JBC Ideal method for primary cell transfection

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Abu-Elneel, K.
Right arrow Articles by Shlomai, J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Abu-Elneel, K.
Right arrow Articles by Shlomai, J.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

J Biol Chem, Vol. 274, Issue 19, 13419-13426, May 7, 1999


Universal Minicircle Sequence-binding Protein, a Sequence-specific DNA-binding Protein That Recognizes the Two Replication Origins of the Kinetoplast DNA Minicircle*

Kawther Abu-ElneelDagger , Irit Kapeller, and Joseph Shlomai§

From the Department of Parasitology, The Hebrew University-Hadassah Medical School, Jerusalem 91120, Israel

    ABSTRACT
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

Replication of the kinetoplast DNA minicircle lagging (heavy (H))-strand initiates at, or near, a unique hexameric sequence (5'-ACGCCC-3') that is conserved in the minicircles of trypanosomatid species. A protein from the trypanosomatid Crithidia fasciculata binds specifically a 14-mer sequence, consisting of the complementary strand hexamer and eight flanking nucleotides at the H-strand replication origin. This protein was identified as the previously described universal minicircle sequence (UMS)-binding protein (UMSBP) (Tzfati, Y., Abeliovich, H., Avrahami, D., and Shlomai, J. (1995) J. Biol. Chem. 270, 21339-21345). This CCHC-type zinc finger protein binds the single-stranded form of both the 12-mer (UMS) and 14-mer sequences, at the replication origins of the minicircle L-strand and H-strand, respectively. The attribution of the two different DNA binding activities to the same protein relies on their co-purification from C. fasciculata cell extracts and on the high affinity of recombinant UMSBP to the two origin-associated sequences. Both the conserved H-strand hexamer and its flanking nucleotides at the replication origin are required for binding. Neither the hexameric sequence per se nor this sequence flanked by different sequences could support the generation of specific nucleoprotein complexes. Stoichiometry analysis indicates that each UMSBP molecule binds either of the two origin-associated sequences in the nucleoprotein complex but not both simultaneously.

    INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

Kinetoplast DNA (kDNA)1 is a unique extrachromosomal DNA network found in the single mitochondrion of parasitic flagellated protozoa of the family Trypanosomatidae. In Crithidia fasciculata, kDNA consists of about 5,000 DNA minicircles (2.5 kilobase pairs each) and about 50 DNA maxicircles (37 kilobase pairs each) interlocked topologically to form a DNA network (reviewed in Refs. 1-7). Minicircles, in most trypanosomatid species, are heterogeneous in sequence. However, two short sequences that are associated with the process of replication initiation and are located 70-100 nucleotides apart on the minicircle complementary DNA strands were conserved in minicircles of all the trypanosomatid species studied: the sequence GGGGTTGGTGTA, known as the universal minicircle sequence (UMS), in the minicircle heavy (H) strand, and the sequence ACGCCC in its light (L) strand (3).

The replication of kDNA is restricted to the discrete S-phase, approximately in parallel with the replication of the nuclear DNA (reviewed in Refs. 4, 5, 8, and 9). According to the current model for the network replication (10, 11), during the S-phase individual minicircles are released from the central zone of the network and replicate, each forming two nicked (and gapped) progeny minicircles that reattach to the periphery of the network (10-14). At the end of the S-phase, the network is composed of replicated, nicked, and gapped circles and has doubled in size. The final steps, which occur at the beginning of the G2 phase, include the physical splitting of the double-size network and the covalent closure of the circles, followed by the network segregation during cell division. Immunolocalization and in situ hybridization studies have co-localized free replicating minicircles and replication proteins to two peripheral antipodal sites of the kinetoplast disc, suggesting that these are the sites in which minicircle replication is conducted through the action of two replication complexes (14-16).

The replication of free minicircles has been studied in Trypanosoma equiperdum (17-20), C. fasciculata (21-25), and Leishmania tarentolae (26, 27). Minicircle replication initiates by the synthesis of an RNA primer at the UMS site. Elongation of the nascent L-strand displaces the parental L-strand, which serves as a template for the discontinuous H-strand synthesis.

We have previously reported on the presence in C. fasciculata of a sequence-specific single-stranded DNA-binding protein that binds specifically to the UMS. The protein, designated UMSBP, was purified to apparent homogeneity from C. fasciculata cell extracts (28, 29), and its encoding gene was cloned and analyzed (30, 31). The UMS-binding protein is a CCHC-type zinc finger dimer protein (31) of 27.4 kDa with a 13.7-kDa protomer (28). Whereas neither the duplex form of a UMS dodecamer nor a quadruplex DNA conformation are bound by UMSBP, the protein binds efficiently the natural double-stranded kDNA minicircle, as well as a duplex minicircle fragment containing the origin-associated UMS (32). These studies have revealed that the kDNA minicircle origin region is significantly curved and distorted, suggesting that binding of UMSBP at the native minicircle origin site may be facilitated through the local unwinding of the DNA double helix at unstacked dinucleotide sequences within the UMS element (32). Here, we report on the specific recognition of a sequence associated with the H-strand replication origin by UMSBP and discuss the protein sequence specificity and mode of binding at the origin region.

    EXPERIMENTAL PROCEDURES
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

Nucleic Acids, Nucleotides, Proteins, and Resins-- Synthetic deoxyoligonucleotides were prepared by an Applied Biosystems oligonucleotide synthesizer at the Bletterman Laboratory of the Interdepartmental Division, Faculty of Medicine, the Hebrew University of Jerusalem. Poly(dI-dC)·poly(dI-dC) was purchased from Roche Molecular Biochemicals. Phenyl-Sepharose was from Sigma and hydroxyapatite from Bio-Rad. Radioactive nucleotides were from NEN Life Science Products, and polynucleotide kinase was from New England Biolabs.

Cell Growth-- C. fasciculata cultures were grown at 28 °C with agitation (150-200 rpm), in a medium containing 37 g/liter brain-heart infusion, 20 µg/ml hemin, 100 units/ml penicillin, and 100 µg/ml streptomycin. Cells were harvested during late logarithmic growth phase by centrifugation at 6,000 × g and washed with 50 mM Tris-Cl, pH 7.5, and 100 mg/ml sucrose (enzyme grade, IBI). Cell paste was frozen in liquid nitrogen and stored at -76 °C.

