JBC Ideal method for primary cell transfection

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Fish, E. N.
Right arrow Articles by Platanias, L. C.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Fish, E. N.
Right arrow Articles by Platanias, L. C.

J Biol Chem, Vol. 274, Issue 2, 571-573, January 8, 1999

COMMUNICATION
Activation of a CrkL-Stat5 Signaling Complex by Type I Interferons*

Eleanor N. FishDagger , Shahab Uddin§, Mete Korkmaz§, Beata MajchrzakDagger , Brian J. Druker, and Leonidas C. Platanias§parallel

From the Dagger  Department of Medical Genetics and Microbiology, University of Toronto, Toronto, Ontario M5S 3E2, Canada, the § Section of Hematology-Oncology, University of Illinois and West Side Veterans Affairs Hospital, Chicago, Illinois 60607, and the  Division of Hematology and Medical Oncology, Oregon Health Sciences University, Portland, Oregon 97201

    ABSTRACT
Top
Abstract
Introduction
Procedures
Results & Discussion
References

Type I interferons (IFNalpha and IFNbeta ) transduce signals by inducing tyrosine phosphorylation of Jaks and Stats, as well as the CrkL adapter, an SH2/SH3-containing protein which provides a link to downstream pathways that mediate growth inhibition. We report that Stat5 interacts constitutively with the IFN receptor-associated Tyk-2 kinase, and during IFNalpha stimulation its tyrosine-phosphorylated form acts as a docking site for the SH2 domain of CrkL. CrkL and Stat5 then form a complex that translocates to the nucleus. This IFN-inducible CrkL-Stat5 complex binds in vitro to the TTCTAGGAA palindromic element found in the promoters of a subset of IFN-stimulated genes. Thus, during activation of the Type I IFN receptor, CrkL functions as a nuclear adapter protein and, in association with Stat5, regulates gene transcription through DNA binding.

    INTRODUCTION
Top
Abstract
Introduction
Procedures
Results & Discussion
References

Type I interferons (IFNalpha ,1 IFNbeta , and IFNomega ) are pleiotropic cytokines that exhibit multiple biological effects including antiviral and growth-inhibitory activities (1, 2). Following engagement of the Type I IFN receptor by IFNalpha or IFNbeta , two kinases of the Janus family, Tyk-2 and Jak-1, are activated and phosphorylate the Stat proteins: Stat1, Stat2, Stat3, Stat4, and Stat5 (3, 4). Activated Stat proteins form distinct signaling complexes to regulate gene transcription. Stat1 and Stat2 form a heterodimer that associates with a member of the IFN regulatory factor family, p48, resulting in the formation of the mature ISGF3 complex that translocates to the nucleus to initiate gene transcription by binding to interferon-stimulated response elements (3, 4). Stat1 and Stat3 homo- and heterodimers and homodimers of Stat4, Stat5a, and Stat5b bind a palindromic sequence found in the promoters of IFN-stimulated genes (4, 5).

In addition to the Stat pathway, other signaling cascades are activated downstream of Jaks in IFNalpha signaling. These include the insulin receptor substrate (IRS) pathway that regulates activation of the phosphatidylinositol 3'-kinase (6-8) and the CrkL pathway that links the functional Type I IFN receptor complex to the growth-inhibitory C3G/Rap-1 cascade (9). In the present study we determined whether the CrkL pathway functions in coordination with the Stat pathway. Our data demonstrate that Stat5 is constitutively associated with the Tyk-2 kinase, and its IFN-phosphorylated form provides a docking site for the SH2 domain of CrkL. The resulting CrkL-Stat5 complex translocates to the nucleus to regulate gene transcription via GAS elements. Viewed together, these findings provide evidence for a novel function of CrkL as a nuclear adapter protein.

    EXPERIMENTAL PROCEDURES
Top
Abstract
Introduction
Procedures
Results & Discussion
References

Cells and Reagents-- The Daudi and KG1 human cell lines were grown in RPMI 1640 (Life Technologies, Inc.) supplemented with 10% (v/v) fetal bovine serum (Life Technologies, Inc.) and antibiotics. Human recombinant IFNalpha 2 was provided by Hoffmann-La Roche. Human recombinant IFNalpha -consensus (IFNCon1) was provided by Amgen Inc. Human recombinant IFNbeta was provided by Biogen Inc. (Cambridge, MA). The anti-CrkL and anti-Stat5b polyclonal antibodies were obtained from Santa Cruz Biotechnology (Santa Cruz, CA). The production of the pGEX-CrkLSH2 construct has been described previously (10).

