![]()
|
|
||||||||
J Biol Chem, Vol. 274, Issue 18, 12642-12649, April 30, 1999
§,
¶,
, and
**
From the Goodpasture disease is an autoimmune disorder
that occurs naturally only in humans. Also exclusive to humans is the
phosphorylation process that targets the unique N-terminal region of
the Goodpasture antigen. Here we report the molecular cloning of GPBP
(Goodpasture antigen-binding
protein), a previously unknown 624-residue polypeptide. Although the predicted sequence does not meet the conventional structural requirements for a protein kinase, its recombinant counterpart specifically binds to and phosphorylates the exclusive N-terminal region of the human Goodpasture antigen in
vitro. This novel kinase is widely expressed in human tissues but
shows preferential expression in the histological structures that are
targets of common autoimmune responses. The work presented in this
report highlights a novel gene to be explored in human autoimmunity.
Goodpasture (GP)1
disease is an autoimmune disorder described only in humans. In GP
patients autoantibodies against the non-collagenous C-terminal domain
(NC1) of the Here we report the cloning and characterization of a novel type
of serine/threonine kinase that specifically binds to and phosphorylates the unique N-terminal region of the human GP antigen.
Synthetic Polymers
Peptides--
GPpep1, KGKRGDSGSPATWTTRGFVFT, representing
residues 3-23 of the human GP antigen, and GPpep1Ala9,
KGKRGDAGSPATWTTRGFVFT, a mutant Ser9 to
Ala9, were synthesized by MedProbe and CHIRON. FLAG
peptide, DYKDDDDK, was from Sigma.
Oligonucleotides--
The following as well as several other
GPBP-specific oligonucleotides were synthesized by Genosys and Life
Technologies, Inc:. ON-GPBP-54m,
TCGAATTCACCATGGCCCCACTAGCCGACTACAAGGACGACGATGACAAG and ON-GPBP-55c,
CCGAGCCCGACGAGTTCCAGCTCTGATTATCCGACATCTTGTCATCGTCG; ON-HNC-B-N-14m,
CGGGATCCGCTAGCTAAGCCAGGCAAGGATGG; ON-HNC-B-N-16c, CGGGATCCATGCATAAATAGCAGTTCTGCTGT.
Isolation and Characterization of cDNA Clones Encoding
Human GPBP
Several human Northern and Southern Blots
Pre-made Northern and Southern blots
(CLONTECH) were probed with HeLa1 cDNA
following the manufacturers' instructions.
Plasmid Construction, Expression, and Purification of
Recombinant Proteins
GPBP-derived Material--
The original GP Antigen-derived Material--
Human recombinant GP antigen
(rGP) was produced in 293 cells using the pRc/CMV-BM40 expression
vector containing the
All the constructs were verified by restriction mapping and nucleotide sequencing.
Cell Culture and DNA Transfection
Human 293 cells were grown in Dulbecco's modified Eagle's
medium supplemented with 10% fetal calf serum. Transfections were performed using the calcium phosphate precipitation method of the
Profection Mammalian Transfection Systems (Promega). Stably transfected
cells were selected by their resistance to G418. Foci of surviving
cells were isolated, cloned, and amplified.
Antibody Production
Polyclonal Antibodies Against the N-terminal Region of
GPBP--
Cells expressing HeLa1 Monoclonal Antibodies against GPBP--
Monoclonal antibodies
were produced essentially as previously reported (7) using GST-GPBP.
The supernatants of individual clones were analyzed for antibodies
against rGPBP.
In Vitro Phosphorylation Assays
About 200 ng of rGPBP were incubated overnight at 30 °C in 25 mM In Vivo Phosphorylation Assays
Individual wells of a 24-well dish were seeded with normal or
with stably pc-n4'-transfected 293 cells. When the cells were grown to
the desired density, a number of wells of the normal 293 cells were
transfected with pc-FLAG-n4'. After 12 h the culture medium was
removed, 20 µCi/well of H332PO4
in 100 µl of phosphate-free Dulbecco's modified Eagle's medium added, and incubation continued for 4 h. The cells were lysed with
300 µl/well of TBS containing 1% Triton X-100, 2 mM
EDTA, 1 mM phenylmethylsulfonyl fluoride, 50 mM
NaF, and 0.2 mM vanadate and extracted with specific
antibodies and protein A-Sepharose. When anti-GPBP serum was used, the
lysate was precleared using preimmune serum and protein
A-Sepharose.
In Vitro Dephosphorylation of rGPBP
About 1 µg of rGPBP was dephosphorylated in 100 µl of 10 mM Tris acetate (pH 7.5), 10 mM magnesium
acetate, and 50 mM potassium acetate with 0.85 units of
calf intestine alkaline phosphatase (Amersham Pharmacia Biotech) for 30 min at 30 °C.
Renaturation Assays
In-blot renaturation assays were performed using 1-5 µg of
rGPBP as described previously (11).
Nucleotide Sequence Analysis
The cDNA sequences were performed by the dideoxy chain
termination method using 32P-Phosphoamino Acid Analysis
Immunopurified rGPBP or high performance liquid chromatography
gel filtration fractions therefrom containing the material of interest
were phosphorylated, hydrolyzed, and analyzed in one- (4) or
two-dimensional thin layer chromatography (12). When performing
two-dimensional analysis, the buffer for the first dimension was formic
acid:acetic acid:water (1:3.1:35.9) (pH 1.9), and the buffer for the
second dimension was acetic acid:pyridine:water (2:0.2:37.8) (pH 3.5).