Protein Purification-- Protein purification was carried out following the specific binding of the oriH-associated 14-mer sequence (H14, 5'-GTAGGGGCGTTCTG-3') oligonucleotide, by the mobility shift electrophoretic assay, as described below. Cell lysate (fraction I, 1.3 g of protein) was prepared from 9.2 g of C. fasciculata cell paste by gentle disruption of the Crithidia cell membrane, using a non-ionic detergent in hypotonic solution, and was further fractionated by ammonium sulfate precipitation, as described previously (33). 92.8 mg of protein, precipitated with 40-60% (of saturation, at 0 °C) ammonium sulfate (fraction II), were further purified as described below (see legend to Fig. 2). Preparation of recombinant UMSBP expressed in Escherichia coli as a glutathione S-transferase fusion, its specific proteolytic digestion, affinity chromatography, and further purification to apparent homogeneity were as we have previously described (34). Protein was determined following the method of Bradford (35).

Electrophoretic Mobility Shift Analysis-- Analyses were carried out as described previously (28, 29). The 10-µl standard reaction mixture contained 25 mM Tris-Cl, pH 7.5, 2 mM MgCl2, 1 mM dithiothreitol, 20% (v/v) glycerol, 2 µg of bovine serum albumin, 0.5 µg of poly(dI-dC)·poly(dI-dC), and the indicated amount of 5'-32P-labeled DNA ligands. Recombinant UMSBP or, alternatively, partially purified C. fasciculata protein, was added to the amounts indicated. Reaction mixtures were incubated at 0-30 °C for 30 min and electrophoresed in an 8% native polyacrylamide gel (1:32 bisacrylamide:acrylamide) in TAE buffer (6.7 mM Tris acetate, 3.3 mM sodium acetate, 1 mM EDTA, pH 7.5). Electrophoresis was conducted at 4 °C and 16 V/cm for 1.5 h. Gels were dried and exposed to x-ray films (Agfa Curix RP2 or Kodak X-Omat AR). Protein-DNA complexes were quantified by exposing the dried gels to an imaging plate (BAS-IIIs, Fuji) and analyzing it by a BioImaging Analyzer (model BAS1000, Fuji). One unit of UMSBP is defined as the amount of protein required for binding of 1 fmol of the oriL-associated UMS (5'-GGGGTTGGTGTA-3') or the oriH-associated 14-mer (H14, 5'-GTAGGGGCGTTCTG-3') DNA ligands, under the standard mobility shift assay conditions. The H14 DNA ligand (as well as some of its derivatives) exhibits two bands upon electrophoresis in native polyacrylamide gels. Only the fast migrating 14-mer species is capable of binding UMSBP. The two bands represent inter-convertible conformational forms as follows: (i) boiling of the oligonucleotides, prior to their electrophoresis in native polyacrylamide gels, results in the disappearance of the slow migrating species; (ii) only one 14-mer band is observed upon electrophoresis in denaturing polyacrylamide gels. In some experiments, as indicated in each case, oligonucleotides were heated at 95 °C for 2 min and then transferred immediately to 0 °C (for up to 30 min), prior to their use in the binding reaction, to eliminate potential secondary structures.

Measurements of Equilibrium Binding Constants-- Measurements of equilibrium binding constants, for the interactions of purified UMSBP with various DNA molecules, were carried out as described by Fried and Crothers (36, 37) and Liu-Johnson et al. (38). Experiments were carried out under the standard mobility shift assay conditions, by serial dilutions of both UMSBP and the oligonucleotide probe, while keeping constant the molar ratio of added protein [Padded] to total DNA [DNAtotal] and varying the total concentration. Reactions were incubated for 30 min at 30 °C. Quantification of protein-DNA complexes was carried out using a BioImaging analyzer, as described above. Data were analyzed as described by Liu-Johnson et al. (38), plotting (1 - r)(alpha  - r)/r versus 1/[DNAtotal], where r is the fraction of the DNA that is in the protein-DNA complex band; [DNAtotal] is the total concentration of the DNA added, and alpha  is the unknown but constant ratio of active protein to total DNA. The equation is solved by searching for an alpha  value that will yield the best line passing through the origin. The slope reciprocal yields the binding constant (K). The fraction (beta ) of protein that is active in DNA binding, as judged by the ability to form a protein-DNA complex band in gel electrophoresis, is calculated from alpha , the total concentration of DNA, and the concentration of added protein using the equation: beta  = alpha [DNAtotal]/[Padded] (38). The value of beta  is usually significantly lower than 1 (38).

    RESULTS
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

A Protein in C. fasciculata That Interacts Specifically with a Unique OriH-associated Sequence-- It has been previously suggested that discontinuous replication of the minicircle H-strand initiates at or near the conserved hexameric sequence 5'-ACGCCC-3', of the displaced parental L-strand (21, 22), at the proposed H-strand replication origin (oriH). A protein that interacts specifically with this unique site in kDNA minicircles has been detected in C. fasciculata cell extracts. Electrophoretic mobility shift analysis using oriH-associated sequences revealed (Fig. 1) that an H-strand 14-mer sequence (H14, 5'-GTAGGGGCGTTCTG-3'), which consists of the conserved hexamer (underlined) and 4 nucleotides flanking its 3' and 5' termini, supports the generation of specific nucleoprotein complexes. Such protein-DNA complexes could not be detected with either the complementary L-strand (L14, Fig. 1) or the duplex form of this sequence (not shown). It was further observed that neither the conserved L-strand hexameric sequence nor its complementary H-strand sequence, per se, constitutes a specific recognition site for the oriH binding activity. No protein-DNA complexes could be detected with hexamer concentrations as high as 12 nM, whereas a 14-mer sequence, containing the H-strand hexamer and 8 flanking nucleotides, supports the efficient generation of specific nucleoprotein complexes at ligand concentrations of 2 orders of magnitude lower (Fig. 1).


