![]()
|
|
||||||||
J Biol Chem, Vol. 274, Issue 17, 11782-11788, April 23, 1999
, andFrom the Departments of Pediatrics, Cell Biology, and Physiology, Washington University School of Medicine, Division of Gastroenterology and Nutrition, Children's Hospital, St. Louis, Missouri 63110
| |
ABSTRACT |
|---|
|
|
|---|
Factor H, a secretory glycoprotein composed of 20 short consensus repeat modules, is an inhibitor of the complement
system. Previous studies of inherited factor H deficiency revealed
single amino acid substitutions at conserved cysteine residues, on one allele arginine for cysteine 518 (C518R) and on the other tyrosine for
cysteine 941 (C941Y) (Ault, B. H., Schmidt, B. Z., Fowler, N. L., Kashtan, C. E., Ahmed, A. E., Vogt, B. A.,
and Colten, H. R. (1997) J. Biol. Chem. 272, 25168-25175). To ascertain if the phenotype, impaired secretion of
factor H, is due to the C518R substitution or the C941Y substitution
and to ascertain the mechanism by which secretion is impaired, we
studied COS-1 and HepG2 cells transfected with wild type and several
mutant factor H molecules. The results showed markedly impaired
secretion of both C518R and C941Y factor H as well as that of factor H
molecules bearing alanine or arginine substitutions at the
Cys518-Cys546 disulfide bond (C518A, C546A,
C546R, C518A-C546A). In each case, mutant factor H was retained in the
endoplasmic reticulum and degraded relatively slowly as compared with
most other mutant secretory and membrane proteins that are retained in
the endoplasmic reticulum. These data indicate that impaired secretion
of the naturally occurring C518R and C941Y mutant factor H proteins is due to disruption of framework-specific disulfide bonds in factor H
short consensus repeat modules.
Complement factor H (2, 3), a regulatory protein of the
alternative pathway of complement activation, inhibits the formation and accelerates the decay of the alternative pathway C3 convertase (C3bBb). It serves as a cofactor for the C3b-cleaving enzyme complement factor I (4). Factor H also has chemotactic activity for monocytes (5)
and may perform functions related to interaction with extracellular matrix and leukocytes (6, 7).
Factor H is a single-chain serum glycoprotein with nine potential sites
for asparagine-linked carbohydrates (8) and a total carbohydrate
composition of 9-18% (3). It is a prototype of proteins with modular
structure (9) consisting of a tandem array of homologous units, called
short consensus repeats
(SCRs),1 each about 60 amino
acid residues in length (8). These structures have been recognized in
12 complement proteins and many noncomplement proteins including
blood-clotting factor XIIIb, the Genetic deficiency of factor H has been described in domesticated
animals (15) and in humans (16-23). Patients with homozygous factor H
deficiency develop recurrent bacterial infections (including Nesseria sp.), vasculitis, and/or glomerulonephritis. The
molecular basis for factor H deficiency has so far only been
investigated in one patient, a child with glomerulonephritis (1). In
skin fibroblasts from this patient there is an impairment in secretion of the large, 155-kDa form of factor H, while the small, 45-kDa form of
factor H is secreted normally. The mutant factor H is retained in the
endoplasmic reticulum (ER) of these cells. Analysis of the factor H
cDNA sequence in the patient revealed single nucleotide substitutions on each allele: C518R substitution that affects the
residue in the Cys2 position of SCR 9 on one allele and a C941Y substitution changing the Cys2 position of SCR 16 on
the other allele. These mutations affect SCR units that are not present in the small form of factor H, thereby providing an explanation for
impaired secretion of the large but not the small form.
In the present study, we used site-directed mutagenesis to generate
several specific mutant factor H molecules. The fate of these mutants
was examined in transfected COS-1 and HepG2 cells to determine whether
impaired secretion in factor H deficiency is caused by either the C518R
substitution or the C941Y substitution or both and whether the
mechanism by which these mutants are retained in the ER involves the
specific amino acid substitutions or disruption of the associated
disulfide bond.
Isolation of a Full-length Factor H cDNA Clone--
A normal
human liver cDNA library in Lambda Zap II (Stratagene, La Jolla,
CA) provided by Dr. Rick Wetsel (24) was screened with a 1.4 kilobase
pair cDNA probe (H-19, provided by Dr. Dennis Hourcade, Washington
University, St. Louis, MO), which spans the nucleotide sequence from
the first half of SCR 1 to the end of SCR 7 (25). A full-length clone
(HL-2) was isolated and sequenced.