Amino acids were revealed with ninhydrin and
32P-phosphoamino acids by autoradiography.
Physical Methods and Immunochemical Techniques
SDS-PAGE and Western blotting were performed as in Ref. 4.
Immunohistochemistry studies were done on human multi-tissue control
slides (Biomeda, Biogenex) using the ABC peroxidase method (13).
Computer Analysis
Homology searches were carried out against the
GenBankTM and SwissProt data bases with the BLAST 2.0 (14)
at the NCBI server and against the TIGR Human Gene Index data base for
expressed sequence tags using the Institute for Genomic Research
server. The search for functional patterns and profiles was performed against the PROSITE data base using the ProfileScan program at the
Swiss Institute of Bioinformatics (15). Prediction of coiled-coil structures was done at the Swiss Institute for Experimental Cancer Research using the program Coils (16) with both 21- and 28-residue windows.
Molecular Cloning of GPBP--
To search for proteins specifically
interacting with the divergent N-terminal region of the human GP
antigen, a 21-residue peptide (GPpep1), encompassing this and flanking
sequence, and specific monoclonal antibodies against it were combined
to screen several human cDNA expression libraries. The screening of
more than 5 × 106 phages was required to identify a
single HeLa-derived recombinant encoding a fusion protein specifically
interacting with GPpep1 without disturbing antibody binding.
By using the cDNA insert of the original clone (HeLa1), we isolated
a 2.4-kb cDNA (n4') that contains 408 bp of 5'-untranslated sequence, an open reading frame (ORF) of 1872-bp encoding 624 residues,
and 109-bp of 3'-untranslated sequence (Fig.
1). Other structural features are of
interest. First, the predicted polypeptide has a large number of
phosphorylatable (17.9%) and acidic (16%) residues with an unequal
distribution along the sequence. Serine, which is the most abundant
residue (9.3%), shows preference for two short regions of the protein
where it comprises nearly 40% of the amino acids compared with an
average of less than 7% throughout the rest of the polypeptide chain.
It is also noteworthy that the more N-terminal serine-rich region
consists mainly of a Ser-Xaa-Yaa repeat. Acidic residues are
preferentially located at the three N-terminal quarters of the
polypeptide with nearly 18% of the residues being acidic. These
residues represent only 9% in the most C-terminal quarter of the
polypeptide, resulting in a polypeptide chain with two electrically
opposite areas. At the N terminus, the polypeptide contains a
pleckstrin homology (PH) domain that has been implicated in the
recruitment of many signaling proteins to the cell membrane where they
exert their biological activities (17). Finally, a bipartite nuclear
targeting sequence (18) exists as an integral part of a heptad repeat
region that meets all the structural requirements to form a coiled-coil
(16).
Protein data bank searches revealed homologies almost exclusively
within the approximately 100 residues at the N-terminal region
harboring the PH domain. The PH domain of the oxysterol-binding protein, which displays an overall identity of 33.5% and a similarity of 65.2% with our cloned protein, is the most similar. In addition, the Caenorhabditis elegans cosmid F25H2
(GenBankTM accession number Q93569) contains a hypothetical
ORF that displays an overall identity of 26.5% and a similarity of
61% throughout the entire protein sequence indicating that similar proteins are present in lower invertebrates. Several tagged human expressed sequences (GenBankTM accession numbers AA287878,
AA287561, AA307431, AA331618, AA040134, AA158618, AA040087, AA122226,
AA158617, AA121104, AA412432, AA412433, AA282679, and N27578) demonstrated a high degree of nucleotide identity (above 98%) with the
corresponding stretches of the GPBP cDNA, suggesting that they
represent human GPBP. Interestingly, the tagged sequence AA287878 shows
a gap of 67 nucleotides within the sequence corresponding to the GPBP
5'-untranslated region, suggesting that the GPBP pre-mRNA is
alternatively spliced in human tissues (not shown).
The distribution and expression of the GPBP gene in human tissues was
first assessed by Northern blot analysis (Fig.
2A). The gene is expressed as
two major mRNAs species between 4.4- and 7.5-kb in length and other
minor species of shorter lengths. The structural relationship between
these multiple mRNA species is not known, and their relative
expression varies between tissues. Striated muscle (skeletal and heart)
is the tissue with highest expression, whereas lung and liver show the
least.
Southern blot studies using genomic DNA from different species indicate
that homologous genes exist throughout phylogeny (Fig. 2B).
Consistent with the human origin of the probe, the hybridization intensities decrease in a progressive fashion as the origin of the
genomic DNA moves away from humans in evolution.
Experimental Determination of the Translation Start Site--
To
confirm experimentally the predicted ORF, eukaryotic expression vectors
containing either the 2.4-kb of cDNA of n4' or only the predicted
ORF tagged with a FLAG sequence (Fig.
