|
J Biol Chem, Vol. 274, Issue 18, 12819-12826, April 30, 1999
The Role of GATA, CArG, E-box, and a Novel Element in the
Regulation of Cardiac Expression of the
Na+-Ca2+ Exchanger Gene*
Guangmao
Cheng,
Tyson P.
Hagen,
Myra L.
Dawson,
Kimberly V.
Barnes, and
Donald R.
Menick
From the Cardiology Division, Department of Medicine, and the Gazes
Cardiac Research Institute, Medical University of South Carolina,
Charleston, South Carolina, 29425-2221
 |
ABSTRACT |
The cardiac
Na+-Ca2+ exchanger (NCX1) is the
principal Ca2+ efflux mechanism in cardiocytes. The
exchanger is up-regulated in both cardiac hypertrophy and failure. In
this report, we identify the cis-acting elements that
control cardiac expression and -adrenergic up-regulation of the
exchanger gene. Deletion analysis revealed that a minimal cardiac
promoter fragment from 184 to +172 is sufficient for cardiac
expression and -adrenergic stimulation. Mutational analysis revealed
that both the CArG element at 80 and the GATA element at 50 were
required for cardiac expression. Gel mobility shift assay supershift
analysis demonstrated that the serum response factor binds to the CArG
element and GATA-4 binds to the GATA element. Point mutations in the
172 E-box demonstrated that it was required for -adrenergic
induction. In addition, deletion analysis revealed one or more enhancer
elements in the first intron (+103 to +134) that are essential for
phenylephrine up-regulation but bear no homology to any known
transcription element. Therefore, this work demonstrates that SRF and
GATA-4 are critical for NCX1 expression in neonatal cardiomyocytes and that the 172 E-box in addition to a novel enhancer element(s) are
required for phenylephrine up-regulation of NCX1 and may mediate its
hypertrophic up-regulation.
 |
INTRODUCTION |
The Na+-Ca2+ exchanger
(NCX1)1 catalyzes the
electrogenic exchange of one intracellular calcium ion for three
extracellular sodium ions across the plasma membrane in many mammalian
cells. Transport is reversible and can facilitate calcium entry, which
in the heart is capable of triggering calcium release from the
sarcoplasmic reticulum (1). The exchanger is most abundant in the
heart, where it regulates Ca2+ fluxes across the sarcolemma
and serves a critical role in the maintenance of the cellular calcium
balance for excitation-contraction coupling.
Na+-Ca2+ exchanger activity in cardiomyocytes
is regulated by several factors. It is activated by cytosolic
Ca2+ and MgATP (2) and inhibited by cytosolic sodium (3)
and ATP depletion (4). A high affinity Ca2+-binding domain
has been identified in the large cytoplasmic loop (residues 371-508)
that is believed to be responsible for calcium regulation (5). It
is also inhibited by the exchanger inhibitory peptide, which
corresponds to a 20-amino acid segment at the N terminus of the large
cytoplasmic loop (6). A recent study has demonstrated that the
exchanger is phosphorylated via a protein kinase
C-dependent pathway and that NCX1 phosphorylation appears to coincide with up-regulation of exchanger activity (7).
In addition, the exchanger is regulated at the transcriptional level in
cardiac hypertrophy, ischemia, and failure. In the feline model of
acute right ventricular hypertrophy, NCX1 message levels are rapidly
up-regulated following pressure overload (8, 9). An increase in NCX1
mRNA expression is also observed in cultured cardiac myocytes
following -adrenergic stimulation by phenylephrine or exposure to
veratridine. Importantly, the exchanger is also up-regulated at both
the message and protein levels in end-stage heart failure (10). Very
little is known about the genetic elements and transcription factors
that regulate NCX1 expression. Identification of the factors involved
in NCX1 up-regulation is important to unraveling the sequence of
molecular events that initiates hypertrophic growth. Furthermore, it
may provide insight into the basis of the development of decompensated
heart failure.
The feline (11), human (12, 13), and rat (13, 14) NCX1 genes have
recently been cloned. The NCX1 gene is unusual in that it contains
three promoters and multiple 5'-untranslated region exons upstream of
the coding region. As a result of alternative promoter usage and the
resulting alternative splicing, there are multiple tissue-specific
variants of the Na+-Ca2+ exchanger (11,
15-17). The feline cardiac minimal promoter ( 184 to +172) is
responsive to -adrenergic stimulation and sufficient to drive
expression of a reporter gene in neonatal cardiomyocytes but not mouse
L cells (18). Analysis of the DNA sequence of the feline cardiac basal
NCX1 promoter revealed a number of elements that may be involved in
regulation and are conserved in the rat promoter (14). There are two
CANNTG motifs (E-boxes) at positions 172 and 153 that are potential
target sites for the basic helix-loop-helix family of transcription
factors. E-box-binding proteins have been demonstrated to mediate the
cardiac expression of several genes including the ventricular myosin
light chain 2 (19), cardiac -actin (20), and - and -myosin
heavy chain (21). This region also contains consensus sequence for two
GATA boxes at positions 125 and 50. Several cardiac specific genes
such as myosin light chain IA, myosin light chain IV, and -myosin
heavy chain (22, 23) contain conserved GATA binding motifs. The GATA
elements in the atrial natriuretic peptide (24) and -myosin heavy
chain (25) gene have been shown to be critical for cardiac expression. This region also contains a single MEF-2 element at position 166. A
MEF-2-like motif appears to be required for cardiac-specific expression
of the rat cardiac troponin T gene. There are six Nkx-2.5 binding sites
in the first 1831 bases of the NCX promoter including one in the first
250 bases. The cardiogenic homeodomain factor Nkx-2.5 has been shown to
be expressed in early cardiac cell progenitors and plays an important
role in cardiac development. A single CArG element is present at
position 80. A CArG element (CC(A/T)6GG) is also present
in the 5'-flanking region of the cardiac -actin, skeletal -actin,
-actin, -myosin heavy chain, cardiac myosin light chain 2, and
troponin T genes (25-29). The CArG elements of skeletal and cardiac
-actin are very homologous to the serum response element and serve
as a binding site for the nuclear serum response factor (SRF). In the
present study, we perform a detailed analysis of the NCX1 promoter
elements important for neonatal cardiocyte expression and
-adrenergic induction. We present three main findings. First,
expression of NCX1 in neonatal cardiomyocytes requires both the CArG
element at 80 to 71 and the GATA element at 50 to 45. Second,
electrophoretic mobility shift analysis revealed specific DNA-protein
complexes for both of these elements. SRF is one of the factors binding
to the CArG element, and GATA-4 binds to the GATA element. Third,
mutagenesis and deletion analysis revealed a E-Box at position 172,
and an additional enhancer element or elements in the first exon-intron
boundary (+103 to +134), which are essential for -adrenergic
induction of the exchanger. This region bears no homology to any of the
known transcription elements.
 |
EXPERIMENTAL PROCEDURES |
Materials--
All restriction enzymes and DNA-modifying enzymes
were purchased from Promega (Madison, WI) or New England Biolabs
(Beverly, MA). QuikChange site-directed mutagenesis and luciferase
reporter kits were from Stratagene (La Jolla, CA). Eagle's minimum
essential medium (MEM), Hanks' balanced salt solution, horse serum,
and newborn calf serum were all from Life Technologies, Inc. Antibodies for supershift assays were purchased from Santa Cruz Biotechnologies, Inc. (Santa Cruz, CA). The AmpliCycle sequencing kit was obtained from
Perkin-Elmer (Foster City, CA). All common reagents were of the highest
quality and were purchased from either Fisher or Sigma.