Site-directed Mutagenesis and Plasmid Constructs--
Five
mutants were constructed using the overlap polymerase chain reaction
strategy (26). The following oligonucleotide pairs were used for
mutagenesis: for mutant C518R
TCATAGTCTAGAGTGTCATTCAGCTTAAACCA and
CACTCTAGACTATGAACGCCATGATGGTTATGAA; for mutant
C518A TCATAGTCTAGAGTGTCATTCAGCTTAAACCA and
CACTCTAGACTATGAAGCCCATGATGGTTATGAAAGC; for
mutant C546R TATGGGTAGATCTGACCAACCATTGTAACC and
GTCAGATCTACCCATACGTTATGAAAGAGAATGCGAA; for
mutant C546A TATGGGTAGATCTGACCAACCATTGTAACC and
GTCAGATCTACCCATAGCTTATGAAAGAGAATGCGAA; for
C518A-C546A TATGGGTAGATCTGACCAACCATTGTAACC and
GTCAGATCTACCCATAGCTTATGAAAGAGAATGCGAA (missense
mutations are underlined, and silent mutations introducing XbaI or BglII restriction enzyme sites are in
boldface type). Oligonucleotides AACATCAGGATCAATTAGATGTGGGAAAGAT and
CCTTATGTTAGAATTATGATCGAATTCCTT were used as flanking primers and
for the second round amplifications of each mutant. Polymerase chain
reaction products were ligated into HL-2 using BbrPI and
BfrI restriction sites. For expression studies, the wild
type and mutant factor H cDNA constructs were ligated into the
mammalian expression vector pcDNA I/Amp (Invitrogen, Carlsbad, CA).
One mutant, the C941Y mutant, was generated by reverse
transcription-polymerase chain reaction using as template RNA from the
patient with factor H deficiency (1). The resulting clone spanned the
sequence from SCR 7 to the 3'-untranslated region and carried the C941Y
mutation in SCR 16. A fragment carrying G2949A mutation was ligated
into the expression vector containing the wild type factor H sequence
using StuI and NcoI restriction sites. Each
mutant was subjected to DNA sequence analysis on both strands by the
dideoxynucleotide method.
Cell Culture and Transfection--
A skin fibroblast cell line
from the factor H-deficient patient was described previously (1).
Normal primary adult human fibroblasts (GM8399), HepG2 cells (human
hepatocellular carcinoma cell line), and COS-1 cells (African green
monkey kidney cells) were obtained from the human genetic repository
(NIGMS, National Institutes of Health, Camden, NJ). All cell lines were
maintained in growth medium, Dulbecco's modified Eagle's medium with
10 mM HEPES, 2 mM L-glutamine, and
10% heat-inactivated fetal bovine serum (Life Technologies, Inc.) at
37 °C in humidified air with 5% CO2. Fibroblasts were
not used after passage 12. Cells were plated in growth medium
supplemented with 100 units/ml penicillin and 100 µg/ml streptomycin
(Life Technologies) in six-well tissue culture plates (NUNC, Roskilde,
Denmark) the day before biosynthetic labeling. HepG2 cells were
transfected with Lipofectin (Life Technologies) according to the
manufacturer's instructions. COS-1 cells were transfected using the
DEAE-dextran method (27) and were replated in six-well plates on the
first day post-transfection.
Pulse and Pulse-Chase Labeling--
Fibroblasts or transfected
cells were washed twice with warm Hanks' balanced salt solution and
incubated for the pulse period in Dulbecco's modified Eagle's medium
without methionine (Life Technologies) containing
L-glutamine, HEPES, penicillin/streptomycin, and 10%
dialyzed FBS (HyClone, Logan, UT) and supplemented with 250-500
µCi/ml of TRAN35S (ICN Radiochemicals, Irvine, CA;
specific activity of 1199 Ci/mmol). At the end of the pulse period, the
labeling medium was removed, and cells were washed twice with warm
Hanks' balanced salt solution and incubated in growth medium
supplemented with penicillin/streptomycin. At timed intervals, the
medium was removed, and the cell monolayer was washed twice with
Hanks' balanced salt solution and lysed by one freeze-thaw cycle in
lysis buffer, PBS containing 0.5% sodium deoxycholate (Fisher), 1%
(w/v) Triton X-100 (Sigma), 10 mM EDTA (Sigma), 2 mM phenylmethylsulfonyl fluoride (Sigma), and 100 µg/ml
leupeptin (Boehringer Mannheim). Cell lysates and media were clarified
by centrifugation (13,000 × g for 10 min). The incorporation of radioactive amino acids into newly synthesized proteins was measured by trichloroacetic acid (Sigma) precipitation.
