticoid response element
(GRE) and the insulin response element (IRE) are closely intricated
(22-25) and interact with the glucocorticoid receptor (GR) and with
liver-enriched trans-acting factors, respectively (23,
26-28).
Transfection experiments have shown that the rat GRU2, but not its
human counterpart, is on its own able to mediate the glucocorticoid response (23-25). A second GRE, located in a more remote 5'-position, is absolutely required for glucocorticoids to stimulate human IGFBP-1
promoter activity (22).
The different abilities of rat and human GRU2 to enhance IGFBP-1
promoter activity in transfected hepatoma cells was unexpected since
their nucleotide sequence is highly conserved between both species.
However a C to A transition (third base pair in the 3'-half of the
GREII imperfect palindrome) creates a GATC tetranucleotide in the rat
promoter (GCTC in the human GREII), a tetranucleotide that undergoes
deoxyadenosine methylation (N6 position of the adenine
residue; dam methylation hereafter) in most
Escherichia coli bacterial strains. In addition,
dam methylation of GRE imperfect palindromes that encompass
the GATC tetranucleotide confers responsiveness to glucocorticoids in
gene transfer experiments (29).
Because dam methylation does not occur in eucaryotic cells,
we wondered whether the ability of the transfected rat GRU2 to enhance
transcription in the presence of glucocorticoids could be due to its
methylation in dam+ E. coli strains. We thus compared the ability of the rat GRU2 propagated in dam+ and
dam Oligonucleotides--
The double-stranded oligonucleotides
consisted of rat (nt
In some instances, dam methylation of the unmethylated
rIGFBP-1-GRU2 was performed in vitro using recombinant
dam methylase (New England Biolabs) and
S+-adenosyl-methionine according to the manufacturer's instructions.
Plasmids--
Rat (nt
pRShGR Plasmid Preparation--
Large scale preparations of the
plasmids were obtained from E. coli HB101
(dam+)-transformed bacteria. A dam
mutant strain (JM110) (Stratagene) was also used to prepare
prIGFBP-1-GRU2 unmethylated at dam Methylation Analysis--
NdeI-XhoI DNA
fragments of 444 and 442 bp were excised from prIGFBP-1-GRU2 and
phIGFBP-1-GRU2, respectively and purified by agarose gel
electrophoresis. The fragments were restricted with MboI (10 units/µg DNA) (Roche Molecular Biochemicals) at 37 °C for 2 h. This enzyme recognizes GATC palindromes and cleaves exclusively the
unmethylated sequence (33). The restriction fragments were then
end-labeled with [ Cell Culture and Transfection--
Human hepatoma (HepG2) and
Chinese hamster ovary (CHO-IR) cells were grown in Dulbecco's modified
Eagle's medium. Rat H4II hepatoma cells were grown in Coon's F12. The
culture medium was supplemented with 10% (HepG2, CHO-IR cells) or 5%
(H4II cells) fetal calf serum, 2 mM
L-glutamine, and antibiotics (100 units/ml penicillin, 100 µg/ml streptomycin), and the cells were maintained in a humidified
atmosphere of 5% CO2 in air.
For transfection experiments, 5 × 105 CHO-IR or
106 HepG2 cells were plated into 60-mm Petri dishes the day
before, and the medium was renewed 3 h before transfection.
Co-transfection (10 µg of prIGFBP-1-GRU2 or of phIGFBP-1-GRU2, 1 µg
of pRSVLuc and 0.125-1 µg of pRShGR
CAT and luciferase activities were assayed according to standard
procedures (32, 35). CAT activities were always normalized relative to
those of luciferase (an internal monitor of transfection efficiency),
and the following CAT/luciferase ratios were used to compute the
glucocorticoid induction.