Mutations in the NCX1831 Luciferase Construct--
A 2-kb
portion of the NCX promoter was cloned into the pGL2 vector as
described previously (11). Mutated constructs were generated using
QuikChange site-directed mutagenesis. Sense and antisense
oligonucleotides were designed to contain the desired mutation flanked
on either side by 12 bp of wild-type NCX sequence. Then, these were
used to introduce the mutations into the NCX1831 construct by
polymerase chain reaction using the manufacturer's protocol. The
entire promoter region of each mutant construct was sequenced using the
AmpliCycle sequencing kit to ensure that they contained only the
desired point mutations.
Cell Culture--
Primary cardiocytes were obtained from
2-4-day-old neonatal rats and cultured by the method described
previously (30). Briefly, ventricular myocardium was isolated from
neonatal rats, minced, and digested with enzyme solution (2.4 units/ml
partially purified trypsin, 2.7 units/ml chymotrypsin, and 0.94 units/ml elastase in calcium- and magnesium-free Hanks' balanced salt
solution). The tissue was incubated for 20 min at 37 °C with
stirring. After incubation, the cells were put into MEM plus 10%
newborn calf serum and centrifuged at 250 × g. The
pellets were resuspended in MEM plus 10% newborn calf serum. The
incubation and centrifugation step was repeated five more times.
Cardiac fibroblast were removed by preferential adherence to polystyene
culture flasks for 90 min to obtain cultures with >95% cardiomyocyte
purity (31). After enrichment, cardiocytes were plated in
gelatin-coated 60-mm culture dishes at 1.25 × 106
cells/plate in 4 ml of modified Eagle's medium (Life Technologies) supplemented with antibiotics (100 units/ml penicillin, 100 µg/ml streptomycin, and 0.25 µg/ml amphotericin B), 10% heat-inactivated newborn calf serum, bromodeoxyuridine, and essential and nonessential amino acids. After serum incubation for 20-24 h, the cultures were
washed and incubated in serum-free supplemented Dulbecco's modified
Eagle's medium including 10 7 M recombinant
insulin (Life Technologies, Inc.).
Transfection--
One day after plating, the cardiocytes were
placed in MEM containing 4% horse serum 1-4 h prior to transfection.
The transfections were performed by the calcium phosphate DNA
precipitation method described previously (32). The efficiency of
transfection was between 1 and 2%. Briefly, 16 µg of
Na+-Ca2+ exchanger-luciferase construct was
co-transfected with 8 µg of cytomegalovirus promoter-driven
-galactosidase expression plasmid and kept in MEM. After 24 h
of incubation, the medium was changed, and where designated,
phenylephrine (100 µM) was added, and the cells were
incubated in 10% CO2 for 48 h. Control cells were
treated with 10 µM verapamil to inhibit any spontaneous
contractile activity. Cells were washed twice in 3 ml of cold
phosphate-buffered saline and lysed for 15 min in reporter lysis buffer
(Promega). The lysates were quick frozen and stored at 70 °C.
Luciferase and -galactosidase activity assays were performed as
described previously (11).
Preparation of Nuclear Extract and Electrophoretic Mobility Shift
Assay--
Nuclear extracts were prepared from neonatal rat ventricle
as described (33). Briefly, 20 hearts from 1-4-day-old neonatal rats
were rinsed 2 times in ice cold phosphate-buffered saline. 5 ml of NE1
buffer (250 mM sucrose, 15 mM Tris-HCl (pH
7.9), 140 mM NaCl, 2 mM EDTA, 0.5 mM EGTA, 0.15 mM spermine, 0.5 mM
spermidine, 1 mM dithiothreitol, 0.4 mM
phenylmethylsulfonyl fluoride, 25 mM KCl, and 2 mM MgCl2) was added to the tissue, which was
immediately homogenized and filtered through two layers of cheese
cloth. Nonidet P40 was added to the homogenate to a final concentration
of 0.5%. Following five more strokes with a Dounce homogenizer, the
homogenate was centrifuged at 1000 × g for 10 min at
4 °C. Nuclei were then washed with 5 ml of NE1 buffer and
centrifuged as above. The pellet was resuspended in 1 packed cell
volume of NE1 buffer containing 350 mM KCl followed by
another 20 strokes with a homogenizer. The homogenate was centrifuged
at 12,000 × g for 5 min at 4 °C to eliminate the
large cell debris and then centrifuged at 180,000 × g
for 90 min at 4 °C. The supernatant was dialyzed for 1 h to overnight at 4 °C against dialyzing buffer (50 mM KCl, 4 mM MgCl2, 20 mM
K3PO4 (pH 7.4), 1 mM
-mercaptoethanol, 20% glycerol). After enriching for DNA-binding
proteins on heparin-Sepharose CL-6B, the supernatant was stored at
80 °C. Nuclear extract (5 µg) was incubated in the presence of
50 µg/ml poly(dG-dC) in binding buffer (50 mM NaCl, 0.1 mM EDTA, 20 mM HEPES (pH 7.9), 0.5 mM dithiothreitol, 10% glycerol). After 20 min of
incubation at room temperature, the samples were loaded on 6%
polyacrylamide gels and electrophoresed in 0.5× TBE at 10 V/cm of gel
at 4 °C. The gels were dried and exposed to an x-ray film. For
oligonucleotide competition or antibody supershift assays,
nonradioactive oligonucleotides or antibodies were added to the
reaction mixture and incubated for 10 min prior to the addition of the
radioactive probe (for a complete listing of the oligonucleotide probes
used in these studies, see Table I).
Statistical Analysis--
The raw data were analyzed by standard
statistical analysis using StatView software (SAS Institute Inc., Cary,
NC), and statistical significance was defined as p < 0.05 by the Dunnett one-tail test.
 |
RESULTS |
In our initial characterization of the NCX1 cardiac promoter (11),
we demonstrated that a construct containing the first 250 bp of the
5'-flanking region, the H1 exon, and 67 bp of the first intron is
sufficient for cardiac-directed expression and -adrenergic
stimulation of the luciferase reporter gene. We have since shown that a
construct containing only 184 bases of the 5'-flanking region has the
same activity as the 250-bp construct (18). This is also in agreement
with what has been reported for the rat NCX1 minimal promoter (14).