Immunoprecipitation and SDS-PAGE--
Precleared samples were
immunoprecipitated with excess goat antibody to human factor H
(INCSTAR, Stillwater, MN). Sheep anti-human factor H serum (Binding
Site, San Diego, CA) was used for immunoprecipitation from HepG2 cells.
Immunocomplexes were collected with an excess of Immunoprecipitin (Life
Technologies), suspended in immunoprecipitation wash solution, PBS, 1%
SDS, 1% Triton X-100, 0.5% sodium deoxycholate, containing 1% bovine
serum albumin (fraction V; ICN Radiochemicals), washed as described by
Kulics et al. (28), and then subjected to SDS-PAGE analysis
in a 6 or 7% acrylamide gel under reducing conditions (29). After
Immunoprecipitin became unavailable, a preparation of protein G bearing
group C Streptococcus sp. cells (Sigma) was used. Gels were
subjected to fluorography on Kodak MR film (Eastman Kodak Co.) at
Glycosidase Digestion--
Immunoprecipitated material was
incubated overnight at 37 °C in 100 mM sodium citrate
(pH 5.5; Sigma), 1% SDS, 100 µg/ml bovine serum albumin (fraction V;
ICN Radiochemicals) in the presence or absence of 0.1 unit/ml
endo-
For the complete removal of N-linked oligosaccharides,
immunoprecipitated material was incubated overnight at 37 °C in PBS, 10 mM EDTA, 1% 2-mercaptoethanol, 0.1% SDS, 1% Triton
X-100, 200 µg/ml bovine serum albumin (fraction V; ICN
Radiochemicals), 10 units/ml N-glycosidase F (Boehringer
Mannheim; EC 3.2.218).
Immunofluorescence Microscopy--
Transfected COS-1 cells were
plated in growth medium on coverslips in 24-well plates 2 days after
transfection. The coverslips were incubated overnight at 37 °C and
then rinsed with PBS and fixed for 2 h at 4 °C in 4%
paraformaldehyde in PBS. Coverslips were blocked with 50 mM
NH4Cl in PBS, and the cells were permeabilized with 100%
methanol at
The coverslips were then incubated overnight at 4°C with goat
anti-human factor H IgG (INCSTAR, Stillwater, MN) and then washed four
times with PBSc 0.1% Tween 20 (Sigma). After blocking,
coverslips were incubated for 2 h with fluorescein
isothiocyanate-labeled donkey anti-goat IgG (Binding Site) and then
washed four times and mounted on microscope slides in Mowiol
(Calbiochem, San Diego, CA) containing 2.5% 1,4-diazabicyclo [2.2.2]
octane (Sigma) (30). Slides were examined and photographed in a Zeiss
Axioscope epifluorescence microscope (Carl Zeiss, Inc., Thornwood, NY).
For the colocalization studies, goat anti-human factor H and rabbit
antibody to the amino terminus of the ER protein calnexin (Stressgen,
Victoria, Canada) were used. Texas Red-labeled donkey anti-rabbit IgG
(Jackson Laboratories, West Grove, PA) was used as second label. For
labeling the Golgi apparatus, Texas Red-labeled wheat germ agglutinin
(Molecular Probes, Inc., Eugene, OR) was used at 2.5 µg/ml (31).
Confocal images were taken using a × 63 immersion oil objective
on a Zeiss epifluorescence microscope (Carl Zeiss) equipped with a
Bio-Rad MRC laser confocal microscope adaptor. Images were processed
using Adobe Photoshop software (version 4.0, Adobe, San Jose, CA).
Nonimmune IgG and nonimmune serum were used in the first step of
staining as controls and were found to not be significantly different
from the unstained background. There was no fluorescence emission for
fluorescein isothiocyanate at the filter setting for Texas Red and
vice versa.