Immunoprecipitations, Immunoblotting, and Glutathione S-Transferase Binding Studies-- Cells were stimulated with 104 units/ml of the indicated interferons as described previously (9). After stimulation, the cells were lysed in phosphorylation lysis buffer, and immunoprecipitations and immunoblotting using the ECL method were performed as described previously (9). Production of glutathione S-transferase fusion proteins and binding experiments using lysates from IFNalpha -untreated or -treated cells were performed as described previously (9, 11).

Genomic DNA Affinity Chromatography and Mobility Shift Assays-- Preparation of nuclear extracts, genomic DNA affinity chromatography, and mobility shift assays were performed essentially as described previously (12). A double-stranded oligodeoxynucleotide specific for Stat5 binding (AGATTTCTAGGAATTCAAATC), derived from the beta -casein promoter, was synthesized and used in gel shift assays.

    RESULTS AND DISCUSSION
Top
Abstract
Introduction
Procedures
Results & Discussion
References

We sought to identify the tyrosine kinase that regulates IFNalpha -induced activation of Stat5 and the mechanisms by which the protein is activated and binds DNA. When lysates from IFNalpha -stimulated KG1 myeloid cells were immunoprecipitated with an anti-Tyk-2 antibody and immunoblotted with antiphosphotyrosine, we noted that a tyrosyl phosphoprotein migrating as a doublet at 96/94 kDa was complexed with Tyk-2 (Fig. 1A). This protein corresponded to Stat5, as determined by immunoblotting with a specific anti-Stat5 antibody (Fig. 1B). The interaction of Stat5 with Tyk-2 was present prior to IFNalpha treatment and increased further after IFNalpha stimulation, suggesting that Stat5 interacts constitutively with Tyk-2 and thus may provide a link between this kinase and downstream signaling elements. Similarly, a constitutive interaction of Stat5 with Tyk-2 was seen in studies with the IFNalpha -sensitive Daudi lymphoblastoid cell line (Fig. 1, C and D).


View larger version (42K):
[in this window]
[in a new window]
 
Fig. 1.   Interaction of Stat5a and Stat5b with the Type I IFN receptor-associated Tyk-2 tyrosine kinase. A, KG-1 cells were incubated with IFNalpha for the indicated times at 37 °C. Cell lysates were immunoprecipitated with an anti-Tyk-2 antiserum or nonimmune rabbit serum (NRS), and proteins were analyzed by SDS-PAGE and immunoblotted with an antiphosphotyrosine monoclonal antibody (4G-10, Upstate Biotechnology). B, the blot shown in A was stripped and reprobed with an antibody against Stat5b that recognizes both forms of Stat-5 (Santa Cruz Biotechnology). C, Daudi cells were incubated at 37 °C for the indicated times in the presence or absence of IFNalpha . Cell lysates were immunoprecipitated with anti-Tyk-2 antiserum or nonimmune RIgG, and proteins were analyzed by SDS-PAGE and immunoblotted with an anti-Stat5b antibody. D, the blot shown in C was stripped and reprobed with a monoclonal antibody against Tyk-2 (Transduction Laboratories).

