![]()
|
|
||||||||
J Biol Chem, Vol. 274, Issue 17, 11889-11896, April 23, 1999
From the Postsynaptic density
(PSD)-95/Synapse-associated protein (SAP) 90 and synaptic scaffolding
molecule (S-SCAM) are neuronal membrane-associated guanylate kinases.
Because PSD-95/SAP90 and S-SCAM function as synaptic scaffolding
proteins, identification of ligands for these proteins is important to
elucidate the structure of synaptic junctions. Here, we report a novel
protein interacting with the PDZ domains of PSD-95/SAP90 and S-SCAM and
named it MAGUIN-1 (membrane-associated guanylate kinase-interacting
protein-1). MAGUIN-1 has one sterile Synaptic junctions are interneuronal cell-cell junctions
differentiated for neurotransmission. Neurotransmitters are released from the synaptic vesicles into the synaptic cleft and bind to the
receptors accumulated at the postsynapse, opening the ion channels and
generating the second messengers involved in synaptic plasticity
(reviewed in Ref. 1). The components required for this process are
organized at the synaptic junctions to play specific roles in
felicitous orders. Several scaffolding proteins are reported to be
involved in the assembly of components of synaptic junctions (reviewed
in Refs. 2-6). Postsynaptic density
(PSD)1-95/synapse-associated
protein (SAP) 90 has three PSD-95/Dlg-A/ZO-1 (PDZ) domain, one Src
homology 3 domain, and one guanylate kinase (GK) domain (7, 8). The PDZ
domain is a protein-interacting module (reviewed in Refs. 9-12), and
PSD-95/SAP90 binds the C termini of N-methyl-D-aspartate
(NMDA) receptors, K+ channels, neuroligins, synGAP, and
CRIPT through distinct PDZ domains to assemble these components at the
synaptic junctions (13-18). PSD-95/SAP90 interacts with
SAP90/PSD-95-associated protein (SAPAP) (also called GK-associated
protein and hDLG-associated protein) (19-21), and a recently
identified protein, BEGAIN (brain-enriched guanylate kinase-interacting
protein) via the GK domain (22). Glutamate
receptor-interacting protein has seven PDZ domains and binds Yeast Two-hybrid Screening and cDNA Cloning--
Rat brain
yeast two-hybrid library was constructed using pVP16 vector and
screened (27). Rat brain cDNA libraries were screened with the
[ Construction of Expression Vectors--
Various expression
vectors were constructed by conventional molecular biology techniques
and polymerase chain reaction method using pBTM116, pBTM116-2, pCMV
Myc, pCMV Myc2, pClneo Myc, pGex5X-3 (Amersham Pharmacia Biotech),
pGex4T-1 (Amersham Pharmacia Biotech), and pGexKG. pBTM116-2, pCMV
Myc, and pClneo Myc were constructed from pBTM116, pCMV5, and pClneo,
respectively (24). pCMV Myc2 was constructed by ligating
aattcgagatctcgggtaccacgcgtatcgatatcgcggccg/ctagcggccgcgatatcgatacgcgtggtacccgagatctcg into EcoRl/Xbal sites of pCMV Myc. pCMV PSD-95, pCMV S-SCAM,
and pClneo Myc S-SCAM-1, -2, -3, and -4 were described previously (20,
24). pBTM116 S-SCAM-13, -14, and -16 and pClneo Myc S-SCAM-9, -10, and
-11 contain the amino acid residues 413-1114, 413-1277, 728-1277,
603-1023, 906-1277, and 772-1277 of S-SCAM, respectively. pBTM116
MAGUIN-9, pGex4T-1 MAGUIN-1, pGex5X-3 MAGUIN-12, pCMV Myc MAGUIN-1f,
and pClneo Myc MAGUIN-n, -m, and -c contain the amino acid residues
846-1032, 716-858, 846-1032, 1-1032, 1-469, 458-858, and
568-1032 of MAGUIN-1, respectively. pGex5X-3 MAGUIN-16 and pCMV Myc
MAGUIN-2f contain the amino acid residues 568-896 and 1-896 of
MAGUIN-2, respectively. pCMV Myc PSD-95-1, -5, and -6 contain the amino
acid residues 1-724, 1-407, and 432-724 of PSD-95/SAP90, respectively.
Antibodies--
Rabbit polyclonal antibodies were raised against
the products of pGex4T-1 MAGUIN-1 and pGex5X-3 MAGUIN-16. The
monoclonal anti-Myc-tag antibody, 9E10, was obtained from American Type
Culture Collection. The anti- Preparation of COS Cell Extract--
COS cells were cultured in
Dulbecco's modified Eagle's medium with 10% fetal bovine serum under
10% CO2 at 37 °C and transfected with DEAE-dextran
(20). COS cells of two 10-cm plates were homogenized in 0.5 ml of 20 mM Tris/HCl, pH 7.4, containing 100 mM NaCl and 1% (w/v) Triton X-100 and centrifuged at 100,000 × g
for 30 min. The supernatant was used as a COS cell extract.