Isolation of a Full-length Factor H cDNA Clone--
Several
clones identified during screening of a normal human liver cDNA
library were analyzed. Clone HL-2 contained the full-length factor H
cDNA (3957 base pairs). The 5'-end of HL-2 is base 13 of the
published factor H cDNA sequence, and the 3' end of HL-2 extends 43 bases beyond the published sequence (Ref. 8; GenBankTM
entry HSH.GB_PR, accession number Y00716). Sequence analysis demonstrated that HL-2 was identical to the published factor H cDNA
sequence except for four nucleotide substitutions. One, A2089G, does
not result in a change in the derived amino acid sequence (CAA and CAG
both encode Gln654). Two differences, C1277T and G2881T,
result in amino acid substitutions that represent previously
characterized polymorphic variants (H384Y and E918D) (32, 33). One
difference, G1551C, which results in the presence of threonine rather
than arginine at residue 475, has not been previously reported.
Biosynthetic Labeling of Wild Type and Mutant Factor H in
Transfected COS-1 Cells and HepG2 Cells--
First, we examined
transfected COS-1 cells on days 1, 2, 3, and 5 after transfection for
the optimal time of expression of wild type factor H (Fig.
1A). In each case, an
~165-kDa factor H polypeptide was present in the cells, and a
slightly more slowly migrating, ~168-kDa factor H was in the
extracellular fluid. The difference in the relative electrophoretic
mobility of the intracellular and extracellular polypeptides is due to
glycosylation, as determined by N-glycosidase F experiments
(data not shown), and is similar to that produced by the endogenous
gene in fibroblasts (1). Synthesis of factor H increased markedly
between 1 and 2 days after transfection but did not change from day 2 to 5. Subsequent experiments were therefore performed at 2-3 days
after transfection.
Next we compared the expression of wild type factor H to that of
several mutant factor H genes in transfected COS-1 cells after a
continuous pulse of 8 h (Fig. 1B). The results show the ~165-kDa factor H in COS-1 cells transfected with wild type
(WT) or C518R, C518A, or C518A-C546A factor H constructs,
but no factor H polypeptide was present in COS-1 cells transfected with
vector alone (Vector) or in mock-transfected COS-1 cells
(None). An ~168-kDa factor H polypeptide was present in
the extracellular fluid of COS-1 cells expressing the wild type factor
H construct. A slightly slower migrating polypeptide was present in the
extracellular medium of COS-1 cells transfected with C518R, C518A, and
C518A-C546A factor H but in markedly lower amounts, indicating a block
in secretion of the C518R, C518A, and C518A-C546A mutant factor H proteins. This decrease in secretion was also apparent at long (24-h)
intervals of pulse radiolabeling (data not shown). A polypeptide of
~45 kDa was also present in cell lysates but is a nonspecific product
of immunoprecipitation, because it was also present in untransfected
COS-1 cells and in COS-1 cells transfected with vector alone, and its
immunoprecipitation was not blocked by cold purified factor H (data not
shown). In other experiments, there was also a marked decrease in
secretion of factor H in COS-1 cells transfected with C546A, C546R, and
C941Y mutant factor H constructs (data not shown).
We also compared wild type and mutant factor H expression in
transfected HepG2 cells (Fig. 2). An
~156-kDa underglycosylated and ~168-kDa mature factor H polypeptide
was detected in HepG2 cells transfected with wild type factor H. The
~156-kDa underglycosylated factor H polypeptide was predominantly
present in HepG2 cells transfected with C518R, C546R, C518A, C546A,
C518A-C546A, and C941Y mutant factor H. Factor H was not detected in
mock-transfected HepG2 cells (None). An ~168-kDa factor H
polypeptide was secreted into the extracellular medium only by HepG2
cells transfected with wild type factor H. Factor H could not be
detected in the extracellular medium of HepG2 cells transfected with
the mutant factor H constructs. Together with the results of
transfected COS-1 cells, these data indicate that the impairment in
secretion is neither cell- nor species-specific.
A comparison of the kinetics of secretion of wild type factor H with
that of one mutant, C518R, in transfected COS-1 cells revealed (Fig.
3) loss of the wild type factor H from
the cells between 1 and 3 h of the chase period, coincident with
the appearance of the ~168-kDa factor H in the extracellular medium.
Densitometric analysis of four separate experiments indicated that 95%
of the initial factor H-specific radioactivity could be accounted for in cell lysates and extracellular medium taken together, and the half
time for secretion was 2.5 h. In contrast, the C518R mutant factor
H only began to disappear from the intracellular compartment between 6 and 12 h of the chase period, and none was detected in the
extracellular fluid. The half time for its intracellular degradation
was 7.77 h (n = 6).
