![]()
|
|
||||||||
J Biol Chem, Vol. 274, Issue 2, 638-648, January 8, 1999
,
,From the Division of Molecular Biology and Biochemistry, School of Biological Sciences, University of Missouri-Kansas City, Kansas City, Missouri 64110-2499
| |
ABSTRACT |
|---|
|
|
|---|
Hemopexin protects cells lacking hemopexin
receptors by tightly binding heme abrogating its deleterious effects
and preventing nonspecific heme uptake, whereas cells with hemopexin
receptors undergo a series of cellular events upon encountering
heme-hemopexin. The biochemical responses to heme-hemopexin depend on
its extracellular concentration and range from stimulation of cell
growth at low levels to cell survival at otherwise toxic levels of
heme. High (2-10 µM) but not low (0.01-1
µM) concentrations of heme-hemopexin increase, albeit
transiently, the protein carbonyl content of mouse hepatoma (Hepa)
cells. This is due to events associated with heme transport since
cobalt-protoporphyrin IX-hemopexin, which binds to the receptor and
activates signaling pathways without tetrapyrrole transport, does not
increase carbonyl content. The N-terminal c-Jun kinase (JNK) is rapidly
activated by 2-10 µM heme-hemopexin, yet the increased
intracellular heme levels are neither toxic nor apoptotic. After
24 h exposure to 10 µM heme-hemopexin, Hepa cells
become refractory to the growth stimulation seen with 0.1-0.75
µM heme-hemopexin but HO-1 remains responsive to
induction by heme-hemopexin. Since free heme does not induce JNK, the
signaling events, like phosphorylation of c-Jun via activation of JNK
as well as the nuclear translocation of NF Generation of reactive oxygen species as well as radical reactions
occur upon tissue and red blood cell damage and release of heme, for
example, hydroxyl radical production by hemoglobin and myoglobin from
hydrogen peroxide (1). Heme is considered to be one causative agent in
organ failure after ischemia reperfusion since heme oxygenase-1
(HO-1)1 is induced in heart
and kidney (2). The forms of heme in the circulation which initially
predominate after an injury are hemoglobin, heme-hemopexin,
hemoglobin-haptoglobin, and heme-albumin (3). Haptoglobin does not
recycle and is readily depleted, and heme rapidly transfers to
hemopexin from heme-albumin (4) and from deoxyhemoglobin in the
presence of hydrogen peroxide (5). Hemopexin, because of its avidity
for heme (Kd <1 pM; Ref. 6), has a
protective role in hemolysis, trauma, and ischemia reperfusion and is
in the first line of defense against heme-mediated oxidative damage
(7-9). Hemopexin binds heme in a low spin complex, thereby decreasing
heme's peroxidative activity, and transports it via endocytosis into
cells expressing hemopexin receptors (10, 11). Moreover, hemopexin is
resistant to depletion since it recycles after heme delivery (12-14)
and remains in circulation to protect against heme-stimulated peroxidation.
On the other hand, while hemopexin (about 10-20 µM in
plasma) is protective extracellularly, the increase in intracellular heme and iron consequent to hemopexin-mediated transport might increase
the intracellular oxidation state and possibly lead to biochemical
responses to prevent oxidative damage to cell constituents. However,
the induction of HO-1 by heme-hemopexin (15) as well as by hypoxia
ischemia (16), cytokines, and hydrogen peroxide (17) is considered to
be protective for cells, since the heme catabolites biliverdin and
bilirubin are anti-oxidants in vitro (18). In addition, iron
sequestration by ferritin protects cells against the toxic effects of
iron released by heme oxygenase, and hemopexin induces ferritin (9).
Furthermore, the gene expression of metallothionein-1 (MT-1) is also
induced by heme-hemopexin (15); in part by activation of signaling
pathways (19, 20). We proposed (20) that MT induction helps the cells
to maintain homeostasis as intracellular heme and iron levels increase
since the sulfhydryl-rich MT protects against radicals (21) and also sequesters zinc, which might otherwise occupy iron sulfur protein active sites as well as copper, which is redox active. MT functions normally in copper (22) and zinc homeostasis (23), but recent studies
with MT-null mice support the role in oxidative stress conditions (24).
Heme-hemopexin targets heme to a discrete set of tissues and cells via
selective expression of the hemopexin receptor and protects receptor
null cells, including endothelial cells lining blood vessels, by
preventing diffusion of free heme. Receptors for heme-hemopexin are
expressed by liver parenchymal cells (25), lymphocytes (26), and cells
of barrier tissues, e.g. retinal pigment epithelia (9) and
probably also neurons of the peripheral (27) and central nervous
systems (28). Heme-hemopexin has also recently been shown to act as a
growth factor by providing a source of nutrient iron and activating PKC
in human T-lymphocytes (26). As with other growth factors, the growth
response curve is bell-shaped, raising the possibility that high levels
of transported heme are deleterious to the cells or even toxic,
although heme-hemopexin induces HO-1 and ferritin (9, 15), and the
heme-iron is rapidly incorporated into ferritin (29). If the heme
handling system is overloaded, heme can participate in intracellular
oxygen radical reactions that lead to the degradation of proteins,
lipids, carbohydrates, and DNA (30).
To address the cellular and biochemical consequences of increasing
intracellular heme via the specific hemopexin receptor, we investigated
the effects of nanomolar to micromolar levels of heme-hemopexin on the
cellular oxidation state as well as on cell growth and activation of
signaling cascades known to respond to growth factors and stress that
ultimately activate mitogen-activated protein kinase (MAPK) family
members. Here, the focus is on the N-terminal c-Jun kinase (JNK), also
known as stress-activated protein kinase (SAPK), one member of the MAPK
family activated by exposure of cells to UV radiation, heat shock, or
inflammatory cytokines. Other members include extracellular signal
regulated kinase, which responds to binding of growth factors to
receptor tyrosine kinases via Ras, and p38 kinase (reactivating kinase or MAP2), which is activated in response to inflammatory cytokines, endotoxins, and osmotic stress (reviewed in Ref. 31). These kinases
play key roles in determining cellular responses to many extracellular
stimuli which activate small G-proteins such as Rho, Rac, and Ras which
in turn stimulate MAPK kinase cascades and lead to the phosphorylation
of transcription factors to produce a unique, appropriate
transcriptional activity for a particular external stress. We report
here additional evidence for the pleiotropic protective effects of
heme-hemopexin, particularly in increasing cell survival under heme
stress and generating high levels of a DNA-binding form of two
transcription factors, c-Jun and NF Reagents--
Metalloporphyrin (Porphyrin Products, Logan, UT)
concentrations were determined spectrophotometrically in dimethyl
sulfoxide using published procedures (19). Camptothecin and hydroxyurea were obtained from Sigma; doxorubicin from Calbiochem (San Diego, CA);
and dinitrophenyl hydrazine and guanidine from Aldrich (Milwaukee, WI).