In Vitro Binding Experiment Using GST Fusion Proteins and COS
Cell Extract--
0.5-ml aliquots of the COS cell extract were
incubated with 200 pmol of various GST constructs fixed on 20 µl of
glutathione-Sepharose 4B beads. After the beads were washed with 50 mM Tris/HCl, pH 7.4, containing 100 mM NaCl and
1% (w/v) Triton X-100, proteins on the beads were detected with the
immunoblottings using the appropriate antibodies.
Coimmunoprecipitation--
The crude synaptosomal fraction was
prepared from four rat brains as described (24). The fraction was
homogenized in 16 ml of 50 mM Hepes/NaOH, pH 8.0, containing 100 mM NaCl, 5 mM EDTA, 1% (w/v)
deoxycholic acid, and 1% (w/v) Nonidet P-40 and centrifuged at
100,000 × g for 30 min to collect the supernatant.
4-ml aliquots of the supernatant were incubated with the
anti-PSD-95/SAP90 antibody, the anti-S-SCAM antibody, or the preimmune
serum fixed on 20 µl of protein G-Sepharose Fast Flow beads. After
the beads were washed four times with 50 mM NaOH/Hepes, pH
8.0, containing 100 mM NaCl, and 1% (w/v) Triton X-100,
proteins on the beads were detected with the immunoblottings using the
appropriate antibodies.
Subcellular Fractionation of CHO Cells--
CHO cells were
transfected with various eukaryote expression vectors using TransFast
Transfection Reagent (Promega). After 48 h, the cells were
collected and homogenized in 300 µl of 20 mM Hepes/NaOH,
pH 7.4, by sonication. 80 µl of the homogenate was kept for the
analysis, and the remaining samples were centrifuged at 100,000 × g for 30 min to separate the supernatant and the pellet. The
pellet was homogenized in 220 µl of 20 mM Hepes/NaOH, pH
7.4, containing 1% (w/v) Triton X-100 and centrifuged at 10,000 × g for 10 min to separate the supernatant and the pellet.
Miscellaneous Procedures--
Other procedures, including
subcellular fractionation of rat brain, primary cultures of rat
hippocampal neurons, immunocytostaining, SDS-polyacrylamide gel
electrophoresis, and protein determination, were performed as described
(20). Northern and Western blottings were performed using multiple
tissue Northern blots (CLONTECH) and ECL reagents
(Amersham Pharmacia Biotech), respectively.
Identification of MAGUINs--
We performed the yeast two-hybrid
screening using baits containing the PDZ domains of S-SCAM (pBTM116
S-SCAM-13, -14, and -16). We obtained 34 positive independent clones
from 5 × 106 clones of a rat brain yeast two-hybrid
library. The sequences of 22 clones were novel, and we performed
Northern blot analysis for these clones. The messages of two clones
(pPrey 4233 and pPrey 4514) were detected only in the brain. During the
study, the sequence of human brain-specific angiogenesis inhibitor-1
was reported, and pPrey 4514 turned out to be rat brain-specific
angiogenesis inhibitor-1. We obtained the presumptive full-length
coding sequences of pPrey 4233 through the conventional hybridization
screening using a rat brain cDNA library and polymerase chain
reaction using rat brain cDNAs as templates. Two isoforms were
detected and named MAGUIN-1 and -2. MAGUIN-1 had 1032 amino acids and
was composed of one sterile Interaction of MAGUIN-1 with S-SCAM and PSD-95/SAP90--
To
confirm the interaction of MAGUIN-1 with S-SCAM, the extract of COS
cells expressing S-SCAM was incubated with either GST-MAGUIN-12 containing the C terminus of MAGUIN-1 or GST-MAGUIN-16 containing the C
terminus of MAGUIN-2. The C terminus of MAGUIN-1 interacted with
S-SCAM, whereas the C terminus of MAGUIN-2 did not (Fig. 3A). MAGUIN-1 was
coimmunoprecipitated with S-SCAM from the rat crude synaptosomal
fraction (Fig. 3, B and C). To determine the interacting region of S-SCAM with MAGUIN-1, various Myc-tagged constructs of S-SCAM were incubated with GST-MAGUIN-12 containing the C
terminus of MAGUIN-1 (Fig.
4A). Myc-S-SCAM-1, -4, -11, and -10 interacted, whereas Myc-S-SCAM-2, -3, and -9 did not (Fig. 4B), suggesting that the fourth and fifth PDZ domains were
involved in the interaction. From the reverse yeast two-hybrid
screening using pBTM116 MAGUIN-9 as a bait, the PDZ domains of
PSD-95/SAP90, PSD93/chapsyn110, and SAP97 were obtained (36-38),
suggesting that MAGUIN-1 interacted with not only S-SCAM but also
PSD-95/SAP90 and its isoforms. MAGUIN-1 was coimmunoprecipitated with
PSD-95/SAP90 from the rat crude synaptosomal fraction (Fig.
