JBC

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Yao, I.
Right arrow Articles by Takai, Y.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Yao, I.
Right arrow Articles by Takai, Y.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

J Biol Chem, Vol. 274, Issue 17, 11889-11896, April 23, 1999


MAGUIN, a Novel Neuronal Membrane-associated Guanylate Kinase-interacting Protein*

Ikuko YaoDagger , Yutaka HataDagger , Nobuyuki IdeDagger , Kazuyo HiraoDagger , Maki DeguchiDagger , Hideo NishiokaDagger , Akira Mizoguchi§, and Yoshimi TakaiDagger parallel

From the Dagger  Takai Biotimer Project, Exploratory Research for Advanced Technology, Japan Science and Technology Corporation, c/o JCR Pharmaceuticals Co. Ltd., 2-2-10 Murotani, Nishi-ku, Kobe 651-2241, Japan, the § Department of Anatomy and Neurobiology, Graduate School, Kyoto University, Kyoto 606-8315, Japan, and the  Department of Molecular Biology and Biochemistry, Osaka University Medical School, Suita 565-0871, Japan

    ABSTRACT
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

Postsynaptic density (PSD)-95/Synapse-associated protein (SAP) 90 and synaptic scaffolding molecule (S-SCAM) are neuronal membrane-associated guanylate kinases. Because PSD-95/SAP90 and S-SCAM function as synaptic scaffolding proteins, identification of ligands for these proteins is important to elucidate the structure of synaptic junctions. Here, we report a novel protein interacting with the PDZ domains of PSD-95/SAP90 and S-SCAM and named it MAGUIN-1 (membrane-associated guanylate kinase-interacting protein-1). MAGUIN-1 has one sterile alpha  motif, one PDZ, and one plekstrin homology domain. MAGUIN-1 is localized at the plasma membrane via the plekstrin homology domain and the C-terminal region and interacts with PSD-95/SAP90 and S-SCAM via a C-terminal PDZ domain-binding motif. MAGUIN-1 has a short isoform, MAGUIN-2, which lacks a PDZ domain-binding motif. MAGUINs are expressed in neurons and localized in the cell body and neurites and are coimmunoprecipitated with PSD-95/SAP90 and S-SCAM from rat crude synaptosome. MAGUIN-1 may play an important role with PSD-95/SAP90 and S-SCAM to assemble the components of synaptic junctions.

    INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

Synaptic junctions are interneuronal cell-cell junctions differentiated for neurotransmission. Neurotransmitters are released from the synaptic vesicles into the synaptic cleft and bind to the receptors accumulated at the postsynapse, opening the ion channels and generating the second messengers involved in synaptic plasticity (reviewed in Ref. 1). The components required for this process are organized at the synaptic junctions to play specific roles in felicitous orders. Several scaffolding proteins are reported to be involved in the assembly of components of synaptic junctions (reviewed in Refs. 2-6). Postsynaptic density (PSD)1-95/synapse-associated protein (SAP) 90 has three PSD-95/Dlg-A/ZO-1 (PDZ) domain, one Src homology 3 domain, and one guanylate kinase (GK) domain (7, 8). The PDZ domain is a protein-interacting module (reviewed in Refs. 9-12), and PSD-95/SAP90 binds the C termini of N-methyl-D-aspartate (NMDA) receptors, K+ channels, neuroligins, synGAP, and CRIPT through distinct PDZ domains to assemble these components at the synaptic junctions (13-18). PSD-95/SAP90 interacts with SAP90/PSD-95-associated protein (SAPAP) (also called GK-associated protein and hDLG-associated protein) (19-21), and a recently identified protein, BEGAIN (brain-enriched guanylate kinase-interacting protein) via the GK domain (22). Glutamate receptor-interacting protein has seven PDZ domains and binds alpha  amino-3-hydroxy-5-methyl-4-isoxazaole propionic acid receptors via the fourth and fifth PDZ domains (23). The ligands for other PDZ domains of glutamate receptor-interacting protein have not been so far reported. Synaptic scaffolding molecule (S-SCAM) was originally identified as a SAPAP-interacting protein (24). We have first reported that S-SCAM has one GK, two WW, and five PDZ domains (24). The GK domain of S-SCAM is shorter than that of PSD-95/SAP90. The WW domain is a protein-interacting module binding a proline-rich sequence (25). The recent version of simple modular architecture research tool recognizes an additional PDZ domain at the N terminus of S-SCAM (26). We number these PDZ domains consecutively from 0 to 5 (PDZ0, -1, -2, -3, -4, and -5) to keep consistency with the first report. Among six PDZ domains, PDZ1 and -5 bind to the C termini of neuroligin and NMDA receptors, respectively (24). Because S-SCAM has more PDZ domains than PSD-95/SAP90, it may integrate more components of synaptic junctions. Based on this assumption, we have performed a yeast two-hybrid screening using the PDZ domains of S-SCAM to obtain a novel neuronal molecule. Eventually, this molecule binds not only to S-SCAM but also to PSD-95/SAP90. We have named this protein MAGUIN-1 (membrane-associated guanylate kinase-interacting protein-1).

    MATERIALS AND METHODS
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

Yeast Two-hybrid Screening and cDNA Cloning-- Rat brain yeast two-hybrid library was constructed using pVP16 vector and screened (27). Rat brain cDNA libraries were screened with the [alpha -32P]dCTP-labeled random-primed probes (27).