Commercial antibodies to bcl-2 were obtained from Oncogene Research
Products and Santa Cruz Biotechnology Inc., Santa Cruz, CA.
Hemopexin Isolation and Preparation of Heme-Hemopexin
Complexes--
Intact rabbit hemopexin was purified and stoichiometric
1:1 heme-hemopexin complexes (>90-95% saturated) characterized and quantitated as described previously (19, 32) keeping the
Me2SO concentration less than 5% (v/v), and using
extinction coefficients (A·
M Cultured Cells--
Mouse hepatoma cells (Hepa) were cultured in
Dulbecco's minimal essential medium (DMEM) containing 5% FBS as
described (33). For growth studies, cells seeded at an initial density
of 2000 cells per well in 96-well plates were synchronized by
incubation in DMEM containing 0.5% serum (LSDMEM) for 16 h before
addition of increasing concentrations of sterilized (0.2-µm nylon)
heme-hemopexin. Cell number was assessed using the Promega Cell Titer
proliferation assay as described previously for MOLT-3 cells (26).
Initial experiments using direct cell counting confirmed the accuracy of this method under the experimental conditions investigated. Although
liver cells are differentiated and not actively dividing, mouse Hepa
cells were used because they have well characterized responses to
heme-hemopexin (15, 25) and are models for replicating cells with
liver-specific functions like interleukin-6
responsiveness2 and plasma
protein synthesis (34).
Cell Cycle Control--
Hepa cells were synchronized by
incubation in low serum medium for 16 h after seeding (2 × 106 cells per T75 flask) in normal culture medium and
attachment during 5 h incubation. Then the medium was changed to
LSDMEM containing heme-hemopexin or the DNA intercalator, doxorubicin
(0.2 µg/ml), or the ribonucleotide reductase inhibitor, hydroxyurea
(10 mM), which were used to induce G2/M and
G1/G0 arrest, respectively. After 3, 8, 24, and
48 h cells were fixed and the DNA stained with propidium iodide
(50 µg/ml) containing RNase (60 µg/ml). The amount of DNA was
measured using Immunocount II with an Orthocytronabsolute flow
cytometer (Orthodiagnostics, Raritan, NJ) and the data analyzed and
correlated with changes in the cell cycle using Modfit (Verity House
Software, Topsham, ME).
Detection of the Protein Carbonyl Content of Cells--
After
the usual subculture and synchronization, cells (6 × 106 cells per T-75) were incubated for up to 2 h in
the presence or absence of 2-10 µM heme-hemopexin, 2-10
µM CoPP-hemopexin, 0.5-10 µM free heme, or
400 µM hydrogen peroxide (stock concentration was
determined spectrophotometrically using a millimolar extinction coefficient of 43.6 M Detection of NF Determination of JNK/SAPK Activity--
Synchronized Hepa cells
(seeded at 1.3 × 106 cells per T-75 flask) were
incubated in LSDMEM for up to 6 h in the presence of 1-10
µM heme-hemopexin, 2-10 µM CoPP-hemopexin,
or 0.4-10 µM free heme and cell extracts prepared using
Tris-Triton X-100 buffer, pH 7.4, containing 1 mM sodium
vanadate (New England BioLabs, Beverly, MA) as phosphatase inhibitor.
Using c-Jun-glutathione S-transferase bound to Sepharose (2 µg) as substrate, the amount of activated JNK/SAPK in cell extracts
(1 mg of protein) was estimated using an in vitro kinase
assay (New England BioLabs, Beverly, MA) followed by quantitation of
phospho-c-Jun-glutathione S-transferase produced by Western
analysis using a polyclonal anti-phospho-c-Jun (Ser-63) antibody
followed by detection using ECL (Amersham) and quantitation using the
NIH Image program.
Detection of Wild-type p53 in Hepa Cells by
Immunoprecipitation--
Due to the low abundance of p53, Hepa cells
were first treated with doxorubicin (0.2 µg/ml) for 48 h to
induce p53 expression. Cell lysates were prepared in PBS, pH 7.4, containing 1% (v/v) Triton X-100, 0.5% (w/v) deoxycholate, 0.1%
(w/v) SDS with 0.2 mM phenylmethylsulfonyl fluoride, 0.1 mM EDTA, 5 µg/ml leupeptin, and 1.0 µg/ml pepstatin
(PBS-TDS buffer) and after preclearing by incubation with 1 µg of
mouse IgG and "protein G-plus-agarose," p53 was recovered by
incubating the lysates with 1 µg of antibodies to wild type and
mutant p53 (Ab-4 and Ab-3, respectively; Oncogene Research Products,
Cambridge, MA). The antibody-bound p53 was recovered by addition of
protein G-plus-agarose and detected by Western analysis after SDS-PAGE
using as primary antibody Pantropic Ab-7 to p53 (diluted 1:2500)
followed by detection using biotinylated rabbit anti-sheep IgG and
streptavidin horseradish peroxidase with the ECL system and quantitated
as described above.
Detection of Poly(ADP-ribose)polymerase (PARP) Expression Using
Western Immunoblotting--
After the usual subculture and
synchronization, Hepa cells (seeded at 1.3 × 106 per
T75) were then incubated in LSDMEM in the presence or absence of 10 µM heme-hemopexin for 21 h. Cell extracts were
prepared from washed cells by solubilization in Laemmli buffer and
sonication, and PARP detected after SDS-PAGE electrophoresis of cell
extracts (equivalent to 1 × 105 cells) and transfer
to polyvinylidene difluoride membranes (Bio-Rad) using monoclonal
antibodies (diluted 1:10,000) which recognize both the intact protein
and the 86-kDa proteolytic fragment (C2-10 from Dr. Guy Poirier,
Research Center of the Central Hospital of Laval University, Quebec,
Canada) were detected with donkey anti-mouse IgG horseradish peroxidase
and carried out as usual with the ECL system. Cleaved PARP present in
extracts of ectoposide (VP16)-treated HL-60 cells (also from Dr. Guy
Pourier) was used as a marker.