3A) were used for transient
expression assays in 293 cells. The corresponding extracts were
analyzed by immunoblot using GPBP- or FLAG-specific antibodies. The
GPBP-specific antibodies bind to a similar major polypeptide in both
transfected cells, but only the polypeptide produced by the engineered
construct expressed the FLAG sequence (Fig. 3B). This
locates the translation start site of the n4' cDNA at the predicted
Met and confirms the proposed primary structure. Furthermore, the
recombinant polypeptides identified display a molecular mass higher
than expected (80 versus 71 kDa) suggesting that GPBP
undergoes post-translational modifications.
Expression and Characterization of Yeast rGPBP--
Yeast
expression and FLAG-based affinity purification were combined to
produce rGPBP (Fig. 4A). A
major polypeptide of ~89 kDa along with multiple related products
displaying lower Mr were obtained. The
recombinant material was recognized by both anti-FLAG and specific
antibodies guaranteeing the fidelity of the expression system. Again,
however, the Mr displayed by the major product was notably higher than predicted and even higher than the
Mr of the 293 cell-derived recombinant material,
supporting the idea that GPBP undergoes important and differential
post-translational modifications. Since phosphorylatable residues are
the most abundant in the polypeptide chain, we investigated the
existence of phosphoamino acids in the recombinant materials. By using
monoclonal or polyclonal (not shown) antibodies against phosphoserine
(Ser(P)), phosphothreonine (Thr(P)), and phosphotyrosine (Tyr(P)), we
identified the presence of all three phosphoresidues either in yeast
rGPBP (Fig. 4B) or in 293 cell-derived material (not shown).
The specificity of the antibodies was further assessed by partially
inhibiting their binding by the addition of 5-10 mM of the
corresponding phosphoamino acid (not shown). This suggests that the
phosphoresidue content varies upon the cell expression system, and the
Mr differences are mainly due to
phosphorylation. Consistently, dephosphorylated yeast-derived material
displays similar Mr to the material derived from
293 cells, and phosphoamino acid content correlates with SDS-PAGE
mobilities (Fig. 4C). As an in vivo measurement,
the phosphorylation of rGPBP in the 293 cells was assessed (Fig.
4D). Control cells (lanes 1) and cells expressing
rGPBP in stable (lanes 2) or transient (lanes 3)
modes were cultured in the presence of
H332PO4. The recombinant material
specifically immunoprecipitated contains 32P indicating
that the phosphorylation of GPBP occurs in vivo and therefore is likely to be a physiological process.
The rGPBP Is a Serine/Threonine Kinase That Phosphorylates the
N-terminal Region of the Human GP Antigen--
Although GPBP does not
contain the 12 conserved structural regions required to define the
classic catalytic domain for a protein kinase, the recent
identification and characterization of novel non-conventional protein
kinases (19-27) encouraged the investigation of its phosphorylating
activity. Addition of [
Although the purification system provides high quality material, the
presence of contaminants with a protein kinase activity could not be
ruled out. The existence of contaminants was also suggested by the
presence of a FLAG-containing 40-kDa polypeptide displaying no
reactivity with specific antibodies nor incorporation of
32P in the phosphorylation assays (Figs. 4A and
5A). To identify precisely the polypeptide harboring the
protein kinase activity, we performed in vitro kinase
renaturation assays after SDS-PAGE and Western blot (Fig.
6). We successfully combined the use of specific antibodies (lane 1) and autoradiographic detection
of in situ 32P incorporation (lane
2), and we identified the 89-kDa rGPBP material as the primary
polypeptide harboring the Ser/Thr kinase activity. The lack of
32P incorporation in the rGPBP-derived products as well as
in the 40-kDa contaminant further supports the specificity of the
renaturation assays and locates the kinase activity to the 89-kDa
polypeptide. Recently, it has been shown that traces of protein kinases
intimately associated to a polypeptide can be released from the blot
membrane, bind to, and phosphorylate the polypeptide during the
labeling step (28). To assess this possibility in our system, we
performed the renaturation studies using a small piece of membrane
containing the 89-kDa polypeptide either alone or together with
membrane pieces representing the different regions of the blot lane. We observed similar 32P incorporation at the 89-kDa
polypeptide regardless of the co-incubated pieces (not shown),
indicating that if there are co-purified protein kinases in our sample
they are not phosphorylating the 89-kDa polypeptide in the renaturation
assays unless they co-migrate. Co-migration does not, however, appear
to be a concern since rGPBP deletion mutants displaying different
mobilities also have kinase activities and could similarly be in-blot
renatured (not shown).
Immunohistochemical Localization of the Novel Kinase--
To
investigate GPBP expression in human tissues, we performed
immunohistochemical studies using specific polyclonal (Fig. 7) or monoclonal antibodies (not shown).
Although GPBP is widely expressed in human tissues, it shows tissue and
cell specificity. In the kidney, the major expression is found at the
epithelial cells of the tubules and at the mesangial cells and
podocytes of the glomerulus. At the lung alveolus, the antibodies
display a linear pattern suggestive of a basement membrane localization along with staining of pneumocytes. Liver shows low expression in the
parenchyma but high expression in biliary ducts. The expression at the
central nervous system is observed in the white matter and not in the
neurons of the brain. In testis, a high expression in the
spermatogonium contrasts with the lack of expression in the Sertoli
cells. The adrenal gland shows a higher level of expression at the
cortical cells versus the medullar. In the pancreas, GPBP is
preferentially expressed in Langerhans islets versus the
exocrine moiety, and in prostate, GPBP is expressed in the epithelial
cells but not in the stroma (Fig. 7). Other locations with high
expression of GPBP are striated muscle, epithelial cells of intestinal
tract, and Purkinje cells of the cerebellum (not shown). In general, in
the tissues where GPBP is highly expressed the staining pattern is
mainly diffuse cytosolic. However in certain locations there is, in
addition, an important staining reinforcement at the nucleus (spermatogonium), at the plasma membrane (pneumocyte, hepatocyte, prostate epithelial cells, white matter), or at the extracellular matrix (alveolus) (Fig. 7).
