![]()
|
|
||||||||
J Biol Chem, Vol. 274, Issue 18, 12730-12737, April 30, 1999
, andFrom INSERM U 386, IFR Pathologies Infectieuses, Université Victor Segalen, 146 rue Léo Saignat, F-33076 Bordeaux Cedex, France
| |
ABSTRACT |
|---|
|
|
|---|
In vitro selection was performed in a
DNA library, made of oligonucleotides with a 30-nucleotide random
sequence, to identify ligands of the human immunodeficiency virus
type-1 trans-activation-responsive (TAR) RNA element.
Aptamers, extracted after 15 rounds of selection-amplification, either
from a classical library of sequences or from virtual combinatorial libraries, displayed an imperfect stem-loop structure and presented a
consensus motif 5'ACTCCCAT in the apical loop. The six central bases of
the consensus were complementary to the TAR apical region, giving rise
to the formation of RNA-DNA kissing complexes, without disrupting the
secondary structure of TAR. The RNA-DNA kissing complex was a poor
substrate for Escherichia coli RNase H, likely due to
steric and conformational constraints of the DNA/RNA heteroduplex. 2'-O-Methyl derivatives of a selected aptamer were binders
of lower efficiency than the parent aptamer in contrast to regular sense/antisense hybrids, indicating that the RNA/DNA loop-loop region
adopted a non-canonical heteroduplex structure. These results, which
allowed the identification of a new type of complex, DNA-RNA kissing
complex, demonstrate the interest of in vitro selection for
identifying non-antisense oligonucleotide ligands of RNA structures that are of potential value for artificially modulating gene expression.
In the antisense strategy, a DNA oligonucleotide is designed to
hybridize to an RNA sequence, in order to inhibit specifically the
reading of the encoded genetic information (1). Although RNA is a
single chain nucleic acid, it adopts secondary and tertiary structures,
which can prevent the hybridization of the antisense sequence. This is
one of the likely explanations of the poor inhibition efficiency, if
any, induced by some antisense oligonucleotides. The aptamer strategy
has been successfully used for the selection of ligands against a large
range of targets, such as proteins and small molecules (nucleotides,
amino acids, dyes) (see Ref. 2 for a review). This methodology offers
an alternative way for designing nucleic acid ligands against an RNA
structure. Indeed, we previously demonstrated that in vitro
selection of DNA ligands (aptamers) against DNA secondary structures
led to the identification of sequences able to recognize the DNA
targets through base pair formation and additional unidentified
interactions (3, 4). This might be of high potential interest, as
numerous RNA structures display a regulatory function through
interaction either with proteins (such as the iron-responsive element
interacting with the iron-responsive element-binding protein (5), the
HIV trans-activation-responsive (TAR)1 element binding to the
viral protein Tat (6), or the HIV Rev-responsive element promoting the
export of retroviral RNA from the nucleus due to the binding with the
viral protein Rev (6)) or with nucleic acids (like the
dimerization-initiating sequence of HIV (7)). The binding of an
oligonucleotide to such structures could prevent the interaction of the
RNA with the regulatory partner, hence controlling the expression of
the target gene.
We used the aptamer strategy to identify DNA ligands of the TAR RNA
element; this RNA structure is a 59-nucleotide-long stem loop present
at the 5' end of HIV-1 RNA. TAR RNA mediates the trans-activation of transcription through the binding (i) of
the viral protein Tat to a three nucleotide bulge in the upper part of
the stem (6), and (ii) of cellular proteins to the upper region of the
hairpin (8). The resulting RNA-protein complex increases the
processivity of the RNA polymerase, allowing the high yield synthesis
of the full-length retroviral genome (9). We hypothesized that
oligonucleotides able to bind to TAR with a high affinity might compete
with the TAR-binding proteins, thus preventing the transcription process.
A DNA library comprising more than 1012 different sequences
was screened on the basis of oligonucleotide ability to bind to TAR. We
identified DNA sequences (aptamers) displaying a binding constant of
about 108 M Libraries of Candidates
Oligonucleotides--
Four DNA libraries were investigated each
one having a random sequence of 30 nucleotides (nt), flanked by
18-nt-long conserved sequences used for PCR amplification. Families I,
II, and III were obtained by in situ chemical (FI) or
enzymatic (FII, FIII) ligation of so-called "half-candidates" from
two different sub-libraries, 5'GCAGTCTCGTCGACACCC(N)15 and
5'P-(N)15GTGCTGGATCCGACGCAG (N represents any of the
four natural nucleic acid bases). Family IV was
5'GCAGTCTCGTCGACACCC(N)30GTGCTGGATCCGACGCAG. Oligonucleotide primers were P1, 5'GCAGTCTCGTCGACACCC, and P2, 5'CTGCGTCGGATCCAGCAC.