Detection of p21WAF1/CIP/SDI1 Using Western
Immunoblotting--
After the usual subculture and synchronization,
Hepa cells (seeded at 1.3 × 106 per T75) were then
incubated in LSDMEM in the presence or absence of heme-hemopexin or
doxorubicin at various times and concentrations given in the figure
legends. Cell extracts were prepared from washed cells by
solubilization in PBS-TDS buffer and p21WAF1/CIP/SDI1 detected
after SDS-PAGE electrophoresis of cell extracts (25 µg of protein)
and transfer to polyvinylidene difluoride membranes (Bio-Rad).
Anti-murine p21 antibodies (Ab-5 from Oncogene Research Products) were
detected using donkey anti-rabbit IgG horseradish peroxidase and the
ECL system.
Heme-Hemopexin Increases the Protein Carbonyl Content of
Cells--
To establish whether events associated with receptor
binding and hemopexin-mediated heme transport increase the
intracellular oxidation state, the production of protein carbonyls was
measured after incubation of Hepa cells with heme-hemopexin.
Concentrations in the range 2-10 µM represent a "heme
load" at sites of localized trauma injury since circulating plasma
hemopexin levels are approximately 20 µM. Within 15 min,
10 µM heme-hemopexin doubled the cell carbonyl content to
about 7 nmol/mg of protein, equivalent to the level produced in
response to 400 µM H2O2 (Fig.
1A). This effect of heme-hemopexin is dose-dependent from 2 to 10 µM (Fig. 1B) and transient since carbonyl
levels declined after 30 min. As expected, free heme also rapidly
increased carbonyl content (Fig. 1C).
Heme-Hemopexin Stimulates Nuclear Translocation and DNA
Binding of Nuclear Factor Heme-Hemopexin Induces the MAPK Family Member JNK/SAPK--
As a
third parameter for the increased oxidation state we investigated
whether heme-hemopexin activated JNK/SAPK, known to respond to a
variety of stresses including DNA damage, heat shock, or tumor necrosis
factor Heme-Hemopexin Supports Cell Growth at Low but Not High
Concentrations--
Hepa cells express relatively abundant, high
affinity receptors for hemopexin (25) and proliferate normally using
0.05 to 1 µM heme-hemopexin as the sole iron source (Fig.
3A), as previously reported
for human lymphocytes (MOLT-3 cells) and polymorphonuclear lymphocytes
(26). However, in the presence of higher concentrations of
heme-hemopexin (2-10 µM), cell growth was arrested.
Stimulation of cell growth was equivalent for cells of either low
(passage 39; data not shown) or high (passage 99; Fig. 3A)
passage number, and there was no loss of viability as judged by trypan
blue staining in cells exposed to 10 µM heme-hemopexin
(data not shown). Heme-hemopexin also overcame the growth inhibition by
the permeable iron chelator, desferroxamine (Fig. 3B), as
previously reported for MOLT-3 cells (26), further substantiating that
the iron released by heme catabolism was used for cell growth.
High Concentrations of Heme-Hemopexin Induce Cell Arrest Not
Apoptosis--
When, after an initial 24-h period, the culture medium
containing 10 µM heme-hemopexin is removed and replaced
with fresh medium lacking heme-hemopexin but containing FBS, cell
growth resumes and 24 h later cell number is increased in
proportion to the FBS concentration (Fig.
4A). After 24 h
incubation in the presence of 10 µM extracellular levels
of heme-hemopexin, the cells are refractory to a previously stimulatory
concentration of heme hemopexin (0.1 µM, see Fig.
4B; 0.5 and 0.75 µM (data not shown)) but are
neither dead nor undergoing apoptosis. This was confirmed by examining
whether cleavage of PARP by activated caspases was occurring (38).
There was no detectable PARP cleavage after 21 (Fig. 4C) or
48 h (data not shown) exposure of the cells to 10 µM
heme-hemopexin. As a positive control, the DNA topoisomerase I
inhibitor, camptothecin, was shown to induce apoptosis in Hepa cells,
producing typical morphological changes within 3 h (data not
shown). The expected reduction in volume of cytoplasm and release of
vesicles without cell lysis as well as cleavage of PARP were apparent
at 21 h. Thus, cell arrest, not apoptosis nor necrosis, occurs at
heme-hemopexin concentrations greater than 1 µM.
Although cells treated with 10 µM heme-hemopexin are
arrested for a time, they do retain hemopexin receptors and remain
responsive to other biological consequences of heme-hemopexin. In
particular, HO-1 protein is induced within 3 h by 10 µM heme-hemopexin, and increases for at least the next
4 h before declining to basal levels at 20 h (data not
shown). A second exposure to heme-hemopexin 20 h after the first
induces HO-1 again and to a similar extent over time. Taken together,
these observations show that cell cycle regulation has taken place with
no obvious loss of hemopexin receptors at the cell surface or ability
to induce HO-1 and catabolize heme.
Hepa Cells Express Wild-type p53--
Since the tumor suppressor
gene product, p53, increases in response to DNA damage (39) and since
many transformed cell lines express mutant forms of p53, we
investigated whether Hepa cells express wild type p53, and whether
changes in p53 expression occur in response to high extracellular
levels of heme-hemopexin. Immunoprecipitation studies reveal that Hepa
cells express wild type p53, which is induced by the DNA intercalator,
doxorubicin (data not shown). When cells are grown for 48 h in
medium containing low levels of serum, p53 expression is also induced
by high levels of heme-hemopexin, but a growth stimulating
concentration (0.5 µM) of heme-hemopexin consistently
causes a 50-60% decrease in immunodetectable p53 (data not shown).
