J Biol Chem, Vol. 274, Issue 19, 13242-13249, May 7, 1999
Mono- and Binuclear Zn2+-
-Lactamase
ROLE OF THE CONSERVED CYSTEINE IN THE CATALYTIC MECHANISM*
Raquel
Paul-Soto
§,
Rogert
Bauer¶,
Jean-Marie
Frère§,
Moreno
Galleni§,
Wolfram
Meyer-Klaucke
,
Hans
Nolting
,
Gian Maria
Rossolini**,
Dominique
de Seny§,
Maria
Hernandez-Valladares
,
Michael
Zeppezauer
, and
Hans-Werner
Adolph

From
Fachrichtung 12.4 Biochemie, Universitaet des
Saarlandes, D-66041 Saarbruecken, Germany, § Centre
d'Ingéniérie des Protéines, Institut de Chimie B6,
Université de Liège, Sart-Tilman,
B-4000 Liège, Belgium,
EMBL-Outstation Hamburg at
DESY, Notkestrasse 85, D-22603 Hamburg, Germany, ¶ Department
of Physics, The Royal Veterinary and Agricultural University,
Dk-1871 Frederiksberg C, Denmark, and the ** Dipartimento di Biologia
Moleculare, Sezione di Microbiologia, Universita di Siena,
Siena 53100, Italy
 |
ABSTRACT |
When expressed by pathogenic bacteria,
Zn2+-
-lactamases induce resistance to most
-lactam antibiotics. A possible strategy to fight these bacteria
would be a combined therapy with non-toxic inhibitors of
Zn2+-
-lactamases together with standard antibiotics. For
this purpose, it is important to verify that the inhibitor is effective
under all clinical conditions. We have investigated the correlation between the number of zinc ions bound to the
Zn2+-
-lactamase from Bacillus cereus and
hydrolysis of benzylpenicillin and nitrocefin for the wild type and a
mutant where cysteine 168 is replaced by alanine. It is shown that both
the mono-Zn2+ (mononuclear) and di-Zn2+
(binuclear) Zn2+-
-lactamases are catalytically active
but with different kinetic properties. The
mono-Zn2+-
-lactamase requires the conserved cysteine
residue for hydrolysis of the
-lactam ring in contrast to the
binuclear enzyme where the cysteine residue is not essential. Substrate
affinity is not significantly affected by the mutation for the
mononuclear enzyme but is decreased for the binuclear enzyme. These
results were derived from kinetic studies on two wild types and the
mutant enzyme with benzylpenicillin and nitrocefin as substrates. Thus, targeting drug design to modify this residue might represent an efficient strategy, the more so if it also interferes with the formation of the binuclear enzyme.
 |
INTRODUCTION |
Zn2+-
-lactamases catalyze the hydrolysis of
-lactam antibiotics by cleaving their
-lactam rings. The
production of Zn2+-
-lactamases most often renders
bacteria resistant to almost all
-lactam drugs so far designed,
including carbapenems. Some of these organisms like Bacteroides
fragilis, Serratia marcescens, Stenotrophomonas maltophilia,
Pseudomonas aeruginosa and Aeromonas hydrophilia are
human pathogens (1), and the search for useful inhibitors for clinical
purposes has become of major importance.
The structures of Zn2+-
-lactamases from Bacillus
cereus strain 569/H/9 and B. fragilis have been solved
by x-ray crystallography (2-4). Both enzymes contain two metal-binding
sites. The zinc ligands are His-86, His-88, and His-149 at the first
site (the "three His" site) and those of His-210, Asp-90, and
Cys-168 at the second, Cys, site. These residues are highly conserved
in almost all the enzymes of the family for which sequence data are available. The first crystal structure of the B. cereus
enzyme, solved at pH 5.6 and 293 K, showed one zinc ion in the first
site (2) but that of the B. fragilis enzyme highlighted an
oxygen-bridged two-zinc center (3), a result in agreement with the
observation that the latter enzyme binds two zinc ions with
dissociation constants below 10 µM and reaches its
maximum activity when two zinc ions are bound (5). Earlier studies of
the B. cereus enzyme suggested a much weaker binding of a
second equivalent of zinc with marginal effects on the activity (6-7),
but further crystallographic studies, performed at 100 K revealed a
fully occupied second site (4). The crystallographic data which
indicate that Cys-168 is not involved in Zn2+ coordination
at the high affinity site are apparently in contradiction with
spectroscopic studies on the B. cereus Co2+ and
Cd2+ derivatives that suggest sulfur ligation at the first
site (8).
Despite the different pH conditions used in the crystallographic and
biochemical studies, the B. cereus and B. fragilis enzymes have been hypothesized to be mono- and binuclear
Zn2+ enzymes, respectively.
The present report investigates this problem for the B. cereus Zn2+-
-lactamase and analyzes the catalytic
mechanisms of the mono- and binuclear Zn2+ enzymes. The
results indicate that the conserved Cys-168 is essential for the
activity of the mono-Zn2+ species but not for the binuclear
enzyme. We further present EXAFS1 data that reconcile
the crystallographic and spectroscopic results concerning
Zn2+ ligation.