In previous studies, we have demonstrated that the adapter protein CrkL interacts in an IFNalpha -dependent manner with Tyk-2 and is tyrosine-phosphorylated during IFNalpha stimulation, providing a link between the Type I IFN receptor and the C3G-Rap-1 growth-inhibitory pathway (9). Accordingly, we examined whether CrkL associates with Stat5 during IFNalpha or IFNbeta stimulation. In time course studies, Daudi cells were left untreated or treated for 10 or 20 min with IFNalpha or IFNbeta . Cell lysates were prepared, immunoprecipitated with an anti-CrkL antibody, and then immunoblotted with an anti-Stat5 antibody. Stat5 was detected in association with CrkL after IFNalpha stimulation, establishing that this member of the Stat family of proteins associates with CrkL in an IFNalpha -dependent manner (Fig. 2, A and B). In contrast, there was no Stat1 present in anti-CrkL immunoprecipitates from IFNalpha -treated cells,2 indicating that the CrkL-Stat5 interaction is selective. As Stat5 was found to be constitutively associated with the Tyk-2 kinase, while the CrkL interaction was IFNalpha -dependent, we determined whether Stat5 undergoes IFNalpha -induced tyrosine phosphorylation and subsequently functions as a docking site for the SH2 domain of CrkL. In experiments in which Daudi or KG-1 cells were treated with IFNalpha for different times and the status of phosphorylation of Stat5 was examined, we observed that Stat5 is phosphorylated on tyrosine, suggesting that it acts as a substrate for the kinase activity of the associated Tyk-2 protein (Fig. 3, A and B, and data not shown). In addition, the SH2 domain of CrkL bound to the phosphorylated/activated form of both Stat5 isomers (a and b) in an IFNalpha -dependent manner (Fig. 3, C and D), confirming that Stat5 acts as a docking site for the CrkL SH2 domain and strongly suggesting that such an interaction mediates the formation of the CrkL-Stat5 complex.


View larger version (26K):
[in this window]
[in a new window]
 
Fig. 2.   IFNalpha and IFNbeta induce the association of CrkL with Stat5 in intact cells. A, Daudi cells were treated for the indicated times with IFNalpha or IFNbeta . Cell lysates were first precleared with nonimmune RIgG and after immunoprecipitation with the indicated antibodies, analyzed by SDS-PAGE and immunoblotted with an anti-Stat5b antibody. B, the blot shown in A was stripped and reprobed with the anti-CrkL antibody to demonstrate equal loading.


View larger version (28K):
[in this window]
[in a new window]
 
Fig. 3.   The IFNalpha -induced tyrosine-phosphorylated form of Stat5 functions as a docking site for the SH2 domain of CrkL. A, Daudi cells were incubated in the presence or absence of IFNalpha for 20 min. Cell lysates were immunoprecipitated with an antibody against Stat5b and immunoblotted with antiphosphotyrosine. B, the blot shown in A was stripped and reprobed with the anti-Stat5b antibody. C, Daudi cells were incubated at 37 °C for 30 min in the presence or absence of IFNalpha . Cell lysates were bound to a glutathione S-transferase fusion protein encoding the SH2 domain of CrkL (GST-CkLSH2) or GST alone used as control. Bound proteins were analyzed by SDS-PAGE and immunoblotted with an antibody against Stat5b. D, KG-1 cells were incubated at 37 °C for 30 min in the presence or absence of IFNalpha . Cell lysates were bound to glutathione S-transferase fusion protein encoding the SH2 domain of CrkL (GST-CkLSH2) or GST alone used as control. Bound proteins were analyzed by SDS-PAGE and immunoblotted with an antibody against Stat5b.

Previous studies have shown that CrkL functions as an adapter, linking tyrosine kinases or their substrates to guanine exchange factors for small G proteins. Our finding that the protein interacts in an SH2-dependent manner with Stat5 suggested that it may also participate in the formation of DNA binding complexes that regulate transcription of interferon-stimulated genes. To test this hypothesis, we evaluated the ability of CrkL to bind DNA using genomic DNA affinity chromatography (GDAC) (12). Specifically, nuclear extracts from Daudi cells treated with IFNalpha or IFNbeta were subjected to GDAC, and then the DNA-bound fraction was resolved by SDS-PAGE and immunoblotted for CrkL (Fig. 4A). CrkL bound DNA in an IFNalpha - or IFNbeta -dependent manner (Fig. 4A), and its DNA-bound form migrated at approximately 140 kDa, strongly suggesting that such DNA binding occurs in a complex with Stat5. Furthermore, as CrkL was detectable in immunoblots of the nuclear extracts only after Type I IFN treatment, these data suggested that the protein translocates to the nucleus in a Type I IFN-dependent manner. Similarly, when the IFN-induced DNA-bound fractions collected following GDAC were immunoblotted with Stat5, we noticed that Stat5 was detectable in the same complex with CrkL (Fig. 4B), strongly suggesting that it forms a DNA-binding complex in association with CrkL.