Chemical Ligation (FI)--
The mixture of half-candidates (100 pmol of each) was heated for 1 min at 80 °C and then cooled down in
5 min from 80 to 40 °C. 2 pmol of TAR in a final volume of 10 µl
of 50 mM sodium cacodylate buffer, pH 7.0, containing 50 mM NaCl, 10 mM MgCl2 were then
added to the candidates. A further linear decrease of temperature from 40 to 20 °C for 2 h, followed by a decrease from 20 to 4 °C
at Enzymatic Ligations (FII and FIII)--
The same TAR/candidate
mixing and annealing conditions as above were used, except the buffer
(50 mM Tris-HCl, pH 7.8, containing 10 mM
MgCl2, 10 mM
2'-O-Methyl oligonucleotides were synthesized on a solid
phase from base-protected
1-(2-O-methyl-3-O-(2-cyanoethoxy(diisopropylamino)-phosphino)-5-(4,4'-dimethoxytrityl)- In Vitro Selection
15 rounds of selection/amplification were performed with each family.
Selection--
10-75 pmol of single-stranded PCR-amplified
candidates were incubated for 2 h at 4 °C in the presence of 1 pmol of 3' end-biotinylated TAR, in D buffer (10 mM
Tris-HCl, pH 7.5, 10 mM MgCl2, 50 mM NaCl, and 1 mM dithioerythritol), in a final
volume of 20 µl. TAR candidates were captured by magnetic
streptavidin-coated beads (Promega), and the bound candidates were then
eluted with water.
Amplification--
Double-stranded amplification was performed
in 50 µl with 25% of the TAR-bound candidates as template and 50 pmol of each primer, using Taq polymerase (0.5 units from
Promega). Single-stranded candidates were then produced from the
previous reaction by 30 PCR cycles, using 100 pmol of P1. The
single-stranded candidates were phenol-extracted, ethanol-precipitated,
and used for the next selection round without any further treatment.
Cloning--
After the 15th round of selection, the candidates
were further amplified with primers P1clon
(5'AATTCCTGCAGTCTCGTCGACACCC) and P2clon
(5'GCCGCTCTAGACTGCGTCGGATCCAGCAC) and cloned in pBluescript. Inserts
were sequenced by the Sanger method, either with T7 sequencing kit
(Amersham Pharmacia Biotech) or by automatic sequencing with dye
terminators (Perkin-Elmer).
Identification of Positive Clones, Electrophoretic Mobility Shift
Assay
Transfected bacteria were lysed by 5 min heating at 96 °C and
then mixed with 50 pmol of each primer P1 and 5'-phosphorylated primer
P2. After PCR amplification, single-stranded candidates were obtained
by incubation for 2 h at 37 °C with 3 units of Footprints
In all experiments, 50 nM 5'-end-radiolabeled
oligonucleotide (either TAR or the candidate) was preincubated for 20 min at 4 °C with 200 nM of the partner, in 8 µl (final
volume) of the selection buffer. Radiolabeled TAR was then partially
digested with either 2 ng of RNase A (Boehringer Mannheim) or 0.5 units of RNase T1 (Boehringer Mannheim) for 20 min at 4 °C. The
5'-end-radiolabeled DNA aptamer was digested by 200 units of S1
nuclease (Boehringer Mannheim) for 20 min at 4 °C. Diethyl
pyrocarbonate (DEPC, 10%) reaction and potassium permanganate
(KMnO4, 2 mM) modification were performed at
4 °C for 90 and 4 min, respectively. The DNA aptamer was then
ethanol-precipitated and cleaved by 1 M piperidine, for 30 min at 90 °C. After DEPC modification, radiolabeled TAR was
ethanol-precipitated, resuspended in 10 µl of Tris-HCl, 1 M, pH 8. Following incubation for 30 min on ice in the dark
with 10 µl of NaBH4 200 mM, it was
ethanol-precipitated and cleaved with 1 M aniline acetate,
pH 4.5, for 30 min at 60 °C in the dark.
RNase H Assay
50 nM 32P-5'-end-labeled TAR were
incubated for 3 h at 20 °C in 10 µl of D buffer in the
presence of the desired aptamer (the concentration was adjusted to 50 times over the Kd value at 4 °C) and of 1 unit of
Escherichia coli RNase H (Fermentas). The digested fragments
were analyzed on a 20% polyacrylamide, 7 M urea gel.
Combinatorial Libraries--
We screened for their binding to the
TAR RNA element a 30-nt randomized oligodeoxynucleotide library which
theoretically contained 430 = 1018 different
sequences. However, as the size of our experiment allowed us to handle
about 10 pmol, only one out of 170,000 sequences was present in the
solution at the first selection step, thus substantially reducing the
diversity of the library. To circumvent this limitation, we considered
the possibility to use a template-assisted combinatorial strategy; two
sub-libraries were synthesized, each one with a 15-nt random region
linked, either at its 5' end (sub-library 1) or at its 3' end
(sub-library 2), to fixed sequences used for PCR amplification with
primers P1 and P2 in further steps of the selection. Moreover, the
sequences in the sub-library 2 were 5'-phosphorylated. Therefore each
sub-library contained about 109 different sequences that
were present on the average 6·103 times each at the scale
of the experiment.
Upon simultaneous mixing with the TAR stem-loop RNA, oligomers from
sub-libraries 1 and 2 may bind independently to the target RNA. We
hypothesized that a bound candidate of the sub-library 1 might have its
3' end in an appropriate position for being ligated to the 5' end of a
bound candidate of the sub-library 2, thus generating a 30-nucleotide
central region. Only such ligated candidates can be amplified from P1
and P2. The ligation reaction was achieved either chemically (Family I,
FI) or enzymatically, under two different sets of conditions (Families
II and III, FII and FIII; see "Materials and Methods"). For
comparison, a fourth family (FIV) corresponded to a library of
"standard" combinatorial sequences comprising a 30-nucleotide
random stretch between the fixed regions corresponding to P1 and P2.