5A). The interaction of
MAGUIN-1 with the PDZ domains of PSD-95/SAP90 was confirmed using
Myc-tagged constructs of PSD-95/SAP90 and the GST construct of MAGUIN-1
(Fig. 5B).
Tissue and Subcellular Distribution of MAGUINs--
Northern blot
analysis revealed 4.4- and 5.4-kilobase pair messages only in brain
(Fig. 6). The two messages with different sizes may reflect differential polyadenylation. No message was detected
in heart, spleen, lung, liver, kidney, skeletal muscles, or testis. In
the subcellular fractionation of rat brain, MAGUINs were detected
mainly in the synaptic plasma membrane (SPM) and PSD fractions (Fig.
7A). Two bands with different
molecular sizes may represent protein degradation, post-translational
modifications, or alternative splicing isoforms. In rat hippocampal
neurons, MAGUINs were distributed in the cell body and the neurites and colocalized with NMDAR1 (Fig. 7B).
Interaction of MAGUINs with Membrane--
The PH domain is known
to interact with the phospholipid membrane (reviewed in Refs. 39 and
40). To test whether MAGUINs associate with the plasma membrane through
the PH domain, various Myc-tagged constructs of MAGUINs were
transfected in CHO cells (Fig.
8A). Full-length MAGUIN-1 and
-2 and the construct containing the PH domain with the C-terminal
stretch were localized at the plasma membrane (Fig. 8B,
1f, 2f, and m). The construct
containing the SAM and PDZ domains was distributed in the cytosol (Fig.
8B, n). The construct containing the C-terminal
region of MAGUIN-1 was localized at the plasma membrane, although it
lacked the PH domain (Fig. 8B, c). The similar
results were obtained in the subcellular fractionation of CHO cells
transfected with these constructs. Full-length MAGUIN-1 was recovered
in the membrane fraction (Fig.
9A). The N-terminal construct
containing the SAM and PDZ domains was distributed more in the cytosol
than in the membrane fraction (Fig. 9B). The PH domain with
the C-terminal stretch was recovered in the membrane fraction (Fig.
9C). The C-terminal construct was recovered mainly in the
membrane fraction with a smaller amount in the cytosol (Fig.
9D). Because the construct containing only the PH domain was
not expressed, we could not determine whether the PH domain was
directly involved in the membrane association of MAGUIN-1. However,
these findings suggest that MAGUIN-1 associates with the plasma
membrane through the region containing the PH domain and the C-terminal
stretch of the PH domain. The N-terminal, PH domain, and C-terminal
constructs were Triton X-100-soluble, whereas the full-length construct
of MAGUIN-1 was Triton X-100-insoluble (Fig. 9), suggesting that the
whole structure of MAGUIN-1 is necessary for the interaction with the Triton X-100-insoluble structures.
Recruitment of PSD-95/SAP90 and S-SCAM into Triton X-100-insoluble
Fraction by MAGUIN-1--
In the last set of experiments, we tested
whether MAGUIN-1 affected the subcellular localization of PSD-95/SAP90
and S-SCAM in the transfected cells. PSD-95/SAP90 and S-SCAM were
distributed in the Triton X-100-soluble fraction in CHO cells (Fig.
10, A and B).
MAGUIN-1 and -2 were distributed in the Triton X-100-insoluble fraction
(Fig. 9A and data not shown). PSD-95/SAP90 and S-SCAM were
recruited into the Triton X-100-insoluble fraction, when coexpressed
with MAGUIN-1 (Fig. 10, C and D). In contrast,
PSD-95/SAP90 and S-SCAM remained in the Triton X-100-soluble fraction,
when coexpressed with MAGUIN-2 (data not shown).
In this paper, we have identified a novel ligand for S-SCAM and
named it MAGUIN-1. We have also reported its short isoform, MAGUIN-2.