Construction of Expression Vectors-- Various expression vectors were constructed by conventional molecular biology techniques and polymerase chain reaction method using pBTM116, pBTM116-2, pCMV Myc, pCMV Myc2, pClneo Myc, pGex5X-3 (Amersham Pharmacia Biotech), pGex4T-1 (Amersham Pharmacia Biotech), and pGexKG. pBTM116-2, pCMV Myc, and pClneo Myc were constructed from pBTM116, pCMV5, and pClneo, respectively (24). pCMV Myc2 was constructed by ligating aattcgagatctcgggtaccacgcgtatcgatatcgcggccg/ctagcggccgcgatatcgatacgcgtggtacccgagatctcg into EcoRl/Xbal sites of pCMV Myc. pCMV PSD-95, pCMV S-SCAM, and pClneo Myc S-SCAM-1, -2, -3, and -4 were described previously (20, 24). pBTM116 S-SCAM-13, -14, and -16 and pClneo Myc S-SCAM-9, -10, and -11 contain the amino acid residues 413-1114, 413-1277, 728-1277, 603-1023, 906-1277, and 772-1277 of S-SCAM, respectively. pBTM116 MAGUIN-9, pGex4T-1 MAGUIN-1, pGex5X-3 MAGUIN-12, pCMV Myc MAGUIN-1f, and pClneo Myc MAGUIN-n, -m, and -c contain the amino acid residues 846-1032, 716-858, 846-1032, 1-1032, 1-469, 458-858, and 568-1032 of MAGUIN-1, respectively. pGex5X-3 MAGUIN-16 and pCMV Myc MAGUIN-2f contain the amino acid residues 568-896 and 1-896 of MAGUIN-2, respectively. pCMV Myc PSD-95-1, -5, and -6 contain the amino acid residues 1-724, 1-407, and 432-724 of PSD-95/SAP90, respectively.

Antibodies-- Rabbit polyclonal antibodies were raised against the products of pGex4T-1 MAGUIN-1 and pGex5X-3 MAGUIN-16. The monoclonal anti-Myc-tag antibody, 9E10, was obtained from American Type Culture Collection. The anti-gamma -aminobutyric acid A receptor antibody was purchased from Chemicon. The anti-NMDAR1 antibody was a generous gift of Dr. Nils Brose (Max Planck Institute). The anti-S-SCAM antibody was described (24).

Preparation of COS Cell Extract-- COS cells were cultured in Dulbecco's modified Eagle's medium with 10% fetal bovine serum under 10% CO2 at 37 °C and transfected with DEAE-dextran (20). COS cells of two 10-cm plates were homogenized in 0.5 ml of 20 mM Tris/HCl, pH 7.4, containing 100 mM NaCl and 1% (w/v) Triton X-100 and centrifuged at 100,000 × g for 30 min. The supernatant was used as a COS cell extract.

In Vitro Binding Experiment Using GST Fusion Proteins and COS Cell Extract-- 0.5-ml aliquots of the COS cell extract were incubated with 200 pmol of various GST constructs fixed on 20 µl of glutathione-Sepharose 4B beads. After the beads were washed with 50 mM Tris/HCl, pH 7.4, containing 100 mM NaCl and 1% (w/v) Triton X-100, proteins on the beads were detected with the immunoblottings using the appropriate antibodies.

Coimmunoprecipitation-- The crude synaptosomal fraction was prepared from four rat brains as described (24). The fraction was homogenized in 16 ml of 50 mM Hepes/NaOH, pH 8.0, containing 100 mM NaCl, 5 mM EDTA, 1% (w/v) deoxycholic acid, and 1% (w/v) Nonidet P-40 and centrifuged at 100,000 × g for 30 min to collect the supernatant. 4-ml aliquots of the supernatant were incubated with the anti-PSD-95/SAP90 antibody, the anti-S-SCAM antibody, or the preimmune serum fixed on 20 µl of protein G-Sepharose Fast Flow beads. After the beads were washed four times with 50 mM NaOH/Hepes, pH 8.0, containing 100 mM NaCl, and 1% (w/v) Triton X-100, proteins on the beads were detected with the immunoblottings using the appropriate antibodies.

Subcellular Fractionation of CHO Cells-- CHO cells were transfected with various eukaryote expression vectors using TransFast Transfection Reagent (Promega). After 48 h, the cells were collected and homogenized in 300 µl of 20 mM Hepes/NaOH, pH 7.4, by sonication. 80 µl of the homogenate was kept for the analysis, and the remaining samples were centrifuged at 100,000 × g for 30 min to separate the supernatant and the pellet. The pellet was homogenized in 220 µl of 20 mM Hepes/NaOH, pH 7.4, containing 1% (w/v) Triton X-100 and centrifuged at 10,000 × g for 10 min to separate the supernatant and the pellet.

Miscellaneous Procedures-- Other procedures, including subcellular fractionation of rat brain, primary cultures of rat hippocampal neurons, immunocytostaining, SDS-polyacrylamide gel electrophoresis, and protein determination, were performed as described (20). Northern and Western blottings were performed using multiple tissue Northern blots (CLONTECH) and ECL reagents (Amersham Pharmacia Biotech), respectively.

    RESULTS
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

Identification of MAGUINs-- We performed the yeast two-hybrid screening using baits containing the PDZ domains of S-SCAM (pBTM116 S-SCAM-13, -14, and -16). We obtained 34 positive independent clones from 5 × 106 clones of a rat brain yeast two-hybrid library. The sequences of 22 clones were novel, and we performed Northern blot analysis for these clones. The messages of two clones (pPrey 4233 and pPrey 4514) were detected only in the brain. During the study, the sequence of human brain-specific angiogenesis inhibitor-1 was reported, and pPrey 4514 turned out to be rat brain-specific angiogenesis inhibitor-1. We obtained the presumptive full-length coding sequences of pPrey 4233 through the conventional hybridization screening using a rat brain cDNA library and polymerase chain reaction using rat brain cDNAs as templates. Two isoforms were detected and named MAGUIN-1 and -2. MAGUIN-1 had 1032 amino acids and was composed of one sterile alpha  motif (SAM) domain, one PDZ domain, and one plekstrin homology (PH) domain (Fig. 1A). MAGUIN-1 had Thr-His-Val at the C terminus, which corresponded to the PDZ domain-binding motif. pPrey 4233 contained the C-terminal 319 residues of MAGUIN-1 (amino acids 714-1032, underlined in Fig. 1A). MAGUIN-2 contained the N-terminal 895 amino acids of MAGUIN-1 and is terminated with Ser as the last (896th) residue, lacking the PDZ domain-binding motif (Fig. 1B). The SAM domain of MAGUINs is about 30% homologous to those of Caenorhabditis elegans R01H10.8 and yeast byr2 and about 15% homologous to that of yeast STE50 (Fig. 2A) (28-31). The PDZ domain of MAGUINs is about 40% homologous to that of C. elegans R01H10.8 (Fig. 2B). The homology with the PDZ domain of PSD-95/SAP90 or CASK is about 15%, and among others the residues of the first alpha  helix are rather well conserved (Fig. 2B) (32, 33). The PH domain of MAGUINs is about 20% homologous to those of C. elegans R01H10.8, human dynamin, and rsec7 (Fig. 2C) (34, 35). This region of MAGUINs is about 55% homologous to human KIAA0403 (Fig. 2C). Although the complete coding sequence of KIAA0403 is not reported, it may be a human isoform of MAGUINs. Because C. elegans R01H10.8 has a similar molecular structure, it may be a C. elegans homologue of MAGUINs.