View larger version (17K):
[in this window]
[in a new window]
 
Fig. 1.   Binding of the oriH-binding protein is preferentially to an H-strand sequence. Electrophoretic mobility shift assays and their quantification were conducted as described previously (28, 29), using fraction II (as described under "Experimental Procedures") as the source of protein (8 ng/assay) and increasing concentrations (0-250 pg) of either of the following 32P-labeled DNA ligands: the H-strand H14, 5'-GTAGGGGCGTTCTG-3' (), or the L-strand L14, 5'-CAGAACGCCCCTAC-3' (black-triangle) 14-mers; the conserved hexameric sequences: L-strand, 5'-ACGCCC-3' (open circle ), or H-strand, 5'-GGGCGT-3' () 6-mers.

UMSBP Binds Conserved Sequences at the Replication Origins of the Two Complementary Strands of kDNA Minicircles-- Purification of the protein that interacts specifically with the unique oriH-associated 14-mer (H14) sequence from C. fasciculata cell extracts has revealed its consistent co-purification with the previously described UMS-binding protein (UMSBP) (28, 29). Similar levels of UMS binding activity and H14 binding activity were measured in crude cell lysates (FI, Table I); both activities were fractionated at the same pattern through a gradual ammonium sulfate precipitation (FII, Table I) and co-chromatographed by hydrophobic chromatography on phenyl-Sepharose (Fig. 2A) and hydroxyapatite chromatography (Fig. 2B). These observations indicated that the same protein, UMSBP, might be responsible for the specific binding of the two different origin-associated sequences.

                              
View this table:
[in this window]
[in a new window]
 
Table I
Distribution of UMS and H14 DNA binding activities in fractionated C. fasciculata cell extracts
Cell lysate (Fraction I (FI), 1.3 g protein) was prepared from 9.2 g of C. fasciculata cell paste, as we have previously described (33). Cleared lysates were fractionated by gradual precipitation using 5-20, 20-40, 40-60, and 60-80% (of saturation, at 0 °C) ammonium sulfate, to obtain Fraction II (33). DNA binding activity was assayed under the standard binding assay conditions as we have previously described (28,29), using the electrophoretic mobility shift analysis, and quantified using phosphorimaging, as described under "Experimental Procedures." The 32P-labeled H14 5'-GTAGGGGCGTTCTG-3' and UMS 5'-GGGGTTGGTGTA-3' (10.6 fmol/assay) were used as radioactive ligands.


View larger version (21K):
[in this window]
[in a new window]
 
Fig. 2.   Chromatography of the oriH-binding protein and UMSBP on phenyl-Sepharose and hydroxyapatite. A, 92.8 mg of fraction II protein (as described under "Experimental Procedures") was loaded onto a 10-ml phenyl-Sepharose column, equilibrated with 50 mM Tris-Cl, pH 7.5, 1.5 M ammonium sulfate, 2 mM MgCl2, 4 mM beta -mercaptoethanol, and 1 mM phenylmethylsulfonyl fluoride. The column was washed subsequently with 2-bed volumes each of the equilibration buffer, containing 1.5 and 1.3 M ammonium sulfate, and proteins were eluted with a linear gradient of 1.3 to 0.4 M ammonium sulfate in this buffer, to yield fraction III (FIII). B, FIII protein was concentrated on a subsequent small (750 µl) phenyl-Sepharose column that was equilibrated and washed as above and eluted stepwise by 1.2 and 0.6 M, and no ammonium sulfate in the equilibration buffer, to yield fraction IV (FIV). 0.55 mg of FIV protein was loaded onto a 100-µl hydroxyapatite column, equilibrated with 50 mM Tris-Cl, pH 7.5, 2 mM MgCl2, and 4 mM beta -mercaptoethanol. The column was washed with 2-bed volumes of the equilibration buffer, and proteins were eluted stepwise using 50, 100, 150 and 200 mM potassium phosphate in the equilibration buffer to yield fraction V. Electrophoretic mobility shift assays were conducted using either the UMS 12-mer (open circle ) or the H14 () oligonucleotides as 32P-labeled DNA ligands. down-triangle denotes the ammonium sulfate and potassium phosphate concentrations.

To explore the possibility that UMSBP may bind both the conserved oriL-UMS and oriH-H14 sequences, we have measured the capacity of recombinant UMSBP, which was expressed in bacteria by a plasmid carrying the C. fasciculata UMSBP gene and purified to apparent homogeneity (34), to bind the two sequences. Electrophoretic mobility shift analyses, using the two sequences as radioactive ligands (Fig. 3), demonstrate clearly that both the authentic eukaryotic UMSBP, which was purified from C. fasciculata cell extracts (Fig. 3, lanes b and e), and pure recombinant UMSBP that was expressed in bacteria (Fig. 3, lanes a and d) bind efficiently both DNA ligands. Binding of the recombinant UMSBP to both origin sequences implies that recognition of the two minicircle sequences is an intrinsic property of UMSBP and has not resulted from an incidental cross-contaminating DNA binding activity in the crithidial protein preparation. Moreover, binding competition analyses, in which the binding of UMSBP to the oriH-associated H14 and the oriL-associated UMS was challenged, reciprocally, with increasing molar excess of these ligands unlabeled (Fig. 4), revealed the efficient competition of both ligands on the binding of UMSBP, with some preference of UMSBP to the H14 over the UMS ligand. Furthermore, the equilibrium binding constant measured for the interaction of UMSBP with the H-strand H14 is 1.1 × 109 M-1 (Fig. 4, inset), a value close to the one measured for UMSBP interaction with the UMS element (28), implying the similar binding affinities of pure UMSBP for the two DNA ligands.


View larger version (57K):
[in this window]
[in a new window]
 
Fig. 3.   Purified recombinant UMSBP binds the oriH-associated 14-mer. Electrophoretic mobility shift assays were conducted as above, using either of the following protein preparations. In lanes a and d, recombinant UMSBP (0.5 ng/assay), which was expressed in induced E. coli carrying the C. fasciculata UMSBP gene, as a glutathione S-transferase fusion, purified by affinity chromatography using glutathione-agarose beads, proteolitically cleaved by Xa-protease factor to remove the glutathione S-transferase moiety, and then purified to apparent homogeneity by phenyl-Sepharose chromatography, as we have previously described (34); lanes b and e, fraction III (FIII) protein preparation (2 ng/assay), obtained by purification of C. fasciculata fraction II preparation using phenyl-Sepharose chromatography, as described under the "Experimental Procedures" and the legend to Fig. 2. The 32P-labeled DNA ligands used are as follows: the oriH 14-mer H14 and the oriL-UMS 12-mer sequence; lanes c and f, free H14 and UMS DNA, respectively. The H14 ligand exhibits two DNA bands, of which only the fast migrating form is capable of binding UMSBP. These two bands represent two interconvertible conformational forms of H14 DNA, as described under "Experimental Procedures."


