J Biol Chem, Vol. 274, Issue 18, 12811-12818, April 30, 1999
GATA-5 Is Involved in Leukemia Inhibitory Factor-responsive
Transcription of the
-Myosin Heavy Chain Gene in Cardiac
Myocytes*
Tatsuya
Morimoto
,
Koji
Hasegawa
§,
Satoshi
Kaburagi
,
Tsuyoshi
Kakita
,
Hiroshi
Masutani¶,
Richard N.
Kitsis
**,
Akira
Matsumori
, and
Shigetake
Sasayama
From the
Department of Cardiovascular Medicine,
Graduate School of Medicine, and ¶ Department of Biological
Responses, Institute for Virus Research, Kyoto University,
Kyoto 606-8507, Japan and
Departments of Medicine and Cell
Biology, Albert Einstein College of Medicine,
Bronx, New York 10461
 |
ABSTRACT |
Leukemia inhibitory factor is a member of a
family of structurally related cytokines sharing the receptor component
gp130. Activation of gp130 by leukemia inhibitory factor is sufficient to induce myocardial cell hypertrophy accompanied by specific changes
in the pattern of gene expression. However, the molecular mechanisms
that link gp130 activation to these changes have not been clarified.
The present study investigated the transcriptional pathways by which
leukemia inhibitory factor activates
-myosin heavy chain expression
during myocardial cell hypertrophy. Mutation of the GATA motif in the
-myosin heavy chain promoter totally abolished leukemia inhibitory
factor-responsive transcription without changing basal transcriptional
activity. In contrast, endothelin-1 responsiveness was unaffected by
the GATA mutation. Among members of the cardiac GATA transcription
factor subfamily (GATA-4, -5, and -6), GATA-5 was the sole and potent
transactivator for the
-myosin heavy chain promoter. This
transactivation was dependent on sequence-specific binding of GATA-5 to
the
-myosin heavy chain GATA element. Cardiac nuclear factors that
bind to to the
-myosin heavy chain GATA element were induced by
leukemia inhibitory factor stimulation. Last, leukemia inhibitory
factor stimulation markedly increased transcripts of cardiac GATA-5, the expression of which is normally restricted to the early embryo. Thus, GATA-5 may be involved in gp130 signaling in cardiac myocytes.
 |
INTRODUCTION |
Cardiac muscle cells exit the proliferative cell cycle soon after
birth, with little or no capacity for subsequent cell division. Hence,
the adult myocardium responds to hemodynamic stimuli through an
adaptive hypertrophic response that is characterized by an increase in
myocardial cell size without a concomitant increase in myocyte number
(for review, see Refs. 1 and 2). During chronic exposure to hemodynamic
stress, however, the myocardium ultimately develops an irreversible
loss of function and ensuing cardiac muscle failure (3). As such, the
identification of the signaling pathways that mediate cardiac muscle
hypertrophy is critical to the ultimate elucidation of the molecular
basis of cardiac muscle failure.
Cardiac myocyte hypertrophy is associated with specific changes in the
pattern of gene expression, exemplified by the induction of
-myosin
heavy chain (MHC)1 and atrial
natriuretic factor in rodents (4-6). Although the human ventricular
myocardium predominately expresses
-MHC under basal conditions, the
induction of this gene occurs in atrial myocardium in response to
hemodynamic overload (7, 8). The regulated expression of cardiac genes
has been studied using primary cultures of neonatal rat cardiac
myocytes (9-16). In this in vitro system, a number of
growth factors signaling through G-protein-coupled receptors, including
1-adrenergic agonists, angiotensin II, and endothelin-1
(ET-1), stimulate increases in myocyte volume and reproduce many of the
changes in cardiac gene expression characteristic of the hypertrophic
program in vivo. Transcriptional regulation of cardiac
genes by these stimuli has been extensively studied using transient
transfection assays. DNA binding factors that might mediate the nuclear
response to
1-adrenergic stimulation include the
transcription enhancer factor-1 family, serum-responsive factor, and
Sp1 (11-13).
Recent work has demonstrated that members of a family of structurally
related cytokines including leukemia inhibitory factor (LIF) and
cardiotrophin-1 induce an increase in cell size in cardiomyocyte culture (17, 18). The receptors of this cytokine family are multimeric
and share the class-specific transmembrane signal-transducing component
gp130 (19-23). Signaling is triggered through the homodimerization of
gp130 (24) or the heterodimerization of gp130 with a related transmembrane signal transducer, the LIF receptor subunit
(25, 26).
Overexpression of both interleukin-6 and its receptor results in
constitutive tyrosine phosphorylation of gp130 (i.e.
activation) in the myocardium and left ventricular hypertrophy in
vivo (27). Thus, the induction of cardiomyocyte hypertrophy
through gp130-dependent signaling pathways is not confined
to the in vitro hypertrophy assay but is also observed
in vivo. Activation of gp130 by LIF or cardiotrophin-1 is
also associated with specific changes in cardiac gene expression (18).
The molecular mechanisms that link gp130 activation to these changes
have not been clarified.
Members of the interleukin-6-LIF cytokine family have been shown to
activate the Janus kinase/signal transducer and activator of
transcription (STAT) pathway and phosphorylate STAT3 (23, 28-30). It
is also clear that this family of cytokines can activate Ras and
mitogen-activated protein kinase cascades (23, 28, 31). An activated
Ras gene, targeted to myocardium in transgenic mice, elicits
ventricular enlargement, atrial natriuretic factor expression,
myofibrillar disarray, and impaired relaxation in diastole (32).
Conversely, microinjection of dominant-negative Ras protein was
reported to block
1-adrenergic induction of both morphological changes in myofibrillar structure and expression of
atrial natriuretic factor (33), demonstrating a requirement of
Ras-dependent pathways for G-protein-coupled signaling in
myocardial cell hypertrophy. The relative contributions of the
Ras/mitogen-activated protein kinase and Janus kinase/STAT pathways to
gp130-induced cardiac hypertrophy are presently unclear, however,
because selective pharmacological inhibition of mitogen-activated
protein kinase activation does not block hypertrophy (34). Recently, we
and others have shown that zinc finger GATA transcription factors are
required for transcriptional activation of the genes for angiotensin II
type 1a receptor and
-MHC during pressure overload hypertrophy in vivo (35, 36). However, pressure overload is a complex stimulus consisting of multiple factors. A specific stimulus linked to
GATA factors has not been clarified. In addition, although so far six
members of the GATA transcription factor family have been cloned, it is
unclear which member of this family plays the most important role.