High Concentrations of Heme-Hemopexin Cause Partial Cell Arrest and
Increase the Expression of p21WAF1/CIP1/SDI1 but Not Protein
Kinase B/Akt1--
Heme-hemopexin increases the expression of the cell
cycle inhibitor p21WAF1/CIP1/SDI1, as assessed with two
different protocols, and prevents apoptosis due to withdrawal of serum
factors (Fig. 5). Somewhat unexpectedly, using a protocol for induction of apoptosis by staurosporine in a
p53-null lung cancer cell line (40), two immunopositive
p21WAF1/CIP1/SDI1 species are induced by heme-hemopexin (Fig.
5A). The faster migrating form of p21WAF1/CIP1/SDI1
was ascribed to be the PKC-dependent cleaved form reported
to be associated with G2/M arrest (40). Cells treated for
48 h with 0.2 µg/ml doxorubicin, which causes DNA damage and
G2/M arrest before apoptosis (41), express only the faster
migrating immunoreactive species of p21 as do the low serum control
cells.
Using a second protocol (Fig. 5B), p21WAF1/CIP1/SDI1
levels are twice as high as the control levels in cells incubated with
heme-hemopexin for 6 h (Fig. 5B) and remain elevated
for 48 h. As in the previous protocol, at 48 h the cell
morphology indicated that the doxorubicin-treated cells were arrested.
In contrast to the cells in LSDMEM which cease to grow, become small,
round, and birefringent and die (Fig. 5C, i), the morphology
of cells incubated with heme-hemopexin is that expected for arrested
cells, i.e. they are enlarged compared with normal (Fig.
5C, ii) like cells exposed to doxorubicin (Fig. 5C,
iii). Although p21WAF1/CIP1/SDI1 is initially increased in
the control cells by the reduced serum concentration during the
overnight incubation for synchronization, cells do not survive if
heme-hemopexin is not added, demonstrating that heme-hemopexin acts as
a survival factor. Furthermore, 10 µM heme-hemopexin
increases the level of p21WAF1/CIP1/SDI1 in cells growing in as
little as 0.5% serum to the level normally found in cells growing in
growth medium containing 2% serum (Fig. 5D).
The flow cytometry data summarized in Table
I demonstrate that after synchronization
a significant proportion of the Hepa cells growing in medium
supplemented with 10 µM heme-hemopexin remain in the
G2/M phase at 8 and 24 h compared with the low serum control cells. In control experiments, doxorubicin and nocodazole cause
G2/M arrest, and the ribonucleotide reductase inhibitor, hydroxyurea, causes G1/G0 arrest; and the
effect of these chemicals is apparent within 8 h and is complete
at 24 h. Thus, in response to heme-hemopexin cells do not progress
through G2/M normally as do cells growing in DMEM
containing 5% FBS. At 48 h the percentage of cells in S phase
incubated with high concentrations of heme-hemopexin is twice that of
cells in LSDMEM, indicating that the cells are progressing through the
cycle and those in LSDMEM become arrested in
G0/G1. Cells growing in LSDMEM supplemented
with 0.5 µM heme-hemopexin also have more cells in
S-phase than those in LSDMEM alone indicating continued growth. Since
the Hepa cells are not clonally derived and are not completely
synchronized by the overnight incubation in LSDEM, the data have been
interpreted conservatively but are clear.
In addition to p21WAF1/CIP1/SDI1, other proteins, for example,
bcl-2 and the protein kinase B/Akt-1, have been identified whose
expression leads to cell survival rather than apoptosis (42). Hepa
cells do not express levels of bcl-2 detectable by immunoblotting, but protein kinase B/Akt1 is activated within 1 h by insulin and
epidermal growth factor; however, low or high concentrations of
heme-hemopexin are without effect (data not shown). Doxorubicin induces
bclXL, a partner of Bad, whereas hemopexin causes a small
decrease in bclXL levels (data not shown).
Rapid Induction of p21WAF1/CIP1/SDI1 Requires High
Concentrations of Heme-Hemopexin--
Since p21WAF1/CIP1/SDI1
acts in cellular responses to oxidative stress and binding of
p21WAF1/CIP1/SDI1 to JNK/SAPK inhibits the kinase and prevents
apoptosis (43), we investigated the kinetics of heme-hemopexin effects
on p21WAF1/CIP1/SDI1 levels. The data in Fig.
6 establish that nuclear levels of
p21WAF1/CIP1/SDI1 are induced within 1 h when cells are
incubated with 2-10 µM heme-hemopexin, independently of
any detectable changes in p53 (data not shown), but concomitantly with
the rapid induction of nuclear translocation of NF
Induction of p21WAF1/CIP1/SDI1 by heme-hemopexin is rapid
and sustained; but in contrast, JNK/SAPK activation is apparent within
15-30 min, reaches a maximum at 1 h, declines after 3 h, and
increases again at 6 h, in parallel with the cellular levels of
phospho-c-Jun (Fig. 2). As discussed below, the high levels of
p21WAF1/CIP1/SDI1 and phospho-c-Jun could explain the observed
absence of apoptosis despite JNK/SAPK activation.
Effect of Receptor Occupancy on JNK/SAPK Activity and on Cellular
Carbonyl Production--
We also investigated the role of receptor
occupancy independent of tetrapyrrole transport on JNK/SAPK activation
and cell protein carbonyl content using CoPP-hemopexin. The results
reveal that JNK/SAPK is activated by this non-transportable
heme-analog-hemopexin complex (Fig.
7A). However, unlike
heme-hemopexin, CoPP-hemopexin does not increase Hepa cell carbonyl
content (Fig. 7D). The stability of the CoPP-hemopexin
complex and lack of CoPP uptake is reinforced by the ability of free
CoPP to triple the carbonyl content within 15 min3 and to extensively
induce HO-1 (19). In contrast, although free heme rapidly diffuses
across the plasma membrane into cells, JNK/SAPK is not activated by
non-protein bound heme (Fig. 7B) despite the increased
oxidative state which heme produces and consequent increased protein
carbonyl content (see Fig. 1B).