Sequences exhibiting affinity for 3'-biotinylated TAR RNA were captured
by magnetic streptavidin beads. The selection was stopped after the
15th round, and candidates from the four families were cloned and sequenced.
Selected Candidates, Three Classes of Sequences
Emerged--
Direct PCR amplification was performed from the bacterial
colonies, and the crude oligonucleotide solutions were incubated with
32P-5'-end-labeled TAR and tested by EMSA. 21 clones
shifted 100% of TAR at 2-3 µM and were sequenced, as
well as 55 other clones that did not induce any shift at this
concentration. All together, 76 clones (12 in FI, 18 in FII, 20 in
FIII, and 26 in FIV) were sequenced.
Primary structure analysis led to four classes of sequences (Fig.
1) as follows. (i) Class A was composed
of sequences containing the octamer 5'ACTCCCAT (sequences II-25, II-29,
II-36, III-43 and IV-40 showed one point mutation in the consensus).
Three families (FII, III, and IV) were represented in this class. It
should be pointed out that 20 out of the 21 clones which shifted TAR at 2 to 3 µM belong to this class. Five different candidates
(corresponding to 10 clones, "class A++") were still
able to shift 100% of TAR at a 10-fold lower concentration (Fig. 1). A
computer analysis was performed to predict the secondary structure of
these candidates (12); all class A sequences can be folded in imperfect
stem-loop structures, the primers P1 and P2 being partially hybridized
to each other, whereas the consensus octamer was located in the apical
loop (Fig. 2). The chemical and enzymatic
footprints performed with the isolated sequences were in agreement with
the predicted hairpin structure (see below). (ii) Class B was more
diverse. No consensus sequence was found, and 33 out of 39 sequences
were different. However, a pyrimidine-rich region was present in the 3'
part of the random sequence. The candidates could be folded by computer
analysis as imperfect hairpins, with a large pyrimidine loop (not
shown). As these sequences seemed not to bind to the target, we did not
investigate their actual secondary structure by enzymatic or chemical
mapping. Such sequences were obtained from all four families. (iii)
Class C was composed of only one sequence, found 12 times in FIV and
one time in FII. (iv) Class D contained four sequences that did not
share any characteristic with sequences of the three previous classes.
One candidate in this class (I-38) was able to shift 100% of TAR at
2-3 µM.
Binding Properties of Selected Sequences--
As the unique
representative of class C, the sequence IV-09 was synthesized; no
interaction with TAR could be detected. Inasmuch as this sequence was
not recovered from FI, FII, and FIII (with only one exception), in
which the candidates were ligated in the presence of TAR, but in the
absence of streptavidin beads at the first round of selection, this
sequence might have been selected against the bead matrix. Indeed, this
sequence was not found in a selection that included a counter-selection
step with beads only.2
Candidate III-10 (class B, obtained six times) is characterized by a
Kd value of about 5 µM (not shown).
The class B might contain sequences targeted to TAR, but with a low
affinity, explaining the large diversity of sequences.
The best candidates of class A (class A++) were synthesized
(except IV-25 which differed from IV-04 by a single mutation outside of
the consensus octamer) either full-length (66 nt, IV-04) or as
fragments restricted to the predicted apical stem loop
(III-2539, III-3339, IV-0439, and
IV-4038) (Fig. 2); all sequences were able to shift TAR,
with Kd values of 20 (IV-04), 50 (III-2539, III-3339 and IV-0439),
and 120 nM (IV-4038). Therefore, these A++ sequences are real aptamers for the TAR RNA element of
HIV-1.
TAR and Class A Aptamer Complexes Involve Loop-Loop
Interaction--
The central part of the consensus motif (5'CTCCCA) is
complementary to the TAR loop region 3'GAGGGU (the 3'G being part of the stem), suggesting a loop-loop interaction (Fig.
3). This was confirmed by footprint
studies performed on TAR bound to different aptamers
(III-2539, III-3339, IV-4038,
IV-04,and IV-0439); as shown in Fig.
4, both the TAR (Fig. 4a) and
the IV-0439 loops (Fig. 4b) were protected
against nuclease digestion (RNases A and T1 for TAR, S1 nuclease for
IV-0439). The reactivity to diethylpyrocarbonate and
potassium permanganate of IV-04 loop was also decreased (Fig. 4c). In contrast, the faint bands corresponding to bases in
TAR and IV-04 stems were significantly less affected by the hybrid formation (Fig. 4). Such results were also obtained with the three other aptamers that we investigated (III-2539,
III-3339, and IV-4038; not shown),
demonstrating that the loop-loop complex was a general recognition mode
for our aptamers. It should be noted that the enzymatic and chemical
mappings performed on the isolated aptamers confirmed the secondary
structures predicted by a computer program designed for RNA folding
(12).
The affinity of TAR mutants was also in agreement with the kissing
complex model. First, no complex was detected with a triple mutant in
the loop ("TAR AAA," Fig.
