![]()
|
|
||||||||
J Biol Chem, Vol. 274, Issue 19, 13419-13426, May 7, 1999
,From the Department of Parasitology, The Hebrew University-Hadassah Medical School, Jerusalem 91120, Israel
| |
ABSTRACT |
|---|
|
|
|---|
Replication of the kinetoplast DNA minicircle
lagging (heavy (H))-strand initiates at, or near, a unique hexameric
sequence (5'-ACGCCC-3') that is conserved in the minicircles of
trypanosomatid species. A protein from the trypanosomatid
Crithidia fasciculata binds specifically a 14-mer sequence,
consisting of the complementary strand hexamer and eight flanking
nucleotides at the H-strand replication origin. This protein was
identified as the previously described universal minicircle sequence
(UMS)-binding protein (UMSBP) (Tzfati, Y., Abeliovich, H., Avrahami,
D., and Shlomai, J. (1995) J. Biol. Chem. 270, 21339-21345). This CCHC-type zinc finger protein binds the
single-stranded form of both the 12-mer (UMS) and 14-mer sequences, at
the replication origins of the minicircle L-strand and H-strand,
respectively. The attribution of the two different DNA binding
activities to the same protein relies on their co-purification from
C. fasciculata cell extracts and on the high affinity of
recombinant UMSBP to the two origin-associated sequences. Both the
conserved H-strand hexamer and its flanking nucleotides at the
replication origin are required for binding. Neither the hexameric
sequence per se nor this sequence flanked by different
sequences could support the generation of specific nucleoprotein
complexes. Stoichiometry analysis indicates that each UMSBP molecule
binds either of the two origin-associated sequences in the
nucleoprotein complex but not both simultaneously.
Kinetoplast DNA (kDNA)1
is a unique extrachromosomal DNA network found in the single
mitochondrion of parasitic flagellated protozoa of the family
Trypanosomatidae. In Crithidia fasciculata, kDNA consists of
about 5,000 DNA minicircles (2.5 kilobase pairs each) and about 50 DNA
maxicircles (37 kilobase pairs each) interlocked topologically to
form a DNA network (reviewed in Refs. 1-7). Minicircles, in most
trypanosomatid species, are heterogeneous in sequence. However, two
short sequences that are associated with the process of replication
initiation and are located 70-100 nucleotides apart on the minicircle
complementary DNA strands were conserved in minicircles of all the
trypanosomatid species studied: the sequence GGGGTTGGTGTA, known as the
universal minicircle sequence (UMS), in the minicircle heavy (H)
strand, and the sequence ACGCCC in its light (L) strand (3).
The replication of kDNA is restricted to the discrete S-phase,
approximately in parallel with the replication of the nuclear DNA
(reviewed in Refs. 4, 5, 8, and 9). According to the current model for
the network replication (10, 11), during the S-phase individual
minicircles are released from the central zone of the network and
replicate, each forming two nicked (and gapped) progeny minicircles
that reattach to the periphery of the network (10-14). At the end of
the S-phase, the network is composed of replicated, nicked, and gapped
circles and has doubled in size. The final steps, which occur at the
beginning of the G2 phase, include the physical splitting
of the double-size network and the covalent closure of the circles,
followed by the network segregation during cell division.
Immunolocalization and in situ hybridization studies have
co-localized free replicating minicircles and replication proteins to
two peripheral antipodal sites of the kinetoplast disc, suggesting that
these are the sites in which minicircle replication is conducted
through the action of two replication complexes (14-16).
The replication of free minicircles has been studied in
Trypanosoma equiperdum (17-20), C. fasciculata
(21-25), and Leishmania tarentolae (26, 27). Minicircle
replication initiates by the synthesis of an RNA primer at the UMS
site. Elongation of the nascent L-strand displaces the parental
L-strand, which serves as a template for the discontinuous H-strand synthesis.
We have previously reported on the presence in C. fasciculata of a sequence-specific single-stranded DNA-binding
protein that binds specifically to the UMS. The protein, designated
UMSBP, was purified to apparent homogeneity from C. fasciculata cell extracts (28, 29), and its encoding gene was
cloned and analyzed (30, 31). The UMS-binding protein is a CCHC-type
zinc finger dimer protein (31) of 27.4 kDa with a 13.7-kDa protomer
(28). Whereas neither the duplex form of a UMS dodecamer nor a
quadruplex DNA conformation are bound by UMSBP, the protein binds
efficiently the natural double-stranded kDNA minicircle, as well as a
duplex minicircle fragment containing the origin-associated UMS (32). These studies have revealed that the kDNA minicircle origin region is
significantly curved and distorted, suggesting that binding of UMSBP at
the native minicircle origin site may be facilitated through the local
unwinding of the DNA double helix at unstacked dinucleotide sequences
within the UMS element (32). Here, we report on the specific
recognition of a sequence associated with the H-strand replication
origin by UMSBP and discuss the protein sequence specificity and mode
of binding at the origin region.
Nucleic Acids, Nucleotides, Proteins, and Resins--
Synthetic
deoxyoligonucleotides were prepared by an Applied Biosystems
oligonucleotide synthesizer at the Bletterman Laboratory of the
Interdepartmental Division, Faculty of Medicine, the Hebrew University
of Jerusalem. Poly(dI-dC)·poly(dI-dC) was purchased from Roche
Molecular Biochemicals. Phenyl-Sepharose was from Sigma and
hydroxyapatite from Bio-Rad. Radioactive nucleotides were from NEN Life
Science Products, and polynucleotide kinase was from New England Biolabs.