Thus, the present study analyzed cis-acting elements and
trans-acting factors required for LIF-responsive
-MHC
transcription during myocardial cell hypertrophy.
 |
EXPERIMENTAL PROCEDURES |
Measurement of Protein Synthesis Rate--
Primary ventricular
cardiac myocytes were prepared from hearts of 1-2-day-old Sprague
Dawley rats as described previously (37). Twenty-four hours after
plating, the cells were washed twice with serum-free media and then
incubated with 5 µCi/ml [3H]phenylalanine (120 Ci/mmol)
and unlabeled phenylalanine (0.36 mmol/liter) in serum-free medium
for 48 h in the presence of 2.5 × 10
9
M LIF (AMRAD, Melbourne, Australia), 10
7
M ET-1 (Peptide Institute, Osaka, Japan), or saline as a
control. The cells were washed twice with phosphate-buffered saline,
and 10% trichloroacetic acid was added at 4 °C for 60 min to
precipitate protein. The precipitate was washed three times with 95%
ethanol and then resuspended in 0.15 N NaOH. Aliquots were
measured by a scintillation counter.
RNA Analysis--
Northern blot analysis of 10 µg of total RNA
was performed as described (36, 37). An isoform-specific antisense
deoxyoligonucleotide complementary to nucleotides 5846-5869 of the rat
3' untranslated region (38) was used to detect
-MHC mRNA as
described (36, 37). As controls, blots were also hybridized with rat
glyceraldehyde-3-phosphate dehydrogenase (GAPDH) cDNA (nucleotides
170-577) (39) obtained by polymerase chain reaction. Amounts of
mRNAs were quantified by a bioimaging analyzer (BAS 2000; FUJIX,
Tokyo, Japan).
Plasmid Constructs--
The plasmid constructs p-2936
-MHCluc
(37, 40), p-3542
-MHCluc (36, 37), p-333wt
-MHCluc (wild type) (36)
and p
-actinluc (37) were firefly luciferase reporter plasmids (41)
driven by the most proximal 2936 bp of the rat
-MHC gene, 3542 or
333 bp of the rat
-MHC gene, or 433 bp of avian cytoplasmic
-actin 5'-flanking region, respectively. In p-333M-CAT
-MHCluc,
two M-CAT elements located at sequences
274/
280 and
204/
210
were simultaneously mutated in the context of the 333-bp rat
-MHC
promoter as described (36). In p-333GATA
-MHCluc, a core part of the
putative GATA consensus in rat
-MHC sequences
264/
269 was
mutated (36). Base substitutions were verified by sequencing in both
directions. pRSVCAT has been described previously (40, 42, 43). The murine GATA-5 and GATA-6 expression plasmids pcDNAG5 (44) and pcDNAG6 (45) were generous gifts of Dr. Michael S. Parmacek (University of Chicago, Chicago, IL) and described elsewhere. The
murine GATA-4 expression plasmid pcDNAG4 was subcloned by digesting
pMT2-GATA-4 (46) (a generous gift of Dr. David Wilson, Washington
University, St. Louis, MO) with EcoRI to isolate a 1.9-kb
insert and subcloning the resultant cDNA fragment encoding the
murine GATA-4 into the EcoRI site of the eukaryotic
expression plasmid pcDNA3 (Invitrogen, Carlsbad, CA). Plasmids were
purified by anion exchange chromatography (Qiagen, Hilden, Germany),
quantified by measurement of A260, and examined
on agarose gels stained with ethidium bromide before use.
Transfection and Luciferase/CAT Assays--
Twenty-four hours
after plating, cells were washed twice with serum-free media and then
co-transfected with 4 µg of the luciferase construct of interest and
1 µg of pRSVCAT using LipofectAMINE (Life Technologies, Inc.)
according to the manufacturer's recommendation. After a 2-h incubation
with DNA-LipofectAMINE complex, the cells were washed twice with
serum-free media and further incubated for 48 h in serum-free
media in the presence of 2.5 × 10
9 M
LIF, 10
7 M ET-1, or saline as a control. The
cells were then washed twice with ice-cold phosphate-buffered saline
and lysed as described (36, 37, 40, 43, 47). Luciferase activities were
determined in duplicate samples from each plate using a Monolight LB
9501 luminometer (EG&G, Berthold) (36, 37, 40, 43, 47). Chloramphenicol acetyltransferase (CAT) activities were determined in the same cell
lysate as that used for the luciferase assay (36, 37, 40, 43, 47).
Electrophoretic Mobility Shift Assays (EMSAs)--
Nuclear
extracts were prepared from cultures of primary neonatal rat cardiac
myocytes as described (48, 49). GATA-4/5 protein was prepared using
in vitro transcription and translation systems (Promega,
Madison, WI) according to the manufacture's recommendation.
Double-stranded oligonucleotides were designed that contained GATA
motifs from the
-MHC or cardiac troponin C (cTnC) promoters. The
sequences of the sense strand of these oligonucleotides were as
follows:
GATA,
5'-CTGTGGAATGTAAGGGATATTTTTGCTTCACTTTGAGCCA-3'; mut
GATA,
5'-CTGTGGAATGTAAGGTCAATTTTTGCTTCACTTTGAGCCA-3'; CEF-1, (GATA element in
the cTnC promoter; Ref. 48),
5'-CGCGGATCCCCAGCCTGAGATTACAGGGAGGATCCGCG-3'; and nonspecific
oligonucleotide, 5'-GGGCATGTCCGGGCATGTCC-3'. Oligonucleotides were
synthesized by Greiner Inc. (Tokyo, Japan) and purified by SDS-polyacrylamide gel electrophoresis.
EMSAs were carried out at 4 °C for 20 min in 15-µl reaction
mixtures containing 10 µg of nuclear extract, 0.25 ng (>20,000 cpm)
of radiolabeled double-stranded oligonucleotide, 500 ng of poly(dI-dC),
5 mM Tris-HCl (pH 7.5), 1 mM EDTA, 0.5 mM dithiothreitol, 37.5 mM KCl, and 4% Ficoll
400. For cold competition experiments, a 100 molar excess of unlabeled
competitor oligonucleotide was included in the binding reaction
mixture. Protein-DNA complexes were separated by electrophoresis on 4%
nondenaturing polyacrylamide gels in 0.25 × Tris-borate EDTA
(1 × Tris-borate EDTA is 100 mM Tris, 100 mM boric acid, and 2 mM EDTA) at 4 °C.
Reverse Transcriptase-Polymerase Chain Reaction (PCR)--
To
detect GATA-5 transcripts in cardiac myocytes, a reverse
transcriptase-polymerase chain reaction was carried out as described previously (51). For this particular experiment, we used ventricular myocytes isolated from 1-2-day-old DDY mice, because the rat GATA-5 sequence has not been published. One litter (8-12 pups) yielded ~4 × 105 cells. Total RNA was isolated as described
(36, 37) from these cells and subjected to reverse transcription (8 µg of total RNA/sample) with a first-strand cDNA synthesis kit
(Amersham Pharmacia Biotech) according to the manufacturer's recommendation.