There are consensus sequences for a number of potential DNA-binding
factors in the NCX1 cardiac minimal promoter (Fig.
1). There are two potential binding sites
for the GATA family of zinc-fingered transcription factors
(A/T)GATA(A/G) and two CANNTG motifs (E-boxes) that are potential
target sites for the basic helix-loop-helix family of transcription
factors. This region also contains a single MEF-2 element, a CArG
element, and a binding site for the cardiogenic homeodomain factor
Nkx-2.5. It is of interest to note that sequence of both GATA elements,
the CArG element, MEF element, and the 153 E-box are perfectly
conserved in both the feline and rat NCX1 promoters (14).

View larger version (33K):
[in this window]
[in a new window]
|
Fig. 1.
Partial nucleotide sequence of the cardiac
NCX promoter sequence. Shown are the H1 exon
(uppercase) along with 361 bp of 5'-flanking sequence and
the first 67 nucleotides of the first intron. The cardiac minimal
promoter ( 184 to +172) is contained within this sequence. Numbering
is relative to the transcriptional start site represented by the
asterisk. Putative cis-acting regulatory elements
are underlined. The region contains two E-box elements, two
GATA elements, a MEF-2 recognition sequence, a CArG element, and one
Nkx-2.5 element. The sequence for the first four exons and the three
promoters of the feline NCX1 gene has been previously published (11)
and has been submitted to GenBankTM with accession numbers
U67072-U67075.
|
|
Using the full-length (1831-bp) construct, we introduced site-specific
point mutations into each of these elements, and the activity of each
of the mutants was compared with the wild-type full-length construct to
determine its contribution to cardiac specific expression (Fig.
2). Each NCX1 mutant promoter construct was transfected in triplicate in at least three independent neonatal cardiomyocyte preparations. Point mutations within the 166 MEF-2 and
10 Nkx-2.5 elements resulted in reporter activity of 70-75% of the
NCX1831 promoter-luciferase construct. If these elements play any role
in the transcription of the NCX1 gene they do so to a very minor
extent. Point mutations within the 172 E-box, 153 E-box, and 125
GATA elements reduced reporter activities to ~35-55% of wild type
promoter activity. Therefore, these elements appear to contribute to
NCX1 transcription. Importantly, point mutations within either the 80
CArG element or the 50 GATA element resulted in luciferase activity
of only 3-8% of the control levels. Clearly, the CArG element at 80
and the GATA element at 50 are critical to NCX1 expression in
neonatal cardiocytes.

View larger version (46K):
[in this window]
[in a new window]
|
Fig. 2.
Effects of mutations of transcriptional
elements on expression of the NCX1 gene. Upper panel, a
diagram of the promoter-proximal sequences and the mutated bases
(below) for each transcriptional element. Point mutations
were created in the full-length, 1831-bp NCX1 promoter-luciferase
construct. Lower panel, relative luciferase
values for wild type and mutant constructs transfected into neonatal
rat cardiomyocytes (n = 3 separate experiments
performed in triplicate). Individual constructs were co-transfected
with a cytomegalovirus promoter-driven -galactosidase fusion vector
to normalize transfection efficiency. The relative luciferase values
were then normalized to the wild-type NCX1831 construct, and the
average was reported as a percentage of the wild-type value.
|
|
Mobility Shift Analysis of Nuclear Factors in Cardiac Tissue That
Bind to the E-box, CArG, and GATA Elements--
To analyze the
potential interactions of the NCX1 cardiac elements with
trans-acting factors, we conducted electrophoretic mobility
shift assays with nuclear extracts from neonatal rat heart tissue.
Oligonucleotide probes were generated for the 5' E-box ( 151 to
189), CArG ( 93 to 55), and the 3' GATA ( 68 to 29) element
(Table I). Mutation of the 172 E-box
reduced reporter gene expression to 55% of control levels in transient transfection of neonatal cardiomyocytes; therefore, this E-box may play
a minor role in NCX1 expression. Incubation of nuclear extracts from
neonatal heart tissue with a 32P-labeled E-box
oligonucleotide resulted in the formation of a specific protein-DNA
complex (Fig. 3A). Specificity
was indicated by its competition with a 100-fold molar excess of
unlabeled E-box oligonucleotide but not by a nonspecific GATA probe.
This E-box element is directly adjacent to a MEF-2 element (Fig. 1),
which is present as part of the sequence in the oligonucleotide probe used for the mobility shift assay. Transfection experiments indicate that the MEF-2 element does not appear to be important for NCX1 expression in neonatal cardiomyocytes (Fig. 2). Further, if this element plays a role in NCX1 expression, one would expect it to contribute to the complex of nuclear factors binding to the E-box oligonucleotide probe. Competition with a 100-fold excess of unlabeled MEF-2 element had no effect on the band. This demonstrates that the
MEF-2 element does not play a role in the DNA-protein complex observed
with the E-box element probe; therefore, it is unlikely to play a role
in NCX1 expression in neonatal cardiomyocytes. An E-box element in the
-myosin heavy chain gene (34) has been demonstrated to be
responsible for the up-regulation of the gene in response to increased
contractile activity. Moreover, this E-box has been shown to bind a
cardiomyocyte nuclear protein antigenically related to upstream
stimulatory factor 1 (USF-1) (34). Gel supershifts were performed to
determine if USF-1 is a part of the NCX1 172 E-box binding complex.
Incubation of the DNA-nuclear protein complex with 2 µg of USF-1
antibody did not result in a supershift (Fig. 3B). In
addition, the formation of this complex was not altered by incubation
with antibodies against either of the widely expressed basic
helix-loop-helix factors E12 or E47 (Fig. 3B). Therefore, the NCX1 172 E-box element-nuclear protein complex does not include detectable amounts of E12, E47 or USF-1.
View this table:
[in this window]
[in a new window]
|
Table I
Oligonucleotide probes
Oligonucleotide probes for EMSA contain a 4-bp (GATC) 5'-overhang for
labeling purposes.
|
|

View larger version (79K):
[in this window]
[in a new window]
|
Fig. 3.
Gel mobility shift assay for E-box
172. Neonatal rat heart extract (20 µg) was probed with
32P-labeled double-stranded oligonucleotides containing the
NCX1 172 E-box sequence and its immediate flanking sequence. A
100-fold molar excess of unlabeled 172 E-box probe was used as a
specific competitor to the labeled probe. Extracts were also probed
using a molar excess of 166 MEF2, 51 GATA, and mutant 172 E-box
probe to verify that the interactions were specific to the E-box
element. All probes and oligonucleotides used for competition
experiments are listed in Table I. The labeled probes were 43-mers, and
the unlabeled competitors were 20-, 22-, 43-, or 44-mers. Supershift
analysis was performed by incubating the reaction mixture with 2 µg
of USF-1, E12, or E47 antibody.
|
|
Incubation of nuclear extracts from neonatal rat hearts with the
32P-labeled oligonucleotide for the NCX1 80 CArG element
resulted in the formation of two specific protein-DNA complexes (Fig.