Cell Growth--
C. fasciculata cultures were grown
at 28 °C with agitation (150-200 rpm), in a medium containing 37 g/liter brain-heart infusion, 20 µg/ml hemin, 100 units/ml
penicillin, and 100 µg/ml streptomycin. Cells were harvested during
late logarithmic growth phase by centrifugation at 6,000 × g and washed with 50 mM Tris-Cl, pH 7.5, and 100 mg/ml sucrose (enzyme grade, IBI). Cell paste was frozen in liquid
nitrogen and stored at Protein Purification--
Protein purification was carried out
following the specific binding of the oriH-associated 14-mer
sequence (H14, 5'-GTAGGGGCGTTCTG-3') oligonucleotide, by the mobility
shift electrophoretic assay, as described below. Cell lysate (fraction
I, 1.3 g of protein) was prepared from 9.2 g of C. fasciculata cell paste by gentle disruption of the
Crithidia cell membrane, using a non-ionic detergent in
hypotonic solution, and was further fractionated by ammonium sulfate
precipitation, as described previously (33). 92.8 mg of protein,
precipitated with 40-60% (of saturation, at 0 °C) ammonium sulfate
(fraction II), were further purified as described below (see legend to
Fig. 2). Preparation of recombinant UMSBP expressed in
Escherichia coli as a glutathione S-transferase
fusion, its specific proteolytic digestion, affinity chromatography,
and further purification to apparent homogeneity were as we have
previously described (34). Protein was determined following the method of Bradford (35).
Electrophoretic Mobility Shift Analysis--
Analyses were
carried out as described previously (28, 29). The 10-µl standard
reaction mixture contained 25 mM Tris-Cl, pH 7.5, 2 mM MgCl2, 1 mM dithiothreitol, 20%
(v/v) glycerol, 2 µg of bovine serum albumin, 0.5 µg of
poly(dI-dC)·poly(dI-dC), and the indicated amount of
5'-32P-labeled DNA ligands. Recombinant UMSBP or,
alternatively, partially purified C. fasciculata protein,
was added to the amounts indicated. Reaction mixtures were incubated at
0-30 °C for 30 min and electrophoresed in an 8% native
polyacrylamide gel (1:32 bisacrylamide:acrylamide) in TAE buffer (6.7 mM Tris acetate, 3.3 mM sodium acetate, 1 mM EDTA, pH 7.5). Electrophoresis was conducted at 4 °C
and 16 V/cm for 1.5 h. Gels were dried and exposed to x-ray films
(Agfa Curix RP2 or Kodak X-Omat AR). Protein-DNA complexes were
quantified by exposing the dried gels to an imaging plate (BAS-IIIs,
Fuji) and analyzing it by a BioImaging Analyzer (model BAS1000, Fuji). One unit of UMSBP is defined as the amount of protein required for
binding of 1 fmol of the oriL-associated UMS
(5'-GGGGTTGGTGTA-3') or the oriH-associated 14-mer (H14,
5'-GTAGGGGCGTTCTG-3') DNA ligands, under the standard mobility shift
assay conditions. The H14 DNA ligand (as well as some of its
derivatives) exhibits two bands upon electrophoresis in native
polyacrylamide gels. Only the fast migrating 14-mer species is capable
of binding UMSBP. The two bands represent inter-convertible
conformational forms as follows: (i) boiling of the oligonucleotides,
prior to their electrophoresis in native polyacrylamide gels, results
in the disappearance of the slow migrating species; (ii) only one
14-mer band is observed upon electrophoresis in denaturing
polyacrylamide gels. In some experiments, as indicated in each case,
oligonucleotides were heated at 95 °C for 2 min and then transferred
immediately to 0 °C (for up to 30 min), prior to their use in the
binding reaction, to eliminate potential secondary structures.
Measurements of Equilibrium Binding Constants--
Measurements
of equilibrium binding constants, for the interactions of purified
UMSBP with various DNA molecules, were carried out as described by
Fried and Crothers (36, 37) and Liu-Johnson et al. (38).
Experiments were carried out under the standard mobility shift assay
conditions, by serial dilutions of both UMSBP and the oligonucleotide
probe, while keeping constant the molar ratio of added
protein [Padded] to total DNA
[DNAtotal] and varying the total concentration. Reactions
were incubated for 30 min at 30 °C. Quantification of protein-DNA
complexes was carried out using a BioImaging analyzer, as described
above. Data were analyzed as described by Liu-Johnson et al.
(38), plotting (1 A Protein in C. fasciculata That Interacts Specifically with a
Unique OriH-associated Sequence--
It has been previously suggested
that discontinuous replication of the minicircle H-strand initiates at
or near the conserved hexameric sequence 5'-ACGCCC-3', of the displaced
parental L-strand (21, 22), at the proposed H-strand replication origin
(oriH). A protein that interacts specifically with this
unique site in kDNA minicircles has been detected in C. fasciculata cell extracts. Electrophoretic mobility shift analysis
using oriH-associated sequences revealed (Fig.
