JBC

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Morimoto, T.
Right arrow Articles by Sasayama, S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Morimoto, T.
Right arrow Articles by Sasayama, S.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

J Biol Chem, Vol. 274, Issue 18, 12811-12818, April 30, 1999


GATA-5 Is Involved in Leukemia Inhibitory Factor-responsive Transcription of the beta -Myosin Heavy Chain Gene in Cardiac Myocytes*

Tatsuya MorimotoDagger , Koji HasegawaDagger §, Satoshi KaburagiDagger , Tsuyoshi KakitaDagger , Hiroshi Masutani, Richard N. Kitsisparallel **, Akira MatsumoriDagger , and Shigetake SasayamaDagger

From the Dagger  Department of Cardiovascular Medicine, Graduate School of Medicine, and  Department of Biological Responses, Institute for Virus Research, Kyoto University, Kyoto 606-8507, Japan and parallel  Departments of Medicine and Cell Biology, Albert Einstein College of Medicine, Bronx, New York 10461

    ABSTRACT
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

Leukemia inhibitory factor is a member of a family of structurally related cytokines sharing the receptor component gp130. Activation of gp130 by leukemia inhibitory factor is sufficient to induce myocardial cell hypertrophy accompanied by specific changes in the pattern of gene expression. However, the molecular mechanisms that link gp130 activation to these changes have not been clarified. The present study investigated the transcriptional pathways by which leukemia inhibitory factor activates beta -myosin heavy chain expression during myocardial cell hypertrophy. Mutation of the GATA motif in the beta -myosin heavy chain promoter totally abolished leukemia inhibitory factor-responsive transcription without changing basal transcriptional activity. In contrast, endothelin-1 responsiveness was unaffected by the GATA mutation. Among members of the cardiac GATA transcription factor subfamily (GATA-4, -5, and -6), GATA-5 was the sole and potent transactivator for the beta -myosin heavy chain promoter. This transactivation was dependent on sequence-specific binding of GATA-5 to the beta -myosin heavy chain GATA element. Cardiac nuclear factors that bind to to the beta -myosin heavy chain GATA element were induced by leukemia inhibitory factor stimulation. Last, leukemia inhibitory factor stimulation markedly increased transcripts of cardiac GATA-5, the expression of which is normally restricted to the early embryo. Thus, GATA-5 may be involved in gp130 signaling in cardiac myocytes.

    INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

Cardiac muscle cells exit the proliferative cell cycle soon after birth, with little or no capacity for subsequent cell division. Hence, the adult myocardium responds to hemodynamic stimuli through an adaptive hypertrophic response that is characterized by an increase in myocardial cell size without a concomitant increase in myocyte number (for review, see Refs. 1 and 2). During chronic exposure to hemodynamic stress, however, the myocardium ultimately develops an irreversible loss of function and ensuing cardiac muscle failure (3). As such, the identification of the signaling pathways that mediate cardiac muscle hypertrophy is critical to the ultimate elucidation of the molecular basis of cardiac muscle failure.

Cardiac myocyte hypertrophy is associated with specific changes in the pattern of gene expression, exemplified by the induction of beta -myosin heavy chain (MHC)1 and atrial natriuretic factor in rodents (4-6). Although the human ventricular myocardium predominately expresses beta -MHC under basal conditions, the induction of this gene occurs in atrial myocardium in response to hemodynamic overload (7, 8). The regulated expression of cardiac genes has been studied using primary cultures of neonatal rat cardiac myocytes (9-16). In this in vitro system, a number of growth factors signaling through G-protein-coupled receptors, including alpha 1-adrenergic agonists, angiotensin II, and endothelin-1 (ET-1), stimulate increases in myocyte volume and reproduce many of the changes in cardiac gene expression characteristic of the hypertrophic program in vivo. Transcriptional regulation of cardiac genes by these stimuli has been extensively studied using transient transfection assays. DNA binding factors that might mediate the nuclear response to alpha 1-adrenergic stimulation include the transcription enhancer factor-1 family, serum-responsive factor, and Sp1 (11-13).

Recent work has demonstrated that members of a family of structurally related cytokines including leukemia inhibitory factor (LIF) and cardiotrophin-1 induce an increase in cell size in cardiomyocyte culture (17, 18). The receptors of this cytokine family are multimeric and share the class-specific transmembrane signal-transducing component gp130 (19-23). Signaling is triggered through the homodimerization of gp130 (24) or the heterodimerization of gp130 with a related transmembrane signal transducer, the LIF receptor subunit beta  (25, 26). Overexpression of both interleukin-6 and its receptor results in constitutive tyrosine phosphorylation of gp130 (i.e. activation) in the myocardium and left ventricular hypertrophy in vivo (27). Thus, the induction of cardiomyocyte hypertrophy through gp130-dependent signaling pathways is not confined to the in vitro hypertrophy assay but is also observed in vivo. Activation of gp130 by LIF or cardiotrophin-1 is also associated with specific changes in cardiac gene expression (18). The molecular mechanisms that link gp130 activation to these changes have not been clarified.

Members of the interleukin-6-LIF cytokine family have been shown to activate the Janus kinase/signal transducer and activator of transcription (STAT) pathway and phosphorylate STAT3 (23, 28-30). It is also clear that this family of cytokines can activate Ras and mitogen-activated protein kinase cascades (23, 28, 31). An activated Ras gene, targeted to myocardium in transgenic mice, elicits ventricular enlargement, atrial natriuretic factor expression, myofibrillar disarray, and impaired relaxation in diastole (32). Conversely, microinjection of dominant-negative Ras protein was reported to block alpha 1-adrenergic induction of both morphological changes in myofibrillar structure and expression of atrial natriuretic factor (33), demonstrating a requirement of Ras-dependent pathways for G-protein-coupled signaling in myocardial cell hypertrophy. The relative contributions of the Ras/mitogen-activated protein kinase and Janus kinase/STAT pathways to gp130-induced cardiac hypertrophy are presently unclear, however, because selective pharmacological inhibition of mitogen-activated protein kinase activation does not block hypertrophy (34). Recently, we and others have shown that zinc finger GATA transcription factors are required for transcriptional activation of the genes for angiotensin II type 1a receptor and beta -MHC during pressure overload hypertrophy in vivo (35, 36). However, pressure overload is a complex stimulus consisting of multiple factors. A specific stimulus linked to GATA factors has not been clarified. In addition, although so far six members of the GATA transcription factor family have been cloned, it is unclear which member of this family plays the most important role. Thus, the present study analyzed cis-acting elements and trans-acting factors required for LIF-responsive beta -MHC transcription during myocardial cell hypertrophy.