Preparation of Nuclear Extracts Containing hGR Electrophoretic Mobility Shift Assay (EMSA)--
The rat
(unmethylated or dam methylated) and human IGFBP-1-GRU2
(ds-oligonucleotides or inserts isolated from prIGFBP-1-GRU2 and from
phIGFBP-1-GRU2) were end-labeled by filling in using the Klenow
fragment of E. coli DNA polymerase I, and either
[
1 µl of crude nuclear extracts (1.71 or 3.80 pmol of BachGR
The radioactivity of the bands corresponding to both DNA-bound GR
(homodimer) and the free probe was quantified using an Instant Imager
(Packard Instrument Co.) or a Berthold linear analyzer.
When supershift experiments were to be performed, the 60-min incubation
at 25 °C was extended for an additional 20 min, after the addition
of a polyclonal anti-GR antibody in the reaction mixture (1 or 2 µl)
(40).
Southern Blot Analyses--
Genomic DNA was prepared from
confluent monolayers of H4II rat hepatoma cells, and 20-µg aliquots
were digested either by FokI (5 units/µg DNA) or by
MboI (5 units/µg DNA). The restriction fragments were
separated by agarose gel electrophoresis (2% agarose). The 340-bp
HindIII/SalI restriction fragment isolated from
phIGFBP-1-GRU2 (i.e. the human IGFBP-1 promoter) was run in
parallel as a positive control for hybridization. After
electrophoresis, the DNA was transferred to a nitrocellulose membrane
and hybridized (18 h, 68 °C) with a random-labeled probe that
encompassed 5'-flanking sequences from the human IGFBP-1 promoter (nt
The rat (nt
121 to
85 and nt
111 to
74 in human and
rat promoters, respectively), was on its own able to mediate the
glucocorticoid response in rat but not in human species (Suwanichkul,
A., Allander, S., Morris, S. L. & Powell, D. R. (1994)
J. Biol. Chem. 269, 30835-30841, Goswami, R., Lacson,
R., Yang, E., Sam, R. & Unterman, T. (1994) Endocrinology
134, 736-743, and Suh, D. S., Ooi, G. T. & Rechler, M. M. (1994) Mol. Endocrinol. 8, 794-805). A close comparison of GRU2 sequences has pointed out a C to A transition in the underlying GREII, which creates a GATC tetranucleotide in rat species. This tetranucleotide is submitted to adenosyl methylation (dam
methylation) in most Escherichia coli bacterial
strains, but not in eucaryotic cells. We showed (i) that on its own,
the unmethylated rat GRU2 (propagated in dam E. coli
strains) was inactive, as is the case for its human counterpart
(nonsignificant glucocorticoid inductions, 1.48 ± 0.23 and
1.7 ± 0.35-fold in Chinese hamster ovary cells, respectively) and
(ii) that its adenosyl methylation in standard dam+ bacterial strains yielded a functional GRU
(6.5 ± 1.1 and 13.1 ± 3.9-fold glucocorticoid inductions in
Chinese hamster ovary and HepG2 cells, respectively). Transient
transfection in HepG2 hepatoma cells clearly showed that the
interaction of liver-enriched trans-acting factor(s) with
the 5'-overlapping insulin response element does not enable the
unmethylated rat GRU2 or the human GRU2 to become responsive to
glucocorticoids (nonsignificant 2.21 ± 0.48 and 1.20 ± 0.06-fold induction, respectively). Furthermore, we have
correlated these functional data with in vitro
DNA-protein interaction studies: the dam methylated rat
GREII displayed a 2.8-fold higher affinity for the glucocorticoid
receptor than its unmethylated counterpart.
![]()
INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES
E. coli strains to
mediate the glucocorticoid response and showed that in the absence of
bacterial methylation, the rat GRU2 was unable to sustain a significant
glucocorticoid increase in promoter activity, as is the case for its
human counterpart. Furthermore, we correlated this differential
activity on transcription with the ability of the GR to interact with
the methylated or unmethylated rat GREII in vitro.