1) that an H-strand 14-mer sequence (H14, 5'-GTAGGGGCGTTCTG-3'), which consists of the conserved
hexamer (underlined) and 4 nucleotides flanking its 3' and 5' termini, supports the generation of specific nucleoprotein complexes. Such protein-DNA complexes could not be detected with either the
complementary L-strand (L14, Fig. 1) or the duplex form of this
sequence (not shown). It was further observed that neither the
conserved L-strand hexameric sequence nor its complementary H-strand
sequence, per se, constitutes a specific recognition site
for the oriH binding activity. No protein-DNA complexes
could be detected with hexamer concentrations as high as 12 nM, whereas a 14-mer sequence, containing the H-strand
hexamer and 8 flanking nucleotides, supports the efficient generation
of specific nucleoprotein complexes at ligand concentrations of 2 orders of magnitude lower (Fig. 1).
UMSBP Binds Conserved Sequences at the Replication Origins of the
Two Complementary Strands of kDNA Minicircles--
Purification of the
protein that interacts specifically with the unique
oriH-associated 14-mer (H14) sequence from C. fasciculata cell extracts has revealed its consistent
co-purification with the previously described UMS-binding protein
(UMSBP) (28, 29). Similar levels of UMS binding activity and H14
binding activity were measured in crude cell lysates (FI, Table
I); both activities were fractionated at
the same pattern through a gradual ammonium sulfate precipitation (FII,
Table I) and co-chromatographed by hydrophobic chromatography on
phenyl-Sepharose (Fig. 2A) and
hydroxyapatite chromatography (Fig. 2B). These observations
indicated that the same protein, UMSBP, might be responsible for the
specific binding of the two different origin-associated sequences.
To explore the possibility that UMSBP may bind both the conserved
oriL-UMS and oriH-H14 sequences, we have measured
the capacity of recombinant UMSBP, which was expressed in bacteria by a
plasmid carrying the C. fasciculata UMSBP gene and purified
to apparent homogeneity (34), to bind the two sequences.
Electrophoretic mobility shift analyses, using the two sequences as
radioactive ligands (Fig. 3), demonstrate
clearly that both the authentic eukaryotic UMSBP, which was purified
from C. fasciculata cell extracts (Fig. 3, lanes
b and e), and pure recombinant UMSBP that was
expressed in bacteria (Fig. 3, lanes a and
d) bind efficiently both DNA ligands. Binding of the
recombinant UMSBP to both origin sequences implies that recognition of
the two minicircle sequences is an intrinsic property of UMSBP and has
not resulted from an incidental cross-contaminating DNA binding
activity in the crithidial protein preparation. Moreover, binding
competition analyses, in which the binding of UMSBP to the
oriH-associated H14 and the oriL-associated UMS
was challenged, reciprocally, with increasing molar excess of these
ligands unlabeled (Fig. 4), revealed the efficient competition of both ligands on the binding of UMSBP, with
some preference of UMSBP to the H14 over the UMS ligand. Furthermore,
the equilibrium binding constant measured for the interaction of UMSBP
with the H-strand H14 is 1.1 × 109
M UMSBP Recognizes Specifically a 14-Mer Sequence at the OriH
H-strand--
Binding of pure UMSBP to both DNA ligands is
sequence-specific. Binding competition analyses (Fig.
5) revealed that an excess of 2 orders of
magnitude of a non-related oligonucleotide (HG15) failed to displace
both the oriH-H14 and the oriL-UMS from their respective nucleoprotein complexes, indicating the high specificity of
these protein-DNA interactions.
As was shown above (Fig. 1), the oriH-conserved hexamer,
per se, is not a sufficient recognition site for the binding
of UMSBP. To define further the sequence directing the specific binding of UMSBP onto the oriH site, a series of oriH
H-strand oligonucleotides (ranging from 6 to 26 nucleotides long), each
containing the conserved hexamer and sequences flanking its 3' and/or
5' termini (0-10 residues long), were used as radioactive ligands in
electrophoretic mobility shift analyses. As demonstrated in Fig.
6, DNA ligands containing less than 4 residues on both the 3' and 5' termini of the hexamer showed a
significantly decreased binding by UMSBP. In fact, no nucleoprotein
complexes could be detected by the electrophoretic mobility shift assay
with oligonucleotides containing <3 residues, flanking both the 3'-
and 5'-ends of the hexamer. This was also the case with ligands
consisting of the conserved hexamer and 2-6 residues flanking its 3'
terminus or 2-4 residues flanking its 5' terminus. A significantly
lower binding affinity is measured for UMSBP interaction with a 12-mer
sequence containing 3 residues flanking both termini of the hexamer,
with a measured binding constant of more than 7-fold higher than that
measured for the interaction of UMSBP with H14 (Fig. 4,
inset). On the other hand, using DNA ligands containing the
hexamer flanked at both termini by sequences of
These observations indicated that an H-strand sequence consisting of 14 nucleotides, including the conserved hexamer and 4 residues flanking
its 3' and 5' termini, forms a recognition site for UMSBP at the
oriH site. Intriguingly, whereas UMSBP shows low affinity to
a 10-mer ligand consisting of the hexamer and 4 residues flanking its
5' terminus, addition of only two nucleotides at its 5'-end has turned
the resulting 12-mer sequence into a ligand that is bound by UMSBP as
efficiently as H14 (Fig. 6). The equilibrium binding constant measured
for the interaction of this ligand with UMSBP is 1.9 × 109 M
We have explored the possibility that specific binding of UMSBP to the
H14 sequence may reflect a specific recognition of the conserved
hexamer, whereas the flanking sequence may contribute, nonspecifically,
to the stability of the nucleoprotein complex. The binding assays
described in Fig. 7 clearly demonstrate
that recognition of the H-strand 14-mer sequence is directed by both the conserved hexamer "core" and the 4 residues flanking both termini. It was found that neither a 14-mer oligonucleotide, consisting of the L-strand hexamer and 8 nucleotides flanking the hexamer on the
complementary H-strand, nor the reciprocal H-strand complementary hexamer and 8 nucleotides flanking the hexamer on the L-strand could
support the binding of UMSBP. Based on these observations (Figs. 1, 6,
and 7), it is suggested that the conserved H-strand hexamer is
essential but is not sufficient for recognition
by UMSBP and that the nucleotides flanking the conserved hexamer at the
oriH H-strand are essential for the specific binding of UMSBP onto this site.