The PCR primers were designed on the basis of published mouse cDNA
sequences for GATA-5 (44) and GAPDH (39) as follows; sense for GATA-5,
TCCCACTCTCCTCAACTCT; antisense for GATA-5, ACACCAGGTCTCCTGACGTA; sense
for GAPDH, TTGCCATCAACGACCCCTTC; and antisense for GAPDH, TTGTCATGGATGACCTTGGC. To define the optimal amplification conditions, a
series of pilot studies were performed using various amounts of reverse
transcription products and various cycle numbers of PCR amplification
as described (51). On the basis of these initial experiments, the
linear portion of the amplification was determined for both genes. The
following conditions were therefore chosen as standard for the PCR
reactions in a volume of 50 µl: reverse transcription products from
300 ng of RNA for GATA-5 or 150 ng of RNA for GAPDH, 2.5 units of
TaqAmpli polymerase (Perkin-Elmer), and 35 cycles of amplification for
GATA-5 or 30 cycles for GAPDH and 100 ng of each sense and antisense
primers. The amplification was carried out as follows: denaturation,
45 s at 94 °C; annealing, 45 s at 54 °C; and extension,
90 s at 72 °C. The PCR products (10 µl/lane) were
electrophoresed on a 1.5% agarose gel and stained with ethidium bromide.
Statistical Analysis--
All data are expressed as means ± S.E. The significance of differences between mean values was
evaluated by the two-tailed Student's t test, and
differences were considered significant at the p < 0.05 level.
 |
RESULTS |
LIF Increases Protein Synthesis Rate and
-MHC Transcription in
Cardiac Myocytes--
Neonatal rat ventricular cardiac myocytes
respond to various hypertrophic stimuli by increasing protein synthesis
and by specifically changing their patterns of gene expression,
e.g. induction of
-MHC (12, 15). To assess whether LIF
induces a hypertrophic response to an extent similar to that of other
previously well defined hypertrophic stimuli, such as ET-1,
cardiomyocytes were treated with 2.5 × 10
9
M LIF or 10
7 M ET-1. As reported
previously, these two stimuli elicit distinct forms of hypertrophy
(width versus length; Ref. 18). Therefore, we have used bulk
protein synthesis as a measure of hypertrophy. Stimulation with LIF and
ET-1 resulted in a 40 ± 7 and 46 ± 5% increase in the
protein synthesis rate, respectively (Fig.
1A). Then we examined the
expression of
-MHC by Northern blot using an oligonucleotide probe
specific for the
-isoform of MHC mRNA. We performed these
experiments using three independent preparations of cardiac myocytes.
Stimulation with LIF and ET-1 increased the expression of
-MHC gene
in cardiac myocytes by 3.8 ± 0.4- and 3.0 ± 0.5-fold,
respectively, compared with the saline-stimulated states (Fig.
1B). However, neither LIF nor ET-1 activated the expression
of a ubiquitously and constitutively expressed GAPDH gene. Thus, both
LIF and ET-1 increased the protein synthesis rate and specifically
activated
-MHC gene expression to a similar extent in cardiac
myocytes.

View larger version (26K):
[in this window]
[in a new window]
|
Fig. 1.
Increase of protein synthesis rate and
-MHC gene expression in cardiac myocytes by ET-1 and LIF.
A, neonatal rat ventricular myocytes were incubated in the
presence of saline, 10 7 M ET-1, or 2.5 × 10 9 M LIF for 48 h. The activities of
incorporated [3H]phenylalanine were determined by
scintillation counting. B, Blots containing total RNA (10 µg) from these myocytes were sequentially hybridized with an
isoform-specific antisense deoxyoligonucleotide complementary to rat
-MHC mRNA and with a rat GAPDH cDNA. , control; ,
ET-1; , LIF.
|
|
To determine whether the increase in
-MHC gene expression during LIF
and ET-1 stimulation of neonatal rat ventricular cells is mediated at
the transcriptional level by elements within the 5'-flanking region of
the
-MHC gene, cardiomyocytes were transfected with a
-MHC-luciferase reporter construct containing 3542-bp rat
-MHC
upstream sequence (p-3542
-MHCluc). To control for transfection efficiency, the cells were co-transfected with a small quantity of
pRSVCAT. After 48 h of stimulation with LIF, ET-1, or saline as a
control, cardiomyocytes were harvested for luciferase and CAT assays.
The 3542-bp
-MHC promoter fragment conferred LIF- and ET-1-inducible
expression to the luciferase reporter gene (1.9 ± 0.3- and
2.4 ± 0.1-fold, respectively). In contrast, neither LIF nor ET-1
stimulation induced the expression of a transfected luciferase gene
driven by the 2936-bp
-MHC promoter (0.9 ± 0.2- and 1.2 ± 0.3-fold, respectively). These findings suggest that the upreguated
expression of
-MHC gene by LIF or ET-1 is mediated, at least in
part, through a transcriptional mechanism and that the proximal 3542-bp
-MHC promoter sequences are sufficient to mediate LIF- and
ET-1-responsive transcription.
LIF-responsive
-MHC Transcription Requires an Intact GATA
Element--
To more precisely determine the downstream molecular
events during LIF-induced cardiac hypertrophy, we examined
cis-acting elements that mediate LIF-responsive
-MHC
transcription. A previous study demonstrated that the proximal 333 bp
of the rat
-MHC promoter are sufficient to mediate muscle-specific
transcription in cultured neonatal cardiac myocytes and in sol8 cells
(52). As shown in Fig. 2B, in
cultured neonatal cardiac myocytes, the transfected
333/+34-bp
-MHC promoter responded to LIF and ET-1 stimulation, increasing the
expression 2.0- and 3.0-fold, respectively. These data demonstrate that
important elements exist within the rat
-MHC promoter sequences
333/+34, although they do not rule out possible elements outside
these sequences.

View larger version (22K):
[in this window]
[in a new window]
|
Fig. 2.
Mutation analysis of the basal
transcriptional activities and ET-1- and LIF-responsive transcription
of rat -MHC promoter sequences in cardiac myocytes. Four µg
of p-333wt -MHCluc (wild type), p-333M-CAT -MHCluc (mutation of
both M-CAT elements) or p-333GATA -MHCluc (mutation of GATA element)
and 1 µg of pRSVCAT were co-transfected into primary cardiac myocytes
of neonatal rats subsequently stimulated with saline, ET-1, or LIF for
48 h. A, basal activities represent the relative
luciferase activities (luc/CAT) in saline-stimulated states and were
expressed by setting those of p-333wt -MHCluc at 100% in each
experiment. B, fold activation was expressed as the -MHC
promoter activities (luc/CAT) in ET-1- or LIF-stimulated myocytes
relative to those in saline-stimulated cells. In both A and
B, data are presented as the mean ± S.E. of at least
three independent experiments. , wild type; , mutant M-CAT;
, mutant GATA.
|
|
The rat
-MHC promoter sequences
333/+34 contain distal and
proximal M-CAT elements, previously demonstrated to mediate
muscle-specific and
1-adrenergic-stimulated
transcription of the
-MHC gene (12). These also contain a GATA
element, shown to mediate cardiac-specific transcription of other genes
(50, 53, 55). Thus, we mutated these elements in the context of the
333-bp
-MHC promoter. Mutations were designed to abolish the binding
of cardiac nuclear factors (12, 53, 56). As shown in Fig.