View larger version (22K):
[in this window]
[in a new window]
 
Fig. 4.   The oriL-UMS and oriH-H14 compete with each other upon the binding of UMSBP. Electrophoretic mobility shift assays and their quantification were as described above, using pure recombinant UMSBP (0.2 ng/assay). The 32P-labeled DNA ligands (10.64 fmol/assay) were either H14 (circles) or UMS (triangles) in the presence of increasing concentrations of these oligonucleotides as unlabeled competitors (0-50-fold, molar ratios), as follows: 32P-labeled H14, with unlabeled H14 competitor (); 32P-labeled H14, with unlabeled UMS competitor (open circle ); 32P-labeled UMS, with unlabeled UMS competitor (black-triangle); 32P-labeled UMS, with unlabeled H14 competitor (triangle ). Inset, determination of the equilibrium binding constant for the interaction of UMSBP with H14 DNA. Samples containing serial dilutions of both UMSBP and H14 DNA (at a constant molar ratio) were analyzed by the mobility shift electrophoretic assay, following the procedure of Fried and Crothers (36, 37) and Liu-Johnson et al. (38) as described under "Experimental Procedures." Data were analyzed by plotting (1 - r)(alpha  - r)/r versus 1/[DNAtotal] and adjusting alpha  to obtain a y intercept value of 0, where r is the fraction of DNA radioactivity that is in the band representing the protein-DNA complexes, [DNAtotal] is the total concentration of DNA in the reaction, and alpha  is the unknown, but constant, molar ratio of active protein to total DNA. The slope reciprocal yields a K value of 1.1 × 109 M-1. The fraction of active protein (beta ) can be calculated from alpha , the total concentration of DNA and the concentration of the added protein [Padded], using the equation beta  = alpha [DNAtotal]/[Padded], as described under "Experimental Procedures." For the data in Fig. 4, alpha  = 0.69 and beta  = 0.19.

UMSBP Recognizes Specifically a 14-Mer Sequence at the OriH H-strand-- Binding of pure UMSBP to both DNA ligands is sequence-specific. Binding competition analyses (Fig. 5) revealed that an excess of 2 orders of magnitude of a non-related oligonucleotide (HG15) failed to displace both the oriH-H14 and the oriL-UMS from their respective nucleoprotein complexes, indicating the high specificity of these protein-DNA interactions.


View larger version (21K):
[in this window]
[in a new window]
 
Fig. 5.   . Binding of UMSBP to both H14 and UMS is sequence-specific. Electrophoretic mobility shift assays and their quantification were as described above, using pure recombinant UMSBP (0.2 ng/assay). The 32P-labeled DNA ligands were either H14 or UMS (10.64 fmol/assay) in the presence of increasing concentrations of the unlabeled oligonucleotide competitor HG15: 5'-CAAAGAATATATCAG-3' (0-50-fold, molar ratios). open circle , 32P-labeled H14 probe and unlabeled H14 competitor; , 32P-labeled H14 probe and unlabeled HG15 competitor; black-triangle, 32P-labeled UMS probe and unlabeled UMS competitor; triangle ,32P-labeled UMS probe and unlabeled HG15 competitor.

As was shown above (Fig. 1), the oriH-conserved hexamer, per se, is not a sufficient recognition site for the binding of UMSBP. To define further the sequence directing the specific binding of UMSBP onto the oriH site, a series of oriH H-strand oligonucleotides (ranging from 6 to 26 nucleotides long), each containing the conserved hexamer and sequences flanking its 3' and/or 5' termini (0-10 residues long), were used as radioactive ligands in electrophoretic mobility shift analyses. As demonstrated in Fig. 6, DNA ligands containing less than 4 residues on both the 3' and 5' termini of the hexamer showed a significantly decreased binding by UMSBP. In fact, no nucleoprotein complexes could be detected by the electrophoretic mobility shift assay with oligonucleotides containing <3 residues, flanking both the 3'- and 5'-ends of the hexamer. This was also the case with ligands consisting of the conserved hexamer and 2-6 residues flanking its 3' terminus or 2-4 residues flanking its 5' terminus. A significantly lower binding affinity is measured for UMSBP interaction with a 12-mer sequence containing 3 residues flanking both termini of the hexamer, with a measured binding constant of more than 7-fold higher than that measured for the interaction of UMSBP with H14 (Fig. 4, inset). On the other hand, using DNA ligands containing the hexamer flanked at both termini by sequences of >= 4 residues (ranging from 4 to 10 nucleotides), no further increase in UMSBP binding affinity (as deduced from equilibrium binding constant determinations) could be measured.


View larger version (65K):
[in this window]
[in a new window]
 
Fig. 6.   The UMSBP binding sequence at oriH. Electrophoretic mobility shift assays and their quantification were as described above, using recombinant UMSBP (0.2 ng/assay). Oligonucleotides were heated at 95 °C for 2 min, prior to their use in the binding reaction, to eliminate any potential secondary structures, as described under "Experimental Procedures." The 32P-labeled DNA ligands (12.5 fmol/assay) were as follows: a, GGGCGT; b, AGGGGCGTTC; c, TAGGGGCGTTCT; d, GTAGGGGCGTTCTG; e, GGTAGGGGCGTTCTGC; f, GGGTAGGGGCGTTCTGCG; g, CGGGTAGGGGCGTTCTGCGA; h, TCTCGGGTAGGGGCGTTCTGCGAAAA; i, GGGCGTTC; j, GGGCGTTCTG; k, GGGCGTTCTGCG; l, AGGGGCGT; m, GTAGGGGCGT; n, GGGTAGGGGCGT; o, UMS, GGGGTTGGTGTA. Italics indicate the conserved hexamer; bold indicates the hexamer flanking sequences. The additional radioactive bands at the bottom of lanes a, b, c, and g represent residual [gamma -32P]-ATP in these oligonucleotides preparations.