    EXPERIMENTAL PROCEDURES
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

Measurement of Protein Synthesis Rate-- Primary ventricular cardiac myocytes were prepared from hearts of 1-2-day-old Sprague Dawley rats as described previously (37). Twenty-four hours after plating, the cells were washed twice with serum-free media and then incubated with 5 µCi/ml [3H]phenylalanine (120 Ci/mmol) and unlabeled phenylalanine (0.36 mmol/liter) in serum-free medium for 48 h in the presence of 2.5 × 10-9 M LIF (AMRAD, Melbourne, Australia), 10-7 M ET-1 (Peptide Institute, Osaka, Japan), or saline as a control. The cells were washed twice with phosphate-buffered saline, and 10% trichloroacetic acid was added at 4 °C for 60 min to precipitate protein. The precipitate was washed three times with 95% ethanol and then resuspended in 0.15 N NaOH. Aliquots were measured by a scintillation counter.

RNA Analysis-- Northern blot analysis of 10 µg of total RNA was performed as described (36, 37). An isoform-specific antisense deoxyoligonucleotide complementary to nucleotides 5846-5869 of the rat 3' untranslated region (38) was used to detect beta -MHC mRNA as described (36, 37). As controls, blots were also hybridized with rat glyceraldehyde-3-phosphate dehydrogenase (GAPDH) cDNA (nucleotides 170-577) (39) obtained by polymerase chain reaction. Amounts of mRNAs were quantified by a bioimaging analyzer (BAS 2000; FUJIX, Tokyo, Japan).

Plasmid Constructs-- The plasmid constructs p-2936alpha -MHCluc (37, 40), p-3542beta -MHCluc (36, 37), p-333wtbeta -MHCluc (wild type) (36) and pbeta -actinluc (37) were firefly luciferase reporter plasmids (41) driven by the most proximal 2936 bp of the rat alpha -MHC gene, 3542 or 333 bp of the rat beta -MHC gene, or 433 bp of avian cytoplasmic beta -actin 5'-flanking region, respectively. In p-333M-CATbeta -MHCluc, two M-CAT elements located at sequences -274/-280 and -204/-210 were simultaneously mutated in the context of the 333-bp rat beta -MHC promoter as described (36). In p-333GATAbeta -MHCluc, a core part of the putative GATA consensus in rat beta -MHC sequences -264/-269 was mutated (36). Base substitutions were verified by sequencing in both directions. pRSVCAT has been described previously (40, 42, 43). The murine GATA-5 and GATA-6 expression plasmids pcDNAG5 (44) and pcDNAG6 (45) were generous gifts of Dr. Michael S. Parmacek (University of Chicago, Chicago, IL) and described elsewhere. The murine GATA-4 expression plasmid pcDNAG4 was subcloned by digesting pMT2-GATA-4 (46) (a generous gift of Dr. David Wilson, Washington University, St. Louis, MO) with EcoRI to isolate a 1.9-kb insert and subcloning the resultant cDNA fragment encoding the murine GATA-4 into the EcoRI site of the eukaryotic expression plasmid pcDNA3 (Invitrogen, Carlsbad, CA). Plasmids were purified by anion exchange chromatography (Qiagen, Hilden, Germany), quantified by measurement of A260, and examined on agarose gels stained with ethidium bromide before use.

Transfection and Luciferase/CAT Assays-- Twenty-four hours after plating, cells were washed twice with serum-free media and then co-transfected with 4 µg of the luciferase construct of interest and 1 µg of pRSVCAT using LipofectAMINE (Life Technologies, Inc.) according to the manufacturer's recommendation. After a 2-h incubation with DNA-LipofectAMINE complex, the cells were washed twice with serum-free media and further incubated for 48 h in serum-free media in the presence of 2.5 × 10-9 M LIF, 10-7 M ET-1, or saline as a control. The cells were then washed twice with ice-cold phosphate-buffered saline and lysed as described (36, 37, 40, 43, 47). Luciferase activities were determined in duplicate samples from each plate using a Monolight LB 9501 luminometer (EG&G, Berthold) (36, 37, 40, 43, 47). Chloramphenicol acetyltransferase (CAT) activities were determined in the same cell lysate as that used for the luciferase assay (36, 37, 40, 43, 47).

Electrophoretic Mobility Shift Assays (EMSAs)-- Nuclear extracts were prepared from cultures of primary neonatal rat cardiac myocytes as described (48, 49). GATA-4/5 protein was prepared using in vitro transcription and translation systems (Promega, Madison, WI) according to the manufacture's recommendation. Double-stranded oligonucleotides were designed that contained GATA motifs from the beta -MHC or cardiac troponin C (cTnC) promoters. The sequences of the sense strand of these oligonucleotides were as follows: beta  GATA, 5'-CTGTGGAATGTAAGGGATATTTTTGCTTCACTTTGAGCCA-3'; mut beta  GATA, 5'-CTGTGGAATGTAAGGTCAATTTTTGCTTCACTTTGAGCCA-3'; CEF-1, (GATA element in the cTnC promoter; Ref. 48), 5'-CGCGGATCCCCAGCCTGAGATTACAGGGAGGATCCGCG-3'; and nonspecific oligonucleotide, 5'-GGGCATGTCCGGGCATGTCC-3'. Oligonucleotides were synthesized by Greiner Inc. (Tokyo, Japan) and purified by SDS-polyacrylamide gel electrophoresis.

EMSAs were carried out at 4 °C for 20 min in 15-µl reaction mixtures containing 10 µg of nuclear extract, 0.25 ng (>20,000 cpm) of radiolabeled double-stranded oligonucleotide, 500 ng of poly(dI-dC), 5 mM Tris-HCl (pH 7.5), 1 mM EDTA, 0.5 mM dithiothreitol, 37.5 mM KCl, and 4% Ficoll 400. For cold competition experiments, a 100 molar excess of unlabeled competitor oligonucleotide was included in the binding reaction mixture. Protein-DNA complexes were separated by electrophoresis on 4% nondenaturing polyacrylamide gels in 0.25 × Tris-borate EDTA (1 × Tris-borate EDTA is 100 mM Tris, 100 mM boric acid, and 2 mM EDTA) at 4 °C.

Reverse Transcriptase-Polymerase Chain Reaction (PCR)-- To detect GATA-5 transcripts in cardiac myocytes, a reverse transcriptase-polymerase chain reaction was carried out as described previously (51). For this particular experiment, we used ventricular myocytes isolated from 1-2-day-old DDY mice, because the rat GATA-5 sequence has not been published. One litter (8-12 pups) yielded ~4 × 105 cells. Total RNA was isolated as described (36, 37) from these cells and subjected to reverse transcription (8 µg of total RNA/sample) with a first-strand cDNA synthesis kit (Amersham Pharmacia Biotech) according to the manufacturer's recommendation.