UMSBP Binds One H14 Element in the Nucleoprotein
Complex--
Previous studies have shown that UMSBP binds only one UMS
sequence in the nucleoprotein complex (28). The experiment described in
Fig. 8 shows that this is also the case
in the protein interaction with the oriH-H14 sequence. We
have followed here the methodology employed in our previous studies on
the binding of UMSBP to UMS (28). Two DNA ligands were used as follows:
(i) an oligonucleotide consisting of the oriH-associated H14
(as above); (ii) a 26-mer sequence (H26), containing the
same 14-mer H14 sequence plus 12 nucleotides flanking it (six residues
at each terminus) at the oriH site. Whereas the affinities
of UMSBP to both ligands, as deduced from equilibrium binding constants
determination (not shown), are similar (see also Fig. 6,
lanes d and h), the expected electrophoretic mobilities of the resulting nucleoprotein complexes differ significantly and can be readily distinguished upon
electrophoresis in native polyacrylamide gels. In the presence of both
ligands in a binding reaction, the following complexes could be
expected. If UMSBP binds only one binding element, then two types of
complexes are expected, one with the 14-mer (H14) and the other with
the 26-mer (H26). However, if UMSBP interacts simultaneously with both
ligands, then (under ligand saturation conditions) three types of
complexes are expected as follows: one with the 14-mer (H14), a second
with the 26-mer (H26), and a third with both ligands. Fig. 8 describes
the results of an experiment in which the oligonucleotides H14 and H26
were mixed together at various molar ratios, as indicated, and used as
radioactive probes in an electrophoretic mobility shift experiment with
UMSBP. Reciprocal titration of one species of DNA ligand over the other
yielded only two types of protein-DNA complexes, one with the H14 DNA
and the other with the H26 DNA. No additional species of protein-DNA
complexes could be detected, indicating that only one H14 site in
either the 14-mer or the 26-mer is bound by UMSBP in the protein-DNA
complex. As shown in Fig. 8, the complex of UMSBP with the shorter
oligonucleotide (H14-UMSBP) migrates slower in the gel than the complex
generated with the longer one (H26-UMSBP). This is also observed in the experiment described in Fig. 9, where
UMSBP forms a nucleoprotein complex of a lower electrophoretic mobility
with the 12-mer UMS (UMS-UMSBP) than with a larger 26-mer containing
the H14 sequence (H26-UMSBP). We have previously reported that a
complex of UMSBP with the 12-mer UMS displayed a lower electrophoretic
mobility than its complex with a UMS-containing 40-mer oligonucleotide (28). This behavior of UMSBP-containing nucleoprotein complexes may
reflect an effect of UMSBP on the structure of the bound DNA. Its
nature and potential biological significance have yet to be explored.
UMSBP Binds Either an OriL-UMS or an OriH-H14 Sequence but Not Both
Sequences Simultaneously--
Considering the adjacent location of the
UMS and H14 sequences (approximately 80 nucleotides apart in the
minicircle H-strand), the question of whether or not UMSBP is capable
of the simultaneous binding of both the oriL and
oriH sequences may be pertinent to its putative role and
mode of action at the minicircle replication origin. To address this
question, we have followed the methodology described above ((28) Fig.
8), using two different DNA ligands as follows: (i) the H26
oligonucleotide containing the 14-mer element of oriH (as
above); (ii) the oriL-associated 12-mer UMS sequence.
Following the same rationale as discussed above, in the presence of
both ligands in a binding reaction, it is expected that binding of only
one binding element by UMSBP will result in the formation of
two types of complexes (H26-UMSBP and UMS-UMSBP), but
simultaneous interaction of UMSBP with both DNA ligands (under ligand
saturation conditions) should yield a third type of protein-DNA complex
that contains both ligands (UMS-UMSBP-H26). The electrophoretic mobility shift analysis described in Fig. 9 clearly demonstrates that a
reciprocal titration of one species of DNA ligand over the other at
various molar ratios yielded only two types of protein-DNA complexes,
one with the H26 and the other with UMS. No additional species of
protein-DNA complexes could be detected, indicating that only one DNA
molecule of either sequence is bound by UMSBP in the nucleoprotein complex.