5) even at a concentration as high as 50 µM; this was likely due to the three C-A mismatches in
the loop-loop interaction. Second, the bases in the bulge area, known
to be crucial for Tat binding (13) were mutated or permuted: no
modification of the affinity was detected with "TAR UCU," "TAR del," "TAR UA," or "TAR CG" compared with the wild type RNA,
except for the CG permutation, which induced a modest 2.5-fold
destabilization (Fig. 5). Finally, a TAR with a truncated bottom stem
("mini-TAR") showed a slightly increased affinity (2-fold) compared
with the full-length TAR (Fig. 5). These results indicate that the
interaction between TAR and the class A aptamers is driven by the TAR
loop and the top part of the aptamer.
The Aptamer Stem Organizes the Aptamer to Stabilize the
Complex--
To determine the role of the stem, the aptamer IV-04 was
progressively truncated from the bottom of the stem region; the
affinities of the resulting IV-04 derivatives were evaluated by EMSA
(Fig. 6). As reported in Table
I, no dramatic loss of affinity was detected until a 12-mer is generated. The five nucleotides at the 5'
end were unnecessary to complex formation as was the bottom of the stem
and the internal loop (IV-0461 and IV-0439).
The deletion up to nt 23 and beyond nt 48 induced a 6-fold decrease of
the affinity for IV-0426 compared with the parent aptamer
(Kd = 120 nM, Table I). Then the
progressive deletion of one base pair at a time (nt 23/48, 24/47,
25/46) was without major further consequence (aptamers
IV-0424 to IV-0420: Kd = 150 nM, Fig. 6). The deletion of the bulged G49 in
IV-0439 did not weaken the association of the mutated
aptamer with TAR (not shown). In contrast, IV-0412 had a
Kd value of 1 µM. It is only 12 nt
long and contains the consensus sequence but certainly cannot fold in a
stable stem-loop structure under the conditions used for binding assays
(Table I). This indicated that the active form of the aptamer was a
structured stem-loop presenting the consensus in the loop.
Loop-Loop Interactions in TAR·IV-04 Complex Distort the RNA/DNA
Duplex Structure--
As 2'-O-methyl oligoribonucleotides
have a higher affinity for RNA than DNA (14), we hypothesized that
2'-O-methyl (2'-O-Me) modifications at the
positions leading to the potential formation of Watson-Crick pairs in
loop-loop complexes could stabilize IV-04·TAR complexes. But the
modified oligonucleotide IV-0439WC2'-O-Me
displayed a 3-fold lower affinity for TAR than the unmodified parent
aptamer (Table I). About the same affinity was obtained for the fully modified molecule (Kd = 160 nM). This
indicated that the loop-loop duplex did not behave as a canonical
double-stranded heteroduplex.
We investigated the activity of the E. coli RNase H on a
radioactively labeled TAR bound to IV-04 at a saturating concentration. As shown on Fig. 7a, two faint
bands corresponding to cleavage at G33 and G34
were observed, demonstrating that the TAR loop was involved in a
DNA/RNA hybrid. When TAR was mixed with truncated derivatives of IV-04
(IV-0439,26,20,12), the cleavage efficiency increased, but
the cleavage pattern remained unchanged (Fig. 7a). The
efficiency of cleavage of TAR by RNase H (at an aptamer concentration
50-fold over the Kd, i.e. sufficient to
ensure a complete hybridization) was inversely related to the
affinity.
Role of the Bulged T41 of the Aptamer IV-04--
The
computer-predicted structure of IV-04, confirmed by the footprints
performed with chemicals and S1 nuclease, suggested the presence of a
bulged T (nt 41) at the top of the stem (Fig. 2). The deletion of this
T (IV-0439(
In class A aptamers, a conserved T was identified at position +2 or +3
relative to the 3' end of the consensus sequence (Fig. 1). We
investigated the properties of three other class A++
aptamers, in which this T was deleted. For III-3339 and
III-2539, no loss of affinity was obtained compared with
the parent aptamer, in contrast to IV-4038, for which
Kd increased from 120 nM for the wild
type sequence to more than 1 µM (Fig. 2). According to
secondary structure predictions, this T was located either in a bulge
or in the stem depending on the aptamer. So, the presence of this
conserved T might not be significant with respect to the binding
property of class A++ aptamers to TAR.
We have selected aptamers against the HIV-1 TAR RNA element from
DNA libraries containing candidates randomized at 30 positions. In
order to take full advantage of the molecular diversity of such a
population (>1018 different sequences) that surpasses by
about 105 times the number of individuals that can be
screened at a time in our in vitro selection experiment, we
used a template-assisted combinatorial strategy for the first round of
selection (15). This approach relied on the spontaneous self-assembly
on the surface of the target molecule, of short oligomers belonging to
two different sub-libraries. The amplification by polymerase chain
reaction (PCR) used to produce the second generation of candidates that will be screened at the next selection step requires a physical link