MAGUIN-1 binds to PSD-95/SAP90 as well as to S-SCAM. MAGUINs have a
unique combination of protein modules including SAM, PDZ, and PH
domains. SAM domain is proposed to mediate protein binding or DNA
binding (reviewed in Refs. 28 and 29). The subcellular localization of
MAGUINs precludes a DNA binding role, but some protein may interact
with MAGUINs via the SAM domain. The PDZ domain is a well
known protein module that binds to the C terminus of other proteins
(reviewed in Refs. 2-6). The study using the peptide library revealed
the existence of two classes of the PDZ domains (41). Class I PDZ
domains, such as those of PSD-95/SAP90, select the peptides containing
Glu-(Ser/Thr)-Xaa-(Val/Ile) (Xaa is any amino acid) at the C terminus,
whereas class II PDZ domains, such as that of CASK, select the peptides
with hydrophobic or aromatic side chains at the C-terminal three
residues (41). The PDZ domains are also reported to interact with other
PDZ domains (36, 42). The PDZ domain is composed of two MAGUIN-1 is a common ligand for PSD-95/SAP90 and S-SCAM, which are both
neuronal multiple PDZ domain-containing proteins. PSD-95/SAP90 and
S-SCAM bind NMDA receptors, K+ channels, and neuroligin
through distinct PDZ domains and assemble these molecules at synaptic
junctions. PSD-95/SAP90 further interacts with neuronal nitric-oxide
synthase, synGAP, and CRIPT (16-18, 36). synGAP regulates the activity
of a small GTP-binding protein, Ras (16, 17). During this study, a
Drosophila gene that genetically interacts with kinase
suppressor of ras (ksr) has been reported and named
connector enhancer of ksr (cnk) (44).
cnk functions in the Ras/mitogen-activated protein kinase
(MAPK) pathway, and the product of cnk physically binds Raf
kinase. CNK has a molecular structure similar to that of MAGUINs.
Therefore, MAGUIN-1 may also bind Raf kinase and links it to
PSD-95/SAP90 and S-SCAM. The yeast two-hybrid screening using the GK
domain of PSD-95/SAP90 revealed SPA-1-like protein besides SAPAP and
BEGAIN (22). SPA-1 is a GAP protein for Rap1 (45), and Rap1 plays roles
in the MAPK pathway (46). We have not confirmed the interaction of SPA-1-like protein with PSD-95/SAP90 using other methods and have not
tested whether it has a GAP activity. However, these findings suggest a
model that the components implicated in the Ras/MAPK pathway are
assembled through the complex of PSD-95/SAP90 and MAGUIN-1. This model
is interesting, because the Ras/MAPK pathway is suggested to be
implicated in the synaptic plasticity (reviewed in Ref. 47). We are now
testing this model. MAGUIN-1 is Triton X-100-insoluble and recruits
PSD-95/SAP90 and S-SCAM into the Triton X-100-insoluble fraction. SAPAP
has a similar activity for PSD-95/SAP90 and S-SCAM
(22).2 These findings suggest
that PSD-95/SAP90 and S-SCAM are connected to the Triton
X-100-insoluble structures via the PDZ domain by MAGUIN-1
and via the GK domain by SAPAP. MAGUIN-2 does not bind to
PSD-95/SAP90 or S-SCAM. MAGUIN-2 may compete with MAGUIN-1 for the same
ligands, such as Raf kinase, and switch off these ligands from the
network around PSD-95/SAP90 and S-SCAM.
C. elegans R01H10.8 also has a structure similar to that of
MAGUINs and may be a homologue of MAGUINs (28). C. elegans
has a putative S-SCAM homologue, K01A.6. Analysis of the mutants of R01H10.8 and K01A.6 may enlighten the physiological function of MAGUINs
and the significance of the interaction of MAGUIN-1 with S-SCAM.
We thank Nils Brose (Max Planck Institute) for
the monoclonal anti-NMDAR1 antibody.
*
The costs of publication of this
article were defrayed in part by the
payment of page charges. The article
must therefore be hereby marked
"advertisement" in
accordance with 18 U.S.C. Section
1734 solely to indicate this fact.
The nucleotide sequence(s) reported in this paper has been submitted to the GenBankTM/EMBL Data Bank with accession number(s) AF102853 and AF102854.
2
K. Hirao, unpublished observation.
The abbreviations used are:
PSD, postsynaptic
density;
SAP, synapse-associated protein;
PDZ, PSD-95/Dlg-A/ZO-1;
GK, guanylate kinase;
NMDA, N-methyl-D-aspartate;
SAPAP, SAP90/PSD-95-associated protein;
S-SCAM, synaptic scaffolding
molecule;
GST, glutathione S-transferase;
SAM, sterile
MAGUIN, a Novel Neuronal Membrane-associated Guanylate
Kinase-interacting Protein*
,
,
,
,
,
,
¶
Takai Biotimer Project, Exploratory Research
for Advanced Technology, Japan Science and Technology Corporation, c/o
JCR Pharmaceuticals Co. Ltd., 2-2-10 Murotani, Nishi-ku, Kobe 651-2241, Japan, the § Department of Anatomy and Neurobiology,
Graduate School, Kyoto University, Kyoto 606-8315, Japan, and the
¶ Department of Molecular Biology and Biochemistry, Osaka
University Medical School, Suita 565-0871, Japan
![]()
ABSTRACT
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES
motif, one PDZ, and one
plekstrin homology domain. MAGUIN-1 is localized at the plasma membrane
via the plekstrin homology domain and the C-terminal region
and interacts with PSD-95/SAP90 and S-SCAM via a C-terminal
PDZ domain-binding motif. MAGUIN-1 has a short isoform, MAGUIN-2, which
lacks a PDZ domain-binding motif. MAGUINs are expressed in neurons and
localized in the cell body and neurites and are coimmunoprecipitated
with PSD-95/SAP90 and S-SCAM from rat crude synaptosome. MAGUIN-1 may
play an important role with PSD-95/SAP90 and S-SCAM to assemble the
components of synaptic junctions.