![]()
EXPERIMENTAL PROCEDURES
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES
111 to
74) and human (nt
121 to
85)
sequences from the IGFBP-1 promoter (i.e. encompassing the
GREII and IRE cis-elements; IGFBP-1-GRU2 hereafter). They
were flanked by HindIII (5'-) and SalI (3'-) cohesive ends. Sequences were as follows: hIGFBP-1-GRU2,
5'-(AGCT)TAGCAAAACAAACTTATTTTGAACACTCAGCTCCTAG(TCGA)-3'; unmethylated rIGFBP-1-GRU2,
5'-(AGCTT)AAGCAAAACAAACTTATTTTGAACACGGGGATCCTAGC(GTCGA)-3'; dam methylated rIGFBP-1-GRU2, upper strand,
5'-(AGCTT)AAGCAAAACAAACTTATTTTGAACACGGGGAmTCCTAGCG-3'; lower strand,
5'-(TCGAC)GCTAGGAmTCCCCGTGTTCAAAATAAGTTTGTTTTGCTTA-3'.
111 to
74) and human (nt
121 to
85) IGFBP-1-GRU2 were inserted as cohesive, double-stranded
oligonucleotides between the unique HindIII and
SalI restriction sites of pBLCAT2, an eucaryotic expression
vector in which CAT gene expression is directed by promoter sequences
(nt
105 to +51) of the herpes simplex virus thymidine kinase gene
(30). This yielded prIGFBP-1-GRU2 and phIGFBP-1-GRU2, respectively, the
sequences of which were checked by dideoxy sequencing.
, a hGR expression vector, and pRSVLuc, an ubiquitous and
constitutive luciferase expression plasmid (Rous sarcoma virus long
terminal repeat upstream of the luciferase cDNA) have been
previously described by Hollenberg et al. (31) and de Wet et al. (32), respectively.
methylation sites.
-32P]ATP in the presence of
T4-polynucleotide kinase. The digestion products were resolved by 12%
polyacrylamide gel electrophoresis and detected by autoradiography.
) was performed using calcium
phosphate-DNA co-precipitation (34). 24 h post-transfection, the
culture medium was replaced by serum-free Dulbecco's modified Eagle's
medium, and the cells were incubated for an additional 18 h in the
absence or presence of 10
6 M dexamethasone.
(Eq. 1)
--
Growth
and infection of Sf9 cells were performed as described
previously (36). 1 µM of triamcinolone acetonide was
added to the culture medium 1 h before harvesting cells, and crude
nuclear extracts were prepared under high ionic strength conditions
(36-38). The recombinant glucocorticoid receptor (BachGR
) recovered
in the crude nuclear extracts was analyzed for its molecular weight, and its ability to bind glucocorticoids was assessed by the
hydroxyapatite method (39). The binding capacities of the crude nuclear
extracts used hereafter were 3,800 pmol/ml (specific activity, 576 pmol/mg protein) or 1,710 pmol/ml (specific activity, 123 pmol/mg protein).
-32P]dATP or [
-33P]dATP and
[
-32P]dCTP or [
-33P]dCTP. The
radiolabeled IGFBP-1-GRU2 were purified by 12% polyacrylamide gel electrophoresis.
, as
estimated by steroid binding) was mixed with 2 µg of sonicated salmon
or herring sperm DNA (final volume, 12 µl) and incubated at 0 °C
for 15 min. 32P- or 33P-labeled rat or human
IGFBP-1-GRU2 (final concentrations, cf. legends to Figs. 6
and 7) was then added alone or with a 6-120-fold molar excess of
unlabeled competitor oligonucleotide (TAT-GREII, unmethylated or
dam methylated rat IGFBP-1-GRU2 or human IGFBP-1-GRU2). The
final reaction mixture (18 µl: 20 mM Tris-HCl, pH = 7.4, 2.2 mM Hepes, 1 mM EDTA, 40-60
mM NaCl, 0.125 mM MgCl2, 4 mM dithiothreitol, 10% glycerol, 0.05% bovine serum
albumin) was incubated for an additional 60 min at 25 °C, then
analyzed on a 5% nondenaturing polyacrylamide gel run in recirculating
0.25× TBE at 0-4 °C. Gels were dried and DNA-protein interactions
were visualized by autoradiography (1 h).