between an oligomer from sub-library 1 and another one from sub-library
2. This link was provided by a ligation step prior to the PCR.
Therefore, as any sub-library 1 sequence can potentially be combined to
any sub-library 2 sequence, we can in principle explore the full
diversity of this virtual library, i.e. 415 × 415 = 1018 entities. The general interest of
such libraries over standard selection methods is discussed in detail
in Ref. 15. The ligation was ensured either chemically (FI) or
enzymatically under two different conditions (FII and FIII), and the
results of a 15-round selection with these three families were compared
with that obtained with a conventional library with 30 random positions
(FIV). The analysis of 76 clones belonging to the four families led to
the identification of 20 sequences defining a single class of aptamers (class A) exhibiting affinity for TAR (the high background level is
partly ascribed to the fact that the selection procedure was not
stringent enough and that no counter selection step was introduced). The ligation step did not provide a clear benefit to the selection process. Indeed, winners (class A++ aptamers) were obtained
from Families III and IV. At least four reasons might account for this
outcome as follows. First, the template-assisted ligation of the
candidates occurred only once at the first step of the process.
Therefore, any further round will weaken the early potential enrichment
of the library. Second, for our selected sequences, a limited number of
residues actually contact the target: at most six bases engage direct
interactions (hydrogen bonds) with the TAR RNA. Third, ligation
occurred in the octameric consensus sequence, located in the loop-loop
duplex, which can impede the enzyme or chemical reagent action.
Finally, only combinations for which the 5'-phosphate group of one
candidate is in contact with the 3'-OH end of another candidate can be
ligated, thus restricting the selected sequences to a sub-class.
In all families, the selected sequences showing binding ability for TAR
displayed two important common features as follows: (i) a stem-loop
structure and (ii) an octameric sequence in the loop, partly
complementary to the TAR loop. We demonstrated that the TAR-aptamer
complex involves loop-loop interactions, showing that kissing complexes
constitute a valid recognition mode for RNA stem-loops by DNA
sequences. Such interactions between two RNA stem-loops were previously
extensively studied. It was demonstrated that kissing RNA complexes
play a key role in the regulation of plasmid replication (16) and in
the dimerization of the retroviral genome (7). But this is to our
knowledge the first time that such a complex is described between DNA
and RNA hairpins.
The structure of the double-stranded region resulting from loop-loop
interactions is unknown. Recent NMR studies have shown that kissing RNA
hairpins form a quasi-continuous structure of three coaxially stacked
helices (17, 18); the loop-loop helix is distorted compared with the
A-form RNA and is bent toward the major groove. This reduces the
distance between the two strands allowing a single phosphodiester bond
to bridge the loops across the major groove. One such complex was
formed between the HIV-1 TAR and TAR*, an RNA hairpin with a fully
complementary loop (17). Our TAR-DNA aptamer kissing complexes can
potentially involve six base pairs. This would require the disruption
of the TAR C29-G36 base pair. Alternatively,
only 5 base pairs can be formed, leaving an intact TAR stem (Fig. 3).
TAR-DNA aptamer complexes will likely adopt a structure different from
that of TAR-TAR*, as in the former case, loop-loop interactions will
generate an RNA/DNA duplex flanked by double-stranded DNA (the aptamer
stem) on one side and double-stranded RNA (the TAR stem) on the other
side. RNA and DNA helices are A- and B-forms, respectively, whereas
RNA/DNA hybrids adopt a different conformation for the two strands
(19). This leads to substantially different groove widths and thus to
different interstrand distances. Whereas the gap across the major
groove is about 10 Å for a 6-base loop in the A-form geometry, it is about twice as large in the B-form geometry (20). Stronger distortions and/or longer "connectors" will be required for the RNA/DNA than for the RNA-RNA kissing complex. Indeed, one or two bases
(A32 of IV-04, C30 of TAR, and either
C33 of IV-04 or C29 of TAR, see Fig. 3) are
necessary to connect the stacked helices, in contrast to what has been
previously described for the TAR-TAR* and the ColE1 complexes (17,
18).
The top of the stem of the aptamers seems to play a crucial role in the
binding process. It is striking that the base pairs next to the loop
are weak, A-T or G-T pairs (Fig. 2). Moreover, bulged bases or internal
loops are frequently observed in the upper part of the stem. This
suggests that a weak double-stranded structure in the vicinity of the
binding loop was selected. Indeed, the removal of the bulged
T41 in the aptamer IV-04 or the insertion of an A in the
opposite strand, both modifications restoring perfect helicity in this region and consequently stabilizing the stem, led to a 25-40-fold increase in Kd. The nature of the nucleic acid base
was not important, as a non-nucleotide linker partly restored the affinity, indicating a structural role for this bulged residue. These
imperfect structures are reminiscent of the kissing complexes formed by
natural antisense RNAs involved in bacterial plasmid replication. In
most of the cases where a single stem-loop is involved, the antisense
RNA does not fold in a perfect hairpin structure. As demonstrated by
Hjalt and Wagner (21), the deletion of the bulge and of the internal
loop of the upper stem in CopA antisense RNA increased the
Kd of the kissing intermediate up to 14-fold, thus
showing the structural role of these abnormalities in the helicity for
kissing complexes. Therefore, secondary and tertiary structures in
these regions are crucial for the proper presentation of the
interacting loops in RNA-RNA as well as RNA-DNA loop-loop complexes.