2A, basal transcriptional activity of the transfected 333-bp
-MHC promoter was attenuated by simultaneous mutations in both
distal and proximal M-CAT elements (66% decrease versus
wild type), compatible with a role for the M-CAT element in
muscle-specific transcription. Basal activity was unaffected, however,
by mutating the GATA motif. LIF- or ET-1-responsive
-MHC
transcription is shown in Fig. 2B. In contrast to the basal activity, mutating the M-CAT elements affected neither ET-1 nor LIF
responsiveness. Notably, however, LIF- but not ET-1-responsive transcription was totally abolished by mutating the GATA element (wild
type, 2.0-fold, versus GATA mutant, 0.9-fold;
p < 0.001). Thus, an intact GATA element is required
for LIF-responsive
-MHC transcription, suggesting a role for this
element in LIF-induced cardiac hypertrophy.
GATA-5 Is a Potent Activator of the
-MHC Promoter--
Among
members of GATA transcription factor family, GATA-4, -5, and -6 are
expressed in the heart (44-46). To determine whether expression of
GATA-4, -5, and -6 can transactivate the LIF-responsive
333/+34 bp
-MHC promoter sequences, we performed transient transfection experiments. We co-transfected a luc expression vector driven by the
333/+34-bp
-MHC promoter with a eukaryotic expression plasmid
encoding one of GATA-4, -5, or -6 or
-galactosidase as a control.
Transfection efficiency was monitored by co-transfected pRSVCAT
activity. GATA-4, -5, or -6 could not transactivate the
333/+34-bp
-MHC promoter in cultured neonatal cardiac myocytes, possibly
because of the competition for co-factors with endogenous GATA factors.
To circumvent this problem, we performed these experiments in NIH3T3
cells, which do not express GATA-4, -5, or -6. As shown in Fig.
3A, expression of GATA-5
resulted in marked (12-fold) activation of the
333/+34 bp
-MHC
promoter. In contrast, a promoter derived from the ubiquitously
expressed
-actin gene was activated only mildly (3.2-fold). The
extent of the
-MHC promoter transactivation by GATA-4 or -6 was
<3-fold and did not differ significantly from that of
-actin
promoter activation. Compatible with a previous report (53), a 2936-bp
-MHC promoter was not transactivated by GATA-4, -5, and -6 (<3-fold). We showed that GATA-4, -5, and -6, to a comparable degree
(>10-fold), transactivated the smooth muscle myosin heavy chain
promoter, which contains two GATA
motifs.2 Thus, among members
of the cardiac GATA transcription factor subfamily (GATA-4, -5, and
-6), GATA-5 is the sole potent activator of the
-MHC promoter. In
addition, this marked activation occurs in the
-MHC promoter but not
in the
-MHC promoter, compatible with LIF responsiveness in cardiac
myocytes.

View larger version (22K):
[in this window]
[in a new window]
|
Fig. 3.
Sequence-specific transactivation of the
-MHC promoter by GATA-5. A, NIH3T3 cells were transfected
with 2.5 µg of GATA-4, -5, and -6 expression vector, 1.5 µg of a
reporter plasmid (p -actinluc, p-333wt -MHCluc, or
p-2936 -MHCluc), and 0.5 µg of pRSVCAT. The results are expressed
as fold activation of the normalized luciferase activity (luc/CAT)
relative to co-transfection with the control -galactosidase
expression vector. The data shown are from two to four independent
experiments, each carried out in duplicate. B, NIH3T3 cells
were transfected with 1.5 µg of luc expression vector, either
p-333wt -MHCluc (wild type) or p-333GATA -MHCluc (with a mutation
that ablates the LIF-responsive transcription), 2.5 µg of GATA-5
expression vector, and 0.5 µg of pRSVCAT. The results are expressed
as fold activation of the normalized luciferase activity (luc/CAT)
relative to co-transfection with the control -galactosidase
expression vector. The data shown are from four independent
experiments, each carried out in duplicate. First ,
-actin; , 333/+34 -MHC; second , -MHC.
|
|
Next we addressed whether GATA-5 stimulation of the
-MHC promoter
activity occurred in a sequence-specific manner. Point mutations were
introduced into the GATA site of the
333/+34-bp
-MHC promoter to
ablate LIF responsiveness (Fig. 2B) as above. The resulting
promoter construct (p-333GATA
-MHCluc) was co-transfected with an
expression plasmid, pcDNA-GATA-5, and subsequently assayed for the
relative luciferase activity. As seen in Fig. 3B,
transactivation of the
-MHC promoter was reduced by the GATA site
mutation to levels only slightly greater than those exhibited by the
-actin promoter. These findings demonstrate that the transactivation of the
-MHC promoter by GATA-5 is dependent on an intact GATA sequence.
GATA-5 Strongly Binds to the
-MHC GATA Element--
To
determine whether the GATA motif in the
-MHC promoter can interact
with GATA-5, EMSAs were performed. In vitro-translated GATA-5 was probed with a radiolabeled oligonucleotide containing the
-MHC GATA site (Fig. 4, lanes
2-6) in the presence or absence of competitor DNAs. Competition
EMSAs revealed that a retarded band represented specific binding (Fig.
4, lane 2), as evidenced by the fact that it was competed by
a 100-fold molar excess of unlabeled
-MHC GATA oligonucleotide (Fig.
4, lane 3). The retarded band represents an interaction of
the probe with GATA-5, because it was absent in unprogrammed lysate
(Fig. 4, lane 1). The retarded band was also competed by an
unlabeled CEF-1 oligonucleotide (Fig. 4, lane 4), which
contains the GATA motif in the cTnC promoter (48) previously
demonstrated to be a binding site of GATA-5. In contrast to the
wild-type
-MHC GATA site, the gel shift could not be competed by an
excess of an oligonucleotide containing the
-MHC GATA site into
which point mutations (Fig. 2B) that ablate LIF
responsiveness had been introduced (Fig. 4, lane 5) or by
the same amount of a nonspecific oligonucleotide (Fig. 4, lane
6), confirming the sequence-specific nature of the interaction. These findings demonstrate that GATA-5 can bind the
-MHC GATA site
in a sequence-specific manner.

View larger version (32K):
[in this window]
[in a new window]
|
Fig. 4.
Analysis of interactions between the -MHC
GATA site and in vitro-translated-GATA-5. EMSA studies
in which unprogrammed lysate (lane 1) or in
vitro-translated GATA-5 (lanes 2-6) were probed with a
radiolabeled oligonucleotide containing the -MHC GATA site.