340 to +1; 69% sequence similarity with the rat IGBP-1 promoter)
(specific activity, 2.7 × 106 cpm/ng; 3 × 106 cpm/ml hybridization buffer). After two washes (15 min
at room temperature then 15 min at 50 °C) in 2× SSC, 0.1% SDS, the
membranes were analyzed using an Instant Imager (Packard Instrument
Co.).
![]()
RESULTS
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES
111 to
74) and human (nt
121 to
85) GRU2 are
composite cis-elements, in which both the GRE and the IRE
(Fig. 1A) are crucial for
promoter activity to be enhanced by glucocorticoids (22-25). On the
basis of transfection experiments, Goswami et al. (23) and
Suh et al. (25) have reported that the rat GRU2 is functional on its own (23-25). This is in contrast with the data reported by Suwanichkul et al. (22) for the human GRU2; it
is inactive by itself (22). This discrepancy would imply that the human
and rat promoters are not functionally homologous with regard to the
glucocorticoid response, despite high sequence similarity between the
two GRUs. The IRE (100% of sequence similarity between the rat and
human IGFBP-1 promoters) cannot account for this discrepancy (Fig.
1A). On the contrary the GREIIs differ by 4 bp; two are localized in the 3-bp spacer that separates the half-palindromes, the
two others are at positions +1 and +3 (A to G and C to A transitions, respectively) (Fig. 1B). Both positions are contacted by the
glucocorticoid receptor (GR), one of which (+3) is essential for high
affinity GR-GRE interaction (reviewed in Ref. 41). Interestingly, the C
to A transition (+3) creates a GATC tetranucleotide in the rat GREII
(boxed in Fig. 1B). This sequence is methylated on the
adenosine residue (N6 position) in most E. coli
strains and such dam methylation has been shown to generate
artificial GREs (29).

View larger version (38K):
[in a new window]
Fig. 1.
Sequence similarities between the human and
rat GRUs, and comparison with the consensus GRE
cis-element. A, alignment of the human
(nt
121 to
85) and rat (nt
111 to
74) IGFBP-1 promoter
sequences that were inserted 5' to the thymidine kinase promoter.
Colons point to conserved nucleotides. The GREs are
boxed (italics, the two halves of the GREs'
imperfect palindromes), and the two moieties (A and
B) of the IREs are underlined. B,
human IGFBP-1 GRE (nt
102 to
88) and homologous sequences from the
rat IGFBP-1 promoter (nt
92 to
78), comparison with the perfectly
palindromic (bold) and with the consensus (italic
and boxed) GRE cis-elements. Colons
point to conserved nucleotides between the rat and the human IGFBP-1
GREs and the palindromic GRE. Dots mean that the
corresponding base pair in the rat IGFBP-1 GRE belongs to the correct
series of nucleotides (purine or pyrimidine), when compared with the
consensus GRE. Asterisks represent nucleotide conservation
between rat and human GREs. The functional role of individual
nucleotides in GR-GRE interaction (reviewed in Ref. 41) is recalled
above the perfectly palindromic GRE. R, Y, and
N stand for purine, pyrimidine, and any nucleotide,
respectively.
The Rat Proximal GREII Is Methylated When prIGFBP-1-GRU2 Is
Propagated in dam+ E. coli Strains--
prIGFBP-1-GRU2 was
propagated in either dam
(JM110) or
dam+ (HB101) E. coli
strains. In each case, the NdeI-XhoI fragment
(444 bp) was excised, purified, then restricted with MboI,
an enzyme that cleaves exclusively the unmethylated GATC sequence, and
the restriction fragments were end-labeled (Fig.
2). When excised from prIGFBP-1-GRU2
propagated in JM110 the NdeI-XhoI fragment was
cleaved by MboI and yielded 172-, 157-, 92-, and 23-bp bands (Fig. 2). These bands were generated by enzymatic cleavage at the three
available GATC sequences (one located in the 3'-half-palindrome of rat
GREII sequences, the other two being localized in pBLCAT2 vector DNA).