![]()
INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES
amino-3-hydroxy-5-methyl-4-isoxazaole propionic acid receptors via the fourth and fifth PDZ domains (23). The ligands for
other PDZ domains of glutamate receptor-interacting protein have not been so far reported. Synaptic scaffolding molecule (S-SCAM) was originally identified as a SAPAP-interacting protein (24). We have
first reported that S-SCAM has one GK, two WW, and five PDZ domains
(24). The GK domain of S-SCAM is shorter than that of PSD-95/SAP90. The
WW domain is a protein-interacting module binding a proline-rich
sequence (25). The recent version of simple modular architecture
research tool recognizes an additional PDZ domain at the N terminus of
S-SCAM (26). We number these PDZ domains consecutively from 0 to 5 (PDZ0, -1, -2, -3, -4, and -5) to keep consistency with the first
report. Among six PDZ domains, PDZ1 and -5 bind to the C termini of
neuroligin and NMDA receptors, respectively (24). Because S-SCAM has
more PDZ domains than PSD-95/SAP90, it may integrate more components of
synaptic junctions. Based on this assumption, we have performed a yeast
two-hybrid screening using the PDZ domains of S-SCAM to obtain a novel
neuronal molecule. Eventually, this molecule binds not only to S-SCAM
but also to PSD-95/SAP90. We have named this protein MAGUIN-1
(membrane-associated guanylate kinase-interacting protein-1).
![]()
MATERIALS AND METHODS
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES
-32P]dCTP-labeled random-primed probes (27).
-aminobutyric acid A receptor antibody
was purchased from Chemicon. The anti-NMDAR1 antibody was a generous gift of Dr. Nils Brose (Max Planck Institute). The anti-S-SCAM antibody
was described (24).
![]()
RESULTS
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES
motif (SAM) domain, one PDZ domain, and
one plekstrin homology (PH) domain (Fig.
1A). MAGUIN-1 had Thr-His-Val
at the C terminus, which corresponded to the PDZ domain-binding motif. pPrey 4233 contained the C-terminal 319 residues of MAGUIN-1 (amino acids 714-1032, underlined in Fig. 1A). MAGUIN-2
contained the N-terminal 895 amino acids of MAGUIN-1 and is terminated
with Ser as the last (896th) residue, lacking the PDZ domain-binding motif (Fig. 1B). The SAM domain of MAGUINs is about 30%
homologous to those of Caenorhabditis elegans R01H10.8 and
yeast byr2 and about 15% homologous to that of yeast
STE50 (Fig. 2A)
(28-31). The PDZ domain of MAGUINs is about 40% homologous to that of
C. elegans R01H10.8 (Fig. 2B). The homology with
the PDZ domain of PSD-95/SAP90 or CASK is about 15%, and among others
the residues of the first
helix are rather well conserved (Fig.
2B) (32, 33). The PH domain of MAGUINs is about 20%
homologous to those of C. elegans R01H10.8, human dynamin,
and rsec7 (Fig. 2C) (34, 35). This region of MAGUINs is
about 55% homologous to human KIAA0403 (Fig. 2C). Although
the complete coding sequence of KIAA0403 is not reported, it may be a
human isoform of MAGUINs. Because C. elegans R01H10.8 has a
similar molecular structure, it may be a C. elegans
homologue of MAGUINs.

View larger version (45K):
[in a new window]
Fig. 1.
Sequences of MAGUINs. Residues are shown
in single-letter codes. A, amino acid sequence of MAGUIN-1.
The residues of SAM, PDZ, and PH domains are boxed with black
lines, boxed with gray lines, and shaded,
respectively. The region contained in the clone from the yeast
two-hybrid screening is underlined. B, the
C-terminal sequence of MAGUIN-2.

View larger version (72K):
[in a new window]
Fig. 2.
Sequence alignment of each domain of
MAGUINs. Residues are shown in single-letter codes. The residues
conserved among four, three, and two proteins are indicated on the
green, orange, and light or dark
blue backgrounds, respectively. A, alignment of the SAM
domains of MAGUINs, C. elegans R01H10.8, yeast
byr2, and STE50. B, alignment of the PDZ domain
of MAGUINs with the PDZ domain of C. elegans R01H10.8, the
PDZ domain of CASK, and the third PDZ domain of PSD-95/SAP90. The amino
acids of
helixes and
sheets are indicated in boxes.