The PCR primers were designed on the basis of published mouse cDNA sequences for GATA-5 (44) and GAPDH (39) as follows; sense for GATA-5, TCCCACTCTCCTCAACTCT; antisense for GATA-5, ACACCAGGTCTCCTGACGTA; sense for GAPDH, TTGCCATCAACGACCCCTTC; and antisense for GAPDH, TTGTCATGGATGACCTTGGC. To define the optimal amplification conditions, a series of pilot studies were performed using various amounts of reverse transcription products and various cycle numbers of PCR amplification as described (51). On the basis of these initial experiments, the linear portion of the amplification was determined for both genes. The following conditions were therefore chosen as standard for the PCR reactions in a volume of 50 µl: reverse transcription products from 300 ng of RNA for GATA-5 or 150 ng of RNA for GAPDH, 2.5 units of TaqAmpli polymerase (Perkin-Elmer), and 35 cycles of amplification for GATA-5 or 30 cycles for GAPDH and 100 ng of each sense and antisense primers. The amplification was carried out as follows: denaturation, 45 s at 94 °C; annealing, 45 s at 54 °C; and extension, 90 s at 72 °C. The PCR products (10 µl/lane) were electrophoresed on a 1.5% agarose gel and stained with ethidium bromide.

Statistical Analysis-- All data are expressed as means ± S.E. The significance of differences between mean values was evaluated by the two-tailed Student's t test, and differences were considered significant at the p < 0.05 level.

    RESULTS
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

LIF Increases Protein Synthesis Rate and beta -MHC Transcription in Cardiac Myocytes-- Neonatal rat ventricular cardiac myocytes respond to various hypertrophic stimuli by increasing protein synthesis and by specifically changing their patterns of gene expression, e.g. induction of beta -MHC (12, 15). To assess whether LIF induces a hypertrophic response to an extent similar to that of other previously well defined hypertrophic stimuli, such as ET-1, cardiomyocytes were treated with 2.5 × 10-9 M LIF or 10-7 M ET-1. As reported previously, these two stimuli elicit distinct forms of hypertrophy (width versus length; Ref. 18). Therefore, we have used bulk protein synthesis as a measure of hypertrophy. Stimulation with LIF and ET-1 resulted in a 40 ± 7 and 46 ± 5% increase in the protein synthesis rate, respectively (Fig. 1A). Then we examined the expression of beta -MHC by Northern blot using an oligonucleotide probe specific for the beta -isoform of MHC mRNA. We performed these experiments using three independent preparations of cardiac myocytes. Stimulation with LIF and ET-1 increased the expression of beta -MHC gene in cardiac myocytes by 3.8 ± 0.4- and 3.0 ± 0.5-fold, respectively, compared with the saline-stimulated states (Fig. 1B). However, neither LIF nor ET-1 activated the expression of a ubiquitously and constitutively expressed GAPDH gene. Thus, both LIF and ET-1 increased the protein synthesis rate and specifically activated beta -MHC gene expression to a similar extent in cardiac myocytes.


View larger version (26K):
[in this window]
[in a new window]
 
Fig. 1.   Increase of protein synthesis rate and beta -MHC gene expression in cardiac myocytes by ET-1 and LIF. A, neonatal rat ventricular myocytes were incubated in the presence of saline, 10-7 M ET-1, or 2.5 × 10-9 M LIF for 48 h. The activities of incorporated [3H]phenylalanine were determined by scintillation counting. B, Blots containing total RNA (10 µg) from these myocytes were sequentially hybridized with an isoform-specific antisense deoxyoligonucleotide complementary to rat beta -MHC mRNA and with a rat GAPDH cDNA. , control; black-square, ET-1; , LIF.

To determine whether the increase in beta -MHC gene expression during LIF and ET-1 stimulation of neonatal rat ventricular cells is mediated at the transcriptional level by elements within the 5'-flanking region of the beta -MHC gene, cardiomyocytes were transfected with a beta -MHC-luciferase reporter construct containing 3542-bp rat beta -MHC upstream sequence (p-3542beta -MHCluc). To control for transfection efficiency, the cells were co-transfected with a small quantity of pRSVCAT. After 48 h of stimulation with LIF, ET-1, or saline as a control, cardiomyocytes were harvested for luciferase and CAT assays. The 3542-bp beta -MHC promoter fragment conferred LIF- and ET-1-inducible expression to the luciferase reporter gene (1.9 ± 0.3- and 2.4 ± 0.1-fold, respectively). In contrast, neither LIF nor ET-1 stimulation induced the expression of a transfected luciferase gene driven by the 2936-bp alpha -MHC promoter (0.9 ± 0.2- and 1.2 ± 0.3-fold, respectively). These findings suggest that the upreguated expression of beta -MHC gene by LIF or ET-1 is mediated, at least in part, through a transcriptional mechanism and that the proximal 3542-bp beta -MHC promoter sequences are sufficient to mediate LIF- and ET-1-responsive transcription.

LIF-responsive beta -MHC Transcription Requires an Intact GATA Element-- To more precisely determine the downstream molecular events during LIF-induced cardiac hypertrophy, we examined cis-acting elements that mediate LIF-responsive beta -MHC transcription. A previous study demonstrated that the proximal 333 bp of the rat beta -MHC promoter are sufficient to mediate muscle-specific transcription in cultured neonatal cardiac myocytes and in sol8 cells (52). As shown in Fig. 2B, in cultured neonatal cardiac myocytes, the transfected -333/+34-bp beta -MHC promoter responded to LIF and ET-1 stimulation, increasing the expression 2.0- and 3.0-fold, respectively. These data demonstrate that important elements exist within the rat beta -MHC promoter sequences -333/+34, although they do not rule out possible elements outside these sequences.


View larger version (22K):
[in this window]
[in a new window]
 
Fig. 2.   Mutation analysis of the basal transcriptional activities and ET-1- and LIF-responsive transcription of rat beta -MHC promoter sequences in cardiac myocytes. Four µg of p-333wtbeta -MHCluc (wild type), p-333M-CATbeta -MHCluc (mutation of both M-CAT elements) or p-333GATAbeta -MHCluc (mutation of GATA element) and 1 µg of pRSVCAT were co-transfected into primary cardiac myocytes of neonatal rats subsequently stimulated with saline, ET-1, or LIF for 48 h. A, basal activities represent the relative luciferase activities (luc/CAT) in saline-stimulated states and were expressed by setting those of p-333wtbeta -MHCluc at 100% in each experiment. B, fold activation was expressed as the beta -MHC promoter activities (luc/CAT) in ET-1- or LIF-stimulated myocytes relative to those in saline-stimulated cells. In both A and B, data are presented as the mean ± S.E. of at least three independent experiments. , wild type; , mutant M-CAT; , mutant GATA.