Our data show that GPBP is a novel non-conventional
serine/threonine kinase and present evidence that indicate that GPBP
discriminates between human and bovine GP antigens and targets the
exclusive human phosphorylatable region in vitro. Although
the presence of additional protein kinases in the affinity-purified
rGPBP cannot completely be ruled out, several lines of evidence
indicate that the 89-kDa polypeptide is the only kinase therein. First,
we found no differences in auto- or trans-phosphorylation among rGPBP
samples purified either in the presence of 150 mM or 0.5, 1, or 2 M salt (not shown) suggesting that rGPBP does not
carry kinases intimately bound. Second, the presence of a
FLAG-containing yeast-derived kinase in our samples is not a concern
since material purified using GPBP-specific antibodies show no
differences in phosphorylation (not shown). Third, a deletion mutant of
GPBP displays reduced auto- and trans-phosphorylation
activities,3 suggesting that is the only material in the
rGPBP with the ability to carry out phosphate transfer.
Although GPBP is not homologous to other
non-conventional kinases, they share some structural features including
a N-terminal Immunohistochemistry studies show that GPBP is a cytosolic polypeptide
also found in the nucleus, associated with the plasma membrane and
likely at the extracellular matrix associated with basement membrane,
indicating that it contains the structural requirements to reach all
these destinations. The nuclear localization signal and the PH domain
confer to it the potential to reach the nucleus and the cell membrane,
respectively (17, 29, 30). Although GPBP does not contain the
structural requirements to be exported, at the 5'-end untranslated
region of its mRNA exists an upstream ORF of 130 residues with an
in-frame stop codon at the beginning (Fig. 1). An mRNA editing
process inserting a single base pair (U) would generate an operative
in-frame start site and an ORF of 754 residues containing an export
signal immediately downstream of the edited Met (not shown). Polyclonal
antibodies against a synthetic peptide representing part of this
hypothetical extra sequence display a linear vascular reactivity in
human tissues suggestive of an extracellular basement membrane
localization.3 Alternatively, a splicing phenomenon could
generate transcripts with additional unidentified exon(s) that would
provide the structural requirements for exportation. The multiple
cellular localization, the high content in Tyr(P), and the lack of
tyrosine kinase activity in vitro suggest that GPBP in
addition is the target of specific tyrosine kinase(s) and therefore
likely involved in specific signaling cascade(s).
The idea that common pathogenic events exist at least for some
autoimmune disorders is suggested by the significant number of patients
displaying more than one autoimmune disease, and also by the strong and
common linkage that some of these diseases show to specific major
histocompatibility complex haplotypes (31, 32). The experimental
observation that the autoantigen is the leading moiety in autoimmunity
and that a limited number of self-components are autoantigenic (31)
suggest that these components share biological features with important
consequences in self/non-self recognition by the immune system. One
possibility is that triggering events by altering different but
specific self-components would result in abnormal antigen processing.
In certain individuals expressing a particular major histocompatibility
complex specificity, the abnormal peptides could be recognized by
non-tolerized T cells and trigger an immune response (1).
We explored the GP antigen to identify biological features of relevance
in autoimmune pathogenesis. Since the human antigen is a natural
autoantigen but not the homologous counterparts from other superior
mammals, and only Phosphorylation of specific serines has been shown to change
intracellular proteolysis (35-40). Conceivably alterations in protein
phosphorylation can affect processing and peptide presentation and thus
mediate autoimmunity. GP antigen-derived peptide presentation by the
HLA-DR15 depends more on processing than on preferences of relatively
indiscriminate DR15 molecules (41), suggesting that if processing is
influenced by abnormal phosphorylation, the resulting peptides would
likely be presented by this HLA. Our more recent data indicate that in
both the GP and myelin basic protein systems, the production of
alternative splicing products serves to regulate the phosphorylation of
specific and structurally homologous cAMP-dependent protein
kinase sites,2 suggesting that this or a closely related
kinase is the in vivo phosphorylating enzyme. Alterations in
the degree of antigen phosphorylation, caused either by an imbalance in
alternative products or by the action of an intruding kinase that
deregulates phosphorylation of the same motifs, could lead to an
autoimmune response in predisposed individuals. Accordingly, we found
that in kidney, GP patients express relatively more alternative
products than control individuals (5) and that rGPBP phosphorylates the
human GP antigen at a major cAMP-dependent protein kinase
phosphorylation site in an apparently unregulated fashion since
alternative products do not affect antigen
phosphorylation.3
Although GPBP is ubiquitously expressed, in certain organs and tissues
it shows a preference for cells and tissue structures that are a target
of common autoimmune responses as follows: the Langerhans cells (type I
diabetes); the white matter of the central nervous system (multiple
sclerosis); the biliary ducts (primary biliary cirrhosis); the cortical
cells of the adrenal gland (Addison disease); striated muscle cells
(myasthenia gravis); spermatogonium (male infertility); Purkinje cells
of the cerebellum (paraneoplastic cerebellar degeneration syndrome);
and epithelial intestinal cells (pernicious anemia, autoimmune
gastritis and enteritis). Although it is premature to draw definitive
conclusions on the pathogenic involvement of GPBP, all the above
observations point to this novel kinase as an attractive candidate to
be considered when envisioning a model for human autoimmune disease.