The E. coli ribonuclease H displayed a very low activity on
the TAR RNA/IV-04 DNA hybrid (Fig. 7). Three explanations can be
proposed as follows. (i) For the length of the heteroduplex, it was
reported that heteroduplex as short as 4 base pairs are substrates for
this enzyme (22). Even though 6 bases of the IV-04 loop are
complementary to the upper part of the TAR RNA element (including the
last G residue next to the TAR loop), we do not know the actual number
of paired bases. (ii) The formation of the kissing complex requires
that the connecting residues between the 3' ends of the loop-loop
"helix" and either the TAR or the aptamer stems cross the grooves
of the loop-loop region (18, 23). These linkers might interfere with
the RNase H binding and/or activity. Indeed, pseudo-half-knot antisense
DNA-RNA hairpin complexes were reported to be cleaved with a reduced
efficiency compared with a linear double-stranded RNA duplex,
indicating that loop regions crossing either the major or the minor
groove of the loop-loop helix interfered with RNase H (24). However, in
both cases ("duplex length" and "limited access"), the IV-04 derivatives share the same loop region, i.e. form the same
duplex region and have the same connector length. Therefore, we
strongly favor the third parameter as the key determinant of low RNase H activity on RNA-aptamer complexes: (iii) the bent structure of the
kissing complex. RNase H requires a nucleic acid region upstream (with
respect to the RNA strand) from the cleaved region for binding, likely
through electrostatic interactions (Fig.
8a) (25). This means that, in
IV-04·TAR complexes, the enzyme should interact with the aptamer stem
in order, for the catalytic site, to be appropriately positioned on the
loop-loop heteroduplex (Fig. 8b). Therefore any distortion
at the heteroduplex-aptamer stem junction will displace the catalytic
site away from the substrate region. It is known that RNA-RNA hairpin
complexes adopt a bent conformation in order to allow loop-loop
interactions (18, 23). A similar structure for aptamer-TAR complexes
will preclude a good contact between the catalytic site and the
loop-loop region once the enzyme is bound to the aptamer stem. The high
efficiency of cleavage obtained with the short IV-0412
derivative is in reasonable agreement with this hypothesis; in contrast
to the bent rigid structure of TAR·IV-04 complex, the 3' part of
IV-0412 derivative will provide a flexible binding site for
the enzyme compatible with catalytic site facing the TAR RNA hybridized
loop (Fig. 8c). When increasing the stem length, the complex
is more stacked and constrained, hence more stable, but resulting in a
worse substrate for RNase H. Different curvatures induced by different
stems (for instance IV-0439(+A30) and
IV-0439(
![]()
INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES
1. In contrast to
antisense oligonucleotides, the selected aptamers did not invade the
TAR stem-loop structure but rather fitted to the existing RNA
structure. The selected aptamers could fold into imperfect stem-loop
structures, displaying a consensus sequence in the aptamer loop,
complementary to TAR loop. Therefore, TAR-aptamer interactions give
rise to so-called "kissing complexes," previously demonstrated to
be involved in different natural RNA-RNA complexes (see Ref. 10 for a
review). The binding properties of the DNA aptamers were analyzed as
follows: we demonstrated that bases outside the loop play a key role in
the binding to TAR, even though they do not directly interact with the
RNA target. The upper part of the aptamer stem likely pre-organizes the
loop to minimize the distortion required for loop-loop complex formation.
![]()
MATERIALS AND METHODS
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES
1.5 °C/h, allowed the candidates to equilibrate in the presence of TAR. 10 µl of 400 mM imidazole, pH 7.0, 200 mM NiCl2, 100 mM BrCN were then
added at 4 °C, and the ligation reaction was allowed to proceed for
24 h at 4 °C.
-mercaptoethanol, and 1 mM ATP). At the end of the annealing step, the ligation was
performed with 4 units of T4 RNA ligase, either for 10 h as the
temperature decreased from 20 to 4 °C, and was then maintained at
4 °C for 14 h (Family II), or for 24 h at 4 °C (Family
III). All reactions were stopped by freezing at
20 °C.
-D-nucleoside by using 1H-tetrazole as activator. TAR RNA was synthesized
either enzymatically or chemically. 3'-Biotinylation was performed
following the procedure described in Ref. 11.
exonuclease
(Life Technologies, Inc.) in a 67 mM glycine, NaOH buffer,
pH 9.4, containing 2.5 mM MgCl2, in order to
selectively remove the phosphorylated strand. Candidates were
phenol-extracted, precipitated, and evaluated for TAR binding by
electrophoretic mobility shift assay (EMSA); 50 nM
32P-5'-end-labeled TAR were incubated with candidates in D
buffer for 2 h at 4 °C. The mixture was then loaded on a 10%
polyacrylamide gel containing 50 mM Tris acetate, pH 7.5, and 10 mM magnesium acetate, run at 4 °C for 18 h
at 10 V/cm. For the subsequent analysis of chemically synthesized
aptamers, the same procedure was used, except that the oligonucleotide
of interest (5 nM) was labeled.
![]()
RESULTS
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

View larger version (51K):
[in a new window]
Fig. 1.