Unlabeled competitor DNAs were present at a 100-fold molar excess as
indicated: wild-type -MHC GATA ( GATA) in lane
3; CEF-1 (a previously established GATA-5 binding site in the
cardiac TnT promoter) in lane 4; -MHC GATA with a
mutation that ablates the LIF-responsive transcription (mut
GATA) in lane 5; and nonspecific
oligonucleotide (NS; see "Experimental Procedures") in
lane 6. The arrow indicates the complex
corresponding to the GATA-specific interaction between the -MHC GATA
site and GATA-5.
|
|
Although cTnC promoter has been shown to be efficiently transactivated
by both GATA-4 and -5 (44, 50), the present study demonstrated that the
-MHC promoter was activated by GATA-5 but not by GATA-4. We have
investigated whether this difference in the transactivation intensity
is attributable to the ability of cTnC and
-MHC GATA sites to bind
GATA-5 relative to GATA-4. In vitro-translated GATA-4 or
GATA-5 was probed with a radiolabeled
-MHC GATA oligonucleotide
(Fig. 5A, lanes 3-6).
Although a retarded band showing the interaction of the
-MHC GATA
site with GATA-5 was strong in its intensity (Fig 5A, lane
5), a band showing the interaction with GATA-4 was very weak (Fig.
5A, lane 3). In vitro-translated GATA-4 or GATA-5
derived from the same lysates with those used for the
-MHC GATA site
was also probed with CEF-1 oligonucleotide containing the GATA motif in
the cTnC promoter (Fig. 5B, lanes 3-6). In contrast to the
-MHC GATA site, the intensity of the band showing the interaction of
the CEF-1 with GATA-5 (Fig. 5B, lane 5) was similar to that
showing the interaction with GATA-4 (Fig. 5B, lane 3). Thus,
the ability of GATA elements to bind GATA-5 relative to GATA-4 differs
between
-MHC and cTnC promoters.

View larger version (46K):
[in this window]
[in a new window]
|
Fig. 5.
The activities of -MHC and cTnT GATA sites
to bind GATA-4, and -5. EMSA studies were performed in which
in vitro-translated GATA-4 (lanes 3 and
4) or GATA-5 (lanes 5 and 6) were
probed with a radiolabeled oligonucleotide containing the -MHC GATA
site (A) or that containing the cTnT GATA site (CEF-1)
(B). Unlabeled competitor DNAs are the same oligonucleotides
as those used as probes.
|
|
LIF Induces the Expression of GATA-5 in Neonatal Cardiac
Myocytes--
To determine whether LIF modulates the
-MHC GATA
binding activity in cardiac myocytes, EMSAs were performed with nuclear extracts from saline- and LIF-stimulated neonatal cardiac myocytes. Nuclear extracts were probed with a radiolabeled
-MHC GATA
oligonucleotide in the presence or absence of competitor
oligonucleotides (Fig. 6, lanes
1-5). Competition EMSAs revealed that one retarded band (Fig. 6,
lanes 1 and 2, arrow) represented GATA
sequence-specific binding, as evidenced by the fact that it was
competed by an unlabeled
-MHC GATA oligonucleotide (Fig. 6,
lane 3) or by an oligonucleotide containing a previously
demonstrated GATA site in the cTnC promoter (CEF-1; Fig. 6, lane
4), but not by an excess of the
-MHC GATA site containing point
mutations that ablate LIF responsiveness (Fig. 6, lane 5) or
by a nonspecific oligonucleotide (data not shown). Notably, the
activity of the specific band was increased in nuclear extracts from
LIF-stimulated myocytes (Fig. 6, lane 2) compared with those
from saline-stimulated cells (Fig. 6, lane 1). This
experiment was repeated three times using three independent preparations of cells and found to be reproducible. Thus, LIF up-regulated the
-MHC GATA binding activity in nuclear extracts from
cardiac myocytes.

View larger version (29K):
[in this window]
[in a new window]
|
Fig. 6.
-MHC GATA binding activities in saline-
and LIF-stimulated cardiac myocytes. Nuclear extract (10 µg of
protein) from saline-stimulated (lane 1) or LIF-stimulated
(lanes 2-5) cardiac myocytes was probed with radiolabeled
oligonucleotide containing the -MHC GATA site. Competitor DNAs are
as indicated.
|
|
To investigate whether the up-regulated
-MHC GATA binding activity
represents increased GATA-5 transcripts in cardiac myocytes, we
examined GATA-5 mRNA levels in saline- and LIF-stimulated cells. Previous studies demonstrated that the GATA-5 expression in the heart
is restricted to the early embryonic stage and not detectable in the
late embryo or in the adult by Northern blots. Using highly sensitive
reverse transcriptase-PCR, a faint band indicating GATA-5 was
detectable in saline-stimulated neonatal rat cardiac myocytes (Fig.
7). Notably, the band intensity markedly
increased in LIF-stimulated cardiac myocytes. We confirmed by
sequencing that this band represents a specific PCR product derived
from GATA-5 cDNA. In contrast, the intensity of the band indicating
GAPDH was almost comparable between saline- and LIF-stimulated cardiac
myocytes. We repeated these experiments with three independent
preparations of cardiac myocytes. With the use of a previously
described semiquantitative reverse transcriptase-PCR (51), the
cumulative results indicated that GATA-5 mRNA relative to GAPDH
mRNA was 6.2 ± 0.5-fold higher in the LIF-stimulated cardiac
myocytes than in the saline-stimulated cells.

View larger version (27K):
[in this window]
[in a new window]
|
Fig. 7.
The effect of LIF on the expression of GATA-5
mRNA by cultured ventricular cardiomyocytes. Cardiomyocytes
were challenged with saline or LIF for 48 h. Representative
photographs of PCR products after reverse transcriptase-PCR for GATA-5
and GAPDH mRNAs are shown. Each lane represents RNA from
a separate culture plate. Similar results were obtained from three
independent experiments. M, molecular marker.
|
|
 |
DISCUSSION |
Cardiac myocyte hypertrophy is a central feature of all
types of cardiac muscle disease and is an interesting example of the response of a terminally differentiated cell type to growth
stimulation. Current insights into the mechanisms controlling
cardiomyocyte hypertrophy have been obtained primarily from a cell
culture model, in which growth factors signaling through
G-protein-coupled receptors induce hypertrophy (9-16). Growing
evidence suggests that gp130 activation is also coupled to myocardial
cell hypertrophy (17, 18, 27). Using neonatal cardiac myocytes in
culture, the present study demonstrates that mutation of the GATA motif
in the
-MHC promoter totally abolished LIF-responsive transcription.
Among members of the cardiac GATA transcription factor subfamily,
GATA-5 alone was able to potently transactivate the
-MHC promoter.
This transactivation was dependent on sequence-specific binding of GATA-5 to the
-MHC GATA element. Last, LIF stimulation markedly increased levels of GATA-5 transcripts in cardiac myocytes. These findings demonstrate that GATA-5 is important in the LIF-mediated up-regulation of
-MHC expression in cardiac myocytes and may represent the mechanism underlying the cardiac hypertrophy induced by
the gp130 ligand family.
Role of M-CAT and GATA Elements in
-MHC Transcription--
Once
the hypertrophy signal is transduced from the membrane to the nucleus,
a fundamental reprogramming occurs within cardiac myocytes that results
in the reexpression of genes encoding fetal protein isoforms. Genes
such as skeletal
-actin,
-MHC, and atrial natriuretic factor
become highly expressed within ventricular myocytes (4-8). Studies
focused on elucidating the transcriptional regulation of these genes
have identified a group of cis-acting regulatory elements
that might mediate the nuclear response to hypertrophic stimuli.