 |
EXPERIMENTAL PROCEDURES |
Site-directed Mutagenesis--
The C168A mutant of the B. cereus 569/H/9 Zn2+-
-lactamase was constructed by
PCR. Two partially overlapping fragments were amplified using
the following primers: 5'GCGTCCTCGAGAAAGGGTTGATGACATGAA3'(
) plus
5'GATTTCACTAAAGAGCCTCCAACTAA3'; and 5'AGTTGGAGGCTCTTTAGTGAAATC3' plus
5'GCGGCTCTAGACGTAATCAACAGATTCAGCAT3' (
). The PCR fragments were
gel-purified and combined by overlap PCR in a total volume of 100 µl
using 10 ng of each fragment, 100 ng of each oligonucleotide
and
, 2 units of Goldstar polymerase, 1.5 mM
MgCl2, 200 µM dNTPs, 50 pmol of primer, and 1 ng of pRTWH012. The corresponding amplimer was digested with
PstI and ClaI restriction enzymes. The
0.24-kilobase pair fragment was introduced in pET-BcII
plasmid2 to yield
pET-BcIICA. Finally, the gene coding for the mature form of
the Zn2+-
-lactamase wild-type and C168A mutant were
introduced by PCR into the pTrxFus plasmid after the
gene coding for thioredoxin. Two unique restriction sites
(KpnI and BamHI) were introduced before the
gene segment coding for the mature form of the
-lactamase and after
the STOP codon, respectively. The primers were
5'CACAATTTCTTCTGTACAGGTACCACAAAAGGTAGAGAAAAC3' and
5'CCCGGGATCCTTAAATATAGTTAGAAGAAAGAGAGGAGAA3'. 25 ng
of pRTWHO12 (for the wild-type) and pETBcIICA
(for the C168A mutant) were used as templates. Reaction conditions were
4 min at 95 °C, 30 times (30 s at 95 °C, 1 min at 55 °C, and 1 min at 72 °C). The KpnI-BamHI PCR fragment was
cloned into pTrxfus in order to create pCIP32
(wild-type) and pCIP33 (C168A mutant). The gene was then completely sequenced with the help of an automated laser fluorescent DNA sequencer (Amersham Pharmacia Biotech) to verify that no unwanted mutation had been introduced during the mutagenesis process.
Purification of the Enzymes--
The wild-type and C168A mutant
from B. cereus, strain 569/H/9, was produced by introduction
of pCIP32 and pCIP33, respectively, in
Escherichia coli GI724. The bacteria were grown at 30 °C
in 1 liter of induction medium (Invitrogen, San Diego) containing 100 µg/ml ampicillin as selection agent. At an
A550 of 0.5, tryptophan (100 µg/ml final
concentration) was added, and the culture was further grown for 120 min. The bacteria were harvested after centrifugation of the culture at
5,000 × g during 15 min. The pellet was resuspended in
100 ml of 10 mM sodium cacodylate buffer, pH 6.5. The cells were broken with the help of a cell disintegrator (Series Z, Constant System, Warwick, UK). After centrifugation at 20,000 × g during 30 min, the supernatant was collected and loaded on
a SP Sepharose column (2.5 × 30 cm, Amersham Pharmacia Biotech,
Uppsala, Sweden) pre-equilibrated in 10 mM sodium
cacodylate, pH 6.5. The hybrid protein was eluted at a rate of 5 ml/min
by a linear salt gradient (0-0.6 M NaCl) in 10 mM sodium cacodylate, pH 6.5. The active fractions were
concentrated to 5 ml by ultrafiltration and were dialyzed overnight
against 50 mM Tris-HCl, pH 8.0, 1 mM
CaCl2, 0.1% Tween 20. Enterokinase (0.1 unit/20 µg of
hybrid protein) was added, and the reaction mixture was incubated at
37 °C for 16 h. The solution was loaded on a MonoS column
pre-equilibrated in 10 mM sodium cacodylate, pH 6.5. The
-lactamase was eluted by a linear salt gradient (0-0.5
M) in 10 mM sodium cacodylate, pH 6.5. The
active fractions were concentrated to 1 mg/ml as determined by the
absorption at 280 nm. The mutant protein was characterized as follows.
1) The mass spectrum, obtained by electrospray mass spectrometry, gave
a molar mass of 25,040 ± 10 g/mol (the theoretical value is
25,037 g/mol). 2) The N-terminal sequence (6 residues) was identical to
that of the WT enzyme. 3) The CD spectra, both in the far and near UV,
were superimposable on those of the WT enzyme. 4) The melting
temperature, determined according to the modification of the
fluorescence spectrum, was identical to that of the WT enzyme (67 ± 0.1 °C) as was the guanidinium chloride concentration resulting
in 50% denaturation.
The Zn2+-
-lactamase from B. cereus 5/B/6 was
produced in E. coli MZ1 carrying the PR2/bla
plasmid as described by Shaw et al. (9).
Metal Content Analysis and Preparation of Apoenzymes--
To
determine the Zn2+ content under various conditions,
0.35-0.5-ml samples of the different enzymes at a concentration of
either 30 or 50 µM were dialyzed against 100 ml of the
specified buffers containing different concentrations of
Zn2+ at 4 °C. The protein concentrations were determined
after dialysis by measuring the absorbance at 281 nm for the various
B. cereus enzymes using the following extinction
coefficients determined by five different methods including the
determination of total amino acid content: 32,700 M
1 cm
1 for B. cereus
5/B/6; 30,500 M
1 cm
1 for the WT
B. cereus 569/H/9; and 31,000 M
1
cm
1 for the B. cereus 569/H/9 C168A mutant.
The values are accurate to 5% and were used in all protein
concentration determinations. Zinc concentrations in samples and in the
final dialysis buffers were measured with a Perkin-Elmer 2100 AAS
spectrometer in the flame mode or by inductively coupled plasma mass
spectroscopy as described by Hernandez Valladares et al.
(10).
To produce "metal-free" buffers, buffer solutions were purified by
extensive stirring with 0.2-0.5% (v/v) of iminodiacetic acid-agarose
(Affiland, Liège, Belgium). The residual Zn2+ content
of the buffers after treatment was approximately 20 nM (10). Standard precautions were taken when the experiments required metal-free conditions (11). Apoenzymes from strain 5/B/6, 569/H/9 WT,
and from the C168A mutant were prepared by dialysis of the corresponding enzymes against 2 changes of 20 mM sodium
cacodylate buffer, pH 6.5, containing 1 M NaCl and 20 mM EDTA over 24 h under stirring. EDTA was removed
from the resulting apoenzyme solution by 5-7 dialysis steps against
the same buffer without metals. In all preparations the remaining zinc
content did not exceed 5% as judged by AAS.