These observations indicated that an H-strand sequence consisting of 14 nucleotides, including the conserved hexamer and 4 residues flanking its 3' and 5' termini, forms a recognition site for UMSBP at the oriH site. Intriguingly, whereas UMSBP shows low affinity to a 10-mer ligand consisting of the hexamer and 4 residues flanking its 5' terminus, addition of only two nucleotides at its 5'-end has turned the resulting 12-mer sequence into a ligand that is bound by UMSBP as efficiently as H14 (Fig. 6). The equilibrium binding constant measured for the interaction of this ligand with UMSBP is 1.9 × 109 M-1, a value close to those measured for the protein interactions with H14 (Fig. 4, inset) and UMS (28). Binding of UMSBP to these oriH-associated sequences is discussed below.

We have explored the possibility that specific binding of UMSBP to the H14 sequence may reflect a specific recognition of the conserved hexamer, whereas the flanking sequence may contribute, nonspecifically, to the stability of the nucleoprotein complex. The binding assays described in Fig. 7 clearly demonstrate that recognition of the H-strand 14-mer sequence is directed by both the conserved hexamer "core" and the 4 residues flanking both termini. It was found that neither a 14-mer oligonucleotide, consisting of the L-strand hexamer and 8 nucleotides flanking the hexamer on the complementary H-strand, nor the reciprocal H-strand complementary hexamer and 8 nucleotides flanking the hexamer on the L-strand could support the binding of UMSBP. Based on these observations (Figs. 1, 6, and 7), it is suggested that the conserved H-strand hexamer is essential but is not sufficient for recognition by UMSBP and that the nucleotides flanking the conserved hexamer at the oriH H-strand are essential for the specific binding of UMSBP onto this site.


View larger version (16K):
[in this window]
[in a new window]
 
Fig. 7.   Binding is specific both to the H-strand hexamer and its flanking sequences. Electrophoretic mobility shift assays and their quantification were conducted as above, using increasing concentrations (0-100 pg) of the following 32P-labeled DNA ligands: , the H-strand hexamer (underlined) and 8 nucleotides flanking it (bold) on the H-strand (H14, GTAGGGGCGTTCTG); black-triangle, the L-strand hexamer (underlined) and 8 nucleotides flanking it (bold) on the H-strand (GTAGACGCCCTCTG); open circle , the H-strand hexamer (underlined) with the 8 nucleotides flanking it (bold) on the complementary L-strand (CAGAGGGCGTCTAC).

UMSBP Binds One H14 Element in the Nucleoprotein Complex-- Previous studies have shown that UMSBP binds only one UMS sequence in the nucleoprotein complex (28). The experiment described in Fig. 8 shows that this is also the case in the protein interaction with the oriH-H14 sequence. We have followed here the methodology employed in our previous studies on the binding of UMSBP to UMS (28). Two DNA ligands were used as follows: (i) an oligonucleotide consisting of the oriH-associated H14 (as above); (ii) a 26-mer sequence (H26), containing the same 14-mer H14 sequence plus 12 nucleotides flanking it (six residues at each terminus) at the oriH site. Whereas the affinities of UMSBP to both ligands, as deduced from equilibrium binding constants determination (not shown), are similar (see also Fig. 6, lanes d and h), the expected electrophoretic mobilities of the resulting nucleoprotein complexes differ significantly and can be readily distinguished upon electrophoresis in native polyacrylamide gels. In the presence of both ligands in a binding reaction, the following complexes could be expected. If UMSBP binds only one binding element, then two types of complexes are expected, one with the 14-mer (H14) and the other with the 26-mer (H26). However, if UMSBP interacts simultaneously with both ligands, then (under ligand saturation conditions) three types of complexes are expected as follows: one with the 14-mer (H14), a second with the 26-mer (H26), and a third with both ligands. Fig. 8 describes the results of an experiment in which the oligonucleotides H14 and H26 were mixed together at various molar ratios, as indicated, and used as radioactive probes in an electrophoretic mobility shift experiment with UMSBP. Reciprocal titration of one species of DNA ligand over the other yielded only two types of protein-DNA complexes, one with the H14 DNA and the other with the H26 DNA. No additional species of protein-DNA complexes could be detected, indicating that only one H14 site in either the 14-mer or the 26-mer is bound by UMSBP in the protein-DNA complex. As shown in Fig. 8, the complex of UMSBP with the shorter oligonucleotide (H14-UMSBP) migrates slower in the gel than the complex generated with the longer one (H26-UMSBP). This is also observed in the experiment described in Fig. 9, where UMSBP forms a nucleoprotein complex of a lower electrophoretic mobility with the 12-mer UMS (UMS-UMSBP) than with a larger 26-mer containing the H14 sequence (H26-UMSBP). We have previously reported that a complex of UMSBP with the 12-mer UMS displayed a lower electrophoretic mobility than its complex with a UMS-containing 40-mer oligonucleotide (28). This behavior of UMSBP-containing nucleoprotein complexes may reflect an effect of UMSBP on the structure of the bound DNA. Its nature and potential biological significance have yet to be explored.


View larger version (78K):
[in this window]
[in a new window]
 
Fig. 8.   Stoichiometry of oriH-H14 sites bound in the UMSBP-[H14-DNA] complex. UMSBP (0.5 ng) was incubated under the standard mobility shift assay conditions in a series of binding reaction mixtures containing 25 fmol total of 5'-32P-labeled H14-DNA (as above) and H26-DNA (5'-TCTCGGGTAGGGGCGTTCTGCGAAAA-3') that contains the H14 sequence (underlined) and 12 flanking residues (bold), at the following H26/H14 molar ratios: only H26, 7/1, 3/1, 1.7/1, 1/1, 1/1.7, 1/3, 1/7, only H14 (lanes b-j, respectively); lanes a and k, free H26-DNA and H14-DNA markers, respectively. Oligonucleotides were heated at 95 °C for 2 min prior to their use in the binding reaction to eliminate any potential secondary structures, as described under "Experimental Procedures." Reaction products were electrophoresed in a native 6.5% polyacrylamide gel at 2 °C and 16 V/cm for 2 h. Indicated are UMSBP-[H14-DNA] and UMSBP-[H26-DNA] complexes and free H14 and H26 oligonucleotides.