Analysis of the
-MHC promoter has demonstrated that the M-CAT
element, a binding site of the transcription enhancer factor-1 family,
may play a role in both basal and hypertrophic-responsive transcription. For example, this element mediates both
1-adrenergic and
-protein kinase C-stimulated
-MHC
transcription (11, 12). M-CAT elements have also been implicated in
1-adrenergic-stimulated expression of the skeletal
-actin and
-type natriuretic peptide promoters (13, 57). In
addition, the M-CAT motif is present in the promoters of several
striated muscle-specific genes, where it functions to positively
regulate basal transcription (57-63). Our observation that
simultaneous disruption of both M-CAT elements in the setting of a
333-bp
-MHC promoter decreases transcriptional activity is
consistent with previous reports demonstrating that M-CAT elements play
an important role in basal
-MHC transcription. Unexpectedly,
however, simultaneous mutations in both M-CAT elements, adequate to
abrogate binding of nuclear proteins and to destroy enhancer function,
had no effect on the ET-1 or LIF responsiveness of the 333-bp rat
-MHC promoter. Although this finding does not rule out the
possibility that M-CAT elements contribute to ET-1 or LIF
responsiveness, it demonstrates that other elements within these
sequences suffice to mediate this transcriptional response.
Sequences
333/+34 of the rat
-MHC promoter also contain a
GATA element (36). GATA elements have been shown to be important for
cardiac-specific transcription in many cardiac genes, including
-MHC,
-type natriuretic peptide, myosin light chain 1/3 and cTnC
(50, 53-55). We show here that mutation of the GATA element in the
333-bp
-MHC promoter totally abolished LIF-responsive transcription
without changing basal transcriptional activity. Thus, this GATA
element plays a critical role in LIF-responsive
-MHC transcription.
In contrast, ET-1 responsiveness was unaffected by the GATA mutation.
These findings suggest that LIF and ET-1 activate
-MHC gene
transcription through distinct cis-acting elements. Previous
work has shown that G-protein and gp130 pathways elicit morphologically
distinct forms of myocardial cell hypertrophy (18). Thus, it appears
that these two stimuli induce distinct hypertrophic processes through
different pathways. The elucidation of the differences in these
signaling pathways and the pathophysiological significance of these two
forms of hypertrophy would be of particular interest.
GATA Factors Mediate gp130 Signaling in Cardiac
Myocytes--
To date, six related zinc finger-containing proteins
have been described, which recognize and bind the GATA motif (44, 45, 64). The proteins fall into two subgroups: those containing GATA-1, -2, and -3, and those with GATA-4, -5, and -6. The subgroups are defined by
both sequence homology and expression pattern, with GATA-1, -2, and -3 predominating in blood and ectodermal derivatives and GATA-4, -5, and
-6 in heart and endodermal derivatives. Interestingly, the genes
encoding GATA-4 and -6 are expressed in the heart throughout embryonic
and postnatal development, whereas the murine GATA-5 gene is normally
expressed in a temporally and spatially restricted pattern within the
embryonic heart (44, 45). These findings raise the possibility that
GATA-4, -5, and -6 play differential roles during LIF-induced
hypertrophy. The present study demonstrated that neither GATA-4 nor -6 significantly activated the LIF-responsive 333-bp
-MHC promoter. In
contrast, GATA-5 markedly stimulated this promoter. This activation
required an intact GATA element, suggesting a direct effect. Consistent with this model, GATA-5 bound the
-MHC GATA element in a
sequence-specific manner. Importantly, LIF stimulation increased
-MHC GATA binding activity in cardiac nuclear extracts. Although
GATA-5-specific antisera for supershift experiments is not available at
present, a complex formed with the
-MHC GATA element is clearly GATA
sequence specific. In addition, LIF stimulation increased expression of GATA-5 in neonatal cardiac myocytes. Taken together, these findings demonstrate that GATA factors are involved in LIF-responsive
-MHC transcription and that GATA-5 is the factor that is primarily involved.
The signal transduction pathways by which members of the gp130 ligand
family activate target genes have been well studied in several cell
types (28-31). Typically, the phosphorylated STAT proteins dimerize,
translocate into the nucleus, and bind to the promoter of target genes.
The DNA binding targets of STATs include the interferon-
activation
site-like elements (TTC/ANNNG/TAA) and the interferon-
-stimulated
response elements (AGTTTCNNTTTCNC/T) (31). Our data demonstrate that
GATA-5 markedly activated the
-MHC promoter through specific binding
to the GATA element and that
-MHC GATA binding activity in cardiac
myocytes is induced by LIF stimulation. At present, the molecular
events that may link the Janus kinase/STAT pathway to this augmentation
are unknown. LIF activates STATs within 15 min after LIF stimulation,
whereas the induction of the
-MHC expression occurs much later (48 h after LIF stimulation). Therefore, it is unlikely that STATs directly associate with GATA factors in the activation of the
-MHC promoter. We demonstrate here that LIF stimulation increased GATA-5 transcripts in neonatal cardiac myocytes. Thus, one model is that the Janus kinase/STAT pathway is linked to the regulation of GATA-5 gene expression. Another model is that LIF-induced intracellular signaling cascades activate GATA factors or GATA co-activators
post-translationally by phosphorylation or other mechanisms. In any
event, because gp130 activation is one component of the hemodynamic
overload stimulus (65), additional studies to delineate the precise
mechanisms by which gp130 activation induces
-MHC transcription are
likely to provide significant insight into the pathways that mediate hemodynamic overload-induced hypertrophy in vivo.
 |
ACKNOWLEDGEMENTS |
We thank Profs. Tetsuya Taga and Junji Yodoi
for critical reading of the manuscript.
 |
FOOTNOTES |
*
This work was in part supported by grants (to K. H.)
from the Kanae Foundation of Research for New Medicine, the Japanese Heart Foundation, the Japan Cardiovascular Research Foundation, and the
Ministry of Education, Science, and Culture of Japan.The costs of publication of this
article were defrayed in part by the
payment of page charges. The article
must therefore be hereby marked
"advertisement" in
accordance with 18 U.S.C. Section
1734 solely to indicate this fact.
§
To whom correspondence should be addressed: Dept. of Cardiovascular
Medicine, Graduate School of Medicine, Kyoto University, 54 Kawara-cho,
Shogoin, Sakyo-ku, Kyoto 606-8507, Japan. Tel.: 81-75-751-3190; Fax:
81-75-751-3203; E-mail: koj{at}kuhp.kyoto-u.ac.jp.
**
Charles and Tamara Krasne Faculty Scholar in Cardiovascular
Research of the Albert Einstein College of Medicine.