Equilibrium Dialysis with 65Zn--
65Zn
in 0.1 M HCl (15 mCi/µmol) was from Amersham Pharmacia
Biotech. Radioactive 65Zn was measured with a Canberra
detector model GC1018 connected to a PC via an amplifier and a Canberra
ACCUSPEC MCA board.
The dissociation constant relevant for binding of the first zinc ion to
the 5/B/6 B. cereus enzyme in substoichiometric amounts was
determined by dialyzing a 20-400-fold excess of the apoenzyme against
radioactive 65Zn. Under these conditions only the
mononuclear species of the enzyme can be formed. The samples containing
the apoenzyme were placed in a 200-µl dialysis button (Hampton
Research), sealed with a membrane tubing for dialysis and placed in a
volume of 2.5 ml of 50 mM HEPES buffer, pH 7.5, in Linbro
plate reservoirs for 1-3 days at room temperature under orbital
shaking. The final concentration of the enzyme was between 0.15 and
2.75 µM (with respect to the total volume of dialysis).
The samples were dialyzed against 0.36 µCi of 65Zn, mixed
either with the apoenzyme in the button or in the 2.5-ml reservoir solution.
For studying the binding of zinc in stoichiometric amounts, the 5/B/6
apoenzyme was dialyzed at two different concentrations (6.75 and 14.1 µM) against various concentrations of isotopically diluted 65Zn.
Equilibrium Model for Zinc Binding--
When two sites can bind
metals, the following four microscopic equilibria describe metal
binding as shown in Equations 1 and 2.
|
(Eq. 1)
|
|
(Eq. 2)
|
where M denotes zinc ions, E the enzyme,
EM the enzyme with zinc bound in the three His site,
ME the enzyme with zinc bound in the Cys site, and
MEM the enzyme with zinc ions bound to both sites. In
equilibrium dialysis one cannot differentiate between binding to the
two sites. Instead macroscopic equilibrium constants are derived. Under
substoichiometric (no extra zinc besides 65Zn) and
stoichiometric conditions Kmono = 1/(1/KEM, E + 1/KME, E) and
Kbi = KMEM, EM + KMEM, ME can be determined, respectively. Note that
KEM, E KMEM, EM =
KME, E KMEM, ME. For a given set of
equilibrium constants, the five different equilibrium concentrations
[E], [M], [ME], [EM], and [MEM] can be derived by solving the
above equations numerically. From these concentrations one can form the
ratio of protein-bound Zn2+ to total Zn2+
(substoichiometric conditions) or protein-bound Zn2+ to
total protein concentration (stoichiometric conditions). Such calculated ratios were compared with the experimentally determined ratios, and the dissociation constants Kmono and
Kbi were derived by standard nonlinear least
squares fitting.
Kinetic Measurements and a Model for the
Mechanism--
Nitrocefin and benzylpenicillin were from Unipath
(Oxford, UK) and Rhone Poulenc (Paris, France), respectively. The
hydrolysis of substrates was followed by monitoring the change in
absorbance with a Perkin-Elmer Lambda 2 UV/VIS spectrometer at 482 nm
for nitrocefin and 235 nm for benzylpenicillin.
Km(app) and kcat(app) values were obtained by the use of
initial rates (the complete time courses of hydrolysis were used when
the values within the uncertainties were identical to the values
obtained with initial rates (12)). The reported
kcat(app) and
Km(app) values are the means of at least
three single experiments in which the different enzymes were added to
the substrate solutions prepared in buffers containing the stated
Zn2+ concentrations. All experiments were performed at
25 °C in 25 mM HEPES, pH 7.5.
A steady state model in which kcat(app) and
Km(app) contains contributions from both
the mononuclear and binuclear Zn2+ enzyme via
kcat,1, kcat,2,
Km,1 and
Km,2 where the subscripts 1 and 2 refer
to the mono- and binuclear Zn2+ enzymes,
respectively, is presented in Equations 3 and 4.
Steady State Model for the Mono and Binuclear
Zn2+-
-Lactamase--
The kinetic data were analyzed
according to the following steady state model involving catalysis by
both the mono- and the binuclear Zn2+ enzymes as
follows.
|
(Eq. 3)
|
|
(Eq. 4)
|
where EZn2+,
EZn2+2,
EZn2+S, and
EZn2+2S are the mononuclear and
binuclear enzyme without and with bound substrate, respectively. In
addition the binding of the second Zn2+ ion to both
EZn2+ and EZn2+S is
assumed to be in rapid equilibrium as shown in Equations 5 and 6.
|
(Eq. 5)
|
|
(Eq. 6)
|
and corresponding macroscopic dissociation constants are
Kbi and K'bi,
respectively. We now use the steady state assumptions that
d[EZn2+S]/dt and
d[EZn2+S]/dt are 0. Also we refer
to the initial conditions where [S] = [S0] and
[P] = 0. On this basis, Equations 7-11 can be derived as
follows.
|
(Eq. 7)
|
|
(Eq. 8)
|
|
(Eq. 9)
|
|
(Eq. 10)
|
|
(Eq. 11)
|
where
is the steady state velocity. The
kcat and Km values for the
mono- and binuclear zinc enzyme are kcat,1 and
kcat,2 and Km,1
and Km,2, respectively. Here
Km,1 = (k
s,1 + kcat,1)/ks,1 and
Km,2 = (k
s,2 + kcat,2)/ks,2. Solving Equations 7-11 yields
/E0,
kcat(app), and
Km(app).