C, alignment of the PH domains of MAGUINs, C. elegans R01H10.8, KIAA0403, dynamin, and rsec7.

View larger version (19K):
[in a new window]
Fig. 3.
Interaction of MAGUIN-1 with S-SCAM.
A, interaction of S-SCAM with the C-terminal region of
MAGUIN-1. The extract of COS cells expressing S-SCAM was incubated with
either GST-MAGUIN-12 (the C-terminal construct of MAGUIN-1) or
GST-MAGUIN-16 (the C-terminal construct of MAGUIN-2) fixed on the
glutathione beads, and the proteins attached to the beads were detected
by the anti-S-SCAM antibody. Lane 1, the original sample
before the incubation; lane 2, the sample incubated with
GST-MAGUIN-12; lane 3, the sample incubated with
GST-MAGUIN-16. B, coimmunoprecipitation of S-SCAM with
MAGUIN-1. The Triton X-100 extract of the rat crude synaptosomal
fraction was incubated with either the anti-MAGUIN serum or the
preimmune serum on protein G-Sepharose beads, and the proteins attached
to the beads were immunoblotted with the anti-S-SCAM antibody.
Lane 1, the original Triton X-100 extract of rat crude
synaptosome before the incubation; lane 2, with the
preimmune serum; lane 3, with the anti-MAGUIN antibody.
C, coimmunoprecipitation of MAGUIN-1 with S-SCAM. The Triton
X-100 extract of the rat crude synaptosomal fraction was incubated with
either the anti-S-SCAM serum or the preimmune serum on protein
G-Sepharose beads, and the proteins attached to the beads were
immunoblotted with the anti-MAGUIN antibody. Lane 1, the
original Triton X-100 extract of rat crude synaptosome before the
incubation; lane 2, with the preimmune serum; lane
3, with the anti-S-SCAM antibody.

View larger version (20K):
[in a new window]
Fig. 4.
MAGUIN-1-interacting domain of S-SCAM.
A, schematic description of various Myc-tagged constructs of
S-SCAM. The letter (a-g) to the left
of each construct corresponds to the letter of each
lane in panel B. B, the extract of COS cells
expressing various Myc-tagged constructs of S-SCAM were incubated with
GST-MAGUIN-12 fixed on the glutathione beads, and the proteins attached
to the beads were detected with the anti-Myc antibody. Lane
a, pClneo Myc S-SCAM-1; lane b, pClneo Myc S-SCAM-2;
lane c, pClneo Myc S-SCAM-3; lane d, pClneo Myc
S-SCAM-4; lane e, pClneo Myc S-SCAM-9; lane f,
pClneo Myc S-SCAM-10; lane g, pClneo Myc S-SCAM-11.

View larger version (21K):
[in a new window]
Fig. 5.
Interaction of MAGUIN-1 with
PSD-95/SAP90. A, coimmunoprecipitation of MAGUIN-1 with
PSD-95/SAP90. The Triton X-100 extract of the rat crude synaptosomal
fraction was incubated with either the anti-PSD-95/SAP90 serum or the
preimmune serum on protein G-Sepharose beads, and the proteins attached
to the beads were immunoblotted with the anti-MAGUIN antibody.
Lane 1, the original Triton X-100 extract of rat crude
synaptosome before the incubation; lane 2, with the
preimmune serum; lane 3, with the anti-PSD-95/SAP90
antibody. B, interaction of MAGUIN-1 with the PDZ domains of
PSD-95/SAP90. The extract of COS cells expressing various Myc-tagged
PSD-95/SAP90 was incubated with GST-MAGUIN-12 (the C-terminal construct
of MAGUIN-1) or GST-MAGUIN-16 (the C-terminal construct of MAGUIN-2)
fixed on the glutathione beads, and the proteins attached to the beads
were detected with the anti-Myc antibody. Lanes 1-3, the
full-length of PSD-95/SAP90; lanes 4-6, the PDZ domains of
PSD-95/SAP90; lanes 7-9, the Src homology 3 and
GK domains of PSD-95/SAP90. Lanes 1, 4, and
7, the original samples before the incubation; lanes
2, 5, and 8, after the incubation with
GST-MAGUIN-12; lanes 3, 6, and 9,
after the incubation with GST-MAGUIN-16.

View larger version (41K):
[in a new window]
Fig. 6.
Northern blot analysis of MAGUINs. A
blot with 2 µg of mRNA from each rat tissue was hybridized with
an uniformly labeled MAGUIN-1 and exposed at
80 °C for 2 days.
Lane 1, heart; lane 2, brain; lane 3,
spleen; lane 4, lung; lane 5, liver; lane
6, skeletal muscle; lane 7, kidney; lane 8,
testis. kb, kilobase pairs.

View larger version (56K):
[in a new window]
Fig. 7.
Subcellular localization of MAGUINs.