The same pulse-chase protocol was used to investigate the fate of
C941Y, C518A, C546R, C546A, and C518A-C546A mutant factor H molecules
in transfected COS-1 cells. In each case, the mutant factor H molecule
was retained in the cells, with none or a negligible amount detected in
the extracellular fluid (data not shown).
In the experiments presented in Fig. 4,
we used pulse-chase radiolabeling to compare the rate of intracellular
degradation of each mutant factor H molecule in transfected COS-1 cells
with that of mutant factor H expressed in the cell line from the
compound heterozygous factor H-deficient individual. First, we compared the transfected COS-1 cells expressing the C518R and C941Y mutants to
the factor H-deficient human fibroblast cell line (Fig. 4, A
and B). The same ~165-kDa polypeptide was synthesized in
each case. The rates of intracellular degradation were similar for C518R and C941Y mutant factor H molecules in the transfected COS-1 cells, but in each case factor H was somewhat more rapidly degraded than in the deficient fibroblast cell line. However, the degree of
experimental variation and the difference in cell type make it
difficult to conclude that this apparent difference in rate of
degradation is physiologically significant. Next, we compared transfected COS-1 cells expressing the C518A, C546R, C546A, and C518A-C546A mutant factor H molecules with each other (Fig. 4, A and C). The rates of intracellular degradation
were almost identical. Densitometry and phosphor imaging analysis
showed the following results for the half-time of intracellular
degradation: factor H-deficient fibroblasts, 11.51 ± 1.96 h
(n = 6); C518R, 7.77 ± 0.92 h
(n = 6); C941Y, 8.96 ± 1.29 h
(n = 5); C518A, 7.46 ± 2.10 h
(n = 5); C546R, 7.91 ± 0.88 h
(n = 2); C546A, 7.97 ± 1.41 h (n = 4); C518A-C546A, 6.15 ± 1.04 h
(n = 4).
Fate of Mutant Factor H in Transfected COS-1 Cells--
All of the
mutant factor H glycoproteins were sensitive to Endo H digestion even
after 5 h of the chase period (Fig.
5A), consistent with retention
in a pre-Golgi compartment. These results are comparable with similar
experiments in control and factor H-deficient fibroblasts (Fig.
5B). All of the factor H retained in the factor H-deficient
cells was sensitive to Endo H and N-glycosidase F, and none
was secreted (right side of Fig. 5B).
Although most of the factor H present in the cell lysates from control
fibroblasts was sensitive to Endo H, a small amount was resistant, and
the secreted factor H was also Endo H-resistant (left
side of Fig. 5B). N-Glycosidase F
digestion of the intracellular factor H in the control and deficient
fibroblasts generated polypeptides of similar electrophoretic mobility.
In control fibroblasts treated with 10 µg/ml brefeldin A before and
during the pulse period, factor H was no longer Endo H-resistant (data
not shown). In control fibroblasts treated with 20 µg/ml tunicamycin
before and during the pulse period, the factor H polypeptide migrated
at 146 kDa regardless of treatment with Endo H or
N-glycosidase F, and its migration was identical to that of
N-glycosidase F-digested factor H in untreated control
fibroblasts (data not shown).
We also used immunofluorescence to determine the intracellular
localization of mutant factor H molecules in transfected COS-1 cells.
There was no significant difference in the pattern of factor H-specific
immunofluorescent staining among COS-1 cells transfected with C518R,
C546R, C518A, C546A, C518A-C546A, and C941Y mutant factor H constructs.
In each case, there was a diffuse reticular staining of the cytoplasm
especially prominent in the perinuclear region, which looked identical
to the staining pattern of untransfected COS-1 cells with antibody to
the ER-resident protein calnexin (data not shown). Double labeling
experiments performed in COS-1 cells transfected with the C518R and the
C941Y mutant factor H constructs showed colocalization of factor H and
calnexin (Fig. 6). This colocalization
was apparent in several focal planes. There was no colocalization of
mutant factor H and a Golgi marker, wheat germ agglutinin (data not
shown). Taken together with the Endo H experiments, these data indicate
that all of the mutant factor H molecules are retained in the ER.
In a previous study, we showed that impaired secretion of factor H
in a factor H-deficient child with glomerulonephritis was associated
with single amino acid substitutions, C518R on one allele and C941Y on
the other allele. In this study, we used transfected cells to express
wild type factor H, mutant C518R factor H, and mutant C941Y factor H
alone. The results showed impaired secretion of each of the mutants in
both transfected COS-1 cells and transfected HepG2 cells, indicating
that the defect in secretion is neither cell type- nor
species-specific. Endoglycosidase H digestion and immunofluorescence
studies indicate that each of these mutants is retained in the ER.