The rat beta -MHC promoter sequences -333/+34 contain distal and proximal M-CAT elements, previously demonstrated to mediate muscle-specific and alpha 1-adrenergic-stimulated transcription of the beta -MHC gene (12). These also contain a GATA element, shown to mediate cardiac-specific transcription of other genes (50, 53, 55). Thus, we mutated these elements in the context of the 333-bp beta -MHC promoter. Mutations were designed to abolish the binding of cardiac nuclear factors (12, 53, 56). As shown in Fig. 2A, basal transcriptional activity of the transfected 333-bp beta -MHC promoter was attenuated by simultaneous mutations in both distal and proximal M-CAT elements (66% decrease versus wild type), compatible with a role for the M-CAT element in muscle-specific transcription. Basal activity was unaffected, however, by mutating the GATA motif. LIF- or ET-1-responsive beta -MHC transcription is shown in Fig. 2B. In contrast to the basal activity, mutating the M-CAT elements affected neither ET-1 nor LIF responsiveness. Notably, however, LIF- but not ET-1-responsive transcription was totally abolished by mutating the GATA element (wild type, 2.0-fold, versus GATA mutant, 0.9-fold; p < 0.001). Thus, an intact GATA element is required for LIF-responsive beta -MHC transcription, suggesting a role for this element in LIF-induced cardiac hypertrophy.

GATA-5 Is a Potent Activator of the beta -MHC Promoter-- Among members of GATA transcription factor family, GATA-4, -5, and -6 are expressed in the heart (44-46). To determine whether expression of GATA-4, -5, and -6 can transactivate the LIF-responsive -333/+34 bp beta -MHC promoter sequences, we performed transient transfection experiments. We co-transfected a luc expression vector driven by the -333/+34-bp beta -MHC promoter with a eukaryotic expression plasmid encoding one of GATA-4, -5, or -6 or beta -galactosidase as a control. Transfection efficiency was monitored by co-transfected pRSVCAT activity. GATA-4, -5, or -6 could not transactivate the -333/+34-bp beta -MHC promoter in cultured neonatal cardiac myocytes, possibly because of the competition for co-factors with endogenous GATA factors. To circumvent this problem, we performed these experiments in NIH3T3 cells, which do not express GATA-4, -5, or -6. As shown in Fig. 3A, expression of GATA-5 resulted in marked (12-fold) activation of the -333/+34 bp beta -MHC promoter. In contrast, a promoter derived from the ubiquitously expressed beta -actin gene was activated only mildly (3.2-fold). The extent of the beta -MHC promoter transactivation by GATA-4 or -6 was <3-fold and did not differ significantly from that of beta -actin promoter activation. Compatible with a previous report (53), a 2936-bp alpha -MHC promoter was not transactivated by GATA-4, -5, and -6 (<3-fold). We showed that GATA-4, -5, and -6, to a comparable degree (>10-fold), transactivated the smooth muscle myosin heavy chain promoter, which contains two GATA motifs.2 Thus, among members of the cardiac GATA transcription factor subfamily (GATA-4, -5, and -6), GATA-5 is the sole potent activator of the beta -MHC promoter. In addition, this marked activation occurs in the beta -MHC promoter but not in the alpha -MHC promoter, compatible with LIF responsiveness in cardiac myocytes.


View larger version (22K):
[in this window]
[in a new window]
 
Fig. 3.   Sequence-specific transactivation of the beta -MHC promoter by GATA-5. A, NIH3T3 cells were transfected with 2.5 µg of GATA-4, -5, and -6 expression vector, 1.5 µg of a reporter plasmid (pbeta -actinluc, p-333wtbeta -MHCluc, or p-2936alpha -MHCluc), and 0.5 µg of pRSVCAT. The results are expressed as fold activation of the normalized luciferase activity (luc/CAT) relative to co-transfection with the control beta -galactosidase expression vector. The data shown are from two to four independent experiments, each carried out in duplicate. B, NIH3T3 cells were transfected with 1.5 µg of luc expression vector, either p-333wtbeta -MHCluc (wild type) or p-333GATAbeta -MHCluc (with a mutation that ablates the LIF-responsive transcription), 2.5 µg of GATA-5 expression vector, and 0.5 µg of pRSVCAT. The results are expressed as fold activation of the normalized luciferase activity (luc/CAT) relative to co-transfection with the control beta -galactosidase expression vector. The data shown are from four independent experiments, each carried out in duplicate. First , beta -actin; , -333/+34beta -MHC; second , alpha -MHC.

Next we addressed whether GATA-5 stimulation of the beta -MHC promoter activity occurred in a sequence-specific manner. Point mutations were introduced into the GATA site of the -333/+34-bp beta -MHC promoter to ablate LIF responsiveness (Fig. 2B) as above. The resulting promoter construct (p-333GATAbeta -MHCluc) was co-transfected with an expression plasmid, pcDNA-GATA-5, and subsequently assayed for the relative luciferase activity. As seen in Fig. 3B, transactivation of the beta -MHC promoter was reduced by the GATA site mutation to levels only slightly greater than those exhibited by the beta -actin promoter. These findings demonstrate that the transactivation of the beta -MHC promoter by GATA-5 is dependent on an intact GATA sequence.

GATA-5 Strongly Binds to the beta -MHC GATA Element-- To determine whether the GATA motif in the beta -MHC promoter can interact with GATA-5, EMSAs were performed. In vitro-translated GATA-5 was probed with a radiolabeled oligonucleotide containing the beta -MHC GATA site (Fig. 4, lanes 2-6) in the presence or absence of competitor DNAs. Competition EMSAs revealed that a retarded band represented specific binding (Fig. 4, lane 2), as evidenced by the fact that it was competed by a 100-fold molar excess of unlabeled beta -MHC GATA oligonucleotide (Fig. 4, lane 3). The retarded band represents an interaction of the probe with GATA-5, because it was absent in unprogrammed lysate (Fig. 4, lane 1). The retarded band was also competed by an unlabeled CEF-1 oligonucleotide (Fig. 4, lane 4), which contains the GATA motif in the cTnC promoter (48) previously demonstrated to be a binding site of GATA-5. In contrast to the wild-type beta -MHC GATA site, the gel shift could not be competed by an excess of an oligonucleotide containing the beta -MHC GATA site into which point mutations (Fig. 2B) that ablate LIF responsiveness had been introduced (Fig. 4, lane 5) or by the same amount of a nonspecific oligonucleotide (Fig. 4, lane 6), confirming the sequence-specific nature of the interaction. These findings demonstrate that GATA-5 can bind the beta -MHC GATA site in a sequence-specific manner.