View larger version (45K):
[in this window]
[in a new window]
 
Fig. 1.   Sequences of MAGUINs. Residues are shown in single-letter codes. A, amino acid sequence of MAGUIN-1. The residues of SAM, PDZ, and PH domains are boxed with black lines, boxed with gray lines, and shaded, respectively. The region contained in the clone from the yeast two-hybrid screening is underlined. B, the C-terminal sequence of MAGUIN-2.


View larger version (72K):
[in this window]
[in a new window]
 
Fig. 2.   Sequence alignment of each domain of MAGUINs. Residues are shown in single-letter codes. The residues conserved among four, three, and two proteins are indicated on the green, orange, and light or dark blue backgrounds, respectively. A, alignment of the SAM domains of MAGUINs, C. elegans R01H10.8, yeast byr2, and STE50. B, alignment of the PDZ domain of MAGUINs with the PDZ domain of C. elegans R01H10.8, the PDZ domain of CASK, and the third PDZ domain of PSD-95/SAP90. The amino acids of alpha  helixes and beta  sheets are indicated in boxes. C, alignment of the PH domains of MAGUINs, C. elegans R01H10.8, KIAA0403, dynamin, and rsec7.

Interaction of MAGUIN-1 with S-SCAM and PSD-95/SAP90-- To confirm the interaction of MAGUIN-1 with S-SCAM, the extract of COS cells expressing S-SCAM was incubated with either GST-MAGUIN-12 containing the C terminus of MAGUIN-1 or GST-MAGUIN-16 containing the C terminus of MAGUIN-2. The C terminus of MAGUIN-1 interacted with S-SCAM, whereas the C terminus of MAGUIN-2 did not (Fig. 3A). MAGUIN-1 was coimmunoprecipitated with S-SCAM from the rat crude synaptosomal fraction (Fig. 3, B and C). To determine the interacting region of S-SCAM with MAGUIN-1, various Myc-tagged constructs of S-SCAM were incubated with GST-MAGUIN-12 containing the C terminus of MAGUIN-1 (Fig. 4A). Myc-S-SCAM-1, -4, -11, and -10 interacted, whereas Myc-S-SCAM-2, -3, and -9 did not (Fig. 4B), suggesting that the fourth and fifth PDZ domains were involved in the interaction. From the reverse yeast two-hybrid screening using pBTM116 MAGUIN-9 as a bait, the PDZ domains of PSD-95/SAP90, PSD93/chapsyn110, and SAP97 were obtained (36-38), suggesting that MAGUIN-1 interacted with not only S-SCAM but also PSD-95/SAP90 and its isoforms. MAGUIN-1 was coimmunoprecipitated with PSD-95/SAP90 from the rat crude synaptosomal fraction (Fig. 5A). The interaction of MAGUIN-1 with the PDZ domains of PSD-95/SAP90 was confirmed using Myc-tagged constructs of PSD-95/SAP90 and the GST construct of MAGUIN-1 (Fig. 5B).


View larger version (19K):
[in this window]
[in a new window]
 
Fig. 3.   Interaction of MAGUIN-1 with S-SCAM. A, interaction of S-SCAM with the C-terminal region of MAGUIN-1. The extract of COS cells expressing S-SCAM was incubated with either GST-MAGUIN-12 (the C-terminal construct of MAGUIN-1) or GST-MAGUIN-16 (the C-terminal construct of MAGUIN-2) fixed on the glutathione beads, and the proteins attached to the beads were detected by the anti-S-SCAM antibody. Lane 1, the original sample before the incubation; lane 2, the sample incubated with GST-MAGUIN-12; lane 3, the sample incubated with GST-MAGUIN-16. B, coimmunoprecipitation of S-SCAM with MAGUIN-1. The Triton X-100 extract of the rat crude synaptosomal fraction was incubated with either the anti-MAGUIN serum or the preimmune serum on protein G-Sepharose beads, and the proteins attached to the beads were immunoblotted with the anti-S-SCAM antibody. Lane 1, the original Triton X-100 extract of rat crude synaptosome before the incubation; lane 2, with the preimmune serum; lane 3, with the anti-MAGUIN antibody. C, coimmunoprecipitation of MAGUIN-1 with S-SCAM. The Triton X-100 extract of the rat crude synaptosomal fraction was incubated with either the anti-S-SCAM serum or the preimmune serum on protein G-Sepharose beads, and the proteins attached to the beads were immunoblotted with the anti-MAGUIN antibody. Lane 1, the original Triton X-100 extract of rat crude synaptosome before the incubation; lane 2, with the preimmune serum; lane 3, with the anti-S-SCAM antibody.