We express our gratitude to Billy G. Hudson,
Neil Turner, and Jorgen Wieslander for providing native and recombinant
GP antigens; Francesc Miró and Emilio Itarte for the phosphoamino
acid analysis; Susan Quiñones and Mercedes Costell for preparing
recombinant human GP antigen; Pilar Martinez for help preparing rGPBP;
and Javier Cervera for advice in the production of monoclonal
antibodies. The technical assistance of María José
Agulló is also appreciated. Finally, we also thank Susan
Quiñones for the critical reading of this manuscript.
*
This work was supported in part by Grants SAL91/0513,
SAF94/1051, and SAF97/0065 from the Plan Nacional I+D of the
Comisión Interministerial de Ciencia Tecnología, Grant
93/0343 from Fondo de Investigaciones Sanitarias, and Grants GV-3166/95
and GV-C-VS-21-118-96 from la Direcció General d'Ensenyaments
Universitaris i Investigació (Comunitat Valenciana, Spain) (to
J. S.).The costs of publication of this
article were defrayed in part by the
payment of page charges. The article
must therefore be hereby marked
"advertisement" in accordance with 18 U.S.C. Section
1734 solely to indicate this fact.
The nucleotide sequence(s) reported in this paper has been submitted to the GenBankTM/EMBL Data Bank with accession number(s) AF136450.
§
Supported by a postdoctoral fellowship sponsored by Fundación
Valenciana de Investigaciones Biomédicas, by Exploraciones Radiológicas Especiales S.A., and by Bancaixa.
¶
Recipient of a fellowship from the Consellería de
Educació i Ciència de la Comunitat Valenciana.
**
To whom correspondence should be addressed: Instituto de
Investigaciones Citológicas, C/Amadeo de Saboya 4, 46010 Valencia, Spain. Tel.: 34-96-3391250; Fax: 34-96-3601453; E-mail:
jsaus{at}ochoa.fib.es.
2
J. Saus, manuscript in preparation.
3
A. Raya and J. Saus, unpublished observations.
The abbreviations used are:
GP, Goodpasture;
bp, base pair;
GPBP and rGPBP, native and recombinant Goodpasture
antigen-binding protein;
GST, glutathione S-transferase;
HLA, human lymphocyte antigens;
kb, kilobase pairs;
NC1, non-collagenous domain;
PH, pleckstrin homology;
PAGE, polyacrylamide
gel electrophoresis;
TBS, Tris-buffered saline;
ORF, open reading
frame.
Fundación Valenciana de
Investigaciones Biomédicas,
Departamento de
Patología,
![]()
ABSTRACT
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES
![]()
INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES
3 chain of collagen IV cause a rapidly progressive
glomerulonephritis and often lung hemorrhage, the two cardinal clinical
manifestations of the GP syndrome (see Ref. 1 for review). Since the
NC1 domain is a highly conserved domain among species and between the
different collagen IV
chains (
1-
6) (2), the exclusive
involvement of the human
3(IV)NC1 in a natural autoimmune response
suggests that this domain has structural and/or biological
peculiarities of pathogenic relevance. Consistent with this, the N
terminus of the human antigen is highly divergent, and it contains a
unique 5-residue motif, KRGDS9, that conforms to a
functional phosphorylation site for type A protein kinases (3, 4).
Furthermore, the corresponding human gene, but not the other human
related or homologous genes from other species, generates multiple
transcripts by an exclusive alternative splicing phenomenon (5-7).
Recent studies indicate that the phosphorylation of the N terminus of
the GP antigen by cAMP-dependent protein kinase is
up-regulated by the presence of the alternative
products.2 Thus, specific
serine/threonine phosphorylation appears to be a major biological
difference between the human antigen, antigen from other species, and
the homologous domains from other human
(IV) chains and therefore
might be important in pathogenesis (1, 4).
![]()
MATERIALS AND METHODS
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES
-gt11 cDNA expression libraries (eye, fetal
and adult lung, kidney, and HeLa S3, from CLONTECH)
were probed for cDNAs encoding proteins interacting with GPpep1.
Nitrocellulose filters (Millipore) prepared following standard
immunoscreening procedures were blocked and incubated with 1-10 nmol
per ml of GPpep1 at 37 °C. Specifically bound GPpep1 was detected
using M3/1A monoclonal antibodies (7). A single clone was identified in
the HeLa-derived library (HeLa1). Specificity of fusion protein binding
was confirmed by similarly binding recombinant eukaryotic human GP
antigen. The EcoRI cDNA insert of HeLa1 (0.5 kb) was used to screen further the same library and to isolate overlapping cDNAs. The largest cDNA (2.4 kb) containing the entire cDNA
of HeLa1 (n4') was fully sequenced.