View larger version (21K):
[in this window]
[in a new window]
 
Fig. 4.   Identification of Type I IFN-inducible CrkL by genomic DNA affinity chromatography. Nuclear extracts were prepared from Daudi cells incubated with or without 104 IU/ml IFNalpha or IFNbeta for 10 min at 37 °C, then analyzed by GDAC. GDAC eluates were resolved by 11% SDS-PAGE and after Western blotting probed with anti-CrkL antibody (A) or anti-Stat5 antibody (B).

Further analyses of these Type I IFN-induced nuclear extracts by gel shift assays, employing an oligonucleotide specific for Stat5 binding derived from the beta -casein promoter, identified the presence of IFNalpha - or IFNbeta -inducible DNA-binding complexes, whose mobilities were affected by inclusion of anti-CrkL antibodies (Fig. 5A) but not control RIgG (Fig. 5A and data not shown). The presence of Stat5 in these CrkL-containing complexes in the electrophoretic mobility shift assay was confirmed by immunoblotting with antibodies to Stat5 (Fig. 5B). Thus, CrkL forms DNA-binding complexes in association with Stat5, strongly suggesting that it is involved in the regulation of Type I IFN-dependent gene expression.


View larger version (45K):
[in this window]
[in a new window]
 
Fig. 5.   IFNalpha and IFNbeta activate Stat5-CrkL DNA binding complexes in Daudi cells. A, Daudi cells were either not treated or treated with 104 IU/ml IFNalpha or IFNbeta for 10 min. Nuclear extracts were prepared, incubated with or without antisera to CrkL or nonimmune rabbit immunoglobulin, and reacted with a 32P-labeled oligonucleotide, specific for Stat5 binding (AGATTTCTAGGAATTCAAATC), derived from the beta -casein promoter. The resultant complexes were resolved using 4.5% native PAGE and visualized by autoradiography. B, nuclear extracts (10 µg/ml, lanes 1 and 2, or 2 µg/ml, lanes 3 and 4) from IFNalpha -treated or -untreated cells were reacted with a 32P-labeled oligonucleotide specific for Stat5 binding (as in A). The resultant complexes were resolved using 4.5% native PAGE and visualized by autoradiography (left panel). To confirm the presence of Stat5 in the complexes seen in A and the left panel, aliquots of nuclear extracts from the same experiment shown in the left panel were reacted with the unlabeled oligonucleotide, analyzed by native PAGE, and Stat5 was detected by immunoblotting with an anti-Stat5 antibody (Santa Cruz Biotechnology) (right panel).

Our data provide strong evidence that CrkL, in cooperation with Stat5, binds DNA, and this complex likely functions as a transcription factor in IFNalpha /beta -induced signaling. Indeed, we have observed this IFN-induced CrkL-Stat5 complex in other IFN-sensitive cell lines, namely human glial T98G and human osteosarcoma U2OS cells (data not shown). Such a role for CrkL was unexpected and raises the possibility that other related proteins, e.g. CrkII, Grb-2, may function as transcriptional activators in other signaling cascades. The members of this family of proteins have been previously shown to function as adapters, providing a link between receptor tyrosine kinases or their substrates and guanine exchange factors. Until now, there has been no evidence of their exhibiting DNA binding activity. CrkL has been shown to interact primarily with C3G (9, 13-15), which acts as a guanine exchange factor for Rap-1 (16), a small G protein that antagonizes Ras and has tumor suppressor activity (17-19). Regulation of Rap-1 activation by the CrkL-C3G complex appears to be critical for inhibition of T-cell proliferation and induction of anergy (20). In addition, recent studies have demonstrated that CrkL interacts with a newly cloned member of the IRS family of proteins, IRS-4, in an IGF-1-dependent manner and that it has oncogenic potential when overexpressed in cell lines (21).