A, Western blot analysis of the subcellular fractions of rat
brain. Equal aliquots of the subcellular fractions of rat brain (25 µg of protein each) were immunoblotted with the anti-MAGUIN antibody.
Lane 1, the homogenate fraction; lane 2, the
nuclear pellet fraction; lane 3, the crude synaptosomal
fraction; lane 4, the synaptosomal cytosol fraction;
lane 5, the crude synaptosomal pellet fraction; lane
6, the crude synaptic vesicle fraction; lane 7, the
lysed synaptosomal membrane fraction; lane 8, the SPM
fraction; lane 9, the 0.5% (w/v) Triton X-100-soluble
fraction of the SPM; lane 10, the 0.5% (w/v) Triton
X-100-insoluble fraction of the SPM; lane 11, the 1% (w/v)
Triton X-100-soluble fraction of the SPM; lane 12, the 1%
(w/v) Triton X-100-insoluble fraction of the SPM. B,
expression of MAGUINs in rat primary cultured hippocampal neurons. Rat
hippocampal neurons were immunostained with the polyclonal mouse
anti-MAGUIN antibody. The scale bar indicates 10 µm.

View larger version (29K):
[in a new window]
Fig. 8.
Membrane association of MAGUINs in CHO
cells. A, schematic description of various Myc-tagged
constructs of MAGUINs. B, CHO cells transfected with various
Myc-tagged constructs indicated in panel A were
immunostained with the monoclonal anti-Myc antibody. 1f,
pCMV Myc MAGUIN-1f (the full length of MAGUIN-1); 2f, pCMV
Myc MAGUIN-2f (the full length of MAGUIN-2); n, pClneo Myc
MAGUIN-n (the SAM and PDZ domains); m, pClneo Myc MAGUIN-m
(the PH domain with the C-terminal stretch); c, pClneo Myc
MAGUIN-c (the C-terminal region of MAGUIN-1).

View larger version (31K):
[in a new window]
Fig. 9.
Subcellular localization of MAGUIN-1 in CHO
cells. CHO cells were transfected with various Myc-tagged
constructs of MAGUIN-1. The homogenates of the cells were
subfractionated into the cytosol, membrane, Triton X-100-soluble, and
Triton X-100-insoluble fractions. Comparable amounts of fractions were
immunoblotted with the monoclonal anti-Myc antibody. Lanes
1, homogenate; lanes 2, cytosol; lanes 3,
membrane; lanes 4, Triton X-100-soluble; lanes 5,
Triton X-100-insoluble. A, pCMV Myc MAGUIN-1f (the full
length of MAGUIN-1). B, pClneo Myc MAGUIN-n (the SAM and PDZ
domains). C, pClneo Myc MAGUIN-m (the PH domain with the
C-terminal stretch). D, pClneo Myc MAGUIN-c (the C-terminal
region of MAGUIN-1).

View larger version (38K):
[in a new window]
Fig. 10.
Recruitment of PSD-95/SAP90 and S-SCAM into
the Triton X-100-insoluble fraction by MAGUIN-1. CHO cells were
transfected with either pCMV Myc MAGUIN-1f, pCMV PSD-95, and pCMV
S-SCAM or the combination of pCMV Myc MAGUIN-1f with pCMV PSD-95 or
pCMV S-SCAM. The homogenates of the cells were subfractionated into the
cytosol, membrane, Triton X-100-soluble, and Triton X-100-insoluble
fractions. The comparable amount of each fraction was immunoblotted
with the indicated antibodies. Lanes 1, homogenate;
lanes 2, cytosol; lanes 3, membrane; lanes
4, Triton X-100-soluble; lanes 5, Triton
X-100-insoluble. A, PSD-95/SAP90. B, S-SCAM.
C, PSD-95 in the presence of MAGUIN-1. D, S-SCAM
in the presence of MAGUIN-1.
![]()
DISCUSSION
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES
helixes and six
sheets, and the second
helix and second
sheet provide a
carboxyl-binding loop (32, 33). The residues of this loop of MAGUINs
are diverged from those of PSD-95/SAP90 or CASK, suggesting that the
ligand for the PDZ domain of MAGUINs has the C-terminal residues
different from either group 1 or group 2 consensus motif (41). No
interacting protein was obtained from the yeast two-hybrid screening
using the PDZ domain of MAGUINs as a bait (data not shown), and whether
the PDZ domain of MAGUINs functions as a protein-interacting module
needs to be investigated. The PH domain binds to inositol phosphates
and phosphoinositides and regulates the membrane association of many
signaling proteins (reviewed in Refs. 39 and 40). We could not
determine whether the PH domain was required for the membrane
association, but we observed that MAGUIN-1 binds to the plasma membrane
through the region containing the PH domain and the C-terminal region.