Selected sequences. The 30-nucleotide
randomized region only is represented. Sequences are named after the
family of selection (I-IV), ranked in classes A, B, C, or D, and
classified according to primary structure criteria (see text). In A and
B classes, the octameric consensus and the pyrimidine-rich region,
respectively, are in boldface. a, representativity
(R) means the number of times (when >1) that each sequence
was found. b, the affinity (A) for TAR was evaluated by
EMSA: 100% shift of TAR was obtained with an aptamer concentration of
2-3 µM (+) or 0.2-0.3 µM (++).
means
that no shift was detected at 2-3 µM. *, III-40 (class
A) and II-11 (class C) are identical to IV-04 and IV-09,
respectively.

View larger version (20K):
[in a new window]
Fig. 2.
Secondary structure and
Kd values of some class A++
candidates. The secondary structures of IV-04,
III-2539, III-3339, and IV-4038
were predicted by computer folding (12) and confirmed by enzymatic and
chemical mapping (see Fig. 4). Truncated IV-0439 is
indicated by solid black arrows. The sequences corresponding
to the primers are in italic, the octameric consensus in
bold face, and the mutated positions are shaded.
+A and
T indicate an insertion or a deletion,
respectively. The Kd values (in nM)
determined by EMSA, in D buffer at 4 °C, of intact aptamers (in
parentheses) and of mutated or point-deleted aptamers are
given. PG, propylene glycol linker.

View larger version (11K):
[in a new window]
Fig. 3.
Scheme of the kissing complex. Only the
apical regions of TAR (nt 20-42) and IV-04 (nt 25-46) are
represented. The consensus octamer of IV-04 is in boldface.
The G36 of TAR can pair either with C33 of
IV-04 or with C29 of TAR, as indicated by dotted
lines.

View larger version (48K):
[in a new window]
Fig. 4.
Footprints of TAR·IV-04 complexes.
a, radiolabeled TAR (TAR*, 50 nM) was incubated
in the absence (
) or in the presence (+) of 200 nM IV-04
and digested by RNase A (A) or RNase T1 (T1). The
sequence of TAR is given to the left. b,
radiolabeled IV-0439 (IV-0439*, 50 nM) was incubated in the absence (
) or in the presence
(+) of 200 nM TAR and digested by S1 nuclease
(S1). The sequence of IV-0439 is given to the
left. c, summary of major cleavage sites in
TAR·IV-04 complex induced by S1 nuclease (
), RNase T1 or A
([dharrow]), DEPC (
), and KMnO4 (
). Open
and solid symbols refer to protected and sensitized sites in
the complex, respectively.

View larger version (20K):
[in a new window]
Fig. 5.
Affinity of mutated TAR elements for the
aptamer IV-04. The Kd values were evaluated by
EMSA in D buffer at 4 °C.

View larger version (84K):
[in a new window]
Fig. 6.
Affinity of IV-04 and IV-0420 for
TAR. Radiolabeled IV-04 (a) and IV-0420
(b) were incubated with an increasing concentration of TAR
(in nM) and analyzed by band-shift assay. The complexes are
indicated by an arrow.
Affinity of IV-04 derivatives for TAR

View larger version (33K):
[in a new window]
Fig. 7.
RNase H cleavage of TAR·IV-04 derivative
complexes. a, radiolabeled TAR (50 nM) was
incubated in the absence (
) or in the presence of IV-04 (1 µM), IV-0439 (2.5 µM),
IV-0426 (6 µM), IV-0420 (7.5 µM), IV-0412 (50 µM), or
IV-0439(+A30) (100 µM) and
digested by E. coli RNase H. L is an alkaline
hydrolysis of TAR. The sites of digestion are indicated to the
left, according to RNase T1 digestion (not shown).
b, cleavage pattern in the presence of
IV-0439(+A30). Only the upper part
of the TAR stem (nt 18-44) is presented. The size of arrows
is related to the cleavage efficiency.
T41)) or the introduction of an A
in the opposite strand (IV-0439(+A30)), both
modifications, which lead to a perfect double-stranded stem next to the
loop of the aptamer, induced a large destabilization of the complex
(Kd > 1 µM, Fig. 2). However, the
substitution in IV-0439 of T41 by A, C, G or by
a propylene glycol linker induced minor changes in affinity, leading to
Kd values of 60, 150, 20, and 250 nM,
respectively, compared with 50 nM for the parent aptamer (Fig. 2). This supports a structural role, rather than a sequence effect of this bulged residue. The pattern of RNase H cleavage of TAR
induced by IV-0439(+A30) was totally unexpected
and differed from that obtained with other IV-04 derivatives (Fig.
7a). Multiple cleavage sites were detected with a decreasing
sensitivity in the order U31, C30 > C29, G28, A27, G26 > U25, U24 (Fig. 7b). In this region,
only U31 was predicted to be paired in the TAR RNA/aptamer
DNA hybrid (Fig. 3); no complementarity between TAR and the other
nucleotides of this sequence could be identified. This pattern resulted
from the insertion of a single nucleotide compared with the parent IV-0439. In contrast to
IV-0439(+A30), the
IV-0439(
T41) derivative (in which the
T41 was deleted) led to the same cleavage sites as
IV-0439, although with a much higher efficiency (not
shown). In this latter case, the cleavage yield was also inversely
related to the affinity.