-gt11 HeLa1 clone was
expressed as a lysogen in Escherichia coli Y1089 (8). The
corresponding
-galactosidase-derived fusion protein containing the
N-terminal 150 residues of GPBP was purified from the cell lysate using
an APTG-agarose column (Roche Molecular Biochemicals). The
EcoRI 2.4-kb fragment of n4' was subcloned in Bluescribe
M13+ vector (Stratagene) (BS-n4'), amplified, and used for subsequent
cloning. A DNA fragment containing from 5' to 3', an EcoRI
restriction site, a standard Kozak consensus for translation
initiation, a region coding for a tag peptide sequence (FLAG,
DYKDDDDK), and the sequence coding for the first 11 residues of GPBP
including the predicted Meti and a BanII
restriction site, was obtained by hybridizing ON-GPBP-54m and
ON-GPBP-55c and extending with modified T7 DNA polymerase
(Amersham Pharmacia Biotech). The resulting DNA product was digested
with EcoRI and BanII and ligated with the
BanII/EcoRI cDNA fragment of BS-n4' in the
EcoRI site of pHIL-D2 (Invitrogen) to produce pHIL-FLAG-n4'. This plasmid was used to obtain Muts transformants of the
GS115 strain of Pichia pastoris and to express FLAG-tagged
recombinant GPBP (rGPBP) either by conventional liquid culture or by
fermentation procedures (Pichia Expression Kit, Invitrogen).
The cell lysates were loaded onto an anti-FLAG M2 column (Sigma), the
unbound material washed out with Tris-buffered saline (TBS, 50 mM Tris-HCl, pH 7.4, 150 mM NaCl) or
salt-supplemented TBS (up to 2 M NaCl), and the recombinant
material eluted with FLAG peptide. For expression in cultured human
kidney-derived 293 cells (ATCC 1573-CRL), the 2.4- or 2.0-kb
EcoRI cDNA insert of either BS-n4' or pHIL-FLAG-n4' was
subcloned in pcDNA3 (Invitrogen) to produce pc-n4' and pc-FLAG-n4',
respectively. When used for transient expression, 18 h after
transfection the cells were lysed with 3.5-4 µl/cm2
chilled lysis buffer (1% Nonidet P-40 or Triton X-100, 5 mM EDTA, and 1 mM phenylmethylsulfonyl fluoride
in TBS) with or without 0.1% SDS depending whether the lysate was to
be used for SDS-PAGE or FLAG purification, respectively. For FLAG
purification, the lysate of four to six 175-cm2 culture
dishes was diluted up to 50 ml with lysis buffer and purified as above.
For stable expression, the cells were similarly transfected with pc-n4'
and selected for 3 weeks with 800 µg/ml G418. For bacterial
recombinant expression, the 2.0-kb EcoRI cDNA fragment
of pHIL-FLAG-n4' was cloned in-frame downstream of the glutathione
S-transferase (GST)-encoding cDNA of pGEX-5x-1 (Amersham Pharmacia Biotech). The resulting construct was used to express GST-GPBP fusion protein in DH5
(9).
3-specific cDNA between ON-HNC-B-N-14m and
ON-HNC-B-N-16c. The expression vector is a pRc/CMV (Invitrogen)-derived
vector provided by Billy G. Hudson that contains cDNA encoding an
initiation Met, a BM40 signal peptide followed by a tag peptide
sequence (FLAG), and a polylinker cloning site. To obtain
3-specific
cDNA, a polymerase chain reaction was performed using the
oligonucleotides above and a plasmid containing the previously reported
3(IV) cDNA sequence (3) as template (clone C2). For stable
expression of rGP, 293 cells were transfected with the resulting
construct (f
3VLC) and selected with 400 µg/ml G418. The harvested
rGP was purified using an anti-FLAG M2 column.
-gt11 as a lysogen were lysed by
sonication in the presence of Laemmli sample buffer and subjected to
electrophoresis in a 7.5% acrylamide preparative gel. The gel was
stained with Coomassie Blue, and the band containing the fusion protein
of interest was excised and used for rabbit immunization (10). The
antiserum was tested for reactivity using APTG affinity purified
antigen. To obtain affinity purified antibodies, the antiserum was
diluted 1:5 with TBS and loaded onto a Sepharose 4B column containing
covalently bound affinity purified antigen. The bound material was
eluted and, unless otherwise indicated, used in the immunochemical studies.
-glycerol phosphate (pH 7.0), 0.5 mM
EDTA, 0.5 mM EGTA, 8 mM MgCl2, 5 mM MnCl2, 1 mM dithiothreitol, and
0.132 µM [
-32P]ATP, in the
presence or absence of 0.5-1 µg of protein substrates or 10 nmol of
synthetic peptides, in a total volume of 50 µl.
-35S-dATP, modified
T7 DNA polymerase (Amersham Pharmacia Biotech), and
universal or GPBP-specific primers (8-10).
![]()
RESULTS
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

View larger version (99K):
[in a new window]
Fig. 1.
Nucleotide and derived amino acid sequences
of n4'. The denoted structural features are from 5'- to 3'-end and
are as follows: the cDNA present in the original clone (HeLa1)
(dotted box) that contains the PH homology domain (in
black) and the Ser-Xaa-Yaa repeat (in gray); the
heptad repeat of the predictable coiled-coil structure (open
box) containing the bipartite nuclear localization signal (in
gray); and a serine-rich domain (filled gray
box). The asterisks denote the positions of in-frame
stop codons.