The current report implicates Stat5 in the engagement of CrkL in IFN signaling, as shown by the requirement of Stat5 as a docking site for the SH2 domain of CrkL. Most importantly, for the first time these data demonstrate that a Stat protein can act as a docking protein for the SH2 domain of a non-Stat protein to form a DNA-binding complex with it. Although, in the case of CrkL, this function appears to be specific for Stat5, it is likely that other Stats will be found to function in a similar manner in other systems. Recent reports have suggested that Stat5 is involved in IFNalpha signaling in myeloid cell lines and HeLa cells (5), and its activation has been observed in response to differentiation and growth arrest signals (22, 23). Our results strongly suggest that such functions for Stat5 require its interaction with and formation of a signaling complex with CrkL.

    FOOTNOTES

* This work was supported by Grant CA77816 from the National Institutes of Health (to L. C. P.), by the Hairy Cell Leukemia Foundation (to L. C. P.), and a Medical Research Council of Canada grant (to E. N. F.).The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

parallel To whom correspondence should be addressed: Section of Hematology-Oncology, University of Illinois at Chicago, MBRB, MC-734, Rm. 3150, 900 S. Ashland Ave, Chicago, IL 60607-7173. Tel.: 312-355-0155; Fax: 312-413-7963; E-mail: Lplatani{at}UIC.Edu.

The abbreviations used are: IFN, interferon; GST, glutathione S-transferase; STAT, signal transducer and activator of transcription; IRS, insulin receptor substrate; PAGE, polyacrylamide gel electrophoresis; GDAC, genomic DNA affinity chromatography.

2 S. Uddin and L. C. Platanias, unpublished observations.

    REFERENCES
Top
Abstract
Introduction
Procedures
Results & Discussion
References

  1. Pestka, S., Langer, J. A., Zoon, K. C., and Samuel, C. E. (1987) Annu. Rev. Biochem. 56, 727-777[CrossRef][Medline] [Order article via Infotrieve]
  2. Platanias, L. C. (1995) Curr. Opin. Oncol. 7, 560-565[Medline] [Order article via Infotrieve]
  3. Darnell, J. E., Jr., Kerr, I. M., and Stark, G. R. (1994) Science 264, 1415-1420[Abstract/Free Full Text]
  4. Darnell, J. E., Jr. (1997) Science 277, 1630-1635[Abstract/Free Full Text]
  5. Meinke, A., Barahmand-Pour, F., Wohrl, S., Stoiber, D., and Decker, T. (1996) Mol. Cell. Biol. 16, 6937-6945[Abstract]
  6. Uddin, S., Yenush, L., Sun, X-J., Sweet, M. E., White, M. F., and Platanias, L. C. (1995) J. Biol. Chem. 270, 15938-15941[Abstract/Free Full Text]
  7. Platanias, L. C., Uddin, S., Yetter, A., Sun, X-J., and White, M. F. (1996) J. Biol. Chem. 271, 278-282[Abstract/Free Full Text]
  8. Burfoot, M. S., Rogers, N. C., Watling, D., Smith, J. M., Pons, S., Paonessaw, G., Pellegrini, S., White, M. F., and Kerr, I. M. (1997) J. Biol. Chem. 272, 24183-24190[Abstract/Free Full Text]
  9. Ahmad, S., Alsayed, Y., Druker, B. J., and Platanias, L. C. (1997) J. Biol. Chem. 272, 29991-29994[Abstract/Free Full Text]
  10. Heaney, C., Kolibaba, K., Bhat, A., Oda, T., Ohno, S., Fanning, S., and Druker, B. J. (1997) Blood 89, 297-306[Abstract/Free Full Text]
  11. Uddin, S., Katzav, S., White, M. F., and Platanias, L. C. (1995) J. Biol. Chem. 270, 7712-7716[Abstract/Free Full Text]
  12. Ghislain, J. J., and Fish, E. N. (1996) J. Biol. Chem. 271, 12408-12413[Abstract/Free Full Text]
  13. Ingham, R. J., Krebs, D. L., Barbazuk, S. M., Turck, C. W., Hirai, H., Matsuda, M., and Gold, M. R. (1996) J. Biol. Chem. 271, 32306-32314[Abstract/Free Full Text]
  14. Sawasdikosol, S., Ravichandran, K. S., Kay Lee, K., Chang, J-H., and Burakoff, S. J. (1995) J. Biol. Chem. 270, 2893-2896[Abstract/Free Full Text]
  15. Reedquist, K. A., Fukazawa, T., Panchamoorthy, G., Langdon, W. Y., Shoelson, S. E., Druker, B. J., and Band, H. (1996) J. Biol. Chem. 271, 8435-8442[Abstract/Free Full Text]
  16. Gotoh, T., Hattori, S., Nakamura, S., Kitayama, H., Noda, M., Takai, Y., Kaibuchi, K., Matsui, H., Hatase, O., Takahashi, H., Kurata, T., and Matsuda, M. (1995) Mol. Cell. Biol. 15, 6746-6753[Abstract]
  17. Cook, S., Rubinfeld, B., Albert, I., and McCormick, F. (1993) EMBO J. 12, 3475-3485[Medline] [Order article via Infotrieve]
  18. Kitayama, H., Sugimoto, Y., Matsuzaki, T., Ikawa, Y., and Noda, M. (1989) Cell 56, 77-84[CrossRef][Medline] [Order article via Infotrieve]
  19. Kitayama, H., Matsuzaki, T., Ikawa, Y., and Noda, M. (1990) Proc. Natl. Acad. Sci. U. S. A. 87, 4284-4288[Abstract/Free Full Text]
  20. Boussiotis, V. A., Freeman, G. J., Berezovskaya, A., Barber, D. L., and Nadler, L. M. (1997) Science 278, 124-128[Abstract/Free Full Text]
  21. Koval, A. P., Karas, M., Zick, Y., and LeRoith, D. (1997) J. Biol. Chem. 273, 14780-14787[Abstract/Free Full Text]
  22. Barahmand-pour, F., Meinke, A., Eilers, A., Gouilleux, F., Groner, B., and Decker, T. (1995) FEBS Lett 360, 29-33[CrossRef][Medline] [Order article via Infotrieve]
  23. Eilers, A., Baccarini, M., Hipskind, R. A., Schindler, C., and Decker, T. (1994) Mol. Cell. Biol. 14, 1364-1373[Abstract/Free Full Text]