2
H. Wada, K. Hasegawa, T. Kakita, S. Kaburagi, T. Morimoto, and S. Sasayama, unpublished data.
 |
ABBREVIATIONS |
The abbreviations used are:
MHC, myosin heavy
chain;
LIF, leukemia inhibitory factor;
STAT, signal transducer and
activator of transcription;
luc, luciferase;
CAT, chloramphenicol
acetyltransferase;
EMSA, electrophoretic mobility shift assay;
cTnC, cardiac troponin C;
ET, endothelin;
GAPDH, glyceraldehyde-3-phosphate
dehydrogenase;
wt, wild type;
RSV, Rous sarcoma virus;
PCR, polymerase
chain reaction.
 |
REFERENCES |
-
Chien, K. R.,
Knowlton, K. U.,
Zhu, H.,
and Chien, S.
(1991)
FASEB J.
5,
3037-3046[Abstract]
-
MacLellan, W. R.,
Hawker, J.,
and Schneider, M. D.
(1997)
in
Molecular Biology of Cardiovascular Disease (Marks, A. R., and Taubman, M. B., eds), pp. 327-378, Marcel Dekker, Inc., New York
-
Copper, G.
(1997)
Annu. Rev. Med.
48,
13-23[CrossRef][Medline]
[Order article via Infotrieve]
-
Izumo, S.,
Lompre, A.,
Matsuoka, R.,
Koren, G.,
Schwarz, K.,
Nadal-Ginard, B.,
and Mahdavi, V.
(1987)
J. Clin. Invest.
79,
970-977
-
Lee, R. T.,
Bloch, K. D.,
Pfeffer, J. M.,
Pfeffer, M. A.,
Neer, E. J.,
and Seidman, C. E.
(1988)
J. Clin. Invest.
81,
431-434
-
Izumo, S.,
Nadal-Ginard, B.,
and Mahdavi, V.
(1988)
Proc. Natl. Acad. Sci. U. S. A.
85,
339-343[Abstract/Free Full Text]
-
Kurabayashi, M.,
Shibasaki, Y.,
Komuro, I.,
Tsuchimochi, H.,
and Yazaki, Y.
(1990)
Jpn. Circ. J.
54,
1192-1205[Medline]
[Order article via Infotrieve]
-
Mercadier, J. J.,
Lompre, A. M.,
Swynghedauw, B.,
and Schwartz, K.
(1993)
Bull. Acad. Natl. Med. (Paris)
177,
917-931
-
Knowlton, K. U.,
Baracchini, E.,
Ross, S.,
Harris, A. N.,
Henderson, S. A.,
Evans, S. M.,
Glembotski, C. C.,
and Chien, K. R.
(1991)
J. Biol. Chem.
266,
7759-7768[Abstract/Free Full Text]
-
Shubeita, H. E.,
McDonough, P. M.,
Harris, A. N.,
Knowlton, K. U.,
Glembotski, C. C.,
Brown, J. H.,
and Chien, K. R.
(1990)
J. Biol. Chem.
265,
20555-20562[Abstract/Free Full Text]
-
Kariya, K.,
Farrance, I. K.,
and Simpson, P. C.
(1993)
J. Biol. Chem.
268,
26658-26662[Abstract/Free Full Text]
-
Kariya, K.,
Karns, L. R.,
and Simpson, P. C.
(1994)
J. Biol. Chem.
269,
3775-3782[Abstract/Free Full Text]
-
Karns, L. R.,
Kariya, K.,
and Simpson, P. C.
(1995)
J. Biol. Chem.
270,
410-417[Abstract/Free Full Text]
-
Zhu, H.,
Garcia, A. V.,
Ross, R. S.,
Evans, S. M.,
and Chien, K. R.
(1991)
Mol. Cell. Biol.
11,
2273-2281[Abstract/Free Full Text]
-
Sadoshima, J.,
Jahn, L.,
Takahashi, T.,
Kulik, T. J.,
and Izumo, S.
(1992)
J. Biol. Chem.
267,
10551-10560[Abstract/Free Full Text]
-
Ardati, A.,
and Nemer, M.
(1993)
EMBO J.
12,
5131-5139[Medline]
[Order article via Infotrieve]
-
Pennica, D.,
King, K. L.,
Shaw, K. J.,
Luis, E.,
Rullams, J.,
Louh, S.,
Darbonne, W. C.,
Knutzon, D. S.,
Yen, R.,
Chien, K. R.,
Baker, J. B.,
and Wood, W. I.
(1995)
Proc. Natl. Acad. Sci. U. S. A.
92,
1142-1146[Abstract/Free Full Text]
-
Wollert, K. C.,
Taga, T.,
Saito, M.,
Narazaki, M.,
Kishimoto, T.,
Glembotski, C. C.,
Vernallis, A. B.,
Heath, J. K.,
Pennica, D.,
Wood, W. I.,
and Chien, K. R.
(1996)
J. Biol. Chem.
271,
9535-9545[Abstract/Free Full Text]
-
Hibi, M.,
Murakami, M.,
Saito, M.,
Hirno, T.,
Taga, T.,
and Kishimoto, T.
(1990)
Cell.
63,
1149-1157[CrossRef][Medline]
[Order article via Infotrieve]
-
Taga, T.,
Narazaki, M.,
Yasukawa, K.,
Saito, T.,
Miki, D.,
Hamaguchi, M.,
Davis, S.,
Shoyab, M.,
Yancopoulos, G. D.,
and Kishimoto, T.
(1992)
Proc. Natl. Acad. Sci. U. S. A.
89,
10998-11001[Abstract/Free Full Text]
-
Ip, N. Y.,
Nye, S. H.,
Boulton, T. G.,
Davis, S.,
Taga, T.,
Li, Y.,
Birren, S. J.,
Yasukawa, K.,
Kishimoto, T.,
Anderson, D. J.,
Stahl, N.,
and Yancopoulos, G. D.
(1992)
Cell
69,
1121-1132[CrossRef][Medline]
[Order article via Infotrieve]
-
Yin, T.,
Taga, T.,
Tsang, M. L.,
Yasukawa, K.,
Kishimoto, T.,
and Yang, Y.
(1993)
J. Immunol.
151,
2555-2561[Abstract]
-
Taga, T.
(1996)
J. Neurochem.
67,
1-10[Medline]
[Order article via Infotrieve]
-
Murakami, M.,
Hibi, M.,
Nakagawa, N.,
Nakagawa, T.,
Yasukawa, K.,
Yamanisi, K.,
Taga, T.,
and Kishimoto, T.
(1993)
Science
260,
1808-1810[Abstract/Free Full Text]
-
Gearing, D. P.,
Thut, C. J.,
VandenBos, T.,
Gimpel, S. D.,
Delaney, P. B.,
King, J.,
Price, V.,
Cosman, D.,
and Beckmann, M. P.
(1991)
EMBO. J.
10,
2839-2848[Medline]
[Order article via Infotrieve]
-
Davis, S.,
Aldrich, T. H.,
Stahl, N.,
Pan, L.,
Taga, T.,
Kisimoto, T.,
Ip, N. Y.,
and Yancopoulos, G. D.