4). Competition with a 100-fold excess of
the unlabeled 43-mer probe or a shorter 22-mer containing the NCX1 CArG
sequence completely eliminated both of these complexes, whereas
competition with a 100-fold excess of unlabeled mutant CArG sequence
did not affect the binding of the probe to either of these complexes.
In addition, incubation with nonspecific competitor DNA (100-fold E-box
element) did not compete for binding to either complex. The ubiquitous SRF, which recognizes a CArG element in the cardiac -actin promoter (35), may be involved in the cardiac specific transcription of NCX1. To
determine whether SRF actually binds to the NCX1 CArG element, a
supershift assay was performed with anti-SRF polyclonal antibody.
Incubation of the DNA-nuclear protein complex with 2 µg of SRF
antibody showed a definitive supershift, demonstrating that at least
one of the components is SRF or is antigenically related to SRF (Fig.
4, lane 6).

View larger version (94K):
[in this window]
[in a new window]
|
Fig. 4.
Gel mobility shift assay for CArG.
Neonatal rat heart extract (20 µg) was probed with
32P-labeled double-stranded oligonucleotides containing the
NCX CArG sequence and its immediate flanking sequence. A 100-fold molar
excess of unlabeled CArG probe was used as a specific competitor to the
labeled probe. Extracts were also probed using a molar excess of 172
E-box probe and mutant CArG probe to verify that the interactions were
specific to the CArG element. The labeled probes were 43-mers, and the
unlabeled competitors were either 22- or 43-mers. Supershift analysis
was performed using 2 µg of SRF antibody.
|
|
Incubation of nuclear extracts from neonatal cardiomyocytes with a
32P-labeled GATA probe ( 68 to 29), revealed a single
protein-DNA complex (Fig. 5). Competition
with 100-fold excess of unlabeled mutant GATA sequence or nonspecific
competitor DNA (E-box ( 172)) did not affect the complex; however,
competition with a 100-fold molar excess of an unlabeled GATA probe
completely eliminated the complex (Fig. 5A). Both GATA-4 and
GATA-6 are expressed in the adult heart. To determine if GATA-4 and/or
GATA-6 was present in the NCX1 50 GATA sequence-specific interaction,
GATA-4 and GATA-6 antibodies were incubated with the nuclear
protein-DNA complex and examined by gel shift analysis. The GATA-4
antibody clearly supershifted the 50 GATA complex (Fig.
5B). No supershift was detected with the GATA-6 antibody
(data not shown), indicating that GATA-4 but not GATA-6 interacts with
this site.

View larger version (95K):
[in this window]
[in a new window]
|
Fig. 5.
Gel mobility shift assay for GATA 50.
Neonatal rat heart extract (20 µg) was probed with
32P-labeled double-stranded oligonucleotides containing the
NCX GATA 50 sequence and its immediate flanking sequence. A 100-fold
molar excess of unlabeled 50 GATA probe was used as a specific
competitor to the labeled probe. Extracts were also probed using a
molar excess of 172 E-box probe and mutant 50 GATA probe to verify
that the interactions were specific to the 50 GATA element. The
labeled probes were 44-mers, and the unlabeled competitors were either
43- or 44-mers (see Table I). Supershift analysis was performed by
incubating the reaction mixture with 4 µg of GATA-4
antibody.
|
|
Identification of Elements Responsive to -Adrenergic
Stimulus--
In order to identify elements mediating -adrenergic
up-regulation, constructs containing mutations in the putative elements in the minimal promoter were transfected into neonatal rat cardiocytes treated with phenylephrine. Phenylephrine treatment induced an approximately 2-fold increase in luciferase activity over that of
untreated (11) or verapamil-treated cardiomyocytes transfected with the
1831-bp full-length wild-type NCX1 luciferase construct (Fig.
6). Fig. 6 demonstrates that mutations in
the 10 Nkx, 166 MEF, 153 E-box, and 125 GATA elements did not
affect -adrenergic stimulation. Each shows a 1.8-2-fold induction
of luciferase expression with PE treatment. Interestingly, constructs
with point mutations in the 80 CArG and 50 GATA elements, which are
required for transcriptional activity in the neonatal cardiocytes, have
not lost -adrenergic inducible expression. In fact, they are
stimulated to a greater extent than the wild type NCX1 construct. This
may be due in part to the very low transcription level of 50 GATA and
80 CArG (10-20-fold lower than wild type) mutant constructs. However, an NCX1 construct with the 172 E-box sequence mutated yielded only a 1.2-fold increase in luciferase activity when treated with phenylephrine (Fig. 6). This is significantly less induction than
what is seen in the wild type NCX1 construct. Therefore, the NCX1 172
E-Box element appears to be required for -adrenergic up-regulation.
This is similar to the -MHC promoter in which an E-box element was
demonstrated to be responsible for up-regulation in response to
increased contractile activity (34).

View larger version (61K):
[in this window]
[in a new window]
|
Fig. 6.
Effects of adrenergic stimulation on the
expression of NCX1 H1-luciferase chimeric point mutation
constructs. Point mutations were created in the putative
cis-elements of the feline NCX1 cardiac 1831-bp promoter,
the first exon, and the first 67 bp of the first intron fused to the
luciferase gene in the pGL2 vector. All transfections of NCX1 deletion
and point mutants were performed in neonatal rat cardiomyocytes.
Individual constructs were co-transfected with a cytomegalovirus
promoter-driven -galactosidase fusion vector to normalize
transfection efficiency. Data are shown as -fold induction of the
PE-treated transfections over the reporter activity of each construct
without PE treatment. Averages shown are for at least three independent
transfection experiments preformed in triplicate. Cells were treated
with 100 µM phenylephrine (PE) 24 h after
transfection. Control cells were treated with 10 µM
verapamil 24 h after transfection to inhibit any spontaneous
contractile activity. *, p < 0.05 versus
activity of NCX1 1831 for each mutant construct. S.E. bars
are shown.
|
|
Each of the above constructs contained the entire first exon (H1) and
67 bases of the first intron. Constructs in which luciferase was fused
at position +22 of the H1 exon had only 20% of control activity. More
importantly, these constructs did not show any up-regulation in
response to phenylephrine treatment (data not shown). Therefore, in
addition to the 172 E-box, one or more elements within the H1 exon or
the first 67 bases of intron 1 appear to be required for -adrenergic
stimulation of the NCX1 gene. A series of deletions were made to
identify the region responsible for -adrenergic stimulation.