View larger version (20K):
[in this window]
[in a new window]
 
Fig. 4.   MAGUIN-1-interacting domain of S-SCAM. A, schematic description of various Myc-tagged constructs of S-SCAM. The letter (a-g) to the left of each construct corresponds to the letter of each lane in panel B. B, the extract of COS cells expressing various Myc-tagged constructs of S-SCAM were incubated with GST-MAGUIN-12 fixed on the glutathione beads, and the proteins attached to the beads were detected with the anti-Myc antibody. Lane a, pClneo Myc S-SCAM-1; lane b, pClneo Myc S-SCAM-2; lane c, pClneo Myc S-SCAM-3; lane d, pClneo Myc S-SCAM-4; lane e, pClneo Myc S-SCAM-9; lane f, pClneo Myc S-SCAM-10; lane g, pClneo Myc S-SCAM-11.


View larger version (21K):
[in this window]
[in a new window]
 
Fig. 5.   Interaction of MAGUIN-1 with PSD-95/SAP90. A, coimmunoprecipitation of MAGUIN-1 with PSD-95/SAP90. The Triton X-100 extract of the rat crude synaptosomal fraction was incubated with either the anti-PSD-95/SAP90 serum or the preimmune serum on protein G-Sepharose beads, and the proteins attached to the beads were immunoblotted with the anti-MAGUIN antibody. Lane 1, the original Triton X-100 extract of rat crude synaptosome before the incubation; lane 2, with the preimmune serum; lane 3, with the anti-PSD-95/SAP90 antibody. B, interaction of MAGUIN-1 with the PDZ domains of PSD-95/SAP90. The extract of COS cells expressing various Myc-tagged PSD-95/SAP90 was incubated with GST-MAGUIN-12 (the C-terminal construct of MAGUIN-1) or GST-MAGUIN-16 (the C-terminal construct of MAGUIN-2) fixed on the glutathione beads, and the proteins attached to the beads were detected with the anti-Myc antibody. Lanes 1-3, the full-length of PSD-95/SAP90; lanes 4-6, the PDZ domains of PSD-95/SAP90; lanes 7-9, the Src homology 3 and GK domains of PSD-95/SAP90. Lanes 1, 4, and 7, the original samples before the incubation; lanes 2, 5, and 8, after the incubation with GST-MAGUIN-12; lanes 3, 6, and 9, after the incubation with GST-MAGUIN-16.

Tissue and Subcellular Distribution of MAGUINs-- Northern blot analysis revealed 4.4- and 5.4-kilobase pair messages only in brain (Fig. 6). The two messages with different sizes may reflect differential polyadenylation. No message was detected in heart, spleen, lung, liver, kidney, skeletal muscles, or testis. In the subcellular fractionation of rat brain, MAGUINs were detected mainly in the synaptic plasma membrane (SPM) and PSD fractions (Fig. 7A). Two bands with different molecular sizes may represent protein degradation, post-translational modifications, or alternative splicing isoforms. In rat hippocampal neurons, MAGUINs were distributed in the cell body and the neurites and colocalized with NMDAR1 (Fig. 7B).


View larger version (41K):
[in this window]
[in a new window]
 
Fig. 6.   Northern blot analysis of MAGUINs. A blot with 2 µg of mRNA from each rat tissue was hybridized with an uniformly labeled MAGUIN-1 and exposed at -80 °C for 2 days. Lane 1, heart; lane 2, brain; lane 3, spleen; lane 4, lung; lane 5, liver; lane 6, skeletal muscle; lane 7, kidney; lane 8, testis. kb, kilobase pairs.


View larger version (56K):
[in this window]
[in a new window]
 
Fig. 7.   Subcellular localization of MAGUINs. A, Western blot analysis of the subcellular fractions of rat brain. Equal aliquots of the subcellular fractions of rat brain (25 µg of protein each) were immunoblotted with the anti-MAGUIN antibody. Lane 1, the homogenate fraction; lane 2, the nuclear pellet fraction; lane 3, the crude synaptosomal fraction; lane 4, the synaptosomal cytosol fraction; lane 5, the crude synaptosomal pellet fraction; lane 6, the crude synaptic vesicle fraction; lane 7, the lysed synaptosomal membrane fraction; lane 8, the SPM fraction; lane 9, the 0.5% (w/v) Triton X-100-soluble fraction of the SPM; lane 10, the 0.5% (w/v) Triton X-100-insoluble fraction of the SPM; lane 11, the 1% (w/v) Triton X-100-soluble fraction of the SPM; lane 12, the 1% (w/v) Triton X-100-insoluble fraction of the SPM. B, expression of MAGUINs in rat primary cultured hippocampal neurons. Rat hippocampal neurons were immunostained with the polyclonal mouse anti-MAGUIN antibody. The scale bar indicates 10 µm.

Interaction of MAGUINs with Membrane-- The PH domain is known to interact with the phospholipid membrane (reviewed in Refs. 39 and 40). To test whether MAGUINs associate with the plasma membrane through the PH domain, various Myc-tagged constructs of MAGUINs were transfected in CHO cells (Fig. 8A). Full-length MAGUIN-1 and -2 and the construct containing the PH domain with the C-terminal stretch were localized at the plasma membrane (Fig. 8B, 1f, 2f, and m). The construct containing the SAM and PDZ domains was distributed in the cytosol (Fig. 8B, n). The construct containing the C-terminal region of MAGUIN-1 was localized at the plasma membrane, although it lacked the PH domain (Fig. 8B, c). The similar results were obtained in the subcellular fractionation of CHO cells transfected with these constructs. Full-length MAGUIN-1 was recovered in the membrane fraction (Fig. 9A). The N-terminal construct containing the SAM and PDZ domains was distributed more in the cytosol than in the membrane fraction (Fig. 9B). The PH domain with the C-terminal stretch was recovered in the membrane fraction (Fig. 9C). The C-terminal construct was recovered mainly in the membrane fraction with a smaller amount in the cytosol (Fig. 9D). Because the construct containing only the PH domain was not expressed, we could not determine whether the PH domain was directly involved in the membrane association of MAGUIN-1. However, these findings suggest that MAGUIN-1 associates with the plasma membrane through the region containing the PH domain and the C-terminal stretch of the PH domain. The N-terminal, PH domain, and C-terminal constructs were Triton X-100-soluble, whereas the full-length construct of MAGUIN-1 was Triton X-100-insoluble (Fig. 9), suggesting that the whole structure of MAGUIN-1 is necessary for the interaction with the Triton X-100-insoluble structures.