Heme-mediated oxidative stress may play a role in
neurodegenerative diseases, including Alzheimer's (44), as well as
contribute to aging and is considered to be a contributing factor in
the pathology of ischemia reperfusion injury of kidney, heart, and brain principally due to the associated induction of heme oxygenase (2). In stroke, reperfusion injury is considered to be due to the toxic
effects of heme (45) and to cascades from calcium channels and
glutamate receptors (46, 47). Hemopexin has both extra- and
intra-cellular protective roles and the present research begins to
define the responses of cells to high concentrations (2-10
µM) of heme-hemopexin as a model for a physiological,
cellular heme "load" and to determine at the molecular level some
of the initial hemopexin receptor-activated and heme-related events in hemolysis, trauma, and ischemia reperfusion.
This is the first report to link cellular heme transport processes with
metal-catalyzed oxidation, which is also a mixed function oxidation
since it requires molecular oxygen and reducing equivalents. Heme
transport causes oxidative modification of proteins as shown by the
increase in protein carbonyl content of ferritin replete Hepa cells
within 15 min of exposure to heme-hemopexin. This assay is the
definitive method for assessing metal-catalyzed oxidation (35), and
reaction with oxygen or H2O2 generates an
active oxygen species which oxidizes amino acids at or near the metal.
Hemopexin receptor occupancy per se, examined using
CoPP-hemopexin which binds to the receptor without tetrapyrrole
transport, does not increase cellular protein carbonyl content as does
free heme which is amphipathic and is nonspecifically taken up by all
cells. Thus, carbonyl production is caused by the cellular uptake of
heme, events associated with endocytosis of heme-hemopexin and heme catabolism. When heme is transported into cells via the hemopexin receptor the oxidation state is transiently increased, and recovery, as
indicated by decreased carbonyl content, starts within 30 min presumably due to proteolysis of the oxidized proteins which are known
to be unstable. The actual carbonyl levels induced in the Hepa cells by
heme-hemopexin are essentially identical to those induced by 400 µM H2O2 or generated during
ischemia reperfusion injury of brain (48).
Key transcription factors activated by stresses and producing the
cellular responses to inflammation include the NF c-Jun is the major substrate of JNK/SAPK which is activated in
vivo during reperfusion of ischemic kidney (53). Raising intracellular levels of heme via heme-hemopexin could constitute a
cellular stress and, as shown here, JNK/SAPK is rapidly and extensively
activated by heme-hemopexin as well as by CoPP-hemopexin implicating
the hemopexin receptor itself in this process. In contrast, free heme
which increases the cellular oxidation state as does heme-hemopexin
does not activate JNK/SAPK, nor does 20 µM free heme in
chick embryo liver cells (54). Despite sustained elevated levels of
phospho-c-Jun, Hepa cells exposed to 2-10 µM heme-hemopexin do not undergo apoptosis: there is no abnormal morphology, no activation of caspases nor increase in
bclXL. Thus, the research presented here links for the
first time the stimulus of high levels of extracellular heme,
viz. heme-hemopexin complexes, with sequential
phosphorylation events leading to the activation of the JNK/SAPK signal
transduction pathway.
Even more important is the finding potentially linking activation of a
MAPK cascade by hemopexin, a receptor-mediated heme transport system,
with the concomitant increase of HO-1 and MT-1 gene transcription. A
role for c-Jun, the major substrate for JNK/SAPK, in the regulation of
both HO-1 and MT-1 genes, induced by phorbol esters (20), remains to be
defined. However, AP-1 sites have been identified in the promoters of
these genes and implicated in both HO-1 (52, 55) and MT-1 (56) gene
expression but the mode of regulation by c-Jun is not established and
may not be a simple activation of transcription. An involvement of MAPK
cascades in HO-1 and MT-1 gene transcription readily explains how so
many disparate surface as well as intracellular stimuli, e.g. hydrogen peroxide, cytokines, metals like cadmium,
chemicals like arsenite and diethylmaleate which decrease intracellular GSH, might converge or in parallel result in increased transcription of
the HO-1 and MT-1 genes.
During recovery from ischemia, in addition to NF The cellular responses to extracellular heme-hemopexin and the
mechanism whereby gene regulation is linked to heme and iron metabolism
and to cell cycle control is a physiologically relevant biological
process that requires more definition. The time course of induction of
HO-1 shown here and of
ferritin5 is consistent with
observations that overexpression of these proteins causes cell arrest
(62, 63). In comparison with doxorubicin- and nocodazole-treated cells,
the percentage of cells in G2/M stage of the cycle shows
that the arrest mediated by heme-hemopexin is dynamic indicative of
pausing. Thus, while the maximum induction of HO-1 and ferritin occurs
at about 7 h of exposure to heme-hemopexin, by 20 h HO-1 has
already declined to basal levels although ferritin remains slightly
elevated. Overall, the data support that the cells recover after a
period of cell arrest and that processes in addition to HO-1 and
ferritin induction are occurring.
The role of HO-1 and ferritin on the intracellular protection of cells
against oxidative stress from heme and heme-iron derived from
catabolism is supported by several lines of evidence (63-65). It is of
interest to compare the effects of heme-hemopexin with those of free
heme since elevated intracellular heme levels are not inconsequential
to cells. In contrast to heme-hemopexin, heme does not activate
JNK/SAPK nor, as shown elsewhere,4 extensively induce
NF There are four principal means whereby heme binding by hemopexin
protects cells from heme. First, coordination of the heme-iron via two
histidine ligands prevents heme from acting as an extracellular oxidant; second, expression of hemopexin receptors targets heme to
cells which can respond appropriately and as a corollary cells lacking
hemopexin receptors are protected from exposure to heme; third, cells
which express hemopexin receptors receive heme at a controlled rate and
in such a manner that signals from the cell surface generated by
receptor occupancy set in motion events including activation of
JNK/SAPK generating phospho-c-Jun, the nuclear translocation of NF Thus, the hemopexin heme transport system defends mammalian cells
against more than one deleterious agent or condition and as such can be
considered an important member of "pleiotropic defense systems."
Taken together these observations suggest that increasing both
extracellular and intracellular heme by heme-hemopexin above a
certain threshold is sensed via the hemopexin receptor by cells which
then undergo a series of events initiated by rapid JNK/SAPK activation
with phosphorylation of c-Jun and nuclear translocation of NF
B, G2/M
arrest, and increased expression of p53 and of the cell cycle inhibitor
p21WAF1/CIP1/SDI1 generated by heme-hemopexin appear to be of
paramount importance in cellular protection by heme-hemopexin.