View larger version (74K):
[in this window]
[in a new window]
 
Fig. 9.   Either the UMS or the H14 site is bound in the UMSBP-DNA complex but not both simultaneously. UMSBP (0.5 ng) was incubated under the standard mobility shift assay conditions in a series of binding reaction mixtures containing 25 fmol total of 5'-32P-labeled UMS 12-mer (for sequence, see legend to Fig. 6) and H26 (for sequence, see legend to Fig. 8) oligonucleotides at the following H26/UMS molar ratios: only H26, 7/1, 3/1, 1.7/1, 1/1, 1/1.7, 1/3, 1/7, only UMS (lanes b-j, respectively); lanes a and k, free H26-DNA and UMS-DNA markers, respectively. Oligonucleotides were heated at 95 °C for 2 min prior to their use in the binding reaction to eliminate any potential secondary structures, as described under "Experimental Procedures." Reaction products were electrophoresed in a native 8% polyacrylamide gel at 2 °C and 16 V/cm for 3 h. Indicated are UMSBP-[H26-DNA] and UMSBP-[UMS-DNA] complexes and free H26 and UMS oligonucleotides.

UMSBP Binds Either an OriL-UMS or an OriH-H14 Sequence but Not Both Sequences Simultaneously-- Considering the adjacent location of the UMS and H14 sequences (approximately 80 nucleotides apart in the minicircle H-strand), the question of whether or not UMSBP is capable of the simultaneous binding of both the oriL and oriH sequences may be pertinent to its putative role and mode of action at the minicircle replication origin. To address this question, we have followed the methodology described above ((28) Fig. 8), using two different DNA ligands as follows: (i) the H26 oligonucleotide containing the 14-mer element of oriH (as above); (ii) the oriL-associated 12-mer UMS sequence. Following the same rationale as discussed above, in the presence of both ligands in a binding reaction, it is expected that binding of only one binding element by UMSBP will result in the formation of two types of complexes (H26-UMSBP and UMS-UMSBP), but simultaneous interaction of UMSBP with both DNA ligands (under ligand saturation conditions) should yield a third type of protein-DNA complex that contains both ligands (UMS-UMSBP-H26). The electrophoretic mobility shift analysis described in Fig. 9 clearly demonstrates that a reciprocal titration of one species of DNA ligand over the other at various molar ratios yielded only two types of protein-DNA complexes, one with the H26 and the other with UMS. No additional species of protein-DNA complexes could be detected, indicating that only one DNA molecule of either sequence is bound by UMSBP in the nucleoprotein complex.

    DISCUSSION
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

Origin-directed initiation of DNA replication is regulated through the specific interactions of an origin-binding protein (the initiator protein) with a unique origin-associated sequence (the replicator sequence) (39) (reviewed in Refs. 40-42). Replication of kDNA minicircles initiates by the synthesis of an RNA primer at the conserved UMS site, the presumed replicator sequence for kDNA minicircle L-strand replication. Searching for the corresponding initiator protein, we have previously purified and characterized a sequence-specific single-stranded UMS-binding protein (UMSBP) from C. fasciculata cell extracts (28, 29) and described its encoding gene and genomic locus in the trypanosomatid cell (30, 31). On the basis of its specific binding to a conserved minicircle origin sequence (28, 29) and to free native kDNA minicircles and kDNA networks (32), we have suggested a potential role for UMSBP as a minicircle oriL-binding protein.

We have searched here for a protein that interacts specifically with the potential H-strand replicator sequence, the hexameric sequence 5'-ACGCCC-3' that was conserved at the proposed oriH. We have found that UMSBP (that has been originally purified based on its affinity to the oriL-associated UMS (28, 29)) binds also an oriH-associated 14-mer sequence (H14) that consists of the conserved hexamer and flanking residues. Several lines of observations support the conclusion that binding of both the oriH-associated H14 and the oriL-associated UMS is an intrinsic property of UMSBP. (i) The two DNA-binding activities are consistently co-purified from C. fasciculata cell extracts, through several different fractionation and chromatography steps (Table I and Fig. 2). (ii) Recombinant UMSBP, expressed in bacteria by a plasmid carrying the cloned C. fasciculata UMSBP gene (and subsequently purified to apparent homogeneity), binds the H14 sequence as efficiently as it binds the UMS (Fig. 3). (iii) The two origin-associated sequences compete efficiently with each other upon the binding of UMSBP. Binding competition analyses as well as direct measurements of equilibrium binding constants for the two protein-DNA interactions revealed similar binding affinities of UMSBP for the two binding sites (Fig. 4 and inset) (28).

Our search for an oriH-binding protein has led to several intriguing observations. First, it was found that although the conserved hexameric sequence is essential for specific protein-DNA interactions, it could not per se direct the binding of UMSBP onto the oriH site (Figs. 1, 6, and 7). Second, although this sequence resides within the H-strand origin site, it is located at the minicircle H-strand, which is complementary to the template (L) strand for H-strand synthesis (Fig. 1). Binding of UMSBP to the non-template H-strand at this site could have been predicted on the basis of the protein sequence specificity (28) and the similarity of the two bound sequences (Fig. 10). Both sequences consist of the same sequence elements, including a cluster of 4-G residues, followed by a TT and a TG dinucleotide elements. There are also additional sequence similarities (e.g. a GTT, at positions 4-6 of UMS and 9-11 of H14, or a TA dinucleotide at positions 11 and 12 of UMS and 2 and 3 in H14). UMSBP-binding sites are specific nucleotide sequences of a high G content. Analyses of point mutations, introduced at each individual residue in the UMS-binding site, revealed the sequence specificity of these protein-DNA interactions (29). These studies clearly demonstrated the different contribution of residues that are located at different positions in the binding sequence to the UMS-UMSBP interactions. These analyses revealed the significance of the G residues at positions 3, 4, 7, 8, and 10 in UMS for the specific protein-DNA interactions. A possible role for the "kinkable" (deformable) TpG and TpA stacks in the untwisting (or distortion) of the native UMS element has been previously suggested (32). Furthermore, we have previously shown (28, 29) that UMSBP binds efficiently the 12-mer sequences GGGGTTGGGGTT and AGGGTTAGGGTT, representing the telomeric repeats of ciliates and vertebrate chromosomes, respectively. Here we observed the high affinity of UMSBP to the sequence 5'-G1G2G3T4A5G6G7G8G9C10G11T12-3', consisting of the conserved hexamer (bold) and a 5'-flanking 6-mer sequence (Fig. 6), that similarly contains two clusters of G residues (in italics) separated by a TA (underlined) dinucleotide sequence. This oriH-associated sequence may provide an additional, or alternative, site for the binding of UMSBP. Several features of the UMSBP sequence-specificity, such as the effect of the G1and G14 residues in H14 upon the binding of UMSBP (Fig. 6, lane c versus d), has yet to be explored.