Copyright © 1999 by The American Society for Biochemistry and Molecular Biology, Inc.



This article has been cited by other articles:


Home page
J. Biol. Chem.Home page
E. Katsoulidis, A. Sassano, B. Majchrzak-Kita, N. Carayol, P. Yoon, A. Jordan, B. J. Druker, E. N. Fish, and L. C. Platanias
Suppression of Interferon (IFN)-inducible Genes and IFN-mediated Functional Responses in BCR-ABL-expressing Cells
J. Biol. Chem., April 18, 2008; 283(16): 10793 - 10803.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
S. V. Scherbik, B. M. Stockman, and M. A. Brinton
Differential Expression of Interferon (IFN) Regulatory Factors and IFN-Stimulated Genes at Early Times after West Nile Virus Infection of Mouse Embryo Fibroblasts
J. Virol., November 1, 2007; 81(21): 12005 - 12018.
[Abstract] [Full Text] [PDF]


Home page
DiabetesHome page
M. Laloraya, A. Davoodi-Semiromi, G. P. Kumar, M. McDuffie, and J.-X. She
Impaired Crkl Expression Contributes to the Defective DNA Binding of Stat5b in Nonobese Diabetic Mice
Diabetes, March 1, 2006; 55(3): 734 - 741.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
D. Weichart, J. Gobom, S. Klopfleisch, R. Hasler, N. Gustavsson, S. Billmann, H. Lehrach, D. Seegert, S. Schreiber, and P. Rosenstiel
Analysis of NOD2-mediated Proteome Response to Muramyl Dipeptide in HEK293 Cells
J. Biol. Chem., January 27, 2006; 281(4): 2380 - 2389.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
K.-W. Zhao, D. Li, Q. Zhao, Y. Huang, R. H. Silverman, P. J. Sims, and G.-Q. Chen
Interferon-{alpha}-induced Expression of Phospholipid Scramblase 1 through STAT1 Requires the Sequential Activation of Protein Kinase C{delta} and JNK
J. Biol. Chem., December 30, 2005; 280(52): 42707 - 42714.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
S. Parmar, J. Smith, A. Sassano, S. Uddin, E. Katsoulidis, B. Majchrzak, S. Kambhampati, E. A. Eklund, M. S. Tallman, E. N. Fish, et al.
Differential regulation of the p70 S6 kinase pathway by interferon {alpha} (IFN{alpha}) and imatinib mesylate (STI571) in chronic myelogenous leukemia cells
Blood, October 1, 2005; 106(7): 2436 - 2443.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
Y. Li, S. Batra, A. Sassano, B. Majchrzak, D. E. Levy, M. Gaestel, E. N. Fish, R. J. Davis, and L. C. Platanias
Activation of Mitogen-activated Protein Kinase Kinase (MKK) 3 and MKK6 by Type I Interferons
J. Biol. Chem., March 18, 2005; 280(11): 10001 - 10010.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
S.-Z. Wang and R. M. Roberts
Interaction of Stress-Activated Protein Kinase-Interacting Protein-1 with the Interferon Receptor Subunit IFNAR2 in Uterine Endometrium
Endocrinology, December 1, 2004; 145(12): 5820 - 5831.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
K. K. Srivastava, S. Batra, A. Sassano, Y. Li, B. Majchrzak, H. Kiyokawa, A. Altman, E. N. Fish, and L. C. Platanias