![]()
INTRODUCTION
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References
B.
![]()
MATERIALS AND METHODS
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References
1·cm
1) of 1.1 × 105 at 280 nm for apo-hemopexin; 1.2 × 105 at 280 nm and 1.3 × 105 at 405 nm for
rabbit mesoheme-hemopexin. Cobalt-protoporphyrin IX-hemopexin complexes
were similarly made using published extinction coefficients (19) and
all hemopexin complexes were dialyzed against PBS at 4 °C before use.
1 cm
1 at
240 nm). The cellular carbonyl content of oxidatively modified proteins
in cell extracts was determined using a published protocol (35) and
contaminating nucleic acids were removed from the cell extracts (1 mg
of protein) by precipitation upon addition of streptomycin sulfate (1%
w/v). Proteins were recovered by precipitation and the protein carbonyl
content of the final washed pellet, dissolved in 6 M
guanidine-HCl, pH 2.3 (600 µl), was calculated from the maximum
absorbance (360-390 nm) using a molar absorbance coefficient of 22 mM
1 cm
1. To minimize variation,
the amount of protein recovered in the final pellet after
solubilization in 6 M guanidine was quantitated using the
bicinchoninic acid assay (Pierce, Rockford, IL) and the carbonyl
content of cell samples expressed per mg of protein.
B in Nuclear Extracts--
Forty eight hours
after seeding (4 × 106 cells/T150 flask) Hepa cells
were rinsed and incubated for 1 h in serum-free HEPES-buffered DMEM, pH 7.4, supplemented with heme-hemopexin (50 nM to 10 µM). Nuclear extracts were then prepared from these cells
essentially as described previously for HeLa cells (36).
Electrophoretic mobility shift assays were carried out using a 4%
(80:1 acrylamide:bis-acrylamide) polyacrylamide gel after incubation of
nuclear extracts (3 µg) for 20 min at room temperature with 0.035 pmol of an radiolabeled oligonucleotide probe encoding a consensus
sequence for the transcription factor NF
B (Promega, WI). The
oligonucleotides were radiolabeled using T4 polynucleotide
kinase (Promega, Madison, WI) and [
-32P]ATP (NEN Life
Science Products Inc., specific activity 10 µCi/µl). The identity
of the specific NF
B·DNA complex was confirmed by separate
competition studies with 50 M excess of the unlabeled NF
B consensus oligonucleotide (AGTTGAGGGGACTTTCCCAGGC from Promega, Madison, WI) as well as by supershift assays using a rabbit polyclonal anti-p65 NF
B antibody (Santa Cruz Biotechnology, Santa Cruz, CA).
![]()
RESULTS
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References

View larger version (22K):
[in a new window]
Fig. 1.
Increased oxidation by high concentrations of
heme-hemopexin (HHPX): a rapid increase in
protein carbonyl levels and nuclear translocation of NF-
B. The
data in panel A show the level of protein carbonyls in Hepa
cells incubated in DMEM containing 0.5% serum for up to 1 h as
indicated with: PBS (
), 10 µM heme-hemopexin (
), or
400 µM hydrogen peroxide (
). Panels B and
C show the data from Hepa cells incubated for 15 min with
increasing concentrations of heme-hemopexin and free heme,
respectively. The data in panel D show the results from an
electrophoretic mobility shift assay using nuclear extracts (3 µg of
protein), from Hepa cells incubated for 1 h with 0, 2, 5, or 10 µM heme-hemopexin (lanes 2-5), with a
radiolabeled oligonucleotide probe containing the consensus binding
site for NF
B (lane 1, free probe). In lane 6,
addition of antibody to the p65 subunit retarded migration of the
DNA-protein complex (top arrow), and there was a decrease in
the amount of radioactive complex in the presence of a 50-fold excess
of unlabeled NF
B oligonucleotide (lane 7).
B (NF
B)--
The nuclear concentration
of NF
B is induced by extracellular hydrogen peroxide, cell damage,
and growth arrest (37). Within 1 h, heme-hemopexin (2-10
µM) induces NF
B DNA binding approximately 5-7-fold as
shown by electrophoretic mobility shift assays (Fig. 1D).
Identification of NF
B was confirmed by the supershift of the
radiolabeled DNA-protein complexes in the presence of an antibody to
the p65 subunit of NF
B (Fig. 1D, lane 6) and by specific
competition with a non-radiolabeled oligonucleotide encoding an NF
B
consensus binding site (Fig. 1D, lane 8). Low levels of
heme-hemopexin (i.e. 0.01-1 µM), which
stimulate cell growth in MOLT-3 cells (26) and in Hepa cells (see
below), do not detectably increase the DNA binding of NF
B.
. Exposure of cells to 2-10 µM heme-hemopexin caused extensive activation of JNK/SAPK within 30 min, which continues to increase for 1 h (Fig. 2). The
extent of JNK/SAPK activation is proportional to the extracellular
concentration of heme-hemopexin (Fig. 2B). JNK/SAPK activity
exhibits a biphasic response: declining by 3 h but increasing
again by 6 h. Phospho-c-Jun levels are maintained for at least
6 h, with a small decline at 3 h (Fig. 2A) and
there is no apparent change in the amount of total c-Jun, as determined by Western analysis, over this time (Fig. 2A, lower
panel).

View larger version (39K):
[in a new window]
Fig. 2.
Activation of JNK/SAPK by heme-hemopexin
(HHPX). Hepa cells were incubated for up to 6 h
in LSDMEM in the presence or absence of 0-10 µM
heme-hemopexin. The activity of JNK/SAPK is determined in whole cell
extracts as described under "Experimental Procedures" using the
phosphorylation of c-Jun as substrate, the amount of which was then
quantitated by Western immunoblotting as shown. Panel A
shows the time course in response to 10 µM heme-hemopexin
of, from top to bottom, JNK/SAPK activation, levels of phospho-c-Jun,
and the levels of total c-Jun (the arrow indicates the
phosphorylated form due to a small degree of cross-reactivity of the
anti-c-Jun antibody with phosphorylated c-Jun). The dose-response of
c-Jun levels after a 1-h incubation with 1-10 µM
heme-hemopexin is shown in panel B.