Deletion of the last 13 bases of the first exon and the first 67 bases
of intron sequence ( 94-172) also resulted in a construct with low
activity and insensitivity to PE stimulation, indicating that the
elements responsible for -adrenergic stimulation are located in this
region (Fig. 7). Analysis of the first
intron sequence revealed a single GATA element at +135. Since GATA-4
has been recently demonstrated to play an important role in the
hypertrophic responsiveness of both -MHC and angiotensin
II1a receptor promoters (36, 37), mutations were introduced
into the consensus +135 GATA element (Fig. 7). PE treatment stimulated
reporter gene expression approximately 2-fold, indicating that the +134
GATA element was not required for -adrenergic up-regulation. A
deletion from +94 to +119 had low activity and was recalcitrant to PE
stimulation, but the smaller deletion from +94 to +103 was still
responsive to PE stimulation. In order to further define this element
or elements, -adrenergic up-regulation was examined with a construct
containing seven point mutations between positions +106 and +112
(NCXM106-112). The mutation of this seven-base region was
sufficient to lower luciferase activity and, more importantly, prevent
-adrenergic stimulation. In summary, this series of deletion and
point mutation constructs have helped define a 33-bp region from +103
to +135 that includes the last two bases of the H1 exon and the first
27 bases of intron 1 (AG/GTAGGTGCAGGGCTTTTGTGATGAAAC). This region
contains one or more elements that are requisite for -adrenergic
stimulation of NCX1 expression, and at least one of these is contained
in part between +106 and +112. Sequence analysis revealed no consensus
sequence for known transcriptional elements; therefore, -adrenergic
stimulation of Na+-Ca2+ exchanger expression is
mediated via the 172 E-box and a novel element or elements present in
the first intron.

View larger version (44K):
[in this window]
[in a new window]
|
Fig. 7.
Effects of adrenergic stimulation on
the expression of NCX1 H1-luciferase deletion constructs. Deletion
mutations were created in the first exon (H1) and first
intron of the feline NCX1 cardiac 1831-bp promoter fused to the
luciferase gene in the pGL2 vector. Upper panel,
a map of the H1 exon and first intron region of the NCX1 promoter
showing the relative positions of all of the deletion mutations.
Position numbers are relative to the transcriptional start site.
Lower panel, all transfections involving the NCX1
deletion and point mutations were performed in neonatal rat
cardiomyocytes. Individual constructs were co-transfected with a
cytomegalovirus promoter-driven -galactosidase fusion vector to
normalize transfection efficiency. The relative luciferase values were
then normalized to the wild-type NCX1831 construct and reported as a
percentage of the wild-type value. Averages shown are for at least
three independent transfection experiments preformed in triplicate.
Cells were treated with 100 µM phenylephrine
(PE) 24 h after transfection. Control cells were
treated with 10 µM verapamil 24 h after transfection
to inhibit any spontaneous contractile activity.
|
|
In order to further characterize this region and determine whether
elements in this region bind nuclear factors,
electrophoretic mobility shift assays
were performed using neonatal heart nuclear extracts with a
double-stranded oligonucleotide probe corresponding to +89 through +128
containing the NCX1 cardiac novel element region (Fig. 8). Four
protein-DNA complexes were observed binding to the cardiac novel
element region probe. Competition experiments using a 100-fold molar
excess of the unlabeled competitor DNA sequences were used to determine
specificity of the complexes. Incubation with cold cardiac novel
element region probe competed away all but the band 4 protein-DNA
complex. Competition with the mutant cardiac novel element region
oligonucleotide, NCXM109-112, containing the four point
mutations between positions +106 and +112 did not affect B1, B2, or B3
protein-DNA complexes, but the B4 complex was slightly diminished.
Competition with the shorter (19-mer) oligonucleotide containing only
+103-117 wild type sequence, eliminated the B1, B2, and B3 complexes
but had less of an affect on B4. Therefore, the B1, B2, and B3
protein-DNA complexes appear to be specific for the 103-117 region. In
addition, the 4-base point mutation further defines the element by
demonstrating that a portion of it lies between positions +109 and
+112.

View larger version (56K):
[in this window]
[in a new window]
|
Fig. 8.
Gel mobility shift assay for the novel
element region. Neonatal rat heart extract (20 µg) was probed
with 32P-labeled double-stranded oligonucleotides
containing sequence of the suspected novel element region. The wild
type 44-mer probe spans the region from +89 in the first exon to +128
in the first intron. A 100-fold molar excess of unlabeled probe was
used as a specific competitor to the labeled probe. Extracts were also
probed using a molar excess of mutated 44-mer probe, which is identical
to the wild type 44-mer probe except that bases +109 to +112 were
mutated from AGGT to GAAC (see Table I). A wild type 19-mer probe
containing NCX1 sequence form +103 to +117 was used to show specific
interaction.
|
|
 |
DISCUSSION |
We have used promoter-reporter gene constructs to identify the
elements regulating cardiac expression and mediating -adrenergic up-regulation of the NCX1 gene. Here, we demonstrate that NCX1 expression in neonatal rat ventricular myocytes requires at least two
DNA sequence elements, CArG and GATA. The CArG element (CCATGTATGG) present at 80 bp diverges from the canonical CArG sequence
CC(AT)6GG but, nevertheless, is required for cardiac
expression of the NCX1 gene. In addition, we have demonstrated that the
SRF is a part of the complex binding to the NCX1 CArG element,
suggesting that SRF is required for basal NCX1 expression. CArG boxes
are present in the proximal promoters of many muscle genes and have
been shown to be involved in skeletal as well as cardiac
muscle-specific regulation (38-40).
Although the NCX1 CArG element is required for basal activity, it does
not appear to mediate -adrenergic stimulated expression. This is
similar to what has been identified in the human cardiac -actin
promoter and mouse skeletal -actin promoter (41). Only recently has
it been determined how the ubiquitous SRF factor, which mediates
transcriptional activation of serum-responsive genes, could regulate
muscle-specific genes. Interactions between SRF and other nuclear
factors appear to provide mechanisms by which SRF could provide
tissue-specific transcriptional activity. SAP-1, Elk-1, and Phox-1 have
been demonstrated to potentiate the transcriptional activity of SRF on
the c-fos promoter (42). Chen and Schwartz (43) have shown
that the cardiogenic homeodomain factor, Nkx-2.5, interacts with SRF to
synergistically trans-activate the cardiac -actin
promoter. This trans-activation is dependent on an intact
serum response element and not on the Nkx-2.5 element. Interaction of
SRF with Nkx-2.5 may also be important in the cardiac regulation of the
NCX1 promoter. However, we showed earlier that the 10 Nkx-2.5 element
does not appear to be required for NCX1 expression in neonatal rat
cardiomyocyte (Fig. 2), and this element is not preserved in the rat
NCX1 promoter (14). This interaction, if present in the NCX1 promoter,
must be mediated via the CArG and not the Nkx-2.5 element, similar to
what was found for the cardiac -actin gene. Importantly, Nkx-2.5 and
SRF have recently been shown to regulate the cardiac -actin promoter
through combinatorial interactions with GATA-4 (44). Although these
studies have not focused on transcription factor interactions, our
experiments here demonstrate that, in addition to SRF, cardiac
expression of NCX1 is also regulated by a GATA-4 factor. We are
currently exploring the interactions of Nkx-2.5, SRF, and the GATA-4
factors in the co-activation of the NCX1 promoter.