Origin-directed initiation of DNA replication is regulated through
the specific interactions of an origin-binding protein (the initiator
protein) with a unique origin-associated sequence (the replicator
sequence) (39) (reviewed in Refs. 40-42). Replication of kDNA
minicircles initiates by the synthesis of an RNA primer at the
conserved UMS site, the presumed replicator sequence for kDNA
minicircle L-strand replication. Searching for the corresponding initiator protein, we have previously purified and characterized a
sequence-specific single-stranded UMS-binding protein (UMSBP) from
C. fasciculata cell extracts (28, 29) and described its encoding gene and genomic locus in the trypanosomatid cell (30, 31). On
the basis of its specific binding to a conserved minicircle origin
sequence (28, 29) and to free native kDNA minicircles and kDNA networks
(32), we have suggested a potential role for UMSBP as a minicircle
oriL-binding protein.
We have searched here for a protein that interacts specifically with
the potential H-strand replicator sequence, the hexameric sequence
5'-ACGCCC-3' that was conserved at the proposed oriH. We
have found that UMSBP (that has been originally purified based on its
affinity to the oriL-associated UMS (28, 29)) binds also an
oriH-associated 14-mer sequence (H14) that consists of the
conserved hexamer and flanking residues. Several lines of observations
support the conclusion that binding of both the
oriH-associated H14 and the oriL-associated UMS
is an intrinsic property of UMSBP. (i) The two DNA-binding activities
are consistently co-purified from C. fasciculata cell
extracts, through several different fractionation and chromatography
steps (Table I and Fig. 2). (ii) Recombinant UMSBP, expressed in
bacteria by a plasmid carrying the cloned C. fasciculata
UMSBP gene (and subsequently purified to apparent homogeneity),
binds the H14 sequence as efficiently as it binds the UMS (Fig. 3).
(iii) The two origin-associated sequences compete efficiently with each
other upon the binding of UMSBP. Binding competition analyses as well
as direct measurements of equilibrium binding constants for the two
protein-DNA interactions revealed similar binding affinities of UMSBP
for the two binding sites (Fig. 4 and inset) (28).
Our search for an oriH-binding protein has led to several
intriguing observations. First, it was found that although the
conserved hexameric sequence is essential for specific protein-DNA
interactions, it could not per se direct the binding of
UMSBP onto the oriH site (Figs. 1, 6, and 7). Second,
although this sequence resides within the H-strand origin site,
it is located at the minicircle H-strand, which is complementary to the
template (L) strand for H-strand synthesis (Fig. 1). Binding of UMSBP
to the non-template H-strand at this site could have been predicted on
the basis of the protein sequence specificity (28) and the similarity
of the two bound sequences (Fig. 10).
Both sequences consist of the same sequence elements, including a
cluster of 4-G residues, followed by
a TT and a TG
dinucleotide elements. There are also additional sequence similarities
(e.g. a GTT, at positions 4-6 of UMS
and 9-11 of H14, or a TA dinucleotide at
positions 11 and 12 of UMS and 2 and 3 in H14). UMSBP-binding sites are
specific nucleotide sequences of a high G
content. Analyses of point mutations, introduced at each individual
residue in the UMS-binding site, revealed the sequence specificity of
these protein-DNA interactions (29). These studies clearly demonstrated
the different contribution of residues that are located at different
positions in the binding sequence to the UMS-UMSBP interactions. These
analyses revealed the significance of the G residues at
positions 3, 4, 7, 8, and 10 in UMS for the specific protein-DNA
interactions. A possible role for the "kinkable" (deformable)
TpG and TpA stacks in the untwisting (or
distortion) of the native UMS element has been previously suggested
(32). Furthermore, we have previously shown (28, 29) that UMSBP binds
efficiently the 12-mer sequences GGGGTTGGGGTT and AGGGTTAGGGTT,
representing the telomeric repeats of ciliates and vertebrate
chromosomes, respectively. Here we observed the high
affinity of UMSBP to the sequence
5'-G1G2G3T4A5G6G7G8G9C10G11T12-3', consisting of the conserved hexamer (bold) and a 5'-flanking 6-mer sequence (Fig. 6), that similarly contains two clusters of
G residues (in italics) separated by a TA
(underlined) dinucleotide sequence. This oriH-associated
sequence may provide an additional, or alternative, site for the
binding of UMSBP. Several features of the UMSBP sequence-specificity, such as the effect of the G1and
G14 residues in H14 upon the binding of UMSBP
(Fig. 6, lane c versus d), has yet to be
explored.
![]()
INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES
![]()
EXPERIMENTAL PROCEDURES
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES
76 °C.
r)(
r)/r versus
1/[DNAtotal], where r is the fraction of the
DNA that is in the protein-DNA complex band; [DNAtotal]
is the total concentration of the DNA added, and
is the unknown but
constant ratio of active protein to total DNA. The equation is solved
by searching for an
value that will yield the best line passing through the origin. The slope reciprocal yields the binding constant (K). The fraction (
) of protein that is active in DNA
binding, as judged by the ability to form a protein-DNA complex band in gel electrophoresis, is calculated from
, the total concentration of
DNA, and the concentration of added protein using the equation:
=
[DNAtotal]/[Padded] (38).
The value of
is usually significantly lower than 1 (38).
![]()
RESULTS
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

View larger version (17K):
[in a new window]
Fig. 1.