View larger version (42K):
[in a new window]
Fig. 2.
Distribution of GPBP in human tissues
(Northern blot) and in eukaryotic species (Southern blot). A
random priming 32P-labeled HeLa1 cDNA probe was used to
identify homologous messages in a Northern blot of poly(A+)
RNA from the indicated human tissues (A) or in a Southern
blot of genomic DNA from the indicated eukaryotic species
(B). Northern hybridization was performed under highly
stringent conditions to detect perfect matching messages and at low
stringency in the Southern blot to allow the detection of messages with
mismatches. No appreciable differences in the quality and amount of
each individual poly(A+) RNA were observed by denaturing
gel electrophoresis and when probing with human
-actin cDNA a
representative blot from the same lot. The numbers denote
the position and the sizes in kb of the RNA or DNA markers used.

View larger version (60K):
[in a new window]
Fig. 3.
Experimental determination of the translation
start site. A, the two cDNAs present in pc-n4' and
pc-FLAG-n4' plasmids used for transient expression are represented as
black lines. The relative position of the corresponding
predicted (n4') or engineered (FLAG-n4') translation start site is
indicated (Met). B, the extracts from control
(
), pc-n4'(n4'), or pc-FLAG-n4' (FLAG-n4') transfected 293 cells were
subjected to SDS-PAGE under reducing conditions in 10% gels, and the
separated proteins were transferred to a polyvinylidene difluoride
membrane (Millipore) and blotted with the indicated antibodies. The
numbers and bars indicate the molecular mass in
kDa and the relative positions of the molecular weight markers,
respectively.

View larger version (24K):
[in a new window]
Fig. 4.
Characterization of rGPBP from yeast and 293 cells. A, 1 µg (lane 1) or 100 ng
(lanes 2 and 3) of yeast rGPBP were analyzed by
reducing SDS-PAGE in a 10% gel. The separated proteins were stained
with Coomassie Blue (lane 1) or transferred and blotted with
anti-FLAG antibodies (lane 2) or monoclonal antibody 14, a
monoclonal antibody against GPBP (lane 3). B, the
cell extracts from GPBP-expressing yeast were analyzed as in
A and blotted with anti-FLAG (lane 1),
anti-Ser(P) (lane 2), anti-Thr(P) (lane 3), or
anti-Tyr(P) (lane 4) monoclonal antibodies, respectively.
C, 200 ng of either yeast rGPBP (lane 1),
dephosphorylated yeast rGPBP (lane 2), or 293 cell-derived
rGPBP (lane 3) were analyzed as in B with the
indicated antibodies. D, similar amounts of
H332PO4-labeled non-transfected
(lanes 1), stable pc-n4'-transfected (lanes 2),
or transient pc-FLAG-n4'-expressing (lanes 3) 293 cells were
lysed, precipitated with the indicated antibodies, and analyzed by
SDS-PAGE and autoradiography. The molecular weight markers are
represented with numbers and bars as in Fig. 3.
The arrows indicate the position of the rGPBP.
-32P]ATP to rGPBP either from
yeast or 293 cells (not shown) in the presence of Mn2+ and
Mg2+ resulted in the incorporation of 32P as
Ser(P) and Thr(P) in the major and related products that were
recognized by both anti-FLAG and specific antibodies (Fig. 5, A and B),
indicating that the affinity purified material contains a Ser/Thr
protein kinase. To characterize this activity further, GPpep1,
GPpep1Ala9 (a GPpep1 mutant with Ser9 replaced
by Ala), native and recombinant human antigens, and native bovine
antigen were assayed (Fig. 5C). Affinity purified rGPBP
phosphorylates all human-derived material to a different extent;
however, in similar conditions no appreciable 32P
incorporation was observed in the bovine-derived substrate. The lower
32P incorporation displayed by GPpep1Ala9 when
compared with GPpep1 and the lack of phosphorylation of the bovine
antigen indicates that the kinase present in rGPBP discriminates
between human and bovine antigens and that Ser9 is a target
for the kinase.

View larger version (22K):
[in a new window]
Fig. 5.
Recombinant GPBP contains a serine/threonine
kinase that specifically phosphorylates the N-terminal region of the
human GP antigen. To assess phosphorylation, approximately 200 ng
of yeast rGPBP were incubated with [
-32P]ATP in the
absence (A and B) or presence of GP
antigen-derived material (C). A, the mixture was
subjected to reducing SDS-PAGE (10% gel) and autoradiographed.
B, the mixture was subjected to 32P-phosphoamino
acid analysis by two-dimensional thin layer chromatography. The
dotted circles indicate the position of ninhydrin-stained
phosphoamino acids. C, the phosphorylation mixtures of the
indicated GP-derived material were analyzed by SDS-PAGE (15% gel) and
autoradiography (GPpep1 and
GPpep1Ala9) or immunoprecipitated with
monoclonal antibody 17, a monoclonal antibody that specifically
recognizes GP antigen from human and bovine origin, and analyzed by
SDS-PAGE (12.5%) and autoradiography (rGP and
GP). The relative positions of rGPBP (A), rGP
antigen, and the native human and bovine GP antigens (C) are
indicated by arrows. The numbers and
bars refer to molecular weight markers as in previous
figures.