GATA elements have an important role in the transcriptional regulation
of several cardiac specific genes including -myosin heavy chain
(25), cardiac troponin C (45), myosin light chain 1/3 (46), and the
-type natriuretic peptide (24). Although GATA elements do not play a
role in the basal cardiac expression of the -myosin heavy chain or
angiotensin II type 1a receptor, a GATA binding site is requisite for
the induction of these genes in in vivo hemodynamic pressure
overload (36, 37). GATA-4 plays a critical role in the cardiac
expression of NCX1 but is not required for -adrenergic
up-regulation. With the exception of the 172 E-box, none of the
consensus sequences in the +184 minimal promoter appeared to mediate
the -adrenergic stimulation. A series of deletion constructs
indicated that a 32-bp region spanning the first exon-intron boundary
(+103 to +134) contains one or more additional elements requisite for
-adrenergic stimulated up-regulation. Interestingly, this region
contains no consensus binding motifs for known transcription factors.
Comparison of the rat (14), human (13), and feline (11) gene sequence in this region revealed 100% homology between bases +104 to +114 and
that 17 out of the 21 bases in the region from +94 to +114 are
identical. Although the findings of this work by no means exclude the
existence of other -adrenergic responsive elements elsewhere in the
NCX1 gene, they demonstrate clearly that the 172 E-Box and the region
between +103 to +134 are both requisite for -adrenergic stimulation
in the context of the NCX1831 promoter-luciferase construct.
-adrenergic stimulation has been demonstrated to activate signaling pathways that result in cardiac hypertrophy. Although this
study demonstrates that this region mediates -adrenergic stimulation, it remains to be seen whether it also mediates
up-regulation in response to hemodynamic load. It is important to note
that these studies were carried out in neonatal cardiocytes. In
vitro transfection of neonatal cardiocytes is an extremely
valuable system to identify and begin to elucidate the role of specific cis-elements that mediate changes in expression. But the
significance of the elements identified here and whether they mediate
basal cardiac expression and/or hypertrophic induced up-regulation
needs to be confirmed in adult cardiomyocytes in vivo.
Transgenic lines with the NCX1 promoter should permit us to examine the
relative importance and role of CArG, GATA, the E-box, and the novel
element in mediating the expression of NCX1 during development and in the normal and hypertrophic heart.
 |
ACKNOWLEDGEMENTS |
We are grateful to Kristie Blade and Dr.
Joachim Müller for fruitful and stimulating discussions and for
reviewing the manuscript. We thank Linda Paddock for secretarial assistance.
 |
FOOTNOTES |
*
This work was supported in part by National Institutes of
Health Program Project Grant HL48788 (Project 3, to D. R. M.).The costs of publication of this
article were defrayed in part by the
payment of page charges. The article
must therefore be hereby marked
"advertisement" in
accordance with 18 U.S.C. Section
1734 solely to indicate this fact.
To whom correspondence should be addressed: Cardiology Division,
Medical University of South Carolina, 171 Ashley Ave., Charleston, SC
29425-2221. Tel.: 843-792-3405; Fax: 843-792-7771.
 |
ABBREVIATIONS |
The abbreviations used are:
NCX, sodium calcium
exchanger;
MEM, Eagle's minimum essential medium;
SRF, serum response
factor;
bp, base pair(s);
USF, upstream stimulatory factor.
 |
REFERENCES |
-
Kimura, J.,
Noma, A.,
and Irisawa, H.
(1986)
Nature
319,
596-597[CrossRef][Medline]
[Order article via Infotrieve]
-
Hilgemann, D. W.
(1990)
Nature
344,
242-245[CrossRef][Medline]
[Order article via Infotrieve]
-
Hilgemann, D. W.,
Matsuoka, S.,
Nagel, G. A.,
and Collins, A.
(1992)
J. Gen. Physiol.
100,
905-932[Abstract/Free Full Text]
-
Condrescu, M.,
Gardner, J. P.,
Chernaya, G.,
Aceto, J. F.,
Kroupis, C.,
and Reeves, J. P.
(1995)
J. Biol. Chem.
270,
9137-9146[Abstract/Free Full Text]
-
Levitsky, D. O.,
Nicoll, D. A.,
and Philipson, K. D.
(1994)
J. Biol. Chem.
269,
22847-22852[Abstract/Free Full Text]
-
Li, Z.,
Nicoll, D. A.,
Collins, A.,
Hilgemann, D. W.,
Filoteo, A. G.,
Penniston, J. T.,
Weiss, J. N.,
Tomich, J. M.,
and Philipson, K. D.
(1991)
J. Biol. Chem.
266,
1014-1020[Abstract/Free Full Text]
-
Iwamoto, T.,
Pan, Y.,
Wakabayashi, S.,
Imagawa, T.,
Yamanaka, H. I.,
and Shigekawa, M.
(1996)
J. Biol. Chem.
271,
13609-13615[Abstract/Free Full Text]
-
Kent, R. L.,
Rozich, J. D.,
McCollam, P. L.,
McDermott, D. E.,
Thacker, U. F.,
Menick, D. R.,
McDermott, P. J.,
and Cooper, G.
(1993)
Am. J. Physiol.
265,
H1024-H1029[Abstract/Free Full Text]
-
Menick, D. R.,
Barnes, K. V.,
Thacker, U. F.,
Dawson, M. M.,
McDermott, D. E.,
Rozich, J. D.,
Kent, R. L.,
and Cooper, G. T.
(1996)
Ann. N. Y. Acad. Sci.
779,
489-501[Medline]
[Order article via Infotrieve]
-
Studer, R.,
Reinecke, H.,
Bilger, J.,
Eschenhagen, T.,
Bohm, M.,
Hasenfuss, G.,
Just, H.,
Holtz, J.,
and Drexler, H.
(1994)
Circ. Res.
75,
443-453[Abstract/Free Full Text]
-
Barnes, K. V.,
Cheng, G.,
Dawson, M. M.,
and Menick, D. R.
(1997)
J. Biol. Chem.
272,
11510-11517[Abstract/Free Full Text]
-
Kraev, A.,
Chumakov, I.,
and Carafoli, E.
(1996)
Genomics
37,
105-112[CrossRef][Medline]
[Order article via Infotrieve]
-
Scheller, T.,
Kraev, A.,
Skinner, S.,
and Carafoli, E.
(1998)
J. Biol. Chem.
273,
7643-7649[Abstract/Free Full Text]
-
Nicholas, S. B.,
Yang, W.,
Lee, S. L.,
Zhu, H.,
Philipson, K. D.,
and Lytton, J.
(1998)
Am. J. Physiol.