View larger version (29K):
[in this window]
[in a new window]
 
Fig. 8.   Membrane association of MAGUINs in CHO cells. A, schematic description of various Myc-tagged constructs of MAGUINs. B, CHO cells transfected with various Myc-tagged constructs indicated in panel A were immunostained with the monoclonal anti-Myc antibody. 1f, pCMV Myc MAGUIN-1f (the full length of MAGUIN-1); 2f, pCMV Myc MAGUIN-2f (the full length of MAGUIN-2); n, pClneo Myc MAGUIN-n (the SAM and PDZ domains); m, pClneo Myc MAGUIN-m (the PH domain with the C-terminal stretch); c, pClneo Myc MAGUIN-c (the C-terminal region of MAGUIN-1).


View larger version (31K):
[in this window]
[in a new window]
 
Fig. 9.   Subcellular localization of MAGUIN-1 in CHO cells. CHO cells were transfected with various Myc-tagged constructs of MAGUIN-1. The homogenates of the cells were subfractionated into the cytosol, membrane, Triton X-100-soluble, and Triton X-100-insoluble fractions. Comparable amounts of fractions were immunoblotted with the monoclonal anti-Myc antibody. Lanes 1, homogenate; lanes 2, cytosol; lanes 3, membrane; lanes 4, Triton X-100-soluble; lanes 5, Triton X-100-insoluble. A, pCMV Myc MAGUIN-1f (the full length of MAGUIN-1). B, pClneo Myc MAGUIN-n (the SAM and PDZ domains). C, pClneo Myc MAGUIN-m (the PH domain with the C-terminal stretch). D, pClneo Myc MAGUIN-c (the C-terminal region of MAGUIN-1).

Recruitment of PSD-95/SAP90 and S-SCAM into Triton X-100-insoluble Fraction by MAGUIN-1-- In the last set of experiments, we tested whether MAGUIN-1 affected the subcellular localization of PSD-95/SAP90 and S-SCAM in the transfected cells. PSD-95/SAP90 and S-SCAM were distributed in the Triton X-100-soluble fraction in CHO cells (Fig. 10, A and B). MAGUIN-1 and -2 were distributed in the Triton X-100-insoluble fraction (Fig. 9A and data not shown). PSD-95/SAP90 and S-SCAM were recruited into the Triton X-100-insoluble fraction, when coexpressed with MAGUIN-1 (Fig. 10, C and D). In contrast, PSD-95/SAP90 and S-SCAM remained in the Triton X-100-soluble fraction, when coexpressed with MAGUIN-2 (data not shown).


View larger version (38K):
[in this window]
[in a new window]
 
Fig. 10.   Recruitment of PSD-95/SAP90 and S-SCAM into the Triton X-100-insoluble fraction by MAGUIN-1. CHO cells were transfected with either pCMV Myc MAGUIN-1f, pCMV PSD-95, and pCMV S-SCAM or the combination of pCMV Myc MAGUIN-1f with pCMV PSD-95 or pCMV S-SCAM. The homogenates of the cells were subfractionated into the cytosol, membrane, Triton X-100-soluble, and Triton X-100-insoluble fractions. The comparable amount of each fraction was immunoblotted with the indicated antibodies. Lanes 1, homogenate; lanes 2, cytosol; lanes 3, membrane; lanes 4, Triton X-100-soluble; lanes 5, Triton X-100-insoluble. A, PSD-95/SAP90. B, S-SCAM. C, PSD-95 in the presence of MAGUIN-1. D, S-SCAM in the presence of MAGUIN-1.


    DISCUSSION
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

In this paper, we have identified a novel ligand for S-SCAM and named it MAGUIN-1. We have also reported its short isoform, MAGUIN-2. MAGUIN-1 binds to PSD-95/SAP90 as well as to S-SCAM. MAGUINs have a unique combination of protein modules including SAM, PDZ, and PH domains. SAM domain is proposed to mediate protein binding or DNA binding (reviewed in Refs. 28 and 29). The subcellular localization of MAGUINs precludes a DNA binding role, but some protein may interact with MAGUINs via the SAM domain. The PDZ domain is a well known protein module that binds to the C terminus of other proteins (reviewed in Refs. 2-6). The study using the peptide library revealed the existence of two classes of the PDZ domains (41). Class I PDZ domains, such as those of PSD-95/SAP90, select the peptides containing Glu-(Ser/Thr)-Xaa-(Val/Ile) (Xaa is any amino acid) at the C terminus, whereas class II PDZ domains, such as that of CASK, select the peptides with hydrophobic or aromatic side chains at the C-terminal three residues (41). The PDZ domains are also reported to interact with other PDZ domains (36, 42). The PDZ domain is composed of two alpha  helixes and six beta  sheets, and the second alpha  helix and second beta  sheet provide a carboxyl-binding loop (32, 33). The residues of this loop of MAGUINs are diverged from those of PSD-95/SAP90 or CASK, suggesting that the ligand for the PDZ domain of MAGUINs has the C-terminal residues different from either group 1 or group 2 consensus motif (41). No interacting protein was obtained from the yeast two-hybrid screening using the PDZ domain of MAGUINs as a bait (data not shown), and whether the PDZ domain of MAGUINs functions as a protein-interacting module needs to be investigated. The PH domain binds to inositol phosphates and phosphoinositides and regulates the membrane association of many signaling proteins (reviewed in Refs. 39 and 40). We could not determine whether the PH domain was required for the membrane association, but we observed that MAGUIN-1 binds to the plasma membrane through the region containing the PH domain and the C-terminal region. This finding suggests that the PH domain can support the membrane attachment, as well as the C-terminal region. The C-terminal stretch of the PH domain of beta -adrenergic receptor kinase is reported to bind the beta gamma subunits of heterotrimeric GTP-binding proteins (Gbeta gamma ) (43). The C-terminal stretch of the PH domain of MAGUINs is diverged from that of beta -adrenergic receptor kinase, and the interaction of MAGUIN-1 with Gbeta gamma is not detected (data not shown). However, because the C-terminal region of MAGUIN-1 also mediates the membrane association, this region also has a binding activity for lipid or some membrane protein.