On the contrary, when prIGFBP-1-GRU2 was propagated in HB101, the
NdeI-XhoI fragment remained uncleaved after
MboI digestion. These results demonstrated that the adenine
residue at position +3 of the rat GREII was methylated when
prIGFBP-1-GRU2 was propagated in a dam+
E. coli strain.
|
dam Methylation Is Responsible for the Ability of the Rat GREII to
Mediate Glucocorticoid Responsiveness in Mammalian Cells--
When
prIGFBP-1-GRU2 was prepared from the widely used HB101 E. coli strain (dam+), then
co-transfected in CHO cells with an expression vector encoding the
human GR, the rat GRU2 increased CAT reporter gene expression by
6.50 ± 1.05-fold in the presence of glucocorticoids in the
culture medium. GRU2 was thus able to enhance transcription from the
heterologous thymidine kinase promoter (Fig.
3, A and B,
GAmTC). On the contrary, when prIGFBP-1-GRU2 was prepared
from a dam
bacterial strain (JM110), the
hormonal inducibility of CAT reporter gene expression was completely
abolished; the slight difference in CAT activities between untreated
and dexamethasone-treated cells (1.48 ± 0.23-fold) was not
statistically significant (Fig. 3, A and B,
GATC). These results allowed the conclusions that only the
dam methylated prIGFBP-1-GRU2 mediated significant
glucocorticoid induction and that such a hormonal inducibility was
dependent on adenosyl methylation of the GATC motif of the rat GREII.
As a matter of fact, glucocorticoid induction was not obtained with phIGFBP-1-GRU2 (vide infra), which does not contain any GATC
in the human GREII but encompasses the GATCs present in pBLCAT2 DNA, the latter being methylated after propagation in the HB101
(dam+) E. coli strain (the
NdeI-XhoI fragment excised from phIGFBP-1-GRU2 was not restricted by MboI; Fig. 2).
|
When such co-transfection experiments were performed in the presence of
varying amounts of pRShGR
(range 0.125 to 1 µg), the magnitude of
glucocorticoid effect was dose-dependent, pointing to GR
dependence and was always greater in the dam methylated series (Fig. 4).
|
Because the rat GRU2 encompasses an IRE that, as is the case for its
human counterpart (27), interacts with liver-specific trans-acting factors (26), we wondered whether these factors would cooperate with the GR and thus allow glucocorticoid inducibility from the unmethylated rat GREII in cells from hepatic origin. To
address this question, prIGFBP-1-GRU2 was prepared from
dam+ or dam
E. coli strains, then co-transfected with pRShGR
in
HepG2 human hepatoma cells (Fig. 5). In
this cell line, the glucocorticoid-induced increase in CAT reporter
gene expression was observed when the dam methylated
prIGFBP-1-GRU2 was used as a reporter plasmid (13.3 ± 3.9-fold)
(Fig. 5, A and B, GAmTC). In
contrast, when prIGFBP-1-GRU2 had been prepared from
dam
bacteria, the slight difference in CAT
activities (dexamethasone versus vehicle; 2.21 ± 0.48-fold) was not statistically significant (Fig. 5, A and
B, GATC).
|
The Human GREII Is not Functional in CHO and HepG2 Cells--
The
human GREII is also degenerated, compared with the consensus GRE
sequence (Fig. 1B). When inserted upstream of the
heterologous thymidine kinase promoter in phIGFBP-1-GRU2, and
co-transfected with pRShGR
in either CHO (which do not contain
liver-enriched trans-acting factors) or HepG2 cells, it
turns out to be unable to mediate any glucocorticoid response
(1.70 ± 0.35 and 1.02 ± 0.06-fold induction in CHO and
HepG2 cells, respectively) (Figs. 3 and 5; A and
B, GCTC).
Altogether, these data show that the human GRU2 is thus functionally homologous to the unmethylated rat GRU2 (the actual methylation status of the rat GRU2 in vivo; cf. results below and under "Discussion").
dam Methylation of the GATC Motif of the Rat GREII Increases Its
Affinity toward the GR--
Unmethylated or dam methylated
rIGFBP-1-GRU2 were excised from prIGFBP-1-GRU2
(HindIII-SalI restriction fragments) that had been propagated in dam
or
dam+ E. coli strains,
respectively. They were end-labeled and incubated with crude nuclear
extracts prepared from Sf9 cells overexpressing hGR
.