274,
H217-H232[Abstract/Free Full Text]
-
Lee, S. L., Yu, A. S.,
and Lytton, J.
(1994)
J. Biol. Chem.
269,
14849-14852[Abstract/Free Full Text]
-
Kofuji, P.,
Lederer, W. J.,
and Schulze, D. H.
(1993)
Am. J. Physiol.
265,
F598-F603[Abstract/Free Full Text]
-
Quednau, B. D.,
Nicoll, D. A.,
and Philipson, K. D.
(1997)
Am. J. Physiol.
272,
C1250-C1261[Abstract/Free Full Text]
-
Cheng, G.,
Hagen, T. P.,
Dawson, M. L.,
and Menick, D. R.
(1998)
Circulation
98,
I609
-
Navankasattusas, S.,
Sawadogo, M.,
van Bilsen, M.,
Dang, C. V.,
and Chien, K. R.
(1994)
Mol. Cell. Biol.
14,
7331-7339[Abstract/Free Full Text]
-
French, B. A.,
Chow, K. L.,
Olson, E. N.,
and Schwartz, R. J.
(1991)
Mol. Cell. Biol.
11,
2439-2450[Abstract/Free Full Text]
-
Molkentin, J. D.,
Brogan, R. S.,
Jobe, S. M.,
and Markham, B. E.
(1993)
J. Biol. Chem.
268,
2602-2609[Abstract/Free Full Text]
-
Rindt, H.,
Gulick, J.,
Knotts, S.,
Neumann, J.,
and Robbins, J.
(1993)
J. Biol. Chem.
268,
5332-5338[Abstract/Free Full Text]
-
Kurabayashi, M.,
Komuro, I.,
Shibasaki, Y.,
Tsuchimochi, H.,
Takaku, F.,
and Yazaki, Y.
(1990)
J. Biol. Chem.
265,
19271-19278[Abstract/Free Full Text]
-
Grepin, C.,
Dagnino, L.,
Robitaille, L.,
Haberstroh, L.,
Antakly, T.,
and Nemer, M.
(1994)
Mol. Cell. Biol.
14,
3115-3129[Abstract/Free Full Text]
-
Molkentin, J. D.,
Kalvakolanu, D. V.,
and Markham, B. E.
(1994)
Mol. Cell. Biol.
14,
4947-4957[Abstract/Free Full Text]
-
Muscat, G. E.,
Gustafson, T. A.,
and Kedes, L.
(1988)
Mol. Cell. Biol.
8,
4120-4133[Abstract/Free Full Text]
-
Mably, J. D.,
Sole, M. J.,
and Liew, C. C.
(1993)
J. Biol. Chem.
268,
476-482[Abstract/Free Full Text]
-
Papadopoulos, N.,
and Crow, M. T.
(1993)
Mol. Cell. Biol.
13,
6907-6918[Abstract/Free Full Text]
-
Mably, J. D.,
and Liew, C. C.
(1996)
Circ. Res.
79,
4-13[Abstract/Free Full Text]
-
Foster, K. A.,
McDermott, P. J.,
and Robishaw, J. D.
(1990)
Am. J. Physiol.
259,
H432-H441[Abstract/Free Full Text]
-
Knowlton, K. U.,
Baracchini, E.,
Ross, R. S.,
Harris, A. N.,
Henderson, S. A.,
Evans, S. M.,
Glembotski, C. C.,
and Chien, K. R.
(1991)
J. Biol. Chem.
266,
7759-7768[Abstract/Free Full Text]
-
Chen, C.,
and Okayama, H.
(1987)
Mol. Cell. Biol.
7,
2745-2752[Abstract/Free Full Text]
-
Roy, R. J.,
Gosselin, P.,
and Guerin, S. L.
(1991)
BioTechniques
11,
770-777[Medline]
[Order article via Infotrieve]
-
Ojamaa, K.,
Samarel, A. M.,
and Klein, I.
(1995)
J. Biol. Chem.
270,
31276-31281[Abstract/Free Full Text]
-
Chen, C. Y.,
Croissant, J.,
Majesky, M.,
Topouzis, S.,
McQuinn, T.,
Frankovsky, M. J.,
and Schwartz, R. J.
(1996)
Dev. Genet.
19,
119-130[CrossRef][Medline]
[Order article via Infotrieve]
-
Herzig, T. C.,
Jobe, S. M.,
Aoki, H.,
Molkentin, J. D.,
Cowley, A. W., Jr.,
Izumo, S.,
and Markham, B. E.
(1997)
Proc. Natl. Acad. Sci. U. S. A.
94,
7543-7548[Abstract/Free Full Text]
-
Hasegawa, K.,
Lee, S. J.,
Jobe, S. M.,
Markham, B. E.,
and Kitsis, R. N.
(1997)
Circulation
96,
3943-3953[Abstract/Free Full Text]
-
Miwa, T.,
and Kedes, L.
(1987)
Mol. Cell. Biol.
7,
2803-2813[Abstract/Free Full Text]
-
Amacher, S. L.,
Buskin, J. N.,
and Hauschka, S. D.
(1993)
Mol. Cell. Biol.
13,
2753-2764[Abstract/Free Full Text]
-
Catala, F.,
Wanner, R.,
Barton, P.,
Cohen, A.,
Wright, W.,
and Buckingham, M.
(1995)
Mol. Cell. Biol.
15,
4585-4596[Abstract]
-
Sartorelli, V.,
Webster, K. A.,
and Kedes, L.
(1990)
Genes Dev.
4,
1811-1822[Abstract/Free Full Text]
-
Grueneberg, D. A.,
Simon, K. J.,
Brennan, K.,
and Gilman, M.
(1995)
Mol. Cell. Biol.
15,
3318-3326[Abstract]
-
Chen, C. Y.,
and Schwartz, R. J.
(1996)
Mol. Cell. Biol.
16,
6372-6384[Abstract]
-
Sepulveda, J. L.,
Belaguli, N.,
Nigam, V.,
Chen, C. Y.,
Nemer, M.,
and Schwartz, R. J.
(1998)
Mol. Cell. Biol.
18,
3405-3415[Abstract/Free Full Text]
-
Ip, H. S.,
Wilson, D. B.,
Heikinheimo, M.,
Tang, Z.,
Ting, C. N.,
Simon, M. C.,
Leiden, J. M.,
and Parmacek, M. S.
(1994)
Mol. Cell. Biol.
14,
7517-7526[Abstract/Free Full Text]
-
McGrew, M. J.,
Bogdanova, N.,
Hasegawa, K.,
Hughes, S. H.,
Kitsis, R. N.,
and Rosenthal, N.
(1996)
Mol. Cell. Biol.
16,
4524-4534[Abstract]
Copyright © 1999 by The American Society for Biochemistry and Molecular Biology, Inc.

CiteULike Complore Connotea Del.icio.us Digg Reddit Technorati What's this?