MAGUIN-1 is a common ligand for PSD-95/SAP90 and S-SCAM, which are both neuronal multiple PDZ domain-containing proteins. PSD-95/SAP90 and S-SCAM bind NMDA receptors, K+ channels, and neuroligin through distinct PDZ domains and assemble these molecules at synaptic junctions. PSD-95/SAP90 further interacts with neuronal nitric-oxide synthase, synGAP, and CRIPT (16-18, 36). synGAP regulates the activity of a small GTP-binding protein, Ras (16, 17). During this study, a Drosophila gene that genetically interacts with kinase suppressor of ras (ksr) has been reported and named connector enhancer of ksr (cnk) (44). cnk functions in the Ras/mitogen-activated protein kinase (MAPK) pathway, and the product of cnk physically binds Raf kinase. CNK has a molecular structure similar to that of MAGUINs. Therefore, MAGUIN-1 may also bind Raf kinase and links it to PSD-95/SAP90 and S-SCAM. The yeast two-hybrid screening using the GK domain of PSD-95/SAP90 revealed SPA-1-like protein besides SAPAP and BEGAIN (22). SPA-1 is a GAP protein for Rap1 (45), and Rap1 plays roles in the MAPK pathway (46). We have not confirmed the interaction of SPA-1-like protein with PSD-95/SAP90 using other methods and have not tested whether it has a GAP activity. However, these findings suggest a model that the components implicated in the Ras/MAPK pathway are assembled through the complex of PSD-95/SAP90 and MAGUIN-1. This model is interesting, because the Ras/MAPK pathway is suggested to be implicated in the synaptic plasticity (reviewed in Ref. 47). We are now testing this model. MAGUIN-1 is Triton X-100-insoluble and recruits PSD-95/SAP90 and S-SCAM into the Triton X-100-insoluble fraction. SAPAP has a similar activity for PSD-95/SAP90 and S-SCAM (22).2 These findings suggest that PSD-95/SAP90 and S-SCAM are connected to the Triton X-100-insoluble structures via the PDZ domain by MAGUIN-1 and via the GK domain by SAPAP. MAGUIN-2 does not bind to PSD-95/SAP90 or S-SCAM. MAGUIN-2 may compete with MAGUIN-1 for the same ligands, such as Raf kinase, and switch off these ligands from the network around PSD-95/SAP90 and S-SCAM.

C. elegans R01H10.8 also has a structure similar to that of MAGUINs and may be a homologue of MAGUINs (28). C. elegans has a putative S-SCAM homologue, K01A.6. Analysis of the mutants of R01H10.8 and K01A.6 may enlighten the physiological function of MAGUINs and the significance of the interaction of MAGUIN-1 with S-SCAM.

    ACKNOWLEDGEMENT

We thank Nils Brose (Max Planck Institute) for the monoclonal anti-NMDAR1 antibody.

    FOOTNOTES

* The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

The nucleotide sequence(s) reported in this paper has been submitted to the GenBankTM/EMBL Data Bank with accession number(s) AF102853 and AF102854.

parallel To whom correspondence should be addressed. Tel.: 81-66-879-3410; Fax: 81-66-879-3419; E-mail: ytakai{at}molbio.med.osak-u.ac.jp.

2 K. Hirao, unpublished observation.

    ABBREVIATIONS

The abbreviations used are: PSD, postsynaptic density; SAP, synapse-associated protein; PDZ, PSD-95/Dlg-A/ZO-1; GK, guanylate kinase; NMDA, N-methyl-D-aspartate; SAPAP, SAP90/PSD-95-associated protein; S-SCAM, synaptic scaffolding molecule; GST, glutathione S-transferase; SAM, sterile alpha  motif; PH, plekstrin homology; SPM, synaptic plasma membrane; MAPK, mitogen-activated protein kinase; CHO, Chinese hamster ovary.