Both unmethylated or dam methylated rIGFBP-1-GRU2 yielded
identical patterns in EMSA, with one retarded band, (GR)2,
corresponding to GR homodimers (Fig.
6A). That (GR)2
corresponded to bona fide GR-GRE interactions was concluded
from two additional observations. This band was extinguished in the
presence of unlabeled TAT-GREII in the incubation mixture (25-fold
molar excess) and was super-shifted in the presence of anti-GR antibody
(Fig. 6A).
|
When rat GRU2 ds-oligonucleotides were used in EMSA, the intensity of
the (GR)2 band was increased 3.74-fold when the rat GREII
had previously been dam methylated in vitro using
recombinant dam methylase (Fig. 6B, left
panel, lanes GATC; Fig. 6C, left panel, lanes GATC). The intensity of the
(GR)2 band was also increased by 2.72-fold when the rat
GRU2 was excised from dam methylated versus
unmethylated prIGFBP-1-GRU2 (i.e. propagated in
dam+ and dam
strains of
E. coli, respectively) (Fig. 6B, right
panel; and Fig. 6C, right panel).
EMSAs were also carried out with a 32P-labeled rat GRU2
oligonucleotide that had been synthesized in its dam
methylated form, introducing a N6-methyl-adenine
instead of an adenine within the GATC tetranucleotide (Eurogentec).
Competition experiments were performed in the presence of 6-120-fold
molar excesses either of the homologous oligonucleotide or of
unmethylated rat GRU2 or of human GRU2. In the presence of the
homologous nucleotide 50% competition (EC50) was achieved in the presence of a 33.8-fold molar excess of unlabeled competitor (Fig. 7, A, top
row; and B). Competition was 2.78 times less efficient in the presence of unmethylated rat GRU2 (EC50 of 94.2-fold
molar excess) (Fig. 7, A, middle row; and
B).
|
That the affinity of the GR for the rat GRU2 was increased after
dam methylation could also be inferred from the further
observation that
sham
dam methylation of the human
GRU2 oligonucleotide (devoid of GATC tetranucleotide in the GREII)
in vitro (i.e. using recombinant dam
methylase) did not yield any significant increase in the amount of
GR-GRE complexes (Fig. 6, B and C; middle
panels). Moreover, competition experiments in EMSA showed that the
affinity of the human GRU2-GR interaction was close to that observed
for the unmethylated rat GRU2 and was 1.94 times lower than that of dam methylated rat GRU2 (EC50 of 65.5-fold molar
excesses)(Fig. 7, A, middle row; and
B).
The Rat GREII Is not Methylated in Vivo--
To check what the
functional status of the rat GRU2 in vivo, we examined
whether or not the GATC tetranucleotides were methylated at the IGFBP-1
locus. H4II rat hepatoma cells, an IGFBP-1-producing cell line in which
IGFBP-1 gene expression is stimulated by glucocorticoids, was used as a
model system (18). Genomic DNA was prepared from H4II cells, digested
either by FokI alone or by FokI and
MboI, then run on agarose gel. The human IGFBP-1 promoter
(nt
340 to +1; an internal standard for hybridization efficiency) was
run in parallel on the same gel (Fig. 8,
lane 1). The restriction fragments and the hIGFBP-1 promoter
fragment were analyzed by Southern blotting, using a
32P-labeled probe that encompassed the human IGFBP-1
promoter (nt
340 to +1). FokI cleaves IGFBP-1 genomic DNA
in the 5'-flanking sequences (between nt
755 and
754) and in exon 1 (between nt +133 and +134), and a restriction fragment of 887-bp was
indeed obtained by Southern blot analyses (Fig. 8, lane 2).