View larger version (28K):
[in a new window]
Fig. 3.
Dose-response curve for the effects of
heme-hemopexin (HHPX) on Hepa cell
proliferation. Mouse Hepa cells (2 × 103
cells/well) were grown in microtiter plates in DMEM containing 4.5 g/ml
glucose and either 5% FBS or 0.5% FBS with or without supplementation
with heme-hemopexin (0.05-10 µM) as indicated. The
number of viable cells was determined 48 h later using the Promega
proliferation assay, as described under "Experimental Procedures."
The data in Panel A were obtained using cells at high (p99)
passage, but essentially identical results were obtained with cells at
low (p39) passage number (data not shown) routinely used. Panel
B shows the effect of increasing amounts of heme-hemopexin on
cells treated with 20 µM desferroxamine. The means and
standard deviation of triplicate samples from one representative
experiment repeated at least twice are shown. The mean value for cells
grown in DMEM containing 0.5% FBS was defined as 100% (O.D. 570 minus
650 nm) and was used to normalize all other values.

View larger version (20K):
[in a new window]
Fig. 4.
Effects of high concentrations of
heme-hemopexin (HHPX) on cell viability. The data show
the growth of Hepa cells incubated for 24 h in DMEM supplemented
with 0.5% FBS containing 10 µM heme-hemopexin followed
by a second 24-h period of culture in increasing concentrations of
serum as indicated (Panel A) or in low serum medium
containing either 0.75 or 10 µM heme-hemopexin
(Panel B). In panel C, PARP cleavage was used as
an indicator of apoptosis. After growth for 16 h, cells were
incubated for 21 h in medium containing PBS or 10 µM
heme-hemopexin (lanes 1 and 2, respectively) or
the topoisomerase I inhibitor, camptothecin (10 µM;
lane 3). Lane 4 contains the 86-kDa proteolytic
fragment of cleaved PARP present in an extract of HL-60 cells
(equivalent to 1 × 105 cells) after incubation with
ectoposide.

View larger version (33K):
[in a new window]
Fig. 5.
Effects of heme-hemopexin (HHPX)
on the expression of p21WAF1/CIP1/SDI1. Two protocols were
employed as illustrated. The data in panel A show the
increase in p21WAF1/CIP1/SDI1 when cells growing in DMEM with
0.5% FBS were incubated with 10 µM heme-hemopexin at
different times after synchronization. In panel B, cells
were treated at time 0 and harvested subsequently at 6, 24, and 48 h. Doxorubicin (0.2 µg/ml) was used as a positive control. In
panel C, the data show by light microscopy the typical
morphology of cells after incubation for 48 h in LSDMEM (i), 10 µM heme-hemopexin (ii), or doxorubicin (iii). Panel
D shows the levels of p21WAF1/CIP1/SDI1 detected by
Western analysis in cells growing for 48 h in the presence or
absence of 10 µM heme-hemopexin in DMEM containing
various amounts of FBS (0.5-2.0%) compared with cells growing
exponentially in normal culture medium (DMEM supplemented with 2%
FBS).
Flow cytometry analysis of the effect of heme-hemopexin on Hepa cell
growth
B shown in Fig. 1.
This induction of p21WAF1/CIP1/SDI1 takes place whether cells
are incubated in LSDMEM (Fig. 6A) or in HEPES-buffered,
serum-free DMEM (Fig. 6B).

View larger version (24K):
[in a new window]
Fig. 6.
Rapid effects of heme-hemopexin
(HHPX) on nuclear levels of p21WAF1/CIP1/SDI1.
Western immunoblotting was used to measure the
p21WAF1/CIP1/SDI1 levels in aliquots of whole cell extracts (25 µg of protein, panel A) or nuclear extracts (5 µg of
protein, panel B) from Hepa cells incubated for 1 h
with increasing concentrations of heme-hemopexin in LSDMEM or in
HEPES-buffered serum-free DMEM, respectively.

View larger version (35K):
[in a new window]
Fig. 7.
Effects of CoPP-hemopexin
(CoPP-HPX) on JNK/SAPK activation and cellular protein
carbonyl content. The data in panel A show the increase
in phosphorylation of c-Jun in response to CoPP-hemopexin (10 µM) by 3 h by Western immunoblotting as described
under "Experimental Procedures." Panel B shows the
results from the JNK/SAPK activation assay after cells were incubated
with PBS, 10 µM heme-hemopexin, or 2 µM
free heme (a level which generates the same intracellular concentration
of heme as 10 µM heme-hemopexin, Ref. 3) for 1 or 2 h. Panel C shows the cellular phospho-c-Jun levels at 1 h after cells were incubated with PBS, heme-hemopexin, or
CoPP-hemopexin or free heme at the concentrations indicated.
Panel D shows the changes in protein carbonyl content in
Hepa cells incubated for up to 60 min in PBS (
) in the presence or
absence of either 10 µM heme-hemopexin (
) or
CoPP-hemopexin (
).
![]()
DISCUSSION
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References
B Rel family and
NF
B itself which is released from the cytosolic "signalsome" complex upon phosphorylation of a component protein, I
B (49). After
incubation of Hepa cells with heme-hemopexin, NF
B is translocated to
the nucleus within 60 min. Despite increasing cellular protein carbonyl
content, free heme is not as extensive an inducer of the DNA binding of
NF
B as is heme-hemopexin.4
Several kinases including JNK/SAPK, PKC, and an I
B-2 kinase activated by tumor necrosis factor-
have been implicated in the phosphorylation of I
B (see Ref. 49). Both JNK/SAPK as shown here and
PKC (26) are activated by hemopexin. Clinically, NF
B is considered
to play a significant role in ischemia reperfusion injury (50)
especially related to the inflammatory response (51). The promoters of
many genes activated by oxidative stress contain NF
B-binding sites
including human HO-1 (52), but whether NF
B plays a role in HO-1
induction by physiological stimuli is not yet established.