(1993)
Science
260,
1805-1808[Abstract/Free Full Text]
-
Hirota, H.,
Yosida, K.,
Kishimoto, T.,
and Taga, T.
(1995)
Proc. Natl. Acad. Sci. U. S. A.
92,
4862-4866[Abstract/Free Full Text]
-
Kishimoto, T.,
Taga, T.,
and Akira, S.
(1994)
Cell
76,
253-262[CrossRef][Medline]
[Order article via Infotrieve]
-
Narazaki, M.,
Witthuhn, B. A.,
Yoshida, K.,
Silvennoinen, O.,
Yasukawa, K.,
Ihle, J. N.,
Kishimoto, T.,
and Taga, T.
(1994)
Proc. Natl. Acad. Sci. U. S. A.
91,
2285-2289[Abstract/Free Full Text]
-
Akira, S.,
Nisio, Y.,
Inoue, M.,
Wang, X.,
Wei, S.,
Matsusaka, T.,
Yoshida, K.,
Sudo, T.,
Naruto, M.,
and Kishimoto, T.
(1994)
Cell
77,
63-71[CrossRef][Medline]
[Order article via Infotrieve]
-
Heim, M. H.
(1996)
Eur. J. Clin. Invest.
26,
1-12[CrossRef][Medline]
[Order article via Infotrieve]
-
Hunter, J. J.,
Tanaka, N.,
Rockman, H. A.,
Ross, J., Jr.,
and Chien, K. R.
(1995)
J. Biol. Chem.
270,
23173-23178[Abstract/Free Full Text]
-
Thorburn, A.,
Thorburn, J.,
Chen, S.,
Powers, S.,
Shubeita, H. E.,
Feramisco, J. R.,
and Chien, K. R.
(1993)
J. Biol. Chem.
268,
2244-2249[Abstract/Free Full Text]
-
Sheng, Z.,
Knowlton, K.,
Chen, J.,
Hoshijima, M.,
Brown, J. H.,
and Chien, K. R.
(1997)
J. Biol. Chem.
272,
5783-5791[Abstract/Free Full Text]
-
Herzig, T. C.,
Jobe, S. M.,
Aoki, H.,
Molkentin, J. D.,
Cowley, A. W.,
Izumo, S.,
and Markham, B. E.
(1997)
Proc. Natl. Acad. Sci. U. S. A.
94,
7543-7548[Abstract/Free Full Text]
-
Hasegawa, K.,
Lee, S. J.,
Jobe, S. M.,
Markham, B. E.,
and Kitsis, R. N.
(1997)
Circulation
96,
3943-3953[Abstract/Free Full Text]
-
Hasegawa, K.,
Meyers, M. B.,
and Kitsis, R. N.
(1997)
J. Biol. Chem.
272,
20049-20054[Abstract/Free Full Text]
-
Kraft, R.,
Bravo-Zehnder, M.,
Taylor, D. A.,
and Leinwand, L. A.
(1989)
Nucleic Acids Res.
17,
7529-7530[Free Full Text]
-
Tso, J. Y.,
Sun, X. H.,
Kao, T.,
Reece, K. S.,
and Wu, R.
(1985)
Nucleic Acids Res.
13,
2485-2502[Abstract/Free Full Text]
-
Buttrick, P. M.,
Kaplan, M. L.,
Kitsis, R. N.,
and Leinwand, L. A.
(1993)
Circ. Res.
72,
1211-1217[Abstract/Free Full Text]
-
Nordeen, S. K.
(1988)
BioTechniques
6,
454-457[Medline]
[Order article via Infotrieve]
-
Gorman, C. M.,
Merlino, G. T.,
Willingham, M. C.,
Pastan, I.,
and Howard, B. H.
(1982)
Proc. Natl. Acad. Sci. U. S. A.
79,
6777-6781[Abstract/Free Full Text]
-
Kitsis, R. N.,
Buttrick, P. M.,
NcNally, E. M.,
Kaplan, M. L.,
and Leinwand, L. A.
(1991)
Proc. Natl. Acad. Sci. U. S. A.
88,
4138-4142[Abstract/Free Full Text]
-
Morrisey, E. E.,
Ip, H. S.,
Tang, Z.,
Lu, M. M.,
and Parmacek, M. S.
(1997)
Dev. Biol.
183,
21-36[CrossRef][Medline]
[Order article via Infotrieve]
-
Morrisey, E. E.,
Ip, H. S.,
Lu, M. M.,
and Parmacek, M. S.
(1996)
Dev. Biol.
177,
309-322[CrossRef][Medline]
[Order article via Infotrieve]
-
Heikinheimo, M.,
Scandrett, J. M.,
and Wilson, D. V.
(1994)
Dev. Biol.
164,
361-373[CrossRef][Medline]
[Order article via Infotrieve]
-
Hasegawa, K.,
and Kitsis, R. N.
(1997)
in
Molecular Biology of Cardiovascular Disease (Marks, A. R., and Taubman, M. B., eds), pp. 67-80, Marcel Dekker, Inc., New York
-
Magnaghi-Jaulin, L.,
Masutani, H.,
Lipinski, M.,
and Harel-Bellan, A.
(1996)
FEBS Lett.
391,
247-251[CrossRef][Medline]
[Order article via Infotrieve]
-
Andrews, N. C.,
and Faller, D. V.
(1991)
Nucleic Acids Res.
19,
2499[Free Full Text]
-
Ip, H. S.,
Wilson, D. B.,
Heikinheimo, M.,
Tang, Z.,
Ting, C.,
Simon, M. C.,
Leiden, J. M.,
and Parmacek, M. S.
(1994)
Mol. Cell. Biol.
14,
7517-7526[Abstract/Free Full Text]
-
Shioi, T.,
Matsumori, A.,
and Sasayama, S.
(1996)
Circulation
94,
2930-2937[Abstract/Free Full Text]
-
Thompson, W. R.,
Nadal-Ginard, B.,
and Mahdavi, V.
(1991)
J. Biol. Chem.
266,
22678-22688[Abstract/Free Full Text]
-
Molkentin, J. D.,
Kalvakolanu, D. V.,
and Markham, B. E.
(1994)
Mol. Cell. Biol.
14,
4947-4957[Abstract/Free Full Text]
-
Grepin, C.,
Dagnino, L.,
Robitaille, L.,
Haberstroh, L.,
Antakly, T.,
and Nemer, M.
(1994)
Mol. Cell. Biol.
14,
3115-3129[Abstract/Free Full Text]
-
McGrew, M. J.,
Bogdanova, N.,
Hasegawa, K.,
Hughes, S. H.,
Kitsis, R. N.,
and Rosenthal, N.
(1996)
Moll. Cell. Biol.
16,
4524-4534[Abstract]
-
Shimizu, N.,
Smith, G.,
and Izumo, S.
(1993)
Nucleic Acids Res.
21,
4103-4110[Abstract/Free Full Text]
-
Thuerauf, D. J.,
and Glembotski, C. C.
(1997)
J. Biol. Chem.
272,
7464-7472