|
(Eq. 12)
|
where
|
(Eq. 13)
|
and
|
(Eq. 14)
|
If
ks,2/ks,1
is equal to 1 the equation for Km(app)
simplifies, and furthermore, a simple linear relation between
Km(app) and
kcat(app) can be derived by elimination of
[Zn2+] in Equations 13 and 14 for
Km(app) and
kcat(app). We thus get
|
(Eq. 15)
|
|
(Eq. 16)
|
As Equation 16, used for deriving the values for
Km,1 and
Km,2 (Table III), assumes that
ks,2/ks,1 = 1, it is important to know how critical this restriction is concerning the actual values derived. For instance by choosing the
following values (ks,1 = 0.5 µM
1 s
1;
k
s,1 = 200 s
1;
ks,2 = 0.5 µM
1 s
1;
k
s,2 = 825 s
1) for the
hydrolysis of benzylpenicillin by the mutant, one calculates the values
for Km,1 and
Km,2 given in Table III. Increasing the
ks,2 value while keeping
Km,2 [=(k
s,2 + kcat,2)/ks,2]
constant did not result in significant modifications. By contrast,
progressively decreasing the same value also keeping
Km,2 [=
(k
s,2 + kcat,2)/ks,2]
constant resulted in increasing deviations from linearity. At this
point, it should be noted that an equilibrium model where
Km,1 = k
s,1/ks,1 and Km,2 = k
s,2/ks,2
(thus implying kcat,1
<k
s,1 and
kcat,2 <k
s,2) yields an equation identical to Equation 16 without any further assumption. It is clear that increasing
ks,2 brings the steady state model
closer to the equilibrium situation, whereas a decrease of the same
constant increases the differences between the two models and can
result in significant deviations from linearity in the
Km(app) versus
kcat(app) plot. Standard nonlinear least squares
fittings were applied in fitting the kinetic data to the model.
EXAFS Spectroscopy--
The EXAFS studies were performed with
the enzyme produced by strain 5/B/6. The sample was prepared by
dialysis of the native Zn2+ enzyme against two changes of
25 mM Bis-Tris buffer, pH 6.5, containing 1 M
ammonium acetate and 10 µM Zn2+ followed by
an additional dialysis against the same buffer without Zn2+. The presence of a high ionic strength was necessary
to avoid precipitation of the highly concentrated enzyme. After
centrifugation the enzyme concentration was 710 ± 35 µM. The [Zn2+]/[E] ratio was
1.2 ± 0.1 as determined by AAS. The EXAFS data were collected at
beamline D2 at the European Molecular Biology Laboratory Outstation
Hamburg, and samples were measured as frozen solutions at 18 K in
fluorescence mode (13). The energy resolution was better than 2.5 eV.
The data were analyzed using the computer program packages EXPROG (14)
and EXCURV92 (developed by N. Binsted, S. W. Cambell, S. J. Gurman, and P. Stephenson at Daresbury Laboratory, United Kingdom).
 |
RESULTS |
Zn2+ Binding to B. cereus
Zn2+-
-Lactamase--
After equilibrium dialysis against
25 mM HEPES, pH 7.5, containing 1 M NaCl and 15 µM Zn2+, the
[Zn2+]/[E] ratios ([E] = 0.175 µM) obtained for the 5/B/6 and 569/H/9 B. cereus enzymes as determined by AAS were 2.0 ± 0.1, in both cases implying a Kbi value lower than 10 µM.
Analysis of data (Fig. 1) from
equilibrium dialysis of the 5/B/6 enzyme against 65Zn (no
extra Zn2+ added) gave the values for the equilibrium
constants Kmono shown in Table
I. Stoichiometric binding of
Zn2+ (65Zn) to the metal-free 5/B/6 B. cereus
-lactamase was also studied in equilibrium dialysis
experiments with 14.1 µM apoenzyme against 10, 20, 40, and 80 µM Zn2+ (no NaCl added) and with 6.75 µM apoenzyme (1 M NaCl) against 20, 40, and
80 µM Zn2+. For the fitting of these data,
Kmono was constrained to the value obtained
under substoichiometric conditions. The results are shown in Table I.
The dissociation constants Kmono and
Kbi do not depend on the presence of NaCl within
the experimental error and Kbi is about 10 times
larger than Kmono.

View larger version (12K):
[in this window]
[in a new window]
|
Fig. 1.
Binding of radioactive 65Zn to
apo- -lactamase from B. cereus
strain 5/B/6. From equilibrium dialysis of the 5/B/6 enzyme
against 65Zn (no extra Zn2+ added) in 50 mM HEPES, pH 7.5, without ( ) and with 1 M
NaCl ( ). The standard deviation on the experimental points are
below 10%. The curves were obtained by standard nonlinear
least squares fitting using the equilibrium model given under
"Experimental Procedures."
|
|
For comparison with the crystallization conditions used by Carfi
et al. (2), the Zn2+ content of the enzyme from
strain 5/B/6 was determined by AAS after dialyzing 0.35 ml of 50 µM apoenzyme against 100 ml of 25 mM citrate
buffer, pH 5.6, containing 1 M NaCl. The
[Zn2+]/[E] ratio was <0.1 without added
Zn2+; 0.6 and 0.8 with 13.3 and 62.5 µM
external Zn2+, respectively. As the
[Zn2+]/[E] ratio was less than 1 even at
62.5 µM Zn2+ Kbi was
ignored in analyzing the data. If a second zinc ion binds it does so
very weakly. The fitted value of Kmono is given
in Table I.