View larger version (37K):
[in a new window]
Fig. 6.
In-blot renaturation of the serine/threonine
kinase present in rGPBP. Five micrograms of rGPBP from yeast were
in-blot renatured. The recombinant material was specifically identified
by anti-FLAG antibodies (lane 1), and the in situ
32P incorporation was detected by autoradiography
(lane 2). The numbers and bars refer
to molecular weight markers as in previous figures. The
arrow indicates the position of the 89-kDa rGPBP
polypeptide.

View larger version (93K):
[in a new window]
Fig. 7.
Immunological localization of GPBP in human
tissues. Rabbit serum against the N-terminal region of GPBP (1:50)
was used to localize GPBP in human tissues. The tissues shown are as
follows: kidney (A), glomerulus (B), lung
(C), alveolus (D), liver (E), brain
(F), testis (G), adrenal gland (H),
pancreas (I), and prostate (J). Similar results were
obtained using anti-GPBP affinity purified antibodies or a pool of
culture medium from seven different GPBP-specific monoclonal antibodies
(anti-GPBP monoclonal antibodies 3, 4, 5, 6, 8, 10, and 14). Rabbit
preimmune serum did not stain any tissue structure in parallel control
studies. Magnification was × 40 except in B and
D where it was × 100.
![]()
DISCUSSION
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES
-helix coiled-coil (26, 27), serine-rich motifs (24),
high phosphoamino acids content (27), bipartite nuclear localization signal (27), and the absence of a typical nucleotide or ATP-binding motif (24, 27).
3 is involved in autoimmunity but not the
remaining five
chains, comparative studies among NC1 domains were a
useful initial approach. These studies revealed that specific serine
phosphorylation as well as pre-mRNA alternative splicing are
biological hallmarks of the human versus the other species
GP antigens (4, 5). These two features are also associated with the
biology of other autoantigens including acetylcholine receptor and
myelin basic protein (4). The latter is suspected to be the major
antigen in multiple sclerosis, another exclusively human autoimmune
disease in which the immune system targets the white matter of the
central nervous system. GP disease and multiple sclerosis are human
disorders that display a strong association with the same HLA class II
haplotype (HLA DRB1*1501) (32, 33). This along with the recent report
of death by GP disease of a multiple sclerosis patient carrying this
HLA specificity (34) support the existence of common pathogenic events
in these human disorders.
![]()
ACKNOWLEDGEMENTS
![]()
FOOTNOTES
![]()
ABBREVIATIONS
![]()
REFERENCES
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES
Copyright © 1999 by The American Society for Biochemistry and Molecular Biology, Inc.
This article has been cited by other articles:
![]() |
F. Granero-Molto, S. Sarmah, L. O'Rear, A. Spagnoli, D. Abrahamson, J. Saus, B. G. Hudson, and E. W. Knapik Goodpasture Antigen-binding Protein and Its Spliced Variant, Ceramide Transfer Protein, Have Different Functions in the Modulation of Apoptosis during Zebrafish Development J. Biol. Chem., July 18, 2008; 283(29): 20495 - 20504. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. A. Kreidberg Integrins and Matrix in the Glomerulus: Old Mysteries and New Insights J. Am. Soc. Nephrol., April 1, 2008; 19(4): 650 - 651. [Full Text] [PDF] |
||||
![]() |
N. Kudo, K. Kumagai, N. Tomishige, T. Yamaji, S. Wakatsuki, M. Nishijima, K. Hanada, and R. Kato Structural basis for specific lipid recognition by CERT responsible for nonvesicular trafficking of ceramide PNAS, January 15, 2008; 105(2): 488 - 493. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. Revert, R. Merino, C. Monteagudo, J. Macias, A. Peydro, J. Alcacer, P. Muniesa, R. Marquina, M. Blanco, M. Iglesias, et al. Increased Goodpasture Antigen-Binding Protein Expression Induces Type IV Collagen Disorganization and Deposit of Immunoglobulin A in Glomerular Basement Membrane Am. J. Pathol., November 1, 2007; 171(5): 1419 - 1430. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Kumagai, M. Kawano, F. Shinkai-Ouchi, M. Nishijima, and K. Hanada Interorganelle Trafficking of Ceramide Is Regulated by Phosphorylation-dependent Cooperativity between the PH and START Domains of CERT J. Biol. Chem., June 15, 2007; 282(24): 17758 - 17766. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. D. Maines, T. Miralem, N. Lerner-Marmarosh, J. Shen, and P. E. M. Gibbs Human Biliverdin Reductase, a Previously Unknown Activator of Protein Kinase C betaII J. Biol. Chem., March 16, 2007; 282(11): 8110 - 8122. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Kawano, K. Kumagai, M. Nishijima, and K. Hanada Efficient Trafficking of Ceramide from the Endoplasmic Reticulum to the Golgi Apparatus Requires a VAMP-associated Protein-interacting FFAT Motif of CERT J. Biol. Chem., October 6, 2006; 281(40): 30279 - 30288. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. Alpy and C. Tomasetto Give lipids a START: the StAR-related lipid transfer (START) domain in mammals J. Cell Sci., July 1, 2005; 118(13): 2791 - 2801. [Abstract] [Full Text] [PDF] |