Binding of the
oriH-binding protein is preferentially to an H-strand
sequence. Electrophoretic mobility shift assays and their
quantification were conducted as described previously (28, 29), using
fraction II (as described under "Experimental Procedures") as the
source of protein (8 ng/assay) and increasing concentrations (0-250
pg) of either of the following 32P-labeled DNA ligands: the
H-strand H14, 5'-GTAGGGGCGTTCTG-3' (
), or the L-strand L14,
5'-CAGAACGCCCCTAC-3' (
) 14-mers; the conserved hexameric sequences:
L-strand, 5'-ACGCCC-3' (
), or H-strand, 5'-GGGCGT-3' (
)
6-mers.
Distribution of UMS and H14 DNA binding activities in fractionated C. fasciculata cell extracts

View larger version (21K):
[in a new window]
Fig. 2.
Chromatography of the
oriH-binding protein and UMSBP on phenyl-Sepharose and
hydroxyapatite. A, 92.8 mg of fraction II protein (as
described under "Experimental Procedures") was loaded onto a 10-ml
phenyl-Sepharose column, equilibrated with 50 mM Tris-Cl,
pH 7.5, 1.5 M ammonium sulfate, 2 mM
MgCl2, 4 mM
-mercaptoethanol, and 1 mM phenylmethylsulfonyl fluoride. The column was washed
subsequently with 2-bed volumes each of the equilibration buffer,
containing 1.5 and 1.3 M ammonium sulfate, and proteins
were eluted with a linear gradient of 1.3 to 0.4 M ammonium
sulfate in this buffer, to yield fraction III (FIII). B,
FIII protein was concentrated on a subsequent small (750 µl)
phenyl-Sepharose column that was equilibrated and washed as above and
eluted stepwise by 1.2 and 0.6 M, and no ammonium sulfate
in the equilibration buffer, to yield fraction IV (FIV). 0.55 mg of FIV
protein was loaded onto a 100-µl hydroxyapatite column, equilibrated
with 50 mM Tris-Cl, pH 7.5, 2 mM
MgCl2, and 4 mM
-mercaptoethanol. The column
was washed with 2-bed volumes of the equilibration buffer, and proteins
were eluted stepwise using 50, 100, 150 and 200 mM
potassium phosphate in the equilibration buffer to yield fraction V. Electrophoretic mobility shift assays were conducted using either the
UMS 12-mer (
) or the H14 (
) oligonucleotides as
32P-labeled DNA ligands.
denotes the ammonium sulfate
and potassium phosphate concentrations.
1 (Fig. 4, inset), a value close
to the one measured for UMSBP interaction with the UMS element (28),
implying the similar binding affinities of pure UMSBP for the two DNA
ligands.

View larger version (57K):
[in a new window]
Fig. 3.
Purified recombinant UMSBP binds the
oriH-associated 14-mer. Electrophoretic mobility
shift assays were conducted as above, using either of the following
protein preparations. In lanes a and
d, recombinant UMSBP (0.5 ng/assay), which was expressed in
induced E. coli carrying the C. fasciculata UMSBP
gene, as a glutathione S-transferase fusion, purified by
affinity chromatography using glutathione-agarose beads,
proteolitically cleaved by Xa-protease factor to remove the glutathione
S-transferase moiety, and then purified to apparent
homogeneity by phenyl-Sepharose chromatography, as we have previously
described (34); lanes b and e,
fraction III (FIII) protein preparation (2 ng/assay), obtained by
purification of C. fasciculata fraction II preparation using
phenyl-Sepharose chromatography, as described under the "Experimental
Procedures" and the legend to Fig. 2. The 32P-labeled DNA
ligands used are as follows: the oriH 14-mer H14 and the
oriL-UMS 12-mer sequence; lanes c and
f, free H14 and UMS DNA, respectively. The H14 ligand
exhibits two DNA bands, of which only the fast migrating form is
capable of binding UMSBP. These two bands represent two
interconvertible conformational forms of H14 DNA, as described under
"Experimental Procedures."

View larger version (22K):
[in a new window]
Fig. 4.
The oriL-UMS and
oriH-H14 compete with each other upon the binding of
UMSBP. Electrophoretic mobility shift assays and their
quantification were as described above, using pure recombinant UMSBP
(0.2 ng/assay). The 32P-labeled DNA ligands (10.64 fmol/assay) were either H14 (circles) or UMS
(triangles) in the presence of increasing concentrations of
these oligonucleotides as unlabeled competitors (0-50-fold, molar
ratios), as follows: 32P-labeled H14, with unlabeled H14
competitor (
); 32P-labeled H14, with unlabeled UMS
competitor (
); 32P-labeled UMS, with unlabeled UMS
competitor (
); 32P-labeled UMS, with unlabeled H14
competitor (
). Inset, determination of the equilibrium
binding constant for the interaction of UMSBP with H14 DNA.
Samples containing serial dilutions of both UMSBP and H14 DNA
(at a constant molar ratio) were analyzed by the mobility
shift electrophoretic assay, following the procedure of Fried and
Crothers (36, 37) and Liu-Johnson et al. (38) as described
under "Experimental Procedures." Data were analyzed by
plotting (1
r)(
r)/r
versus 1/[DNAtotal] and adjusting
to
obtain a y intercept value of 0, where
r is the fraction of DNA radioactivity that is in the band
representing the protein-DNA complexes, [DNAtotal] is the
total concentration of DNA in the reaction, and
is the unknown, but
constant, molar ratio of active protein to total DNA. The slope
reciprocal yields a K value of 1.1 × 109
M
1. The fraction of active protein (
) can
be calculated from
, the total concentration of DNA and the
concentration of the added protein [Padded], using the
equation
=
[DNAtotal]/[Padded], as
described under "Experimental Procedures." For the data in Fig. 4,
= 0.69 and
= 0.19.