Correlation between Zinc Concentration and Hydrolysis of
Benzylpenicillin and Nitrocefin by B. cereus
Zn2+-
-Lactamases--
Table
II shows the kinetic parameters obtained
for the 5/B/6 and 569/H/9 enzymes at different Zn2+
concentrations. For the two WT enzymes the Km values do not significantly vary with the Zn2+ concentration. Note
that measurements in metal-depleted buffer (20 nM
[Zn2+] or less) with final enzyme concentrations far
below the dissociation constant Kmono results in
kcat(app) values not significantly different from zero with benzylpenicillin as substrate in contrast to the results
obtained with nitrocefin where the 5/B/6 enzyme exhibits full activity
in metal-depleted buffer, even in the presence of 10 µM
EDTA in the assay buffer. For benzylpenicillin this could simply be
explained by the release of Zn2+ (fast on the kinetic time
scale) and for nitrocefin by a strong increase in affinity for
Zn2+ upon binding of nitrocefin most likely by a decrease
of the rate constant for the release of Zn2+. Additional
evidence comes from the observation that the apoenzyme at a
concentration of 36 nM is partly reactivated in the
presence of nitrocefin prepared in metal-depleted buffer (20 nM [Zn2+] or less). For the 5/B/6 enzyme with
nitrocefin as substrate, kcat also appears to be
independent of the Zn2+ concentration (above 20 nM, Table II). Thus, binding of a second Zn2+
ion, if it occurs, has, in this case, no influence on the kinetic parameters. That only one Zn2+ ion is necessary for full
activity was confirmed by titrating the apoenzyme with increasing zinc
concentration. The result demonstrates a virtual linear dependence upon
zinc concentration up to the apoenzyme concentration of 10 µM followed by a plateau (Fig.
2 (
)). Fig. 2 also demonstrates that
the specific activity versus Zn2+ concentration
for benzylpenicillin changes essentially in the submicromolar range of
Zn2+, a result reflecting the formation of the mononuclear
enzyme. Thus, as with nitrocefin, the mononuclear enzyme is likely to be fully active. No significant difference was observed if the reaction
was started by adding the apoenzyme to the reaction mixture. The
specific activity for the hydrolysis of benzylpenicillin for the
569/H/9 WT enzyme is shown in Fig. 3.
Again as with the 5/B/6 enzyme, the major changes in specific activity
occur at submicromolar values of Zn2+ concentrations.
However, both the specific activity and the
kcat(app) values further increase above 1 µM Zn2+. Kinetic parameters fitted using the
model developed under "Experimental Procedures" also highlight a
kcat,2 value about twice as high as
kcat,1 (Table
III). For the 569/H/9 WT enzyme with 150 µM nitrocefin as substrate, similar rates with residual
and 1 µM Zn2+ were observed but increased
2-fold upon further addition of Zn2+ (Fig. 3). As the
values of Km(app) are about 20 times lower than 150 µM, the specific activity supplies a very
good approximation of kcat(app). Therefore the
specific activity shown in Fig. 3 was fitted to Equation 13 for
kcat(app) given under "Experimental Procedures." The results are given in Table III. The specific
activity of the 569/H/9 enzyme versus 150 µM
nitrocefin in citrate buffer, pH 5.6, containing 100 µM
Zn2+ is 46% that in HEPES buffer, pH 7.5, also containing
100 µM Zn2+ demonstrating that at this pH
only the mononuclear enzyme is active.
View this table:
[in this window]
[in a new window]
|
Table II
Zn2+ dependence of the kinetic parameters obtained with the B. cereus enzymes in 25 mM HEPES buffer, pH 7.5, at 25 °C
The enzyme concentrations in the assay were in the 10-50
nM range. SD values were below 10% of the mean of three
measurements.
|
|

View larger version (13K):
[in this window]
[in a new window]
|
Fig. 2.
Interaction between the 5/B/6 enzyme and zinc
ions. , activity recovery of the 5/B/6 apoenzyme upon titration
with Zn2+. The 5/B/6 apoenzyme was diluted to 10 µM in the assay buffer containing from 0 to 30 µM Zn2+. The activity of each sample was
determined by measuring initial rate of hydrolysis of 150 µM nitrocefin prepared in metal-free buffer. The final
enzyme concentration was 36 nM. , influence of
Zn2+ concentration on the specific activity of
Zn2+- -lactamase from strain 5/B/6 with 1 mM
benzylpenicillin as substrate. The final enzyme concentrations were
40-70 nM. The assay buffer was 25 mM HEPES, pH
7.5, in both cases. In both cases the standard deviation on the
experimental points are below 5%.
|
|

View larger version (16K):
[in this window]
[in a new window]
|
Fig. 3.
Interaction between the 569/H/9 enzyme and
zinc ions. , influence of Zn2+ concentration on the
hydrolysis of 150 µM nitrocefin by the 569/H/9 enzyme.
The assay buffer contained different Zn2+ concentrations.
The experimental data shown were fitted as described in the text
(line). The final enzyme concentration was 24 nM. , influence of Zn2+ concentration on the
specific activity of Zn2+- -lactamase from strain 569/H/9
with 1 mM benzylpenicillin as substrate. The final enzyme
concentrations were 40-70 nM. The assay buffer was 25 mM HEPES, pH 7.5. In both cases the standard deviation on
the experimental points are below 5%.
|
|
Correlation between Zinc Concentration and Hydrolysis for the C168A
Mutant--
After equilibrium dialysis of the C168A mutant (0.1 µM) against 25 mM HEPES, pH 7.5, containing
0.6, 5.0, and 10 µM Zn2+, the
[Zn2+]/[E] ratios determined by inductively
coupled plasma mass spectroscopy were 0.7, 1.2, and 1.6, respectively.
Thus, it is also possible to bind two zinc ions to the mutant. The
derived equilibrium constants are given in Table I.
The kinetic properties of the C168A mutant are completely different
from that of the WT enzyme. The activity in the presence of residual
Zn2+ is negligible for both substrates and both the
kcat(app) and Km(app) values for benzylpenicillin
increase with increasing Zn2+ concentration (Fig.
4). The kinetic parameters for the
mononuclear species for the C168A mutant were derived by mixing 2 µM apoenzyme with solutions containing 1.9 µM Zn2+ and different concentrations of
benzylpenicillin and nitrocefin. The results are given in Table III.
When fitting the values of kcat(app) for
benzylpenicillin (Fig. 4) to the equation for
kcat(app), kcat,1 was
fixed to 1.8 s
1 (Table III). At Zn2+
concentrations above 1 µM, the specific activity
versus nitrocefin also increased (Fig.