View larger version (12K):
[in this window]
[in a new window]
 
Fig. 10.   . UMSBP binding sequences in kDNA minicircles. Aligned are the 12-mer sequence (UMS) and the 14-mer sequence (H14) located at the C. fasciculata kDNA minicircle H-strand as follows: at the proposed oriL, the UMS sequence at position 489-500; at the proposed oriH, the H14 sequence at position 396-409. Frames denote the identical sequence elements in both binding sequences. Minicircle map positions are following Sugisaki and Ray (45).

The data presented here, demonstrating the specific recognition of unique sequences at the replication origins of both DNA strands, support a potential role for UMSBP at the replication origin of kDNA minicircles. Moreover, preliminary studies in synchronized cell cultures,2 suggesting the cell cycle-controlled expression of UMSBP during S-phase, may also implicate UMSBP with the process of kDNA replication.

If UMSBP functions as a minicircle initiator protein, could it bind simultaneously to the conserved sequences at both ori-gins, thereby affecting the concurrent origin-directed initiation of both complementary DNA strands?

The data presented here, using single-stranded DNA ligands, suggest that UMSBP binds either an oriL-UMS or an oriH-H14, but not both ligands simultaneously (Fig. 9). However, binding of the protein at the native replication origin may also be affected by other sequence elements. We have observed3 that binding of UMSBP to a 312-base pair minicircle fragment, containing both the oriL and oriH sequences, results in the formation of a nucleoprotein complex that displays a much higher electrophoretic mobility than that observed with the unbound DNA. It has been previously observed by electron microscopy that many site-specific DNA-binding proteins that bind to several target sites in the DNA generate highly organized nucleoprotein structures. The DNA in many of these nucleoprotein structures has been observed to assume special deformations, in which the DNA appears to be bent, wrapped, looped, or unwound (43, 44). The unique anomalous electrophoretic properties, observed with nucleoprotein complex of UMSBP and the native minicircle fragment containing both origins, may imply a similar special structural deformation of the DNA in this complex. Further analysis of the interactions of UMSBP with native kDNA minicircles has yet to be conducted to elucidate the nature of the nucleoprotein complex and the mode of action of UMSBP at the minicircle origin of replication.

    ACKNOWLEDGEMENTS

We gratefully acknowledge Ran Avrahami for the help and advice with the statistical analyses. We are grateful to Shani Balanga for excellent technical assistance.

    FOOTNOTES

* This study was supported in part by United States-Israel Binational Science Foundation Grant BSF 93-00299, the Israel Science Foundation, administered by the Israel Academy of Sciences and Humanities Grant ISF 53/95, and the Israeli Ministry of Science Grant 6114.The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

Dagger Supported by a fellowship to minority students from the Israeli Ministry of Science.

§ To whom correspondence should be addressed. Tel.: 972-2-6758089; Fax: 972-2-6757425; E-mail: shlomai{at}cc.huji.ac.il.

2 K. Abu-Elneel, I. Kapeller, R. Shtaierman, and J. Shlomai, unpublished observations.

3 K. Abu-Elneel, and J. Shlomai, unpublished observations.

    ABBREVIATIONS

The abbreviations used are: kDNA, kinetoplast DNA; UMS, universal minicircle sequence; UMSBP, universal minicircle sequence-binding protein; oriL, replication origin of the kDNA minicircles L-strand; oriH, replication origin of the kDNA minicircles H-strand; H, heavy; L, light; F, fraction.