We then examined several possible mechanisms accounting for the
impaired secretion of C518R and C941Y mutant factor H molecules. These
mutations occur at the Cys2 position of the framework
Cys2-Cys4 disulfide bridge in the ninth and
16th SCR module of factor H, respectively. Accordingly, using C518R as
a model, we generated a series of mutant factor H molecules and
transfected these to ascertain whether the impaired secretion was due
to disruption of the disulfide bridge and/or a difference in size or
charge of the substitution at residue 518. The results showed that the naturally occurring mutant, C518A, C546A, C546R (the latter two substituted at the Cys4 partner in the disulfide bridge)
factor H proteins were retained and degraded in the same intracellular compartment. That C546A and C546R had the same fate as C518A and C518R
in transfected cells established that disruption of the disulfide
bridge is the major factor contributing to impaired secretion of the
natural mutant factor H in the kindred previously described.
Similar results in studies of human lysozyme (34), influenza virus
hemagglutinin (35), MHC class I molecules (36), and apolipoprotein B50
(37) support the conclusion that formation of specific disulfide
bridges is critical for transport out of the ER to the cell surface or
extracellular fluid. However, mutation of other disulfide bridges in
lysozyme, influenza virus hemagglutinin, or apolipoprotein B50 had no
effect on their secretion (34, 35, 37). In fact, in still other
instances disruption of a disulfide bridge was associated with more
rapid assembly and secretion (34, 38, 39). Finally, there are some
examples where disruption of a disulfide bridge does not affect
transport of the polypeptide when both cysteines have been mutated but
a block in transport and ER retention is associated with an unpaired
cysteine (40-42). To test for a potential role of unpaired cysteine
residues in the secretory block of factor H deficiency, a mutant was
constructed in which both Cys518 and Cys546
were substituted by alanine. The double mutant factor H C518A/C546A was
also retained in the ER, making it highly unlikely that the generation
of unpaired cysteines at residue position 546 or 518 was responsible
for the block in secretion of the single mutant factor H molecules.
Other human genetic deficiencies with substitutions at critical
cysteine residues and impaired secretion have been associated with the
deficiency state (aspartylglucosaminuria (43), type 1 von Willebrand
disease (44), factor XIIIb deficiency (45), and protein C deficiency
(46)), but in none has the mechanism been elucidated.
Several different mutant proteins are retained and degraded in the ER
by a quality control apparatus that appears to involve the
ubiquitin-dependent proteasomal degradation pathway (47, 48). The factor H mutants had a considerably longer half-life than most
of the mutant secretory proteins (either naturally occurring or
generated experimentally) that have been described in the literature. The half-time for degradation of the factor H mutants is on the order
of 7-8 h, as compared with 1-3 h for other mutant proteins such as
![]()
INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES
-chain of the interleukin-2
receptor, and cell adhesion molecules such as endothelial leukocyte
adhesion molecule-1 and leukocyte adhesion molecule-1. The SCR motifs
define a protein superfamily (10), characterized by conserved tyrosine,
proline, and glycine residues and by the presence of four conserved
cysteine residues, which form two disulfide bridges in a
Cys1-Cys3 and
Cys2-Cys4 fashion (11, 12). The 20 SCR modules
of factor H are joined by short (3-8-amino acid) linkers, resulting in
a shape that resembles a string of beads (13). The three-dimensional
structure of both individual and paired SCR units has been determined
and shows an autonomously folding structure with the two disulfide
bridges far apart at the ends of a compact hydrophobic core (14).
![]()
EXPERIMENTAL PROCEDURES
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES
70 °C. For some pulse-chase experiments, gels were exposed to a
phosphor screen, and the images were quantified using the STORM system
(Molecular Dynamics, Sunnyvale, CA).
-N-acetylglucosaminidase H of Streptomyces plicatus (Sigma; EC 3.2.1.96).
20 °C for 7 min, rinsed with PBSc (PBS containing 0.50 mM CaCl2 and 0.25 mM MgCl2), and blocked for 1 h at 4 °C
with antibody diluting solution (PBSc containing 1% bovine
serum albumin (Calbiochem) and 0.01% Tween 80 (Pierce)).
![]()
RESULTS
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

View larger version (42K):
[in a new window]
Fig. 1.