View larger version (32K):
[in this window]
[in a new window]
 
Fig. 4.   Analysis of interactions between the beta -MHC GATA site and in vitro-translated-GATA-5. EMSA studies in which unprogrammed lysate (lane 1) or in vitro-translated GATA-5 (lanes 2-6) were probed with a radiolabeled oligonucleotide containing the beta -MHC GATA site. Unlabeled competitor DNAs were present at a 100-fold molar excess as indicated: wild-type beta -MHC GATA (beta  GATA) in lane 3; CEF-1 (a previously established GATA-5 binding site in the cardiac TnT promoter) in lane 4; beta -MHC GATA with a mutation that ablates the LIF-responsive transcription (mut beta  GATA) in lane 5; and nonspecific oligonucleotide (NS; see "Experimental Procedures") in lane 6. The arrow indicates the complex corresponding to the GATA-specific interaction between the beta -MHC GATA site and GATA-5.

Although cTnC promoter has been shown to be efficiently transactivated by both GATA-4 and -5 (44, 50), the present study demonstrated that the beta -MHC promoter was activated by GATA-5 but not by GATA-4. We have investigated whether this difference in the transactivation intensity is attributable to the ability of cTnC and beta -MHC GATA sites to bind GATA-5 relative to GATA-4. In vitro-translated GATA-4 or GATA-5 was probed with a radiolabeled beta -MHC GATA oligonucleotide (Fig. 5A, lanes 3-6). Although a retarded band showing the interaction of the beta -MHC GATA site with GATA-5 was strong in its intensity (Fig 5A, lane 5), a band showing the interaction with GATA-4 was very weak (Fig. 5A, lane 3). In vitro-translated GATA-4 or GATA-5 derived from the same lysates with those used for the beta -MHC GATA site was also probed with CEF-1 oligonucleotide containing the GATA motif in the cTnC promoter (Fig. 5B, lanes 3-6). In contrast to the beta -MHC GATA site, the intensity of the band showing the interaction of the CEF-1 with GATA-5 (Fig. 5B, lane 5) was similar to that showing the interaction with GATA-4 (Fig. 5B, lane 3). Thus, the ability of GATA elements to bind GATA-5 relative to GATA-4 differs between beta -MHC and cTnC promoters.


View larger version (46K):
[in this window]
[in a new window]
 
Fig. 5.   The activities of beta -MHC and cTnT GATA sites to bind GATA-4, and -5. EMSA studies were performed in which in vitro-translated GATA-4 (lanes 3 and 4) or GATA-5 (lanes 5 and 6) were probed with a radiolabeled oligonucleotide containing the beta -MHC GATA site (A) or that containing the cTnT GATA site (CEF-1) (B). Unlabeled competitor DNAs are the same oligonucleotides as those used as probes.

LIF Induces the Expression of GATA-5 in Neonatal Cardiac Myocytes-- To determine whether LIF modulates the beta -MHC GATA binding activity in cardiac myocytes, EMSAs were performed with nuclear extracts from saline- and LIF-stimulated neonatal cardiac myocytes. Nuclear extracts were probed with a radiolabeled beta -MHC GATA oligonucleotide in the presence or absence of competitor oligonucleotides (Fig. 6, lanes 1-5). Competition EMSAs revealed that one retarded band (Fig. 6, lanes 1 and 2, arrow) represented GATA sequence-specific binding, as evidenced by the fact that it was competed by an unlabeled beta -MHC GATA oligonucleotide (Fig. 6, lane 3) or by an oligonucleotide containing a previously demonstrated GATA site in the cTnC promoter (CEF-1; Fig. 6, lane 4), but not by an excess of the beta -MHC GATA site containing point mutations that ablate LIF responsiveness (Fig. 6, lane 5) or by a nonspecific oligonucleotide (data not shown). Notably, the activity of the specific band was increased in nuclear extracts from LIF-stimulated myocytes (Fig. 6, lane 2) compared with those from saline-stimulated cells (Fig. 6, lane 1). This experiment was repeated three times using three independent preparations of cells and found to be reproducible. Thus, LIF up-regulated the beta -MHC GATA binding activity in nuclear extracts from cardiac myocytes.


View larger version (29K):
[in this window]
[in a new window]
 
Fig. 6.   beta -MHC GATA binding activities in saline- and LIF-stimulated cardiac myocytes. Nuclear extract (10 µg of protein) from saline-stimulated (lane 1) or LIF-stimulated (lanes 2-5) cardiac myocytes was probed with radiolabeled oligonucleotide containing the beta -MHC GATA site. Competitor DNAs are as indicated.

To investigate whether the up-regulated beta -MHC GATA binding activity represents increased GATA-5 transcripts in cardiac myocytes, we examined GATA-5 mRNA levels in saline- and LIF-stimulated cells. Previous studies demonstrated that the GATA-5 expression in the heart is restricted to the early embryonic stage and not detectable in the late embryo or in the adult by Northern blots. Using highly sensitive reverse transcriptase-PCR, a faint band indicating GATA-5 was detectable in saline-stimulated neonatal rat cardiac myocytes (Fig. 7). Notably, the band intensity markedly increased in LIF-stimulated cardiac myocytes. We confirmed by sequencing that this band represents a specific PCR product derived from GATA-5 cDNA. In contrast, the intensity of the band indicating GAPDH was almost comparable between saline- and LIF-stimulated cardiac myocytes. We repeated these experiments with three independent preparations of cardiac myocytes. With the use of a previously described semiquantitative reverse transcriptase-PCR (51), the cumulative results indicated that GATA-5 mRNA relative to GAPDH mRNA was 6.2 ± 0.5-fold higher in the LIF-stimulated cardiac myocytes than in the saline-stimulated cells.


View larger version (27K):
[in this window]
[in a new window]
 
Fig. 7.   The effect of LIF on the expression of GATA-5 mRNA by cultured ventricular cardiomyocytes. Cardiomyocytes were challenged with saline or LIF for 48 h. Representative photographs of PCR products after reverse transcriptase-PCR for GATA-5 and GAPDH mRNAs are shown. Each lane represents RNA from a separate culture plate. Similar results were obtained from three independent experiments. M, molecular marker.


    DISCUSSION
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

Cardiac myocyte hypertrophy is a central feature of all types of cardiac muscle disease and is an interesting example of the response of a terminally differentiated cell type to growth stimulation. Current insights into the mechanisms controlling cardiomyocyte hypertrophy have been obtained primarily from a cell culture model, in which growth factors signaling through G-protein-coupled receptors induce hypertrophy (9-16). Growing evidence suggests that gp130 activation is also coupled to myocardial cell hypertrophy (17, 18, 27). Using neonatal cardiac myocytes in culture, the present study demonstrates that mutation of the GATA motif in the beta -MHC promoter totally abolished LIF-responsive transcription. Among members of the cardiac GATA transcription factor subfamily, GATA-5 alone was able to potently transactivate the beta -MHC promoter. This transactivation was dependent on sequence-specific binding of GATA-5 to the beta -MHC GATA element. Last, LIF stimulation markedly increased levels of GATA-5 transcripts in cardiac myocytes. These findings demonstrate that GATA-5 is important in the LIF-mediated up-regulation of beta -MHC expression in cardiac myocytes and may represent the mechanism underlying the cardiac hypertrophy induced by the gp130 ligand family.