Engagement of Protein Kinase C-{theta} in Interferon Signaling in T-cells
J. Biol. Chem., July 16, 2004; 279(29): 29911 - 29920.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
Y. Li, A. Sassano, B. Majchrzak, D. K. Deb, D. E. Levy, M. Gaestel, A. R. Nebreda, E. N. Fish, and L. C. Platanias
Role of p38{alpha} Map Kinase in Type I Interferon Signaling
J. Biol. Chem., January 9, 2004; 279(2): 970 - 979.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
S. Kambhampati, Y. Li, A. Verma, A. Sassano, B. Majchrzak, D. K. Deb, S. Parmar, N. Giafis, D. V. Kalvakolanu, A. Rahman, et al.
Activation of Protein Kinase C{delta} by All-trans-retinoic Acid
J. Biol. Chem., August 29, 2003; 278(35): 32544 - 32551.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
F. Lekmine, S. Uddin, A. Sassano, S. Parmar, S. M. Brachmann, B. Majchrzak, N. Sonenberg, N. Hay, E. N. Fish, and L. C. Platanias
Activation of the p70 S6 Kinase and Phosphorylation of the 4E-BP1 Repressor of mRNA Translation by Type I Interferons
J. Biol. Chem., July 18, 2003; 278(30): 27772 - 27780.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
D. K. Deb, A. Sassano, F. Lekmine, B. Majchrzak, A. Verma, S. Kambhampati, S. Uddin, A. Rahman, E. N. Fish, and L. C. Platanias
Activation of Protein Kinase C{delta} by IFN-{gamma}
J. Immunol., July 1, 2003; 171(1): 267 - 273.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
D. Gomez and N. C. Reich
Stimulation of Primary Human Endothelial Cell Proliferation by IFN
J. Immunol., June 1, 2003; 170(11): 5373 - 5381.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
V. S. Cull, P. A. Tilbrook, E. J. Bartlett, N. L. Brekalo, and C. M. James
Type I interferon differential therapy for erythroleukemia: specificity of STAT activation
Blood, April 1, 2003; 101(7): 2727 - 2735.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
S. Uddin, A. Sassano, D. K. Deb, A. Verma, B. Majchrzak, A. Rahman, A. B. Malik, E. N. Fish, and L. C. Platanias
Protein Kinase C-delta (PKC-delta ) Is Activated by Type I Interferons and Mediates Phosphorylation of Stat1 on Serine 727
J. Biol. Chem., April 19, 2002; 277(17): 14408 - 14416.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
A. Verma, D. K. Deb, A. Sassano, S. Uddin, J. Varga, A. Wickrema, and L. C. Platanias
Activation of the p38 Mitogen-activated Protein Kinase Mediates the Suppressive Effects of Type I Interferons and Transforming Growth Factor-beta on Normal Hematopoiesis
J. Biol. Chem., March 1, 2002; 277(10): 7726 - 7735.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
A. Oda, H. D. Ochs, L. A. Lasky, S. Spencer, K. Ozaki, M. Fujihara, M. Handa, K. Ikebuchi, and H. Ikeda
CrkL is an adapter for Wiskott-Aldrich syndrome protein and Syk
Blood, May 1, 2001; 97(9): 2633 - 2639.
[Abstract] [Full Text] [PDF]