This article has been cited by other articles:

|
 |

|
 |
 
L. Xu, L. Renaud, J. G. Muller, C. F. Baicu, D. D. Bonnema, H. Zhou, C. S. Kappler, S. W. Kubalak, M. R. Zile, S. J. Conway, et al.
Regulation of Ncx1 Expression: IDENTIFICATION OF REGULATORY ELEMENTS MEDIATING CARDIAC-SPECIFIC EXPRESSION AND UP-REGULATION
J. Biol. Chem.,
November 10, 2006;
281(45):
34430 - 34440.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
H.-F. Cheng, M.-Z. Zhang, and R. C. Harris
Nitric oxide stimulates cyclooxygenase-2 in cultured cTAL cells through a p38-dependent pathway
Am J Physiol Renal Physiol,
June 1, 2006;
290(6):
F1391 - F1397.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. P. Konhilas and L. A. Leinwand
Partnering Up for Cardiac Hypertrophy
Circ. Res.,
April 28, 2006;
98(8):
985 - 987.
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
R. O. Balza Jr. and R. P. Misra
Role of the Serum Response Factor in Regulating Contractile Apparatus Gene Expression and Sarcomeric Integrity in Cardiomyocytes
J. Biol. Chem.,
March 10, 2006;
281(10):
6498 - 6510.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
E. M. Small, A. S. Warkman, D.-Z. Wang, L. B. Sutherland, E. N. Olson, and P. A. Krieg
Myocardin is sufficient and necessary for cardiac gene expression in Xenopus
Development,
March 1, 2005;
132(5):
987 - 997.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
B. N. Eigel, H. Gursahani, and R. W. Hadley
Na+/Ca2+ exchanger plays a key role in inducing apoptosis after hypoxia in cultured guinea pig ventricular myocytes
Am J Physiol Heart Circ Physiol,
October 1, 2004;
287(4):
H1466 - H1475.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. Pikkarainen, H. Tokola, R. Kerkela, and H. Ruskoaho
GATA transcription factors in the developing and adult heart
Cardiovasc Res,
August 1, 2004;
63(2):
196 - 207.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
D. H. Schulze, M. Muqhal, W. J. Lederer, and A. M. Ruknudin
Sodium/Calcium Exchanger (NCX1) Macromolecular Complex
J. Biol. Chem.,
August 1, 2003;
278(31):
28849 - 28855.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
H. Akazawa and I. Komuro
Roles of Cardiac Transcription Factors in Cardiac Hypertrophy
Circ. Res.,
May 30, 2003;
92(10):
1079 - 1088.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
F. J. Davis, M. Gupta, B. Camoretti-Mercado, R. J. Schwartz, and M. P. Gupta
Calcium/Calmodulin-dependent Protein Kinase Activates Serum Response Factor Transcription Activity by Its Dissociation from Histone Deacetylase, HDAC4: IMPLICATIONS IN CARDIAC MUSCLE GENE REGULATION DURING HYPERTROPHY
J. Biol. Chem.,
May 23, 2003;
278(22):
20047 - 20058.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. L. Moore, E. A. Park, and J. B. McMillin
Upstream Stimulatory Factor Represses the Induction of Carnitine Palmitoyltransferase-Ibeta Expression by PGC-1
J. Biol. Chem.,
May 2, 2003;
278(19):
17263 - 17268.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
C. Gillio-Meina, Y. Y. Hui, and H. A. LaVoie
GATA-4 and GATA-6 Transcription Factors: Expression, Immunohistochemical Localization, and Possible Function in the Porcine Ovary
Biol Reprod,
February 1, 2003;
68(2):
412 - 422.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
H.-F. Cheng and R. C. Harris
Cyclooxygenase-2 Expression in Cultured Cortical Thick Ascending Limb of Henle Increases in Response to Decreased Extracellular Ionic Content by Both Transcriptional and Post-transcriptional Mechanisms. ROLE OF p38-MEDIATED PATHWAYS
J. Biol. Chem.,
November 15, 2002;
277(47):
45638 - 45643.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
Y.-S. Dai, P. Cserjesi, B. E. Markham, and J. D. Molkentin
The Transcription Factors GATA4 and dHAND Physically Interact to Synergistically Activate Cardiac Gene Expression through a p300-dependent Mechanism
J. Biol. Chem.,
June 28, 2002;
277(27):
24390 - 24398.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. E. Hardt and J. Sadoshima
Glycogen Synthase Kinase-3{beta}: A Novel Regulator of Cardiac Hypertrophy and Development
Circ. Res.,
May 31, 2002;
90(10):
1055 - 1063.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. G. Muller, Y. Isomatsu, S. V. Koushik, M. O'Quinn, L. Xu, C. S. Kappler, E. Hapke, M. R. Zile, S. J. Conway, and D. R. Menick
Cardiac-Specific Expression and Hypertrophic Upregulation of the Feline Na+-Ca2+ Exchanger Gene H1-Promoter in a Transgenic Mouse Model
Circ. Res.,
February 8, 2002;
90(2):
158 - 164.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. Shigekawa and T. Iwamoto
Cardiac Na+-Ca2+ Exchange : Molecular and Pharmacological Aspects
Circ. Res.,
May 11, 2001;
88(9):
864 - 876.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
C. Morisco, K. Seta, S. E. Hardt, Y. Lee, S. F. Vatner, and J. Sadoshima
Glycogen Synthase Kinase 3beta Regulates GATA4 in Cardiac Myocytes
J. Biol. Chem.,
July 20, 2001;
276(30):
28586 - 28597.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
G. S. Huggins, C. J. Bacani, J. Boltax, R. Aikawa, and J. M. Leiden
Friend of GATA 2 Physically Interacts with Chicken Ovalbumin Upstream Promoter-TF2 (COUP-TF2) and COUP-TF3 and Represses COUP-TF2-dependent Activation of the Atrial Natriuretic Factor Promoter
J. Biol. Chem.,
July 20, 2001;
276(30):
28029 - 28036.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. D. Molkentin
The Zinc Finger-containing Transcription Factors GATA-4, -5, and -6. UBIQUITOUSLY EXPRESSED REGULATORS OF TISSUE-SPECIFIC GENE EXPRESSION
J. Biol. Chem.,
December 8, 2000;
275(50):
38949 - 38952.
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. G. Muller, Y. Isomatsu, S. V. Koushik, M. O'Quinn, L. Xu, C. S. Kappler, E. Hapke, M. R. Zile, S. J. Conway, and D. R. Menick
Cardiac-Specific Expression and Hypertrophic Upregulation of the Feline Na+-Ca2+ Exchanger Gene H1-Promoter in a Transgenic Mouse Model
Circ. Res.,
February 8, 2002;
90(2):
158 - 164.
[Abstract]
[Full Text]
[PDF]
|
 |
|
Copyright © 1999 by the American Society for Biochemistry and Molecular Biology.
|
Advertisement
Advertisement
|