Role of M-CAT and GATA Elements in beta -MHC Transcription-- Once the hypertrophy signal is transduced from the membrane to the nucleus, a fundamental reprogramming occurs within cardiac myocytes that results in the reexpression of genes encoding fetal protein isoforms. Genes such as skeletal alpha -actin, beta -MHC, and atrial natriuretic factor become highly expressed within ventricular myocytes (4-8). Studies focused on elucidating the transcriptional regulation of these genes have identified a group of cis-acting regulatory elements that might mediate the nuclear response to hypertrophic stimuli. Analysis of the beta -MHC promoter has demonstrated that the M-CAT element, a binding site of the transcription enhancer factor-1 family, may play a role in both basal and hypertrophic-responsive transcription. For example, this element mediates both alpha 1-adrenergic and beta -protein kinase C-stimulated beta -MHC transcription (11, 12). M-CAT elements have also been implicated in alpha 1-adrenergic-stimulated expression of the skeletal alpha -actin and beta -type natriuretic peptide promoters (13, 57). In addition, the M-CAT motif is present in the promoters of several striated muscle-specific genes, where it functions to positively regulate basal transcription (57-63). Our observation that simultaneous disruption of both M-CAT elements in the setting of a 333-bp beta -MHC promoter decreases transcriptional activity is consistent with previous reports demonstrating that M-CAT elements play an important role in basal beta -MHC transcription. Unexpectedly, however, simultaneous mutations in both M-CAT elements, adequate to abrogate binding of nuclear proteins and to destroy enhancer function, had no effect on the ET-1 or LIF responsiveness of the 333-bp rat beta -MHC promoter. Although this finding does not rule out the possibility that M-CAT elements contribute to ET-1 or LIF responsiveness, it demonstrates that other elements within these sequences suffice to mediate this transcriptional response.

Sequences -333/+34 of the rat beta -MHC promoter also contain a GATA element (36). GATA elements have been shown to be important for cardiac-specific transcription in many cardiac genes, including alpha -MHC, beta -type natriuretic peptide, myosin light chain 1/3 and cTnC (50, 53-55). We show here that mutation of the GATA element in the 333-bp beta -MHC promoter totally abolished LIF-responsive transcription without changing basal transcriptional activity. Thus, this GATA element plays a critical role in LIF-responsive beta -MHC transcription. In contrast, ET-1 responsiveness was unaffected by the GATA mutation. These findings suggest that LIF and ET-1 activate beta -MHC gene transcription through distinct cis-acting elements. Previous work has shown that G-protein and gp130 pathways elicit morphologically distinct forms of myocardial cell hypertrophy (18). Thus, it appears that these two stimuli induce distinct hypertrophic processes through different pathways. The elucidation of the differences in these signaling pathways and the pathophysiological significance of these two forms of hypertrophy would be of particular interest.

GATA Factors Mediate gp130 Signaling in Cardiac Myocytes-- To date, six related zinc finger-containing proteins have been described, which recognize and bind the GATA motif (44, 45, 64). The proteins fall into two subgroups: those containing GATA-1, -2, and -3, and those with GATA-4, -5, and -6. The subgroups are defined by both sequence homology and expression pattern, with GATA-1, -2, and -3 predominating in blood and ectodermal derivatives and GATA-4, -5, and -6 in heart and endodermal derivatives. Interestingly, the genes encoding GATA-4 and -6 are expressed in the heart throughout embryonic and postnatal development, whereas the murine GATA-5 gene is normally expressed in a temporally and spatially restricted pattern within the embryonic heart (44, 45). These findings raise the possibility that GATA-4, -5, and -6 play differential roles during LIF-induced hypertrophy. The present study demonstrated that neither GATA-4 nor -6 significantly activated the LIF-responsive 333-bp beta -MHC promoter. In contrast, GATA-5 markedly stimulated this promoter. This activation required an intact GATA element, suggesting a direct effect. Consistent with this model, GATA-5 bound the beta -MHC GATA element in a sequence-specific manner. Importantly, LIF stimulation increased beta -MHC GATA binding activity in cardiac nuclear extracts. Although GATA-5-specific antisera for supershift experiments is not available at present, a complex formed with the beta -MHC GATA element is clearly GATA sequence specific. In addition, LIF stimulation increased expression of GATA-5 in neonatal cardiac myocytes. Taken together, these findings demonstrate that GATA factors are involved in LIF-responsive beta -MHC transcription and that GATA-5 is the factor that is primarily involved.

The signal transduction pathways by which members of the gp130 ligand family activate target genes have been well studied in several cell types (28-31). Typically, the phosphorylated STAT proteins dimerize, translocate into the nucleus, and bind to the promoter of target genes. The DNA binding targets of STATs include the interferon-gamma activation site-like elements (TTC/ANNNG/TAA) and the interferon-gamma -stimulated response elements (AGTTTCNNTTTCNC/T) (31). Our data demonstrate that GATA-5 markedly activated the beta -MHC promoter through specific binding to the GATA element and that beta -MHC GATA binding activity in cardiac myocytes is induced by LIF stimulation. At present, the molecular events that may link the Janus kinase/STAT pathway to this augmentation are unknown. LIF activates STATs within 15 min after LIF stimulation, whereas the induction of the beta -MHC expression occurs much later (48 h after LIF stimulation). Therefore, it is unlikely that STATs directly associate with GATA factors in the activation of the beta -MHC promoter. We demonstrate here that LIF stimulation increased GATA-5 transcripts in neonatal cardiac myocytes. Thus, one model is that the Janus kinase/STAT pathway is linked to the regulation of GATA-5 gene expression. Another model is that LIF-induced intracellular signaling cascades activate GATA factors or GATA co-activators post-translationally by phosphorylation or other mechanisms. In any event, because gp130 activation is one component of the hemodynamic overload stimulus (65), additional studies to delineate the precise mechanisms by which gp130 activation induces beta -MHC transcription are likely to provide significant insight into the pathways that mediate hemodynamic overload-induced hypertrophy in vivo.

    ACKNOWLEDGEMENTS

We thank Profs. Tetsuya Taga and Junji Yodoi for critical reading of the manuscript.