B (57) and immediate
early genes (e.g. c-jun), other key regulatory
proteins which can affect cell cycle distribution, rate of DNA repair
and DNA replication, including p21WAF1/CIP1/SDI1 and p53, are
induced. p21WAF1/CIP1/SDI1 inhibits all
cyclin-dependent kinases and overall acts as a survival factor (58). Hepa cells express wild type p53 and hemopexin causes a
rapid increase in nuclear levels of p21WAF1/CIP1/SDI1 within
1 h, i.e. during the period of carbonyl production, in the absence of any detectable changes in p53 expression.
p21WAF1/CIP1/SDI1 is also induced independently of p53 when GSH
is depleted by diethylmaleate (59). Over several days, in low levels of
serum, the presence of heme-hemopexin in the medium allows the
long-term survival of Hepa cells and this is associated with
G2/M arrest with induction of both p53 and
p21WAF1/CIP1/SDI1. Furthermore, high concentrations of
heme-hemopexin increased the expression of p53 whereas growth
stimulatory levels consistently cause a 50% decrease. Overall, these
effects of hemopexin on p21WAF1/CIP1/SDI1 are consistent with
previous observations supporting a role for p21WAF1/CIP1/SDI1
activated independently of p53 by mitogens at entry into
G1/S but in addition to promote a transient pausing late in
G2/M (60), as discussed below. p21WAF1/CIP1/SDI1 is
a binding partner for JNK/SAPK inhibiting it and thus induction of
p21WAF1/CIP1/SDI1 after DNA damage may prevent apoptosis (43).
The protective effect of hemopexin is therefore proposed to be due in
part to the sustained increase in p21WAF1/CIP1/SDI1 and p53
despite the rapid and extensive JNK/SAPK activation by heme-hemopexin.
In addition, heme-hemopexin as shown here also rapidly induces NF
B
and interestingly, recent studies have shown that suppression of tumor
necrosis factor-
-mediated apoptosis results from activation by
NF
B of several genes involved in cell cycle control via inhibition
of caspase-8 (61).
B despite increasing the cellular protein carbonyl content to
levels similar to heme-hemopexin. Thus, the physiological effects of
free metalloporphyrins differ from those of protein complexes likely to
occur in the circulation reinforcing the need for studies using
physiologically relevant heme-protein complexes.
B
for gene transcription,4 as well as sustained levels of
both p21WAF1/CIP1/SDI1 and p53; and fourth, hemopexin
receptor-mediated uptake occurs in a way that allows the cells to
respond to the intracellular heme levels in a manner where even in
arrested cells HO-1 induction still takes place, which together with
ferritin also induced by heme-hemopexin provide a form of intracellular
protection as shown for retinal pigment epithelial cells (9). Hemopexin
receptors are not ubiquitously expressed on all tissues and clearly the intracellular protection afforded by HO-1 and ferritin induction by
free heme could be crucial for survival of certain cells such as
endothelial cells (64, 65). Clinically, cells lacking hemopexin receptors are at risk for heme toxicity when haptoglobin and hemopexin become depleted during chronic and acute hemolysis. Intravascular hemolysis from normal "wear and tear" on red blood cells accounts for at least 10% of red cell breakdown but is pathological in the
hemolytic anemias, thalassemias, in some patients with intracardiac prosthetic devices or heart valve disease, in certain viral and bacterial infections, and in crush and ischemia reperfusion injury. Although albumin can bind heme tightly (Kd 10 nM), the heme-binding site can also be occupied by
hydrophobic metabolites and pharmaceuticals, which displace heme or
prevent access. Binding of heme to albumin and to
histidine-proline-rich glycoprotein as seen in patients (66), does not
prevent heme uptake, and dissociated heme will diffuse into all cells
causing oxidative stress without JNK/SAPK activation. Once
heme-albumin complexes are detected in the circulation the prognosis is
extremely poor for patients with life-threatening hemorrhagic shock
(67), indicating that additional therapeutic measures utilizing
proteins are worthy of investigation.
B
together with the induction and maintenance of
p21WAF1/CIP1/SDI1 and p53 to protect themselves. Consequently,
dividing cells with functional p53 survive after a period of transient
cell arrest. Thus, the hemopexin system provides cells with a means,
including activation of separate kinases of which PKC and MAPK family
member JNK/SAPK have been identified, whereby they can combat increases in cellular heme, iron, and oxidation state with the concomitant regulation of HO-1 and MT-1 gene expression among several others.
| |
ACKNOWLEDGEMENTS |
|---|
We thank L. Khalifah and Dr. N. Shipulina for help with the purification of hemopexin used for this research. We are indebted to Dr. Bruce Kimler and Bill Justice (Kansas University Medical Center, Kansas City, Kansas) for extensive help with the flow cytometry and also thank Dr. Guy Poirier (Research Center of the Central Hospital of Laval University, Quebec, Canada) for the anti-PARP antibodies.
| |
FOOTNOTES |
|---|
* This work was supported in part by United States Public Health Service Grant DK 37463 (to A. S.).The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
Contributed equally to the results of this research.
§ To whom correspondence should be addressed: Div. of Molecular Biology and Biochemistry, School of Biological Science, University of Missouri-Kansas City, 5007 Rockhill Rd., Kansas City, MO 64110-2499. Tel.: 816-235-2579; Fax: 816-235-5595; E-mail: smithan{at}umkc.edu.
The abbreviations used are:
HO-1, heme
oxygenase-1; heme, iron-protoporphyrin IX; NF
B, nuclear factor
B; CoPP, cobalt-protoporphyrin IX; SAPK, stress-activated protein kinase; JNK, c-Jun N-terminal kinase; MAPK, mitogen-activated protein kinase; MT-1, metallothionein-1; PKC, protein kinase C; GST, glutathione
S-transferase; LSDMEM, Dulbecco's modified Eagle's medium
containing 0.5% FBS; PARP, poly(ADP-ribose)polymerase; PBS, phosphate-buffered saline; PAGE, polyacrylamide gel electrophoresis; FBS, fetal bovine serum.
2 A. Smith, unpublished observations.
3 A. Smith and J. D. Eskew, unpublished observations.
4 R. M. Vanacore, J. D. Eskew, P. J. Morales, L. Sung, and A. Smith, submitted for publication.
5 M. Shibata-Womack, P. J. Morales, L. Sung, N. Shipulina, and A. Smith, submitted for publication.
| |
REFERENCES |
|---|
|
|
|---|