Home page
Nucleic Acids ResHome page
C. Gongora, G. Degols, L. Espert, T. D. Hua, and N. Mechti
A unique ISRE, in the TATA-less human Isg20 promoter, confers IRF-1-mediated responsiveness to both interferon type I and type II
Nucleic Acids Res., June 15, 2000; 28(12): 2333 - 2341.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
Y. Alsayed, S. Uddin, S. Ahmad, B. Majchrzak, B. J. Druker, E. N. Fish, and L. C. Platanias
IFN-{gamma} Activates the C3G/Rap1 Signaling Pathway
J. Immunol., February 15, 2000; 164(4): 1800 - 1806.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
G. Luo and L.-y. Yu-Lee
Stat5b Inhibits NF{kappa}B-Mediated Signaling
Mol. Endocrinol., January 1, 2000; 14(1): 114 - 123.
[Abstract] [Full Text]


Home page
J. Biol. Chem.Home page
E. Pattyn, X. Van Ostade, L. Schauvliege, A. Verhee, M. Kalai, J. Vandekerckhove, and J. Tavernier
Dimerization of the Interferon Type I Receptor IFNaR2-2 Is Sufficient for Induction of Interferon Effector Genes but Not for Full Antiviral Activity
J. Biol. Chem., December 3, 1999; 274(49): 34838 - 34845.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
S. Uddin, B. Majchrzak, J. Woodson, P. Arunkumar, Y. Alsayed, R. Pine, P. R. Young, E. N. Fish, and L. C. Platanias
Activation of the p38 Mitogen-activated Protein Kinase by Type I Interferons
J. Biol. Chem., October 15, 1999; 274(42): 30127 - 30131.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
E. L. K. Goh, T. Zhu, S. Yakar, D. LeRoith, and P. E. Lobie
CrkII Participation in the Cellular Effects of Growth Hormone and Insulin-like Growth Factor-1. PHOSPHATIDYLINOSITOL-3 KINASE DEPENDENT AND INDEPENDENT EFFECTS
J. Biol. Chem., June 2, 2000; 275(23): 17683 - 17692.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
S. Uddin, F. Lekmine, N. Sharma, B. Majchrzak, I. Mayer, P. R. Young, G. M. Bokoch, E. N. Fish, and L. C. Platanias
The Rac1/p38 Mitogen-activated Protein Kinase Pathway Is Required for Interferon alpha -dependent Transcriptional Activation but Not Serine Phosphorylation of Stat Proteins
J. Biol. Chem., September 1, 2000; 275(36): 27634 - 27640.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
J. Du, Y. M. Alsayed, F. Xin, S. J. Ackerman, and L. C. Platanias
Engagement of the CrkL Adapter in Interleukin-5 Signaling in Eosinophils
J. Biol. Chem., October 13, 2000; 275(42): 33167 - 33175.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
I. A. Mayer, A. Verma, I. M. Grumbach, S. Uddin, F. Lekmine, F. Ravandi, B. Majchrzak, S. Fujita, E. N. Fish, and L. C. Platanias
The p38 MAPK Pathway Mediates the Growth Inhibitory Effects of Interferon-alpha in BCR-ABL-expressing Cells
J. Biol. Chem., July 20, 2001; 276(30): 28570 - 28577.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
T. C. Wagner, S. Velichko, D. Vogel, M. R. S. Rani, S. Leung, R. M. Ransohoff, G. R. Stark, H. D. Perez, and E. Croze
Interferon Signaling Is Dependent on Specific Tyrosines Located within the Intracellular Domain of IFNAR2c. EXPRESSION OF IFNAR2c TYROSINE MUTANTS IN U5A CELLS
J. Biol. Chem., January 4, 2002; 277(2): 1493 - 1499.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Fish, E. N.
Right arrow Articles by Platanias, L. C.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Fish, E. N.
Right arrow Articles by Platanias, L. C.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 All ASBMB Journals   Molecular and Cellular Proteomics 
 Journal of Lipid Research