    FOOTNOTES

* This work was in part supported by grants (to K. H.) from the Kanae Foundation of Research for New Medicine, the Japanese Heart Foundation, the Japan Cardiovascular Research Foundation, and the Ministry of Education, Science, and Culture of Japan.The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

§ To whom correspondence should be addressed: Dept. of Cardiovascular Medicine, Graduate School of Medicine, Kyoto University, 54 Kawara-cho, Shogoin, Sakyo-ku, Kyoto 606-8507, Japan. Tel.: 81-75-751-3190; Fax: 81-75-751-3203; E-mail: koj{at}kuhp.kyoto-u.ac.jp.

** Charles and Tamara Krasne Faculty Scholar in Cardiovascular Research of the Albert Einstein College of Medicine.

2 H. Wada, K. Hasegawa, T. Kakita, S. Kaburagi, T. Morimoto, and S. Sasayama, unpublished data.

    ABBREVIATIONS

The abbreviations used are: MHC, myosin heavy chain; LIF, leukemia inhibitory factor; STAT, signal transducer and activator of transcription; luc, luciferase; CAT, chloramphenicol acetyltransferase; EMSA, electrophoretic mobility shift assay; cTnC, cardiac troponin C; ET, endothelin; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; wt, wild type; RSV, Rous sarcoma virus; PCR, polymerase chain reaction.