5), and the shape of the curve was close to that of the kcat(app) for benzylpenicillin.
In Fig. 6 the values of
Km(app) are plotted versus
kcat(app) (from Table II for the 569/H/9 enzyme
and from Fig. 4 for the mutant). Fig. 6 demonstrates a linear
dependence of Km(app) versus
kcat(app), and corresponding least squares
fitting to straight lines gave the values for
Km,1 and
Km,2 presented in Table II.

View larger version (13K):
[in this window]
[in a new window]
|
Fig. 4.
Influence of Zn2+ concentration
on the catalytic parameters.
Km(app) ( ) and
kcat(app) ( ) of the C168A mutant from strain
569/H/9 with benzylpenicillin as substrate. The enzyme concentration
varied from about 1.5 µM for the low Zn2+
concentrations to 0.15 µM for the high Zn2+
concentrations. The values for kcat(app) were
fitted as described in the text (line). The standard
deviations on the experimental points are below 10%.
|
|

View larger version (10K):
[in this window]
[in a new window]
|
Fig. 5.
Influence of Zn2+ concentration
on the hydrolysis of 100 µM
nitrocefin by the C168A mutant. The assay buffer (see legend to
Fig. 2) contained different Zn2+ concentrations. The final
enzyme concentration varied from 9-53 nM. The standard
deviations on the experimental points are below 5%.
|
|

View larger version (11K):
[in this window]
[in a new window]
|
Fig. 6.
Plot of the data in Table II and Fig.
4 as Km(app)
versus kcat(app). The
circles are for the mutant and the boxes for the
WT. The lines were from fits as described in the text.
|
|
EXAFS Spectroscopy--
The rigid structure of systems like
imidazole is well known. Therefore, in EXAFS restrained refinement is
applied to such problems (15). We first modeled the coordination sphere
of zinc with three histidine residues and a water molecule as ligands as would be expected from the crystal structure data if zinc is not
coordinated to the site with cysteine as a ligand. The interpretation of the extracted k2 weighted fine structure by
these assumptions result in fit 1 shown in Fig.
7, where the corresponding Fourier
transform clearly indicates a missing contribution at about 2.25 Å.
This can be accounted for by the contribution of a cysteine ligand
(16). A fractional contribution of sulfur was also observed in EXAFS spectroscopy on the B. cereus, 569/H/9, enzyme at pH 6.0 also containing about 1 eq of Zn2+ (17). However, the
authors did not give any interpretation of the presence of this sulfur.
From the amplitude it was obvious that, on average, less than one
sulfur atom was present. To obtain an upper limit for the number of
sulfur ligands, the corresponding Debye-Waller parameters were fixed,
because of their strong correlation with coordination numbers in EXAFS
spectra. The Debye-Waller parameter of the sulfur atom accounts only
for dynamic disorder and the static disorder between all the enzyme
units, whereas the Deby-Waller parameter for the nitrogen also bound to
the central Zn2+ additionally accounts for the static
disorder within this unit (between the three imidazole ligands). Thus
the Debye-Waller parameter for sulfur should be much smaller than for
nitrogen. To estimate the upper limit for the presence of sulfur atoms,
it was fixed to an even slightly lower value (0.003 Å2).
Analyzing the data with this model resulted in a significant improvement of the fit and a maximum coordination number for sulfur of
0.5 (Fig. 7). The corresponding parameters given in Table
IV show that the improvement of the fit
is only due to this sulfur contribution, because all other parameters
were identical within their errors. The difference between the Fourier
transforms of experiment and theory clearly indicated the absence of
any further contribution above the noise level. The structures derived
from x-ray diffraction data show that the Cys-168 residue is not close enough to coordinate the zinc at the 3-histidine site. As the EXAFS
data show a fractional zinc coordination by sulfur, the only solution
is a partial occupancy of the second site with cysteine, aspartate, and
histidine as zinc ligands in the mononuclear species. However, because
the Zn2+/enzyme ratio was 1.2 ± 0.1 in the present
case, part of the sulfur signal could also arise from a weakly occupied
binuclear zinc enzyme.

View larger version (34K):
[in this window]
[in a new window]
|
Fig. 7.
The effect of including a sulfur atom in a
fit to the EXAFS spectrum of the B. cereus 5/B/6
enzyme at pH 6.5 and with 1.2 zinc ions per enzyme molecule. To
the left is the EXAFS spectrum with the corresponding fits
and to the right the corresponding Fourier transforms.
Fit 1 is without a contribution from sulfur and fit
2 with a contribution of 0.5 sulfur. The plots of the differences
between the Fourier transform of experiment and fit are indicated by
"DIFF."
|
|
View this table:
[in this window]
[in a new window]
|
Table IV
Theoretical fits with and without sulfur to the EXAFS spectrum of the
5/B/6 B. cereus Zn- -lactamase at pH 6.5 having 1.2 Zn ions per
enzyme molecule
All parameters with given error margins were adjusted in the
refinement.
|
|
 |
DISCUSSION |
Existence of a Mono- and a Binuclear Zinc Enzyme with Different
Kinetic Properties--
Equilibrium dialysis in citrate buffer, pH
5.6, provided an estimation of Kmono of 10 µM for the 5/B/6 enzyme and no evidence for binding of a
second Zn2+ ion. The fact that the activity of the 569/H/9
enzyme at pH 5.6 versus nitrocefin is only about 50% that
observed in HEPES buffer, pH 7.5 (when both contain 100 µM Zn2+), correlates well with the absence of
a second enzyme-bound Zn2+ ion. The preferential occupancy
of the three-His site in the mononuclear species revealed in the
crystal structure (Fig. 8) (2) is then
satisfactorily explained by the much weaker binding of Zn2+
to the Cys site at pH 5.6. However, already at pH 6.5 the EXAFS data
indicate a significant occupancy of the Cys site in the so-called mononuclear species. This together with the observation of the binding
of a second zinc at pH 7.5 with a weaker binding (Table I) is
consistent with a dominant population of the three-His site together
with a relatively lower population of the Cys site at pH values higher
than or equal to 6.5 and at stoichiometries close to or below 1. The
mononuclear zinc enzyme thus corresponds to a protein with only 1 zinc
ion per molecule which could be either in the three-His site or the Cys
site. Dialyzing the enzymes against a large concentration of zinc
always results in the formation of a binuclear enzyme. In agreement
with this, recent crystallographic studies of the 569/H/9 enzyme at pH
7.5 show a fully occupied second
site.3

View larger version (36K):
[in this window]
[in a new window]
|
Fig. 8.