    REFERENCES
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES
  1. Englund, P. T., Hajduk, S. L., and Marini, S. (1982) Annu. Rev. Biochem. 51, 695-726[CrossRef][Medline] [Order article via Infotrieve]
  2. Ray, D. S. (1987) Plasmid 17, 177-190[CrossRef][Medline] [Order article via Infotrieve]
  3. Ryan, K. A., Shapiro, T. A., Rauch, C. A., and Englund, P. T. (1988) Annu. Rev. Microbiol. 42, 339-358[CrossRef][Medline] [Order article via Infotrieve]
  4. Shapiro, T. A., and Englund, P. T. (1995) Annu. Rev. Microbiol. 49, 117-143[CrossRef][Medline] [Order article via Infotrieve]
  5. Shlomai, J. (1994) Parasitol. Today 10, 341-346
  6. Simpson, L. (1987) Annu. Rev. Microbiol. 41, 363-382[CrossRef][Medline] [Order article via Infotrieve]
  7. Stuart, K., and Feagin, J. E. (1992) Int. Rev. Cytol. 141, 65-88[Medline] [Order article via Infotrieve]
  8. Englund, P. T., Ferguson, M., Guilbride, D. L., Johnson, C. E., Li, C., Pérez-Morga, D., Rocco, L. J., and Torri, A. F. (1995) in Molecular Approaches to Parasitology (Boothroyd, J. C., and Komuniecki, R., eds), Vol. 12, pp. 147-161, Wiley-Liss, Inc., New York
  9. Torri, A. L., Carpenter, L. R., and Englund, P. T. (1996) in DNA Replication in Eukaryotic Cells (DePamphilis, M. L., ed), pp. 1029-1042, Cold Spring Harbor Laboratory, Cold Spring Harbor, NY
  10. Englund, P. T. (1979) J. Biol. Chem. 254, 4895-4900[Abstract/Free Full Text]
  11. Englund, P. T. (1978) Cell 14, 157-168[CrossRef][Medline] [Order article via Infotrieve]
  12. Brack, C., Delain, E., and Riou, G. (1972) Proc. Natl. Acad. Sci. U. S. A. 69, 1642-1646[Abstract/Free Full Text]
  13. Pérez-Morga, D., and Englund, P. T. (1993) J. Cell Biol. 123, 1069-1079[Abstract/Free Full Text]
  14. Pérez-Morga, D. L., and Englund, P. T. (1993) Cell 74, 703-711[CrossRef][Medline] [Order article via Infotrieve]
  15. Ferguson, M., Torri, A. F., Ward, D. C., and Englund, P. T. (1992) Cell 70, 621-629[CrossRef][Medline] [Order article via Infotrieve]
  16. Melendy, T., Sheline, C., and Ray, D. S. (1988) Cell 55, 1083-1088[CrossRef][Medline] [Order article via Infotrieve]
  17. Ntambi, J. M., and Englund, P. T. (1985) J. Biol. Chem. 260, 5574-5579[Abstract/Free Full Text]
  18. Ntambi, J. M., Shapiro, T. A., Ryan, K. A., and Englund, P. T. (1986) J. Biol. Chem. 261, 11890-11895[Abstract/Free Full Text]
  19. Ryan, K. A., and Englund, P. T. (1989) Mol. Cell. Biol. 9, 3212-3217[Abstract/Free Full Text]
  20. Ryan, K. A., and Englund, P. T. (1989) J. Biol. Chem. 264, 823-830[Abstract/Free Full Text]
  21. Birkenmeyer, L., and Ray, D. S. (1986) J. Biol. Chem. 261, 2362-2368[Abstract/Free Full Text]
  22. Birkenmeyer, L., Sugisaki, H., and Ray, D. S. (1987) J. Biol. Chem. 262, 2384-2392[Abstract/Free Full Text]
  23. Kitchin, P. A., Klein, V. A., and Englund, P. T. (1985) J. Biol. Chem. 260, 3844-3851[Abstract/Free Full Text]
  24. Kitchin, P. A., Klein, V. A., Ryan, K. A., Gann, K. L., Rauch, C. A., Kang, D. S., Wells, R. D., and Englund, P. T. (1986) J. Biol. Chem. 261, 11302-11309[Abstract/Free Full Text]
  25. Sheline, C., Melendy, T., and Ray, D. S. (1989) Mol. Cell. Biol. 9, 169-176[Abstract/Free Full Text]
  26. Sheline, C., and Ray, D. S. (1989) Mol. Biochem. Parasitol. 37, 151-157[CrossRef][Medline] [Order article via Infotrieve]
  27. Englund, P. T., DiMaio, C., and Price, S. S. (1977) J. Biol. Chem. 252, 6208-6216[Abstract/Free Full Text]
  28. Tzfati, Y., Abeliovich, H., Avrahami, D., and Shlomai, J. (1995) J. Biol. Chem. 270, 21339-21345[Abstract/Free Full Text]
  29. Tzfati, Y., Abeliovich, H., Kapeller, I., and Shlomai, J. (1992) Proc. Natl. Acad. Sci. U. S. A. 89, 6891-6895[Abstract/Free Full Text]
  30. Tzfati, Y., and Shlomai, J. (1998) Mol. Biochem. Parasitol. 94, 137-141[CrossRef][Medline] [Order article via Infotrieve]
  31. Abeliovich, H., Tzfati, Y., and Shlomai, J. (1993) Mol. Cell. Biol. 13, 7766-7773[Abstract/Free Full Text]
  32. Avrahami, D., Tzfati, Y., and Shlomai, J. (1995) Proc. Natl. Acad. Sci. U. S. A. 92, 10511-10515[Abstract/Free Full Text]
  33. Shlomai, J., and Linial, M. (1986) J. Biol. Chem. 261, 16219-16225[Abstract/Free Full Text]
  34. Abeliovich, H., and Shlomai, J. (1995) Anal. Biochem. 228, 351-354[CrossRef][Medline] [Order article via Infotrieve]
  35. Bradford, M. M. (1976) Anal. Biochem. 72, 248-254[CrossRef][Medline] [Order article via Infotrieve]
  36. Fried, M. G., and Crothers, D. M. (1981) Nucleic Acids Res. 9, 6505-6525[Abstract/Free Full Text]
  37. Fried, M. G., and Crothers, D. M. (1984) J. Mol. Biol. 172, 241-262[Medline] [Order article via Infotrieve]
  38. Liu-Johnson, H.-N., Gartenberg, M. R., and Crothers, D. M. (1986) Cell 47, 995-1005[CrossRef][Medline] [Order article via Infotrieve]
  39. Jacob, F., Brenner, S., and Cuzin, F. (1963) Cold Spring Harbor Symp. Quant. Biol. 28, 329-348
  40. Kornberg, A., and Baker, T. A. (1991) DNA Replication, 2nd Ed., pp. 511-552, W. H. Freeman & Co., San Francisco, CA
  41. DePamphilis, M. L. (1996) in DNA Replication in Eukaryotic Cells (DePamphilis, M. L., ed), pp. 45-86, Cold Spring Harbor Laboratory, Cold Spring Harbor, NY
  42. Stillman, B. (1996) Science 274, 1659-1664[Abstract/Free Full Text]
  43. Echols, H. (1986) Science 233, 1050-1056[Abstract/Free Full Text]
  44. Echols, H. (1990) J. Biol. Chem. 265, 14697-14700[Free Full Text]
  45. Sugisaki, H., and Ray, D. S. (1987) Mol. Biochem. Parasitol. 23, 253-263[CrossRef][Medline] [Order article via Infotrieve]


Copyright © 1999 by The American Society for Biochemistry and Molecular Biology, Inc.

Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
Proc. Natl. Acad. Sci. USAHome page
N. Milman, S. A. Motyka, P. T. Englund, D. Robinson, and J. Shlomai
Mitochondrial origin-binding protein UMSBP mediates DNA replication and segregation in trypanosomes
PNAS, December 4, 2007; 104(49): 19250 - 19255.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
I. Onn, I. Kapeller, K. Abu-Elneel, and J. Shlomai
Binding of the Universal Minicircle Sequence Binding Protein at the Kinetoplast DNA Replication Origin
J. Biol. Chem., December 8, 2006; 281(49): 37468 - 37476.
[Abstract] [Full Text] [PDF]


Home page
Eukaryot CellHome page
K. M. Sinha, J. C. Hines, and D. S. Ray
Cell Cycle-Dependent Localization and Properties of a Second Mitochondrial DNA Ligase in Crithidia fasciculata
Eukaryot. Cell, January 1, 2006; 5(1): 54 - 61.
[Abstract] [Full Text] [PDF]