    REFERENCES
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES
  1. Chien, K. R., Knowlton, K. U., Zhu, H., and Chien, S. (1991) FASEB J. 5, 3037-3046[Abstract]
  2. MacLellan, W. R., Hawker, J., and Schneider, M. D. (1997) in Molecular Biology of Cardiovascular Disease (Marks, A. R., and Taubman, M. B., eds), pp. 327-378, Marcel Dekker, Inc., New York
  3. Copper, G. (1997) Annu. Rev. Med. 48, 13-23[CrossRef][Medline] [Order article via Infotrieve]
  4. Izumo, S., Lompre, A., Matsuoka, R., Koren, G., Schwarz, K., Nadal-Ginard, B., and Mahdavi, V. (1987) J. Clin. Invest. 79, 970-977
  5. Lee, R. T., Bloch, K. D., Pfeffer, J. M., Pfeffer, M. A., Neer, E. J., and Seidman, C. E. (1988) J. Clin. Invest. 81, 431-434
  6. Izumo, S., Nadal-Ginard, B., and Mahdavi, V. (1988) Proc. Natl. Acad. Sci. U. S. A. 85, 339-343[Abstract/Free Full Text]
  7. Kurabayashi, M., Shibasaki, Y., Komuro, I., Tsuchimochi, H., and Yazaki, Y. (1990) Jpn. Circ. J. 54, 1192-1205[Medline] [Order article via Infotrieve]
  8. Mercadier, J. J., Lompre, A. M., Swynghedauw, B., and Schwartz, K. (1993) Bull. Acad. Natl. Med. (Paris) 177, 917-931
  9. Knowlton, K. U., Baracchini, E., Ross, S., Harris, A. N., Henderson, S. A., Evans, S. M., Glembotski, C. C., and Chien, K. R. (1991) J. Biol. Chem. 266, 7759-7768[Abstract/Free Full Text]
  10. Shubeita, H. E., McDonough, P. M., Harris, A. N., Knowlton, K. U., Glembotski, C. C., Brown, J. H., and Chien, K. R. (1990) J. Biol. Chem. 265, 20555-20562[Abstract/Free Full Text]
  11. Kariya, K., Farrance, I. K., and Simpson, P. C. (1993) J. Biol. Chem. 268, 26658-26662[Abstract/Free Full Text]
  12. Kariya, K., Karns, L. R., and Simpson, P. C. (1994) J. Biol. Chem. 269, 3775-3782[Abstract/Free Full Text]
  13. Karns, L. R., Kariya, K., and Simpson, P. C. (1995) J. Biol. Chem. 270, 410-417[Abstract/Free Full Text]
  14. Zhu, H., Garcia, A. V., Ross, R. S., Evans, S. M., and Chien, K. R. (1991) Mol. Cell. Biol. 11, 2273-2281[Abstract/Free Full Text]
  15. Sadoshima, J., Jahn, L., Takahashi, T., Kulik, T. J., and Izumo, S. (1992) J. Biol. Chem. 267, 10551-10560[Abstract/Free Full Text]
  16. Ardati, A., and Nemer, M. (1993) EMBO J. 12, 5131-5139[Medline] [Order article via Infotrieve]
  17. Pennica, D., King, K. L., Shaw, K. J., Luis, E., Rullams, J., Louh, S., Darbonne, W. C., Knutzon, D. S., Yen, R., Chien, K. R., Baker, J. B., and Wood, W. I. (1995) Proc. Natl. Acad. Sci. U. S. A. 92, 1142-1146[Abstract/Free Full Text]
  18. Wollert, K. C., Taga, T., Saito, M., Narazaki, M., Kishimoto, T., Glembotski, C. C., Vernallis, A. B., Heath, J. K., Pennica, D., Wood, W. I., and Chien, K. R. (1996) J. Biol. Chem. 271, 9535-9545[Abstract/Free Full Text]
  19. Hibi, M., Murakami, M., Saito, M., Hirno, T., Taga, T., and Kishimoto, T. (1990) Cell. 63, 1149-1157[CrossRef][Medline] [Order article via Infotrieve]
  20. Taga, T., Narazaki, M., Yasukawa, K., Saito, T., Miki, D., Hamaguchi, M., Davis, S., Shoyab, M., Yancopoulos, G. D., and Kishimoto, T. (1992) Proc. Natl. Acad. Sci. U. S. A. 89, 10998-11001[Abstract/Free Full Text]
  21. Ip, N. Y., Nye, S. H., Boulton, T. G., Davis, S., Taga, T., Li, Y., Birren, S. J., Yasukawa, K., Kishimoto, T., Anderson, D. J., Stahl, N., and Yancopoulos, G. D. (1992) Cell 69, 1121-1132[CrossRef][Medline] [Order article via Infotrieve]
  22. Yin, T., Taga, T., Tsang, M. L., Yasukawa, K., Kishimoto, T., and Yang, Y. (1993) J. Immunol. 151, 2555-2561[Abstract]
  23. Taga, T. (1996) J. Neurochem. 67, 1-10[Medline] [Order article via Infotrieve]
  24. Murakami, M., Hibi, M., Nakagawa, N., Nakagawa, T., Yasukawa, K., Yamanisi, K., Taga, T., and Kishimoto, T. (1993) Science 260, 1808-1810[Abstract/Free Full Text]
  25. Gearing, D. P., Thut, C. J., VandenBos, T., Gimpel, S. D., Delaney, P. B., King, J., Price, V., Cosman, D., and Beckmann, M. P. (1991) EMBO. J. 10, 2839-2848[Medline] [Order article via Infotrieve]
  26. Davis, S., Aldrich, T. H., Stahl, N., Pan, L., Taga, T., Kisimoto, T., Ip, N. Y., and Yancopoulos, G. D. (1993) Science 260, 1805-1808[Abstract/Free Full Text]
  27. Hirota, H., Yosida, K., Kishimoto, T., and Taga, T. (1995) Proc. Natl. Acad. Sci. U. S. A. 92, 4862-4866[Abstract/Free Full Text]
  28. Kishimoto, T., Taga, T., and Akira, S. (1994) Cell 76, 253-262[CrossRef][Medline] [Order article via Infotrieve]
  29. Narazaki, M., Witthuhn, B. A., Yoshida, K., Silvennoinen, O., Yasukawa, K., Ihle, J. N., Kishimoto, T., and Taga, T. (1994) Proc. Natl. Acad. Sci. U. S. A. 91, 2285-2289[Abstract/Free Full Text]
  30. Akira, S., Nisio, Y., Inoue, M., Wang, X., Wei, S., Matsusaka, T., Yoshida, K., Sudo, T., Naruto, M., and Kishimoto, T. (1994) Cell 77, 63-71[CrossRef][Medline] [Order article via Infotrieve]
  31. Heim, M. H. (1996) Eur. J. Clin. Invest. 26, 1-12[CrossRef][Medline] [Order article via Infotrieve]
  32. Hunter, J. J., Tanaka, N., Rockman, H. A., Ross, J., Jr., and Chien, K. R. (1995) J. Biol. Chem. 270, 23173-23178[Abstract/Free Full Text]
  33. Thorburn, A., Thorburn, J., Chen, S., Powers, S., Shubeita, H. E., Feramisco, J. R., and Chien, K. R. (1993) J. Biol. Chem. 268, 2244-2249[Abstract/Free Full Text]
  34. Sheng, Z., Knowlton, K., Chen, J., Hoshijima, M., Brown, J. H., and Chien, K. R. (1997) J. Biol. Chem. 272, 5783-5791[Abstract/Free Full Text]
  35. Herzig, T. C., Jobe, S. M., Aoki, H., Molkentin, J. D., Cowley, A. W., Izumo, S., and Markham, B. E. (1997) Proc. Natl. Acad. Sci. U. S. A. 94, 7543-7548[Abstract/Free Full Text]
  36. Hasegawa, K., Lee, S. J., Jobe, S. M., Markham, B. E., and Kitsis, R. N. (1997) Circulation 96, 3943-3953[Abstract/Free Full Text]
  37. Hasegawa, K., Meyers, M. B., and Kitsis, R. N. (1997) J. Biol. Chem. 272, 20049-20054[Abstract/Free Full Text]
  38. Kraft, R., Bravo-Zehnder, M., Taylor, D. A., and Leinwand, L. A. (1989) Nucleic Acids Res. 17, 7529-7530[Free Full Text]
  39. Tso, J. Y., Sun, X. H., Kao, T., Reece, K. S., and Wu, R. (1985) Nucleic Acids Res. 13, 2485-2502[Abstract/Free Full Text]
  40. Buttrick, P. M., Kaplan, M. L., Kitsis, R. N., and Leinwand, L. A. (1993) Circ. Res. 72, 1211-1217[Abstract/Free Full Text]
  41. Nordeen, S. K. (1988) BioTechniques 6, 454-457[Medline] [Order article via Infotrieve]
  42. Gorman, C. M., Merlino, G. T., Willingham, M. C., Pastan, I., and Howard, B. H. (1982) Proc. Natl. Acad. Sci. U. S. A. 79, 6777-6781[Abstract/Free Full Text]
  43. Kitsis, R. N., Buttrick, P. M., NcNally, E. M., Kaplan, M. L., and Leinwand, L. A. (1991) Proc. Natl. Acad. Sci. U. S. A. 88, 4138-4142[Abstract/Free Full Text]
  44. Morrisey, E. E., Ip, H. S., Tang, Z., Lu, M. M., and Parmacek, M. S. (1997) Dev. Biol. 183, 21-36[CrossRef][Medline] [Order article via Infotrieve]
  45. Morrisey, E. E., Ip, H. S., Lu, M. M., and Parmacek, M. S. (1996) Dev. Biol. 177, 309-322[CrossRef][Medline] [Order article via Infotrieve]
  46. Heikinheimo, M., Scandrett, J. M., and Wilson, D. V. (1994) Dev. Biol. 164, 361-373[CrossRef][Medline] [Order article via Infotrieve]
  47. Hasegawa, K., and Kitsis, R. N. (1997) in Molecular Biology of Cardiovascular Disease (Marks, A. R., and Taubman, M. B., eds), pp. 67-80, Marcel Dekker, Inc., New York
  48. Magnaghi-Jaulin, L., Masutani, H., Lipinski, M., and Harel-Bellan, A. (1996) FEBS Lett. 391, 247-251[CrossRef][Medline] [Order article via Infotrieve]
  49. Andrews, N. C., and Faller, D. V. (1991) Nucleic Acids Res. 19, 2499[Free Full Text]
  50. Ip, H. S., Wilson, D. B., Heikinheimo, M., Tang, Z., Ting, C., Simon, M. C., Leiden, J. M., and Parmacek, M. S. (1994) Mol. Cell. Biol. 14, 7517-7526[Abstract/Free Full Text]
  51. Shioi, T., Matsumori, A., and Sasayama, S. (1996) Circulation 94, 2930-2937[Abstract/Free Full Text]
  52. Thompson, W. R., Nadal-Ginard, B., and Mahdavi, V. (1991) J. Biol. Chem. 266, 22678-22688[Abstract/Free Full Text]
  53. Molkentin, J. D., Kalvakolanu, D. V., and Markham, B. E. (1994) Mol. Cell. Biol. 14, 4947-4957[Abstract/Free Full Text]
  54. Grepin, C., Dagnino, L., Robitaille, L., Haberstroh, L., Antakly, T., and Nemer, M. (1994) Mol. Cell. Biol. 14, 3115-3129[Abstract/Free Full Text]
  55. McGrew, M. J., Bogdanova, N., Hasegawa, K., Hughes, S. H., Kitsis, R. N., and Rosenthal, N. (1996) Moll. Cell. Biol. 16, 4524-4534[Abstract]
  56. Shimizu, N., Smith, G., and Izumo, S. (1993) Nucleic Acids Res. 21, 4103-4110[Abstract/Free Full Text]
  57. Thuerauf, D. J., and Glembotski, C. C. (1997) J. Biol. Chem. 272, 7464-7472