Expression of wild type and mutant factor H
in transfected COS-1 cells. A, COS-1 cells were
transfected with wild type factor H cDNA using the DEAE-dextran
method. Cells were labeled with methionine-free medium containing 250 µCi/ml TRAN35S for 5 h, on the first, second, third,
or fifth day after transfection. The cell lysates (IC) and
extracellular media (EC) were subjected to
immunoprecipitation for factor H, and the immunoprecipitates were
analyzed on a 7% SDS-PAGE gel. B, COS-1 cells were
transiently transfected with vector alone (Vector), wild
type factor H cDNA (WT), C518R mutant factor H cDNA,
C518A mutant factor H cDNA, or C518A-C546A mutant factor H cDNA
or were mock transfected (None), as indicated at the
top. On the third day after transfection, cells were labeled
and analyzed exactly as described for A. The electrophoretic
migration of molecular mass markers (kDa) is indicated at the
left of both panels.

View larger version (40K):
[in a new window]
Fig. 2.
Expression of wild type and mutant factor H
in transfected HepG2 cells. HepG2 cells were transfected using
Lipofectin and then studied 36 h later. The cells were pulsed with
cysteine- and methionine-free medium containing 250 µCi/ml
TRAN35S for 7 h and analyzed exactly as described in
the legend to Fig. 1. The migration of the more rapidly migrating
underglycosylated factor H precursor in cell lysates (IC) is
indicated by an asterisk, and the migration of the more
slowly migrating mature form of factor H only present in the cell
lysates and extracellular medium (EC) of HepG2 cells
transfected with wild type factor H is indicated by a double
asterisk. The migration of molecular mass markers (kDa) is
indicated at the left.

View larger version (82K):
[in a new window]
Fig. 3.
Kinetics of secretion of wild type
(top) and C518R mutant (bottom)
factor H in transfected COS-1 cells. Three days after
transfection, cells were pulsed with methionine-free medium containing
500 µCi/ml TRAN35S for 30 min and then chased in
methionine-containing medium for the time periods indicated at the
top. Cell lysates (IC) and extracellular media
(EC) were analyzed exactly as described in the legend to
Fig. 1. The migration of the molecular mass markers (kDa) is indicated
at the left.

View larger version (19K):
[in a new window]
Fig. 4.
Kinetics of intracellular
degradation of different factor H mutants in transfected COS-1 cells
and in fibroblasts from the factor H-deficient patient.
A, cells were pulsed with cysteine- and methionine-free
medium containing 500 µCi/ml TRAN35S for 90 min and then
chased in complete medium for the time periods indicated at the
top. Cells were analyzed exactly as described in the legend
to Fig. 1. B and C, the results were also
analyzed by densitometry or by phosphor imaging using the STORM system.
The intensity of the signal for factor H at the time 0 of the chase
period was arbitrarily considered 100%. The points in the graphs
represent average values obtained from 2-6 experiments.

View larger version (32K):
[in a new window]
Fig. 5.
Effect of Endo H and
N-glycosidase F on factor H in transfected COS-1
cells, control fibroblasts, and factor H-deficient fibroblasts.
Cells were pulse-labeled with cysteine- and methionine-free medium
containing 500 µCi/ml TRAN35S for 90 min and then chased
for the time periods indicated at the top. Cell lysates
(IC) and extracellular media (EC) were
immunoprecipitated for factor H. A, the immunoprecipitates
were then incubated in the absence or presence of Endo H (as indicated
at the top of the gel) and then subjected to SDS-PAGE on a
6% gel. For C546R, the sample at 5 h of chase period that was not
treated with Endo H was inadvertently not loaded. B,
immunoprecipitates were incubated in the absence (
) or presence of
Endo H (H) or N-glycosidase F (F) and
then subjected to SDS-PAGE and fluorography.

View larger version (36K):
[in a new window]
Fig. 6.
Double immunofluorescent labeling of factor H
and calnexin in COS-1 cells transfected with factor H C518R
(left column) or C941Y (right
column). Images were taken in the same confocal
plane using filters for green fluorescence corresponding to factor H
(A and D) and red fluorescence corresponding to
calnexin (B and E). The corresponding images
(A with B and D with E)
were overlaid to produce C and F, showing the
colocalization of the green and red signal
(producing orange). Colocalization was established in
several other focal planes (data not shown).