![]()
DISCUSSION
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES
T41)) will generate various
structures for the complexes that are sensed by RNase H, eventually
leading to cuts outside the paired region (Fig. 8d).
Cleavages outside the RNA/DNA duplex were previously reported for
regular (26, 27) and chemically modified duplexes (28, 29).

View larger version (42K):
[in a new window]
Fig. 8.
Model for RNase H binding and cleavage of
aptamer IV-04·TAR RNA complexes. The interaction of the E. coli RNase H basic protrusion with the double strand is indicated
by +++ and the catalytic site by an arrow. The
binding and digestion schemes of RNase H on a perfect RNA/DNA double
strand (a), on the IV-04·TAR kissing complex
(b), on the IV-0412·TAR (c), and on
the mutated IV-0439(+A30)·TAR (d)
are shown. The RNA and DNA strands are, respectively, double
and single lines.
It is striking that a full-length (30-mer) antisense sequence corresponding to the random region of the library was not selected. This confirmed that antisense oligodeoxynucleotides are not good ligands for structured RNA regions. Indeed, it was demonstrated that anti-TAR DNA 17-mers, including a sequence complementary to the top part of the TAR element and which adopted a hairpin structure, had a poor affinity (30); this oligomer was therefore not able to give rise to kissing complex formation.
We selected DNA molecules that might inhibit TAR-dependent
activation of transcription. It is expected that IV-04 will not directly interfere with the binding of Tat, as the binding sites of
these two molecules on TAR are different. In contrast, the cellular
proteins TRP 185 (31), TRBP (32), and the Tat·cyclin T·CDK9 complex
(33) bind to TAR at the level of the loop. This could allow DNA
aptamers to prevent the transcription activation controlled by these
proteins. The competition between Tat or TRBP and the aptamers is
presently under investigation.
| |
ACKNOWLEDGEMENTS |
|---|
We are grateful to Sandra Grelier and Justine Michel for their technical assistance.
| |
FOOTNOTES |
|---|
* This work was supported in part by Genset, the "Agence Nationale de Recherches sur le SIDA," and by the Biotechnology program of the "European Union".The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
Recipient of an INSERM PECO fellowship.
§ To whom correspondence should be addressed. Tel.: (33) 5 57 57 10 17; Fax: (33) 5 57 57 10 15; E-mail: jean-jacques.toulme{at}bordeaux.inserm.fr.
2 D. Sekkai, C. Boiziau, and J. J. Toulmé, unpublished observations.
| |
ABBREVIATIONS |
|---|
The abbreviations used are: TAR, trans-activation-responsive; HIV, human immunodeficiency virus; nt, nucleotides; PCR, polymerase chain reaction; EMSA, electrophoretic mobility shift assay; DEPC, diethyl pyrocarbonate; FI, FII, FIII, and FIV, Family I, II, III, and IV, respectively.
| |
REFERENCES |
|---|
|
|
|---|
This article has been cited by other articles:
![]() |
Liquid-crystal NMR structure of HIV TAR RNA bound to its SELEX RNA aptamer reveals the origins of the high stability of the complex PNAS, July 8, 2008; 105(27): 9210 - 9215. |
||||
![]() |
P. Bellecave, C. Cazenave, J. Rumi, C. Staedel, O. Cosnefroy, M.-L. Andreola, M. Ventura, L. Tarrago-Litvak, and T. Astier-Gin Inhibition of Hepatitis C Virus (HCV) RNA Polymerase by DNA Aptamers: Mechanism of Inhibition of In Vitro RNA Synthesis and Effect on HCV-Infected Cells Antimicrob. Agents Chemother., June 1, 2008; 52(6): 2097 - 2110. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. J. Boese and R. R. Breaker In vitro selection and characterization of cellulose-binding DNA aptamers Nucleic Acids Res., October 8, 2007; 35(19): 6378 - 6388. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Wu, S. L. Heilman-Miller, and J. G. Levin Effects of nucleic acid local structure and magnesium ions on minus-strand transfer mediated by the nucleic acid chaperone activity of HIV-1 nucleocapsid protein Nucleic Acids Res., June 9, 2007; 35(12): 3974 - 3987. [Abstract] [Full Text] [PDF] |
||||
![]() |
W. James Aptamers in the virologists' toolkit J. Gen. Virol., February 1, 2007; 88(2): 351 - 364. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. IVANOVA, A. A ARZUMANOV, J. J TURNER, S. REIGADAS, J.-J. TOULME, D. E BROWN, A. M.L LEVER, and M. J GAIT Anti-HIV Activity of Steric Block Oligonucleotides Ann. N.Y. Acad. Sci., October 1, 2006; 1082(1): 103 - 115. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. A. Di Giusto and G. C. King Construction, Stability, and Activity of Multivalent Circular Anticoagulant Aptamers J. Biol. Chem., November 5, 2004; 279(45): 46483 - 46489. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Pakleza and J. A. H. Cognet Biopolymer Chain Elasticity: a novel concept and a least deformation energy principle predicts backbone and overall folding of DNA TTT hairpins in agreement with NMR distances Nucleic Acids Res., February 1, 2003; 31(3): 1075 - 1085. [Abstract] [Full Text] [PDF] |
||||
![]() |