    REFERENCES
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES
  1. Hammond, C. (1996) Cellular and Molecular Neurobiology, 1st Ed., pp. 20-40, Academic Press, Inc., San Diego, CA
  2. Kennedy, M. B. (1993) Curr. Opin. Neurobiol. 3, 732-737[CrossRef][Medline] [Order article via Infotrieve]
  3. Garner, C., and Kindler, S. (1996) Trends Cell Biol. 19, 429-433
  4. Kennedy, M. B. (1997) Trends Neurosci. 20, 264-268[CrossRef][Medline] [Order article via Infotrieve]
  5. Craven, S. E., and Bredt, D. S. (1998) Cell 93, 495-498[CrossRef][Medline] [Order article via Infotrieve]
  6. Hata, Y., Nakanishi, H., and Takai, Y. (1998) Neurosci. Res. 32, 1-7[CrossRef][Medline] [Order article via Infotrieve]
  7. Cho, K-O., Hunt, C. A., and Kennedy, M. B. (1992) Neuron 9, 929-942[CrossRef][Medline] [Order article via Infotrieve]
  8. Kistner, U., Wenzel, B. M., Veh, R. W., Cases-Langhoff, C., Garner, A. M., Appeltauer, U., Voss, B., Gundelfinger, E. D., and Garner, C. C. (1993) J. Biol. Chem. 268, 4580-4583[Abstract/Free Full Text]
  9. Ponting, C. P., and Phillips, C. (1995) Trends Biochem. Sci. 20, 102-103[CrossRef][Medline] [Order article via Infotrieve]
  10. Kennedy, M. B. (1995) Trends Biochem Sci. 20, 350[CrossRef][Medline] [Order article via Infotrieve]
  11. Fanning, A. S., and Anderson, J. M. (1996) Curr. Biol. 6, 1385-1388[CrossRef][Medline] [Order article via Infotrieve]
  12. Sheng, M. (1996) Neuron 17, 575-578[CrossRef][Medline] [Order article via Infotrieve]
  13. Kornau, H-C., Schenker, L. T., Kennedy, M. B., and Seeburg, P. H. (1995) Science 269, 1737-1740[Abstract/Free Full Text]
  14. Kim, E., Niethammer, M., Rothschild, A., Jan, Y. N., and Sheng, M. (1995) Nature 378, 85-88[CrossRef][Medline] [Order article via Infotrieve]
  15. Irie, M., Hata, Y., Takeuchi, M., Ichtchenko, K., Toyoda, A., Hirao, K., Takai, Y., Rosahl, T. W., and Sudhof, T. C. (1997) Science 277, 1511-1515[Abstract/Free Full Text]
  16. Kim, J. H., Liao, D., Lau, L.-F., and Huganir, R. L. (1998) Neuron 20, 683-691[CrossRef][Medline] [Order article via Infotrieve]
  17. Chen, H. J., Rojas-Soto, M., Oguni, A., and Kennedy, M. B. (1998) Neuron 20, 895-904[CrossRef][Medline] [Order article via Infotrieve]
  18. Niethammer, M., Valtschanoff, J. G., Kapoor, T. M., Allison, D. W., Weinberg, R. J., Craig, A. M., and Sheng, M. (1998) Neuron 20, 693-707[CrossRef][Medline] [Order article via Infotrieve]
  19. Kim, E., Naisbitt, S., Hsueh, Y.-P., Rao, A., Rothschild, A., Craig, A. M., and Sheng, M. (1997) J. Cell Biol. 136, 669-678[Abstract/Free Full Text]
  20. Takeuchi, M., Hata, Y., Hirao, K., Toyoda, A., Irie, M., and Takai, Y. (1997) J. Biol. Chem. 272, 11943-11951[Abstract/Free Full Text]
  21. Satoh, K., Yanai, H., Senda, T., Kohu, K., Nakamura, T., Okumura, N., Matsumine, A., Kobayashi, S., Toyoshima, K., and Akiyama, T. (1997) Genes Cells 2, 415-424[Abstract]
  22. Deguchi, M., Hata, Y., Takeuchi, M., Ide, N., Hirao, K., Yao, I., Irie, M., Toyoda, A., and Takai, Y. (1998) J. Biol. Chem. 273, 26269-26272[Abstract/Free Full Text]
  23. Dong, H., O'Brien, R. J., Fung, E. T., Lanahan, A. A., Worley, P. F., and Huganir, R. L. (1997) Nature 386, 279-284[CrossRef][Medline] [Order article via Infotrieve]
  24. Hirao, K., Hata, Y., Ide, N., Takeuchi, M., Irie, M., Yao, I., Deguchi, M., Toyoda, A., Sudhof, T. C., and Takai, Y. (1998) J. Biol. Chem. 273, 21105-21110[Abstract/Free Full Text]
  25. Chen, H. I., and Sudol, M. (1995) Proc. Natl. Acad. Sci. U. S. A. 92, 7819-7823[Abstract/Free Full Text]
  26. Schultz, J., Milpetz, F., Bork, P., and Ponting, C. P. (1998) Proc. Natl. Acad. Sci. U. S. A. 95, 5857-5864[Abstract/Free Full Text]
  27. Hata, Y., Butz, S., and Sudhof, T. C. (1996) J. Neurosci. 16, 2488-2494[Abstract/Free Full Text]
  28. Ponting, C. P. (1995) Protein Sci. 4, 1928-1930[Abstract]
  29. Schultz, J., Ponting, C. P., Hofman, K., and Bork, P. (1997) Protein Sci. 6, 249-253[Abstract]
  30. Wang, Y., Xu, H. P., Riggs, M., Rodgers, L., and Wigler, M. (1991) Mol. Cell. Biol. 11, 3554-3563[Abstract/Free Full Text]
  31. Ramezani, R. M., Xu, G., and Hollenberg, C. P. (1992) Mol. Gen. Genet. 236, 145-154[Medline] [Order article via Infotrieve]
  32. Doyle, A. D., Lee, A., Lewis, J., Kim, E., Sheng, M., and MacKinnon, R. (1996) Cell 85, 1067-1076[CrossRef][Medline] [Order article via Infotrieve]
  33. Cabral, J. H., Petosa, C., Sutcliffe, M. J., Raza, S., Byron, O., Poy, F., Marfatia, S. M., Chishti, A. H., and Liddington, R. C. (1996) Nature 382, 649-652[CrossRef][Medline] [Order article via Infotrieve]
  34. van der Bliek, A. M., Redelmeier, T. E., Damke, H., Tisdale, E. J., Meyerowitz, E. M., and Schmid, S. L. (1993) J. Cell Biol. 122, 553-563[Abstract/Free Full Text]
  35. Telemenakis, I., Benseler, F., Stenius, K., Sudhof, T. C., and Brose, N. (1997) Eur. J. Cell Biol. 74, 143-149[Medline] [Order article via Infotrieve]
  36. Brenman, J. E., Chao, D., Gee, S. H., McGee, A. W., Craven, S. E., Santillano, D. R., Wu, Z., Huang, F., Xia, H., Peters, M. F., Froehner, S. C., and Bredt, D. S. (1996) Cell 84, 757-767[CrossRef][Medline] [Order article via Infotrieve]
  37. Kim, E., Cho, K-O., Rothschild, A., and Sheng, M. (1996) Neuron 17, 103-113[CrossRef][Medline] [Order article via Infotrieve]
  38. Muller, B. M., Kistner, U., Veh, R. W., Cases-Langhoff, C., Becker, B., Gundelfinger, E. D., and Garner, C. C. (1995) J. Neurosci. 15, 2354-2366[Abstract]
  39. Pawson, T. (1995) Nature 373, 573-580[CrossRef][Medline] [Order article via Infotrieve]
  40. Cohen, G. B., Ren, R., and Baltimore, D. (1995) Cell 80, 237-248[CrossRef][Medline] [Order article via Infotrieve]
  41. Songyang, Z., Fanning, A. S., Fu, C., Xu, J., Marfatia, S. M., Chisti, A. H., Crompton, A., Chan, A. C., Anderson, J. M., and Cantley, L. C. (1997) Science 275, 73-77[Abstract/Free Full Text]
  42. Srivastava, S., Osten, P., Vilim, F. S., Khatri, L., Inman, G., States, B., Daly, C., DeSouza, S., Abagyan, R., Valtschanoff, J. G., Weinberg, R. J., and Ziff, E. B. (1998) Neuron 21, 581-591[CrossRef][Medline] [Order article via Infotrieve]
  43. Touhara, K., Inglese, J., Pitcher, J. A., Shaw, G., and Lefkowitz, R. J. (1994) J. Biol. Chem. 269, 10217-10220[Abstract/Free Full Text]
  44. Therrien, M., Wong, A. M., and Rubin, G. M. (1998) Cell 95, 343-353[CrossRef][Medline] [Order article via Infotrieve]
  45. Kurachi, H., Wada, Y., Tsukamoto, N., Maeda, M., Kubota, H., Hattori, M., Iwaki, K., and Minato, N. (1997) J. Biol. Chem. 272, 28081-28088[Abstract/Free Full Text]
  46. York, R. D., Yao, H., Dillon, T., Ellig, C. L., Eckert, S. P., McCleskey, E. W., and Stork, P. J. (1998) Nature 392, 622-626[CrossRef][Medline] [Order article via Infotrieve]
  47. Finkbeiner, S., and Greenberg, M. E. (1996) Neuron 16, 233-236[CrossRef][Medline] [Order article via Infotrieve]