View larger version (21K):
[in a new window]
Fig. 5.
. Binding of UMSBP to both H14 and UMS is
sequence-specific. Electrophoretic mobility shift assays and their
quantification were as described above, using pure recombinant UMSBP
(0.2 ng/assay). The 32P-labeled DNA ligands were either H14
or UMS (10.64 fmol/assay) in the presence of increasing concentrations
of the unlabeled oligonucleotide competitor HG15: 5'-CAAAGAATATATCAG-3'
(0-50-fold, molar ratios).
, 32P-labeled
H14 probe and unlabeled H14 competitor;
, 32P-labeled
H14 probe and unlabeled HG15 competitor;
,
32P-labeled UMS probe and unlabeled UMS competitor;
,32P-labeled UMS probe and unlabeled HG15
competitor.
4 residues (ranging
from 4 to 10 nucleotides), no further increase in UMSBP binding
affinity (as deduced from equilibrium binding constant determinations)
could be measured.

View larger version (65K):
[in a new window]
Fig. 6.
The UMSBP binding sequence at
oriH. Electrophoretic mobility shift assays and
their quantification were as described above, using recombinant UMSBP
(0.2 ng/assay). Oligonucleotides were heated at 95 °C for 2 min,
prior to their use in the binding reaction, to eliminate any potential
secondary structures, as described under "Experimental Procedures."
The 32P-labeled DNA ligands (12.5 fmol/assay) were as
follows: a, GGGCGT; b,
AGGGGCGTTC; c,
TAGGGGCGTTCT; d,
GTAGGGGCGTTCTG; e,
GGTAGGGGCGTTCTGC; f,
GGGTAGGGGCGTTCTGCG; g,
CGGGTAGGGGCGTTCTGCGA; h,
TCTCGGGTAGGGGCGTTCTGCGAAAA; i,
GGGCGTTC; j,
GGGCGTTCTG; k,
GGGCGTTCTGCG; l,
AGGGGCGT; m, GTAGGGGCGT;
n, GGGTAGGGGCGT; o,
UMS, GGGGTTGGTGTA. Italics indicate the
conserved hexamer; bold indicates the hexamer flanking
sequences. The additional radioactive bands at the bottom of
lanes a, b, c, and g represent
residual [
-32P]-ATP in these oligonucleotides
preparations.
1, a value close to those
measured for the protein interactions with H14 (Fig. 4,
inset) and UMS (28). Binding of UMSBP to these oriH-associated sequences is discussed below.

View larger version (16K):
[in a new window]
Fig. 7.
Binding is specific both to the
H-strand hexamer and its flanking sequences. Electrophoretic
mobility shift assays and their quantification were conducted as above,
using increasing concentrations (0-100 pg) of the following
32P-labeled DNA ligands:
, the H-strand hexamer
(underlined) and 8 nucleotides flanking it (bold)
on the H-strand (H14,
GTAGGGGCGTTCTG);
, the L-strand
hexamer (underlined) and 8 nucleotides flanking it
(bold) on the H-strand
(GTAGACGCCCTCTG);
, the H-strand
hexamer (underlined) with the 8 nucleotides flanking it
(bold) on the complementary L-strand
(CAGAGGGCGTCTAC).

View larger version (78K):
[in a new window]
Fig. 8.
Stoichiometry of
oriH-H14 sites bound in the UMSBP-[H14-DNA]
complex. UMSBP (0.5 ng) was incubated under the standard mobility
shift assay conditions in a series of binding reaction mixtures
containing 25 fmol total of 5'-32P-labeled H14-DNA (as
above) and H26-DNA
(5'-TCTCGGGTAGGGGCGTTCTGCGAAAA-3')
that contains the H14 sequence (underlined) and 12 flanking
residues (bold), at the following H26/H14 molar ratios: only
H26, 7/1, 3/1, 1.7/1, 1/1, 1/1.7, 1/3, 1/7, only H14 (lanes
b-j, respectively); lanes a and
k, free H26-DNA and H14-DNA markers, respectively.
Oligonucleotides were heated at 95 °C for 2 min prior to their use
in the binding reaction to eliminate any potential secondary
structures, as described under "Experimental Procedures." Reaction
products were electrophoresed in a native 6.5% polyacrylamide gel at
2 °C and 16 V/cm for 2 h. Indicated are UMSBP-[H14-DNA] and
UMSBP-[H26-DNA] complexes and free H14 and H26
oligonucleotides.

View larger version (74K):
[in a new window]
Fig. 9.
Either the UMS or the H14 site is bound in
the UMSBP-DNA complex but not both simultaneously. UMSBP (0.5 ng)
was incubated under the standard mobility shift assay conditions in a
series of binding reaction mixtures containing 25 fmol total of
5'-32P-labeled UMS 12-mer (for sequence, see legend to Fig.