MboI cleaves twice the IGFBP-1 gene in the promoter region
(between nt
155/
154 and
82/
81), exclusively if the GATCs are
unmethylated. If such is the case in H4II hepatoma cells, restriction
by both FokI and MboI should yield three
fragments of 600 (nt
754 to
155), 72 (nt
154 to
82), and 215 (nt
81 to +133) bp. However, under our experimental conditions
(stringency of the washes necessary to get rid of nonspecific
hybridizations, length of the overlap between the restriction fragment
and the probe), only the 600-bp fragment, which overlaps 187-bp
fragment of the random-labeled probe, should be detectable on the blot.
As can be seen on Fig. 8 (lane 3) the 887-bp fragment
observed after FokI digestion was detected no more after
digestion of H4II genomic DNA by FokI and MboI.
Moreover, digestion by FokI and MboI yielded
a 600-bp fragment. These results strongly support the conclusion
that the GATCs (including that of GREII) were unmethylated at the
IGFBP-1 locus in IGFBP-1-expressing H4II hepatoma cells.
|
| |
DISCUSSION |
|---|
|
|
|---|
The 340-bp fragment upstream of rat and human IGFBP-1 genes' cap sites constitute highly tissue-specific promoters that encompass both liver-specific (HNF1, HNF3, DBP) (9, 26-28, 42, 43) and ubiquitous (GRE, CRE, HMGI) cis-elements. These are required for efficient gene transcription in hepatocytes (9, 42, 44), and for strict hormonal regulation of IGFBP-1 gene expression (19, 20, 22-25).
In rat and human IGFBP-1 promoters, the GRU and cAMP response units, respectively, consist of overlapping cis-elements; one of these corresponds to the hormone response element (GRE or CRE), and the other(s) to the recognition sequence(s) for liver-specific trans-acting factors (HNF3 and DBP) (26-28).
The rat and human IGFBP-1 promoters contain three GREs; GREI, the most
5'-GRE, spans nt
186 to
172 (rat) and nt
198 to
173 (human),
GREII overlaps the insulin response element (rat, nt
91 to
77;
human,
110 to
84), and GREIII maps either in the 5'-untranslated
sequences of the transcript (rat, nt +41 to + 56) or close to the cap
site (human, nt
52 to
25). However, progressive 5'-truncations of
the rat and human IGFBP-1 promoters yielded discrepant functional
results in transient transfection experiments. Deletion of the human
promoter sequences located upstream of nt
140 (i.e.
eliminating GREI) abolished promoter stimulation by dexamethasone.
Accordingly, an internal deletion or mutation of GREI sequences within
the 1.2-kilobase promoter fragment, led to the inability of
dexamethasone to enhance transcription (22). By contrast, truncation of
the rat promoter to nt
154 and even
92 (just 5' to GREII) does not
abolish the ability of dexamethasone to stimulate promoter activity
(23, 25). This may result from low versus high affinity GR
binding to the human and rat GREII, respectively. As a matter of fact,
replacement of GREII by the rat tyrosine aminotransferase GREII (a
potent GRE) in human IGFBP-1 promoter sequences yielded glucocorticoid responsiveness, whether GREI was mutated or not (22).
Rat and human IGFBP-1-GREIIs differ by 4 bp and one of these, a C to A transition at position +3, generates a GATC tetranucleotide in the 3'-half palindrome of the rat GREII. This sequence is a target for the bacterial dam methylase, and previous studies have shown that its adenosyl methylation in standard dam+ strains used for large scale preparation of reporter plasmids, may alter promoter and/or enhancer activity when these plasmids are used in transient transfection experiments in eucaryotic cells. For instance, the HNF1 cis-element of the rat albumin promoter contains a GATC sequence, and its function is abolished when methylated in dam+ bacterial strains (45). Conversely, artificial steroid hormone response elements (GRE/PRE) are created by dam methylation (29), and adenine methylation at dam sites has been shown to increase transient gene expression in plant cells (46).