Copyright © 1999 by The American Society for Biochemistry and Molecular Biology, Inc.
Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
J. Neurosci.Home page
F. Deng, M. G. Price, C. F. Davis, M. Mori, and D. L. Burgess
Stargazin and other transmembrane AMPA receptor regulating proteins interact with synaptic scaffolding protein MAGI-2 in brain.
J. Neurosci., July 26, 2006; 26(30): 7875 - 7884.
[Abstract] [Full Text] [PDF]


Home page
J BiochemHome page
A. Kawata, J. Iida, M. Ikeda, Y. Sato, H. Mori, A. Kansaku, K. Sumita, N. Fujiwara, C. Rokukawa, M. Hamano, et al.
CIN85 Is Localized at Synapses and Forms a Complex with S-SCAM via Dendrin.
J. Biochem., May 1, 2006; 139(5): 931 - 939.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
A. Ziogas, K. Moelling, and G. Radziwill
CNK1 Is a Scaffold Protein That Regulates Src-mediated Raf-1 Activation
J. Biol. Chem., June 24, 2005; 280(25): 24205 - 24211.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
A. B. Jaffe, P. Aspenstrom, and A. Hall
Human CNK1 Acts as a Scaffold Protein, Linking Rho and Ras Signal Transduction Pathways
Mol. Cell. Biol., February 15, 2004; 24(4): 1736 - 1746.
[Abstract] [Full Text] [PDF]


Home page
FASEB J.Home page
T. M. LANIGAN, A. LIU, Y. Z. HUANG, L. MEI, B. MARGOLIS, and K.-L. GUAN
Human homologue of Drosophila CNK interacts with Ras effector proteins Raf and Rlf
FASEB J, November 1, 2003; 17(14): 2048 - 2060.
[Abstract] [Full Text] [PDF]


Home page
J. Neurosci.Home page
I. Yao, J. Iida, W. Nishimura, and Y. Hata
Synaptic and Nuclear Localization of Brain-Enriched Guanylate Kinase-Associated Protein
J. Neurosci., July 1, 2002; 22(13): 5354 - 5364.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
I. A. Lim, D. D. Hall, and J. W. Hell
Selectivity and Promiscuity of the First and Second PDZ Domains of PSD-95 and Synapse-associated Protein 102
J. Biol. Chem., June 7, 2002; 277(24): 21697 - 21711.
[Abstract] [Full Text] [PDF]


Home page
J. Neurosci.Home page
W. Nishimura, I. Yao, J. Iida, N. Tanaka, and Y. Hata
Interaction of Synaptic Scaffolding Molecule and beta -Catenin
J. Neurosci., February 1, 2002; 22(3): 757 - 765.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
H. Kawabe, H. Nakanishi, M. Asada, A. Fukuhara, K. Morimoto, M. Takeuchi, and Y. Takai
Pilt, a Novel Peripheral Membrane Protein at Tight Junctions in Epithelial Cells
J. Biol. Chem., December 14, 2001; 276(51): 48350 - 48355.
[Abstract] [Full Text] [PDF]


Home page
J. Am. Soc. Nephrol.Home page
K. M. PATRIE, A. J. DRESCHER, M. GOYAL, R. C. WIGGINS, and B. MARGOLIS
The Membrane-Associated Guanylate Kinase Protein MAGI-1 Binds Megalin and Is Present in Glomerular Podocytes
J. Am. Soc. Nephrol., April 1, 2001; 12(4): 667 - 677.
[Abstract] [Full Text] [PDF]


Home page
Physiol. Rev.Home page
Y. Takai, T. Sasaki, and T. Matozaki
Small GTP-Binding Proteins
Physiol Rev, January 1, 2001; 81(1): 153 - 208.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
H. Kawabe, Y. Hata, M. Takeuchi, N. Ide, A. Mizoguchi, and Y. Takai
nArgBP2, a Novel Neural Member of Ponsin/ArgBP2/Vinexin Family That Interacts with Synapse-associated Protein 90/Postsynaptic Density-95-associated Protein (SAPAP)
J. Biol. Chem., October 22, 1999; 274(43): 30914 - 30918.
[Abstract]