![]()
DISCUSSION
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES
1-antitrypsin Z (49),
1-antitrypsin S
(50), mutant forms of complement C2 (51), complement C1 inhibitor (52), carboxypeptidase Y (53), factor XIIIb (45), and apolipoprotein B50
(37). Even when
1-antitrypsin Z is expressed in a
genetic background characterized by a lag in ER degradation, the
half-time for degradation is less (~5-6 h) (49) than that of the
mutant factor H molecules described here. Mutant membrane proteins and unassembled subunits of membrane-bound multisubunit proteins
(e.g. CFTR
F508 (54), the truncated form of ribophorin I
(55), asialoglycoprotein receptor H2b (39), and T cell receptor
-chain (56)), which accumulate in the ER, are also rapidly degraded
in that compartment. The physiologic degradation of the resident ER
membrane protein, 3-hydroxy-3-methylglutaryl-CoA reductase, is also
more rapid (57) than mutant factor H. The truncated T cell receptor
-subunit (generated experimentally by deletion of the transmembrane
segment and cytoplasmic tail (58)) is the only other polypeptide that is retained in the ER as long as the mutant factor H. The possibility must therefore be considered that factor H is degraded by a novel mechanism or that the higher order structure of the mutant H confers unusual resistance to conventional degrading mechanisms. A mutant of
factor XIIIb (another member of the SCR-containing protein superfamily)
substituted at one of the Cys4 residues of a
Cys2-Cys4 disulfide bridge is degraded in the
ER much more rapidly than any of the factor H mutants (45).
| |
ACKNOWLEDGEMENTS |
|---|
We thank Drs. Jeffrey Teckman, David Haviland, Gerard Garnier, and Antonella Circolo for invaluable discussions and advice. B. Z. S. expresses gratitude to Dr. Wataru Fukuda for instruction and example. The advice of Julie Traush-Azar in immunofluorescence studies is appreciated. We are indebted to Dr. Haibing Teng for help in confocal microscopy. The secretarial assistance of Barb Hermann is greatly appreciated.
| |
FOOTNOTES |
|---|
* The studies were supported in part by U. S. Public Health Service Grants AI24836, HL37784, and DK52526.The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
To whom correspondence should be addressed: Dept. of Pediatrics,
Washington University School of Medicine, 1 Children's Place, St.
Louis, MO 63110. Tel.: 314-454-6066; Fax: 314-454-4218; E-mail: perlmutter{at}al.kids.wustl.edu.
§ Present address: Northwestern University Medical School, 303 E. Chicago Ave., Morton 4-656, Chicago, IL 60611.
| |
ABBREVIATIONS |
|---|
The abbreviations used are: SCR, short consensus repeat; Endo H, endoglycosidase H; ER, endoplasmic reticulum; PAGE, polyacrylamide gel electrophoresis; PBS, phosphate-buffered saline, pH 7.4.
| |
REFERENCES |
|---|
|
|
|---|
This article has been cited by other articles:
![]() |
M.-A. Dragon-Durey, V. Fremeaux-Bacchi, C. Loirat, J. Blouin, P. Niaudet, G. Deschenes, P. Coppo, W. Herman Fridman, and L. Weiss Heterozygous and Homozygous Factor H Deficiencies Associated with Hemolytic Uremic Syndrome or Membranoproliferative Glomerulonephritis: Report and Genetic Analysis of 16 Cases J. Am. Soc. Nephrol., March 1, 2004; 15(3): 787 - 795. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. A. Hegasy, T. Manuelian, K. Hogasen, J. H. Jansen, and P. F. Zipfel The Molecular Basis for Hereditary Porcine Membranoproliferative Glomerulonephritis Type II: Point Mutations in the Factor H Coding Sequence Block Protein Secretion Am. J. Pathol., December 1, 2002; 161(6): 2027 - 2034. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. CAPRIOLI, P. BETTINAGLIO, P. F. ZIPFEL, B. AMADEI, E. DAINA, S. GAMBA, C. SKERKA, N. MARZILIANO, G. REMUZZI, and M. NORIS The Molecular Basis of Familial Hemolytic Uremic Syndrome: Mutation Analysis of Factor H Gene Reveals a Hot Spot in Short Consensus Repeat 20 J. Am. Soc. Nephrol., February 1, 2001; 12(2): 297 - 307. [Abstract] [Full Text] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| All ASBMB Journals | Molecular and Cellular Proteomics |
| Journal of Lipid Research | ASBMB Today |