Structure of the active site of the
569/H/9 -lactamase at pH 5.6. The drawing
is produced by Molscript (P. J. Kraulis) using the Brookhaven
Protein Data Bank pdb1bmc file.
|
|
The kcat value of the 569/H/9 enzyme increases
2-fold upon binding of the second Zn2+ ion for both
substrates (Table II, see also Fig. 3). From this alone, it is not
possible to assign different mechanisms for the mononuclear and the
binuclear zinc enzymes because half activity for an average of one zinc
ion bound per protein molecule could equally well be explained by the
coexistence of enzyme molecules with no zinc ions or enzyme molecules
with two zinc ions. However, the data for the 5/B/6 enzyme changes this
for two reasons. First, there is no increase in the
kcat value with increasing zinc concentrations for nitrocefin (Table II). Second, the activity recovery curve with
nitrocefin starting with the 5/B/6 apoenzyme shows unambiguously that
maximum activity is obtained with only one zinc ion bound, i.e. no further increase in activity occurs upon formation
of the binuclear enzyme (Fig. 2, see also Table II). This is further confirmed by the full activity of the 5/B/6 enzyme with the same substrate when no extra zinc is added (Table II). It is obvious that
upon binding to the enzyme, nitrocefin (but not benzylpenicillin) increases the affinity for the first zinc ion as demonstrated by the
activity with no extra zinc added (Table II)- With benzylpenicillin as
substrate and the 5/B/6 enzyme, the data are also consistent with a
2-fold rise in kcat from the mononuclear zinc
enzyme to the binuclear enzyme (Table II, see also Fig. 2) as for the
569/H/9 enzyme with both substrates. The conclusion is then that the
kinetic properties of the mononuclear and the binuclear enzymes can
differ according to the substrate and the enzyme. In a recent work (18) a similar conclusion was drawn for the Zn2+-
-lactamase
from B. fragilis. Despite the differences observed in the
kinetic parameters between the mono- and binuclear species, a large
proportion of activity persists for the mononuclear enzyme. Thus the
formation of a binuclear enzyme is not necessary for efficient catalysis.
Note that the 5/B/6 and 569/H/9 enzymes differ only by 17 substitutions. Although the Thr-173
Ala and Ala-175
Ser
substitutions in the 5/B/6 enzyme relative to the 569/H/9 enzyme are
not far from the active site, they fail to explain, at the present
time, the different values of the kinetic parameters as well as the different dependences on zinc concentrations of the two WT enzymes.
The Role of the Conserved Cysteine Residue--
The kinetic
analysis of the 569/H/9 WT enzyme and its C168A mutant shows that the
affinity for benzylpenicillin is identical for the WT and the mutant
for the mononuclear but different for the binuclear Zn2+
enzyme, whereas hydrolysis of benzylpenicillin is strongly reduced for
the mono-Zn2+ mutant relative to its wild-type counterpart
but not for the binuclear Zn2+ species. With nitrocefin, it
is also clear that the mutant activity is higher than that of the WT at
high Zn2+ concentrations (compare Figs. 3 and 5). This
suggests that the mononuclear and binuclear Zn2+ enzyme
function via different mechanisms. Indeed, Cys-168 is essential for
efficient hydrolysis by the mononuclear enzyme but not by the binuclear species.
As suggested by Concha et al. (3) the two zinc ions could be
bridged by a shared hydroxyl which would attack the carbonyl carbon of
the
-lactam ring, but the exact role of the Cys residue in the
mononuclear enzyme remains to be elucidated.
Nevertheless, the crucial importance of Cys-168 in catalysis by the
mononuclear Zn2+ enzyme and its suggested irrelevance for
hydrolysis by the binuclear enzyme is supported by the fact that the
C168A mutant is able to bind two Zn2+ ions at pH 7.5 with
dissociation constants below 10 µM. Cys-168 is thus not
essential for binding of the second zinc ion. Interestingly the
Pseudomonas maltophilia enzyme where the otherwise conserved cysteine residue is a serine residue also does bind two
Zn2+ ions but the third ligand of the second zinc ion is
now a His side chain situated in a completely different part of the
polypeptide chain (His-89) (19). The possible formation of the
binuclear Zn2+ enzyme may represent a kind of
sophistication in an alternative mechanism that does not require
Cys-168.
The present work shows that the catalytic mechanism of Zn2+
enzymes requiring one metal ion for activity may become somewhat more
efficient by acquisition of co-catalytic sites with two zinc ions in
close proximity acting as a unit center (20). However, as shown by
studies performed with the B. fragilis enzyme (18, 21), the
catalytic efficiency of the binuclear enzyme is only marginally
superior to that of its mononuclear counterpart with some substrates
and is even lower with other ones (18).
 |
ACKNOWLEDGEMENT |
We are grateful to Dr. Bernhard Wannemacher
for technical assistance during the AAS measurements.
 |
FOOTNOTES |
*
This work was supported by the European research network on
metallo-
-lactamases, within the Training and Mobility of Researchers Program Contract ERB-FRMX-CT98-0232, the Bundesministerium fuer Bildung
und Forschung, the Deutsche Forschungsgemeinschaft Grant Ad 152/1-1,
the Danish Natural Research Council, and the Belgian Government Grant
PAIP4/03.The costs of publication of this
article were defrayed in part by the
payment of page charges. The article must therefore be hereby marked
"advertisement" in
accordance with 18 U.S.C. Section
1734 solely to indicate this fact.