This finding suggests that the PH domain can support the membrane
attachment, as well as the C-terminal region. The C-terminal stretch of
the PH domain of
-adrenergic receptor kinase is reported to bind the

subunits of heterotrimeric GTP-binding proteins (G
) (43).
The C-terminal stretch of the PH domain of MAGUINs is diverged from
that of
-adrenergic receptor kinase, and the interaction of MAGUIN-1
with G
is not detected (data not shown). However, because the
C-terminal region of MAGUIN-1 also mediates the membrane association,
this region also has a binding activity for lipid or some membrane protein.
![]()
ACKNOWLEDGEMENT
![]()
FOOTNOTES
To whom correspondence should be addressed. Tel.:
81-66-879-3410; Fax: 81-66-879-3419; E-mail:
ytakai{at}molbio.med.osak-u.ac.jp.
![]()
ABBREVIATIONS
motif;
PH, plekstrin homology;
SPM, synaptic plasma membrane;
MAPK, mitogen-activated protein kinase;
CHO, Chinese hamster ovary.
![]()
REFERENCES
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES
Copyright © 1999 by The American Society for Biochemistry and Molecular Biology, Inc.
![]()
CiteULike
Complore
Connotea
Del.icio.us
Digg
Reddit
Technorati What's this?
This article has been cited by other articles:
![]() |
F. Deng, M. G. Price, C. F. Davis, M. Mori, and D. L. Burgess Stargazin and other transmembrane AMPA receptor regulating proteins interact with synaptic scaffolding protein MAGI-2 in brain. J. Neurosci., July 26, 2006; 26(30): 7875 - 7884. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Kawata, J. Iida, M. Ikeda, Y. Sato, H. Mori, A. Kansaku, K. Sumita, N. Fujiwara, C. Rokukawa, M. Hamano, et al. CIN85 Is Localized at Synapses and Forms a Complex with S-SCAM via Dendrin. J. Biochem., May 1, 2006; 139(5): 931 - 939. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Ziogas, K. Moelling, and G. Radziwill CNK1 Is a Scaffold Protein That Regulates Src-mediated Raf-1 Activation J. Biol. Chem., June 24, 2005; 280(25): 24205 - 24211. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. B. Jaffe, P. Aspenstrom, and A. Hall Human CNK1 Acts as a Scaffold Protein, Linking Rho and Ras Signal Transduction Pathways Mol. Cell. Biol., February 15, 2004; 24(4): 1736 - 1746. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. M. LANIGAN, A. LIU, Y. Z. HUANG, L. MEI, B. MARGOLIS, and K.-L. GUAN Human homologue of Drosophila CNK interacts with Ras effector proteins Raf and Rlf FASEB J, November 1, 2003; 17(14): 2048 - 2060. [Abstract] [Full Text] [PDF] |
||||
![]() |
I. Yao, J. Iida, W. Nishimura, and Y. Hata Synaptic and Nuclear Localization of Brain-Enriched Guanylate Kinase-Associated Protein J. Neurosci., July 1, 2002; 22(13): 5354 - 5364. [Abstract] [Full Text] [PDF] |
||||
![]() |
I. A. Lim, D. D. Hall, and J. W. Hell Selectivity and Promiscuity of the First and Second PDZ Domains of PSD-95 and Synapse-associated Protein 102 J. Biol. Chem., June 7, 2002; 277(24): 21697 - 21711. [Abstract] [Full Text] [PDF] |
||||
![]() |
W. Nishimura, I. Yao, J. Iida, N. Tanaka, and Y. Hata Interaction of Synaptic Scaffolding Molecule and beta -Catenin J. Neurosci., February 1, 2002; 22(3): 757 - 765. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Kawabe, H. Nakanishi, M. Asada, A. Fukuhara, K. Morimoto, M. Takeuchi, and Y. Takai Pilt, a Novel Peripheral Membrane Protein at Tight Junctions in Epithelial Cells J. Biol. Chem., December 14, 2001; 276(51): 48350 - 48355. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. M. PATRIE, A. J. DRESCHER, M. GOYAL, R. C. WIGGINS, and B. MARGOLIS The Membrane-Associated Guanylate Kinase Protein MAGI-1 Binds Megalin and Is Present in Glomerular Podocytes J. Am. Soc. Nephrol., April 1, 2001; 12(4): 667 - 677. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Takai, T. Sasaki, and T. Matozaki Small GTP-Binding Proteins Physiol Rev, January 1, 2001; 81(1): 153 - 208. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Kawabe, Y. Hata, M. Takeuchi, N. Ide, A. Mizoguchi, and Y. Takai nArgBP2, a Novel Neural Member of Ponsin/ArgBP2/Vinexin Family That Interacts with Synapse-associated Protein 90/Postsynaptic Density-95-associated Protein (SAPAP) J. Biol. Chem., October 22, 1999; 274(43): 30914 - 30918. [Abstract] |