6) and H26 (for sequence, see legend to Fig. 8) oligonucleotides at the
following H26/UMS molar ratios: only H26, 7/1, 3/1, 1.7/1, 1/1, 1/1.7,
1/3, 1/7, only UMS (lanes b-j,
respectively); lanes a and k, free
H26-DNA and UMS-DNA markers, respectively. Oligonucleotides were heated
at 95 °C for 2 min prior to their use in the binding reaction to
eliminate any potential secondary structures, as described under
"Experimental Procedures." Reaction products were electrophoresed
in a native 8% polyacrylamide gel at 2 °C and 16 V/cm for 3 h.
Indicated are UMSBP-[H26-DNA] and UMSBP-[UMS-DNA] complexes and
free H26 and UMS oligonucleotides.
![]()
DISCUSSION
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

View larger version (12K):
[in a new window]
Fig. 10.
. UMSBP binding sequences in kDNA
minicircles. Aligned are the 12-mer sequence (UMS) and
the 14-mer sequence (H14) located at the C. fasciculata kDNA minicircle H-strand as follows: at the proposed
oriL, the UMS sequence at position 489-500; at the proposed
oriH, the H14 sequence at position 396-409.
Frames denote the identical sequence elements in both
binding sequences. Minicircle map positions are following Sugisaki and
Ray (45).
The data presented here, demonstrating the specific recognition of unique sequences at the replication origins of both DNA strands, support a potential role for UMSBP at the replication origin of kDNA minicircles. Moreover, preliminary studies in synchronized cell cultures,2 suggesting the cell cycle-controlled expression of UMSBP during S-phase, may also implicate UMSBP with the process of kDNA replication.
If UMSBP functions as a minicircle initiator protein, could it bind simultaneously to the conserved sequences at both ori-gins, thereby affecting the concurrent origin-directed initiation of both complementary DNA strands?
The data presented here, using single-stranded DNA ligands, suggest
that UMSBP binds either an oriL-UMS or an
oriH-H14, but not both ligands simultaneously (Fig. 9).
However, binding of the protein at the native replication origin may
also be affected by other sequence elements. We have
observed3 that binding of UMSBP to a 312-base
pair minicircle fragment, containing both the oriL and
oriH sequences, results in the formation of a nucleoprotein
complex that displays a much higher electrophoretic mobility than that
observed with the unbound DNA. It has been previously observed by
electron microscopy that many site-specific DNA-binding proteins that
bind to several target sites in the DNA generate highly organized
nucleoprotein structures. The DNA in many of these nucleoprotein
structures has been observed to assume special deformations, in which
the DNA appears to be bent, wrapped, looped, or unwound (43, 44). The
unique anomalous electrophoretic properties, observed with
nucleoprotein complex of UMSBP and the native minicircle fragment
containing both origins, may imply a similar special structural
deformation of the DNA in this complex. Further analysis of the
interactions of UMSBP with native kDNA minicircles has yet to be
conducted to elucidate the nature of the nucleoprotein complex and the
mode of action of UMSBP at the minicircle origin of replication.
| |
ACKNOWLEDGEMENTS |
|---|
We gratefully acknowledge Ran Avrahami for the help and advice with the statistical analyses. We are grateful to Shani Balanga for excellent technical assistance.
| |
FOOTNOTES |
|---|
* This study was supported in part by United States-Israel Binational Science Foundation Grant BSF 93-00299, the Israel Science Foundation, administered by the Israel Academy of Sciences and Humanities Grant ISF 53/95, and the Israeli Ministry of Science Grant 6114.The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
Supported by a fellowship to minority students from the Israeli
Ministry of Science.
§ To whom correspondence should be addressed. Tel.: 972-2-6758089; Fax: 972-2-6757425; E-mail: shlomai{at}cc.huji.ac.il.
2 K. Abu-Elneel, I. Kapeller, R. Shtaierman, and J. Shlomai, unpublished observations.
3 K. Abu-Elneel, and J. Shlomai, unpublished observations.
| |
ABBREVIATIONS |
|---|
The abbreviations used are: kDNA, kinetoplast DNA; UMS, universal minicircle sequence; UMSBP, universal minicircle sequence-binding protein; oriL, replication origin of the kDNA minicircles L-strand; oriH, replication origin of the kDNA minicircles H-strand; H, heavy; L, light; F, fraction.
| |
REFERENCES |
|---|
|
|
|---|
This article has been cited by other articles:
![]() |
N. Milman, S. A. Motyka, P. T. Englund, D. Robinson, and J. Shlomai Mitochondrial origin-binding protein UMSBP mediates DNA replication and segregation in trypanosomes PNAS, December 4, 2007; 104(49): 19250 - 19255. [Abstract] [Full Text] [PDF] |
||||
![]() |
I. Onn, I. Kapeller, K. Abu-Elneel, and J. Shlomai Binding of the Universal Minicircle Sequence Binding Protein at the Kinetoplast DNA Replication Origin J. Biol. Chem., December 8, 2006; 281(49): 37468 - 37476. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. M. Sinha, J. C. Hines, and D. S. Ray Cell Cycle-Dependent Localization and Properties of a Second Mitochondrial DNA Ligase in Crithidia fasciculata Eukaryot. Cell, January 1, 2006; 5(1): 54 - 61. [Abstract] [Full Text] [PDF] |
||||