To whom correspondence should be addressed. Tel.:
49-681-302-2492, Fax: 49-681-302-2097 and E-mail:
hwadolph{at}rz.uni-sb.de.
2
M. Galleni, unpublished observations.
3
R. Paul-Soto and J. Wouters, unpublished results.
 |
ABBREVIATIONS |
The abbreviations used are:
EXAFS, extended
x-ray absorption fine structure;
AAS, atomic absorption spectroscopy;
PCR, polymerase chain reaction;
WT, wild-type
Zn2+-
-lactamase;
C168A, mutant of
Zn2+-
-lactamase from B. cereus, strain
569/H/9 where Cys-168 is replaced by Ala;
Bis-Tris, 2-[bis(2-hydroxyethyl)amino]-2-(hydroxymethyl)-pro-
pane-1,3-diol.
 |
REFERENCES |
-
Payne, D. J.
(1993)
J. Med. Microbiol.
39,
93-99[Medline]
[Order article via Infotrieve]
-
Carfi, A.,
Pares, S.,
Duee, E.,
Galleni, M.,
Duez, C.,
Frere, J.-M.,
and Dideberg, O.
(1995)
EMBO J.
14,
4914-4921[Medline]
[Order article via Infotrieve]
-
Concha, N. O.,
Rasmussen, B. A.,
Bush, K.,
and Herzberg, O.
(1996)
Structure
4,
823-836[Medline]
[Order article via Infotrieve]
-
Carfi, A.,
Duee, E.,
Paul Soto, R.,
Galleni, M.,
Frere, J. M.,
and Dideberg, O.
(1998)
Acta Crystallogr. D
54,
47-57
-
Crowder, M. W.,
Wang, Z.,
Franklin, S. L.,
Zovinka, E. P.,
and Benkovic, S. J.
(1996)
Biochemistry
35,
12126-12132[CrossRef][Medline]
[Order article via Infotrieve]
-
Davies, R. B.,
and Abraham, E. P.
(1974)
Biochem. J.
143,
129-135[Medline]
[Order article via Infotrieve]
-
Baldwin, G. S.,
Galdes, A.,
Hill, H. A. O.,
Smith, B. E.,
Waley, S. G.,
and Abraham, E. P.
(1978)
Biochem. J.
175,
441-447[Medline]
[Order article via Infotrieve]
-
Baldwin, G. S.,
Galdes, A.,
Hill, H. A. O.,
Waley, S. G.,
and Abraham, E. P.
(1980)
J. Inorg. Biochem.
13,
189-204[CrossRef][Medline]
[Order article via Infotrieve]
-
Shaw, R. W.,
Clark, S. D.,
Hilliard, N. P.,
and Harman, J. G.
(1991)
Protein Expression Purif.
2,
151-157[CrossRef][Medline]
[Order article via Infotrieve]
-
Hernandez Valladares, M.,
Felici, A.,
Weber, G.,
Adolph, H. W.,
Zeppezauer, M.,
Rossolini, G. M.,
Amicosante, G.,
Frere, J.-M.,
and Galleni, M.
(1997)
Biochemistry
36,
11534-11541[CrossRef][Medline]
[Order article via Infotrieve]
-
Auld, D. S.
(1988)
Methods Enzymol.
158,
1-50[Medline]
[Order article via Infotrieve]
-
De Meester, F.,
Boris, B.,
Reckinger, G.,
Bellefroid-Bourgignon, C.,
Frère, J. M.,
and Waley, S. G.
(1987)
Biochem. Pharmacol.
36,
2393-2403[CrossRef][Medline]
[Order article via Infotrieve]
-
Meyer-Klaucke, W.,
Winkler, W.,
Schuenemann, V.,
Trautwein, A. X.,
Nolting, H. F.,
and Haavik, J.
(1996)
Eur. J. Biochem.
241,
432-439[Medline]
[Order article via Infotrieve]
-
Hermes, C.,
Gilberg, E.,
and Koch, M. H. J.
(1984)
Nucl. Instr. Methods
222,
207-214[CrossRef]
-
Binsted, N.,
Strange, R. W.,
and Hasnain, S. S.
(1992)
Biochemistry
31,
12117-12125[CrossRef][Medline]
[Order article via Infotrieve]
-
Feiters, M.
(1990)
Comments Inorg. Chem.
11,
131-174
-
Feiters, M. C.,
Little, C.,
and Waley, S. G.
(1986)
J. de Phys.
C8,
1169-1173
-
Paul Soto, R.,
Hernandez Valladares, M.,
Galleni, M.,
Bauer, R.,
Zeppezauer, M.,
Frere, J.-M.,
and Adolph, H. W.
(1998)
FEBS Lett.
438,
137-140[CrossRef][Medline]
[Order article via Infotrieve]
-
Ullah, J. H.,
Walsh, T. R.,
Taylor, I. A.,
Emery, D. C.,
Verma, C. S.,
Gamblin, S. J.,
and Spencer, J.
(1998)
J. Mol. Biol.
284,
125-136[CrossRef][Medline]
[Order article via Infotrieve]
-
Vallee, B. L.,
and Auld, D. S.
(1993)
Biochemistry
32,
6493-6500[CrossRef][Medline]
[Order article via Infotrieve]
-
Wang, Z.,
and Benkovic, S. J.
(1998)
J. Biol. Chem.
273,
22402-22408[Abstract/Free Full Text]
Copyright © 1999 by The American Society for Biochemistry and Molecular Biology, Inc.