In this study, we demonstrate that the functional status of the rat IGFBP-1-GREII is also dependent on N6-adenine (dam) methylation of its GATC tetranucleotide. Even though the unmethylated rat IGFBP-1-GREII does not mediate any significant glucocorticoid stimulation of reporter gene expression in transient transfection experiments, its adenosyl methylation in standard dam+ bacterial strains yielded a functional GRE. The unmethylated rat GREII thus behaves as the human IGFBP-1-GREII (GCTC instead of GATC), which, per se, is unable to mediate any glucocorticoid induction, irrespective of the dam phenotype of the bacterial strain.
These functional data are supported by DNA-protein interaction studies; dam methylation of the rat GREII increases its affinity by ~3-fold for the glucocorticoid receptor. This is probably related to the fact that the methyl group at position N6 of adenine can mimic the 5'-methyl group of the thymine (i.e. establish hydrophobic interaction with residue Val-482 of the glucocorticoid receptor) (47) and enables strong specific interaction of the GR with the major groove, although the positions of these methyl groups differ in the major groove (29). Also in agreement with the functional data is the ~2 times lower affinity of the human GREII (relative to that of the dam methylated rat GREII) for the glucocorticoid receptor; it is close to that measured for the unmethylated rat GREII.
As far as we are aware, dam methylation has only been detected in bacteria (e.g. cyanobacteria and in the group of related families of Enterobacteriaceae, e.g. E. coli, Parvobacteriaceae, and Vibrionaceae) (48) and has never been reported in vertebrates. In mammalian cells, genomic DNA is methylated at the 5th position of the cytosine residue in CpG dinucleotides. This is the only chemical modification that genomic DNA allows under physiological conditions (for review, see Ref. 49), and such CpG methylation may cause promoters and/or enhancers to be oblivious to transcription factors, as is the case for the silent allele of imprinted genes (for recent reviews, see Refs. 50 and 51).
In this connection, our results clearly show that the GATC tetranucleotides are not methylated at the rat IGFBP-1 locus in H4II rat hepatoma cells, a cell line that expresses IGFBP-1, and in which its expression is regulated by glucocorticoids (22). The lack of dam methylation of the endogenous IGFBP-1 promoter region strongly supports the conclusion that, in vivo, the rat GREII is not by itself able to enhance IGFBP-1 gene expression in the presence of glucocorticoids and thus behaves as its human homologue.
Altogether these data may explain the functional discrepancy previously noticed between rat and human species (22, 23, 25), and allow speculation that in both species, the promoters are functionally homologous with regard to the glucocorticoid response.2
Finally, our data clearly show that the interaction of liver-enriched
trans-acting factor (HNF3 and/or DBP) with the
5'-overlapping IRE cis-element does not enable the
unmethylated rat GRU2 or the human GRU2 to become responsive to
glucocorticoids and thus does not allow the GR to form committed rapid
start complexes with the basal transcriptional machinery (for review
see Ref. 52).
| |
ACKNOWLEDGEMENTS |
|---|
We are indebted to Elie Winter for help in EMSA studies and to Krzysztof Rajkowski for critical reading of the manuscript.
| |
FOOTNOTES |
|---|
* This work was supported by the Association pour la Recherche contre le Cancer (ARC) and the Ligue Française contre le Cancer and the European Economic Community (Human capital and Mobility, contract No. CHRX-CT-94-00556).The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
§ To whom correspondence should be addressed: INSERM U.488, 80 rue du Général Leclerc, 94276, Le Kremlin-Bicêtre Cedex France. Fax: 33-1-45-21-19-40; E-mail: groyer{at}kb.inserm.fr.
2 G. Schweizer-Groyer, work in progress.
| |
ABBREVIATIONS |
|---|
The abbreviations used are: IGFBP-1, insulin-like growth factor-binding protein-1; GRU, glucocorticoid response unit; IGF, insulin-like growth factor; HRE, hormone response element; GRE, glucocorticoid response element; IRE, insulin response element; GR, glucocorticoid receptor; nt, nucleotide(s); bp, base pair(s); CAT, chloramphenicol acetyltransferase; EMSA, electrophoretic mobility shift assay; ds, double-stranded; CHO, Chinese hamster ovary.
| |
REFERENCES |
|---|
|
|
|---|
This article has been cited by other articles: