![]()
|
|
||||||||
J Biol Chem, Vol. 274, Issue 20, 13865-13869, May 14, 1999
From the Heritable Disorders Branch, NICHHD, National Institutes of
Health, Bethesda, Maryland 20892
Glycogen storage disease type 1b is caused by a
deficiency in a glucose 6-phosphate transporter (G6PT) that
translocates glucose 6-phosphate from the cytoplasm to the endoplasmic
reticulum lumen where the active site of glucose 6-phosphatase is
situated. Using amino- and carboxyl-terminal tagged G6PT, we
demonstrate that proteolytic digestion of intact microsomes resulted in
the cleavage of both tags, indicating that both termini of G6PT face
the cytoplasm. This is consistent with ten and twelve transmembrane
domain models for G6PT predicted by hydropathy analyses. A region of
G6PT corresponding to amino acid residues 50-71, which constitute a
transmembrane segment in the twelve-domain model, are situated in a
51-residue luminal loop in the ten-domain model. To determine which of
these two models is correct, we generated two G6PT mutants, T53N and S55N, that created a potential Asn-linked glycosylation site at residues 53-55 (N53SS) or 55-57
(N55QS), respectively. N53SS or
N55QS would be glycosylated only if it is situated in a
luminal loop larger than 33 residues as predicted by the ten-domain
model. Whereas wild-type G6PT is not a glycoprotein, both T53N and S55N mutants are glycosylated, strongly supporting the ten-helical model for
G6PT.
Glycogen storage disease type 1 (GSD-1),1 also known as von
Gierke disease, is caused by a deficiency in microsomal glucose 6-phosphatase (G6Pase) activity (1). The disease presents with both
clinical and biochemical heterogeneity consistent with the existence of
two major subgroups, GSD-1a and GSD-1b. GSD-1a, the most prevalent form
of GSD-1 (1), is caused by mutations in the G6Pase gene that
abolish or greatly reduce G6Pase activity (2). The active site of
G6Pase is situated inside the lumen of the endoplasmic reticulum (ER)
(3). Therefore, the glucose 6-phosphate (G6P) substrate, which is
present in the cytoplasm, must be translocated across the ER membrane
to be converted to glucose and phosphate by G6Pase, a key enzyme in
glucose homeostasis (4). This led Arion et al. (5, 6) to
postulate that hydrolysis of G6P requires the participation of at least
two membrane proteins, a G6P transporter (G6PT) and a G6Pase catalytic
unit. Based on this concept, Narisawa et al. (7) and Lange
et al. (8) proposed that GSD-1b is caused by a defect in the
microsomal G6P transport system. Both GSD-1a and GSD-1b are
characterized by hypoglycemia, hepatomegaly, kidney enlargement, growth
retardation, lactic acidemia, hyperlipidemia, and hyperuricemia,
consequences of a functional G6Pase deficiency (1). Additionally,
GSD-1b patients also manifest infectious complications because of a
heritable neutropenia and functional deficiencies of neutrophils and
monocytes (9, 10).
Recently, cDNA encoding human (11), mouse (12), and rat (12) G6PT
have been isolated and characterized. Mammalian G6PTs are
membrane-associated proteins of 429 amino acids, each of which contains
an ER transmembrane protein retention signal at its carboxyl (COOH)
terminus (11, 12). The human G6PT gene consists of 9 exons
(13, 14), spans approximately 5.3 kilobases (14), and maps to
chromosome 11q23 (15-17). Mutations in the G6PT gene that
segregated with the GSD-1b disorder have been identified in over forty
GSD-1b families (11, 13, 14, 16, 17). More recently, we have developed
a functional assay for the recombinant G6PT protein and shown that
mutations uncovered in the G6PT gene of GSD-1b patients
abolish G6P transport activity (14), thus establishing the molecular
basis of the GSD-1b disorder.
Hydropathy profile analysis of the G6PT amino acid sequence predicts
that this transporter is anchored in the ER membrane by either ten (18)
or twelve (11, 19) putative transmembrane helices. The major difference
between the two G6PT models is that amino acid residues 50-71, which
constitute the transmembrane segment-2 in the twelve-domain model (11),
are part of a 51-residue loop in the ten-domain model. A survey of
mammalian multi-span membrane proteins has revealed that for a
potential Asn-linked glycosylation site to be used, it must be situated
inside the ER lumen, and the size of the hydrophilic loop must be at
least 33-amino acids in length (20, 21). Therefore, protein
glycosylation can provide useful topological information for membrane proteins.
In this report, we have analyzed the orientation of human G6PT in the
ER membrane. We used the 8 amino acid FLAG marker peptide to tag the
amino (NH2) or COOH termini of G6PT and inserted two factor
Xa protease cleavage sites (22) between G6PT and its terminal tag,
which allows the in situ removal of the tag without affecting the G6PT protein. Our results show that human G6PT contains an even number of transmembrane helices with both NH2 and
COOH termini facing the cytoplasm. To distinguish between the ten- and
twelve-domain models of G6PT, we constructed two G6PT mutants, T53N and
S55N, which create potential Asn-linked glycosylation sites at residues
53-55 and 55-57, respectively, and examined G6PT synthesis by
transient expression and in vitro translation studies. Our
data show that although the wild-type (WT) G6PT protein is
nonglycosylated, the newly introduced glycosylation sites at either
residues 53-55 (NSS) or 55-57 (NQS) are used, confirming the ten
transmembrane helical model of G6PT.
In Vitro Transcription and Translation--
In vitro
transcription-translation of G6PT cDNA constructs, in a pGEM-7Zf(+)
vector, was performed using the transcription and translation-coupled
reticulocyte lysate system obtained from Promega Biotech (Madison, WI).
L-[35S]methionine was used as the labeled
precursor. The in vitro synthesized proteins were analyzed
by 10% polyacrylamide-SDS gel electrophoresis and
fluoro-autoradiography.
Generation of Mutant G6PT Constructs--
Nucleotides 166-1486
of the human G6PT cDNA (11), which contains the entire coding
region (nucleotides 170-1459), were used as a template for mutant
construction by polymerase chain reaction. The 8-amino acid FLAG marker
peptide, DYKDDDDK (Scientific Imaging Systems, Eastman Kodak, CT) was
used to tag the NH2 and COOH termini of G6PT. The 5'-primer
for the NH2-terminal FLAG G6PT (G6PT-5'FLAG) contained an
ATG initiation codon followed by the 24-bp FLAG coding sequence
(5'-GACTACAAGGACGACGATGACAAG-3') and nucleotides 170-190 of human
G6PT; the 3'-primer contained nucleotides 1439-1459 of human G6PT. The
5'-primer for COOH-terminal FLAG G6PT (G6PT-3'FLAG) contained
nucleotides 166-187 of human G6PT; the 3'-primer contained the last
coding nucleotides (1439-1459) of human G6PT, followed by the 24-bp
FLAG coding sequence and a termination codon. The amplified fragments
were ligated into the pSVL vector (Amersham Pharmacia Biotech).
The G6PT-fXaFLAG plasmids with two factor Xa tetrapeptide recognition
motifs (IEGR) (22) located between the G6PT coding region and the
terminal FLAG tag were also constructed by polymerase chain reaction.
The 5'-primer for the NH2-terminal FLAG-fXa-G6PT (G6PT-5'fXaFLAG) contained an ATG initiation codon followed by the
24-bp FLAG coding sequence, two fXa recognition sequence
(ATCGAGGGTAGAATCGAGGGTAGA), and nucleotides 170-190 of human G6PT; the
3'-primer contained nucleotides 1439-1459 of human G6PT. The 5'-primer
for the COOH-terminal fXa-FLAG G6PT (G6PT-3'fXaFLAG) contained
nucleotides 166-187 of human G6PT; the 3'-primer contained the last
coding nucleotides (1439-1459) of human G6PT, followed by the 24-bp
fXa recognition sequence, the 24-bp FLAG coding sequence, and a
termination codon. The amplified fragments were ligated into the pSVL vector.
The two outside polymerase chain reaction primers for codon 53 (nucleotides 326-328) and codon 55 (nucleotides 332-334) mutants are
nucleotides 164-187 (sense) and nucleotides 851-878 (antisense) of
human G6PT. The antisense primer contains a BstEII site,
located at nucleotides 863-869 in human G6PT (11). Codon 53 (ACC, Thr) mutant primers (nucleotides 317-337) are (AAC, Asn) and codon 55 (AGC, Ser) mutant primers (nucleotides 323-343) are
(AAC, Asn) or (CGC, Arg); mutant bases are
denoted in boldface letters. The amplified fragments were ligated into
the pGEM7ZhG6PT-BstEII-3' or
pSVLhG6PT-3'FLAG-BstEII-3' fragment. All constructs were
verified by DNA sequencing.
Expression in COS-1 Cells and Western Blot Analysis--
COS-1
cells were grown at 37 °C in HEPES-buffered Dulbecco's modified
minimal essential medium supplemented with streptomycin, penicillin,
and 4% fetal bovine serum. The G6PT construct in a pSVL vector was
transfected into COS-1 cells by the DEAE-dextran/chloroquine method
(23) in the absence or presence of a co-transfected G6Pase cDNA
(14). Each construct was present at 30 µg and the pSVL vector DNA was
included in each transfection to a final concentration of 60 µg
plasmid DNA per 150-cm2 flask. Mock transfections of COS-1
cultures with the pSVL vector (60 µg) alone were used as controls.
After incubation at 37 °C for 3 days, the transfected cultures were
harvested for microsomal G6P uptake and Western blot analyses.
For Western blot analysis of tagged G6PT, microsomal proteins were
separated by electrophoresis through a 10% SDS-polyacrylamide gel and
blotted onto polyvinylidene fluoride membranes (Millipore Co., Bedford,
MA). The filters were incubated with a monoclonal antibody against the
FLAG epitope (Scientific Imaging Systems). The immunocomplex was then
incubated with a second antibody conjugated to alkaline phosphatase and
visualized by 5-bromo-4-chloro-3-indolyl phosphate/nitroblue
tetrazolium substrate (Kirkegarrd & Perry Laboratories, Gaithersburg, MD).
G6P Uptake Assays--
G6P uptake measurements were performed
essentially as described previously (14). Briefly, microsomes (40 µg)
were incubated in a reaction mixture (100 µl) containing 50 mM sodium cacodylate buffer, pH 6.5, 250 mM
sucrose, and 0.2 mM [U-14C]G6P (50 µCi/µmol). The reaction was stopped at the appropriate time by
filtering immediately through a nitrocellulose filter (BA85, Schleicher
& Schuell) and washed with an ice-cold solution containing 50 mM Tris-HCl, pH 7.4, and 250 mM sucrose.
Microsomes permeabilized with 0.2% deoxycholate, which abolished G6P
uptake, were used as negative controls. Two to three independent
experiments were conducted, and at least two G6P uptake studies were
performed for each microsomal preparation. Data are presented as the
mean ± S.E.
Protease Protection Assays--
G6PT-5'fXaFLAG-,
G6PT-3'fXaFLAG-, G6PT-5'FLAG-, or G6PT-3'FLAG-transfected COS-1
cultures were used for protease protection assays. Cell homogenates
(100 µg of protein) were treated with 7.5 µg of factor Xa protease
(New England Biolabs, Beverly, MA) for 2 h at room temperature in
a reaction mixture (75 µl) containing 25 mM Tris-HCl, pH
7.4, 100 mM NaCl, and 2.5 mM CaCl2.
Then, dansyl-Glu-Gly-Arg-chloromethylketone (Calbiochem) was added to a
final concentration of 10 µM to inactivate factor Xa. The
reaction mixture was then diluted 100-fold to 7.5 ml with cold buffer A
(0.25 M sucrose and 5 mM HEPES, pH 7.4) and
centrifuged at 100,000 × g for 1 h at 4 °C.
The microsomal pellets were resuspended in buffer A and used for
Western blot analysis.
Mammalian G6PTs Are Nonglycoproteins--
Sequence analysis
predicts the presence of a potential Asn-linked glycosylation site at
amino acids 354-356, conserved among human, mouse, and rat G6PT
proteins (11, 12). This site is predicted to be located in a 17-amino
acid loop in the ten-domain model (Fig.
1) or in helix 10 in the twelve-domain
model, thus would not satisfy the criteria as an acceptor for
oligosaccharides in either model. In vitro translation
assays showed that human, mouse, or rat G6PT cDNA supported the
synthesis of a 37-kDa polypeptide both in the absence or presence of
canine microsomal membranes (Fig. 2),
confirming that this glycosylation site is not normally used.
Membrane Topology of G6PT--
Sequence analysis predicts that
G6PT is anchored in the ER membrane by ten (18) or twelve (11, 19)
transmembrane helices. Because microsomes are closed vesicles with a
defined cytoplasmic-side out orientation (24), protease protection
assays using NH2- and COOH-terminal tagged G6PT constructs
should allow us to assess the location of its NH2 and COOH
termini with respect to the ER lumen. To tag G6PT, we used the 8-amino
acid FLAG marker peptide, DYKDDDDK, which has been successfully used to
tag human G6Pase (3). To demonstrate that the FLAG-tagged G6PT proteins
are targeted to the ER membrane and retain G6P transport activity, we
examined microsomal G6P uptake in COS-1 cells transfected with the WT
or a FLAG-tagged G6PT construct. In earlier studies, we have
demonstrated that G6Pase greatly facilitates G6P transport into the ER
lumen by the G6PT protein (14). In the presence of a co-transfected
G6Pase cDNA, G6P was efficiently taken up by intact microsomes
isolated from COS-1 cells transfected with the G6PT-WT cDNA (Fig.
3A). Microsomal G6P uptake
activity in G6PT-5'FLAG/G6Pase-transfected cells (Fig. 3B)
was indistinguishable from that of G6PT-WT-transfected cells (Fig.
3A), suggesting that a small 5'FLAG tag did not interfere
with G6P transport function of the G6PT protein. Significant levels of
microsomal G6P uptake activity (approximately 71% of G6PT-WT activity)
was also observed in COS-1 cells transfected with G6PT-3'FLAG/G6Pase
cDNAs (Fig. 3B), suggesting that G6PT is less tolerant
of a small COOH-terminal tag.
Both the ten and the twelve transmembrane helical models predict that
NH2 and COOH termini of G6PT are situated at the same side
of the ER membrane. The presence of an ER transmembrane retention signal at the COOH termini of mammalian G6PT proteins suggests that
COOH terminus of G6PT faces the cytoplasm (25). Thus, in intact
microsomes, both NH2- and COOH-terminal FLAG tags in G6PT should be sensitive to proteolytic digestion. However, unlike G6Pase,
which is resistant to limited proteolytic digestion (3), the G6PT
protein is sensitive to proteolysis as trypsin at 10 µg/mg microsomal
protein rapidly abolishes G6P transport activity of the G6PT protein
both in the absence or presence of
G6Pase.2 To accurately
determine the topology of G6PT, we inserted two factor Xa protease
recognition motifs (22) between the G6PT coding region and the FLAG tag
to yield G6PT-5'fXaFLAG and G6PT-3'fXaFLAG constructs, and examined G6P
transport by transient expression assays. Significant G6P uptake
activities were observed in microsomes from either
G6PT-5'fXaFLAG/G6Pase or G6PT-3'fXaFLAG/G6Pase-transfected cells (Fig.
3C), albeit at reduced efficiencies. Our data suggest that
both G6PT-5'fXaFLAG and G6PT-3'fXaFLAG constructs were anchored in the
ER membrane and functioned as a G6P transporter.
Intact microsomes, isolated from G6PT-5'fXaFLAG or G6PT-3'fXaFLAG
transfected COS-1 cells, were then subjected to digestion by factor Xa
and the presence of the FLAG epitope was visualized by Western blot
analysis (Fig. 4). Microsomes isolated
from G6PT-5'FLAG or G6PT-3'FLAG-transfected cells were used as
controls. The FLAG tag in microsomes of G6PT-5'fXaFLAG or
G6PT-3'fXaFLAG-transfected cells was cleaved by factor Xa protease
(Fig. 4), indicating that both NH2 and COOH termini of
human G6PT face the cytoplasm and that human G6PT possesses an even
number of transmembrane helices. Amino acid sequence analysis of G6PT
predicts that the native protein contains no factor Xa recognition
motifs. The FLAG tag in microsomes of either G6PT-5'FLAG or G6PT-3'FLAG
transfected cells was resistant to factor Xa digestion (Fig. 4), as
expected.
Human G6PT Contains Ten-transmembrane Helices--
The major
difference between the two topological models of G6PT is that residues
50-71, which constitutes helix 2 in the twelve-domain model (11), are
situated in a 51-residue luminal loop 1 in the ten-domain model (Fig.
1). Whereas a potential Asn-linked glycosylation site within a
transmembrane helix would not be used as an acceptor for
oligosaccharides, such a site in a luminal loop larger than 33 residues
would be used (20, 21). To distinguish between these two models, we
constructed two mutants, G6PT-T53N and G6PT-S55N, that created a
potential glycosylation site at residue 53-55 (N53SS) or
residues 55-57 (N55QS), respectively. Synthesis and
processing of WT or mutant G6PT were examined in transfected COS-1
cells and by in vitro translation assays.
Biosynthesis of G6PT in COS-1 cells transfected with a FLAG-tagged
G6PT-WT, G6PT-T53N, or G6PT-S55N construct, in the absence or presence
of a protein glycosylation inhibitor, tunicamycin (26), was analyzed by
Western blot assays. Both G6PT-WT5'FLAG and G6PT-WT3'FLAG constructs
supported the synthesis of a 37-kDa polypeptide in the absence or
presence of tunicamycin (Fig.
5A), confirming that G6PT is
not a glycoprotein. In contrast, G6PT-T53N3'FLAG as well as
G6PT-S55N3'FLAG constructs supported the synthesis of polypeptides of
41- and 37-kDa in the absence or presence of tunicamycin, respectively
(Fig. 5A). Our data show that the introduced glycosylation
sites, N53SS and N55QS, were used as acceptors
for oligosaccharides.
In vitro translation assays showed that G6PT-T53N and
G6PT-S55N mutant mRNAs directed the synthesis of a polypeptide of
37 kDa, which was processed to a glycopolypeptide of 41 kDa in the presence of canine microsomal membranes (Fig. 5B). This is
in contrast to the G6PT-WT mRNA which directed the synthesis of a 37-kDa protein both in the absence of presence of canine microsomal membranes (Fig. 5B). Our data support the ten transmembrane
helical model for G6PT.
A number of missense mutations identified in the G6PT gene
of GSD-1b patients are located in the 51 amino acid luminal loop (14,
16, 17) in G6PT, predicted by the ten-helical model (Fig. 1). Using
transient expression studies, we have previously shown that G6PT
harboring one of these mutations, R28H, was unable to transport G6P
into the microsomes (14). In the present study, we examined microsomal
G6P transport activity of another naturally occurring luminal loop
mutant, G6PT-S55R (17), as well as our glycosylated G6PT constructs,
G6PT-T53N and G6PT-S55N. Our results showed that G6P uptake activity in
intact microsomes isolated from COS-1 cells transfected with the
G6PT-S55R, G6PT-T53N, or G6PT-S55N cDNA, in the presence of a
co-transfected G6Pase cDNA, was nondetectable (data not shown).
It has been proposed that hydrolysis of G6P requires the
participation of at least two ER-associated membrane proteins, a G6P
transporter, G6PT, that translocates G6P from the cytoplasm to the ER
lumen, and a catalytic unit, G6Pase, that hydrolyzes G6P to glucose and
phosphate (5). In earlier studies (3, 27), we have defined the
transmembrane topology of G6Pase and shown that the active site of this
enzyme faces the ER lumen. In this study, we characterized the
orientation of the G6PT protein in the ER and showed that both the
NH2 and COOH termini of G6PT reside in the cytoplasm,
indicating that G6PT contains an even number of transmembrane helices.
We further show that mammalian G6PTs are nonglycoproteins and a
conserved Asn-linked glycosylation site at residues 354-356 (11, 12)
is not used as an acceptor for oligosaccharides.
Hydropathy profile analysis of bacterial transporters/receptors
predicts that the sugar-phosphate transporter, uhpT, the G6P receptor,
uhpC, and the glycerol-3-P transporter, GlpT, contain twelve
transmembrane segments (28, 29). Sequence alignment of G6PT with uhpT,
uhpC, and GlpT suggests that human G6PT may also contain twelve
transmembrane helices (11). The topology of uhpT has been examined
using fusion proteins containing uhpT and a topological reporter,
alkaline phosphatase (PhoA) (29). It was assumed that fusion of PhoA to
a periplasm-facing segment of a membrane protein would allow export of
the PhoA moiety, resulting in high phosphatase activity. On the other
hand, fusion of PhoA to a cytoplasm-facing segment or to a
transmembrane domain of a membrane protein would exhibit lower
phosphatase activity. A total of fifteen uhpT-PhoA fusion proteins were
analyzed and the results, in general, supported the proposed twelve
helical model for uhpT (29). However, fusion of PhoA to residue 79 in
uhpT yielded a fusion protein exhibiting 100% of phosphatase activity (29). According to the twelve-domain model of uhpT, residue 79 is
situated within helix 2, and thus should exhibit low phosphatase activity. This raised the possibility that amino acid 79 in uhpT actually faces the periplasm. The hydropathy profiles analyzed by newly
developed algorithms (the TMpred program and Ref. 18) predict that
uhpT, uhpC, and G6PT contains nine, ten, and ten transmembrane helices,
respectively. To distinguish between the ten versus twelve
transmembrane helical models of G6PT, we employed glycosylation
scanning assays. Protein glycosylation provides a useful topological
marker for membrane proteins. We created a potential Asn-linked
glycosylation site in the region spanning amino acid residues 50-71 in
G6PT, which would be in either helix 2 (twelve-helical model) or a
51-residue luminal loop 1 (ten-helical model). We showed that the newly
introduced glycosylation sites, N53SS and
N55QS, were used as acceptors for oligosaccharides. Our
data support the ten transmembrane helical model for the G6PT protein
(Fig. 1).
To date, twelve missense mutations, G20D, R28C, R28H, S55R, G68R, G88D,
W118R, G149E, G150R, C183R, R300H, and G339C, have been uncovered in
the G6PT gene of GSD-1b patients (11, 13, 14, 16, 17). It is
interesting to note that four of these mutations, R28C, R28H, S55R, and
G68R, are in the 51-residue luminal loop 1 in G6PT (Fig. 1). In an
earlier study (14), we showed that G6P uptake by the G6PT protein is
greatly enhanced by G6Pase, and that G6PT harboring a R28H mutation
(G6PT-R28H) was unable to transport G6P both in the absence or presence
of G6Pase. In this study, we show that the G6PT-T53N and G6PT-S55N
mutants as well as a naturally occurring G6PT-S55R mutant, each of
which altered an amino acid within luminal loop 1, also lost their
ability to transport G6P. Because this loop is located inside the ER
lumen, it is tempting to speculate that luminal loop 1 in G6PT plays an
important role in facilitating hydrolysis of G6P by G6Pase and is not
involved in recruiting or binding of G6P in the cytoplasm.
In summary, our data strongly support the ten transmembrane helical
model of human G6PT. We have previously shown that G6Pase is anchored
in the ER membrane by nine transmembrane helices (3). Understanding of
the orientations of both proteins in the ER should facilitate studies
of the interrelationship between G6PT and G6Pase, two major players of
the G6Pase system.
We thank Drs. A. Mukherjee, I. Owens, and M. Chamberlin for critical reading of the manuscript.
*
The costs of publication of this
article were defrayed in part by the
payment of page charges. The article
must therefore be hereby marked
"advertisement" in
accordance with 18 U.S.C. Section
1734 solely to indicate this fact.
2
C.-J. Pan, B. Lin, J. Y. Chou, unpublished results.
The abbreviations used are:
GSD-1, glycogen
storage disease type 1;
G6Pase, glucose 6-phosphatase;
ER, endoplasmic
reticulum;
G6P, glucose 6-phosphate;
G6PT, G6P transporter;
WT, wild
type;
bp, base pair(s);
PhoA, alkaline phosphatase.
Transmembrane Topology of Human Glucose 6-Phosphate
Transporter*
![]()
ABSTRACT
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES
![]()
INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES
![]()
MATERIALS AND METHODS
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES
![]()
RESULTS
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

View larger version (47K):
[in a new window]
Fig. 1.
The predicted ten transmembrane helical
structure of human G6PT. The locations of the twelve missense
mutations identified in the G6PT gene of GSD-1b patients are
shown in black. A potential Asn-linked glycosylation site at
residues 354-356 and amino acid residues 50-71, which constitute
helix 2 in the twelve-helical model of G6PT (11, 19) are shaded.
Transmembrane helices were identified by the algorithm of Hoffman and
Stoffel (18) using the TMpred program.

View larger version (38K):
[in a new window]
Fig. 2.
Analysis of G6PT synthesis by in
vitro transcription-translation of human, mouse, or rat G6PT
cDNA in the absence or presence of canine microsomal
membranes. L-[35S]methionine was used as
the labeled precursor, and after electrophoresis, the proteins were
visualized by fluoro-autoradiography.

View larger version (12K):
[in a new window]
Fig. 3.
Microsomal [U-14C]G6P
uptake. COS-1 cells were transfected with a G6PT construct in the
presence of a co-transfected G6Pase cDNA as described under
"Materials and Methods." Cells transfected with the pSVL vector
(mock) or a G6Pase cDNA alone were used as controls. A,
uptake of G6P into microsomes of G6PT-WT/G6Pase- (
) G6Pase- (
, or
mock- (
) transfected cells. B, uptake of G6P into
microsomes of G6PT-5'FLAG/G6Pase- (
) or G6PT-3'FLAG/G6Pase- (
)
transfected cells. C, uptake of G6P into microsomes of
G6PT-5'fXaFLAG/G6Pase- (
) or G6PT-3'fXaFLAG/G6Pase- (
)
transfected cells. Data are presented as the mean ± S.E.

View larger version (40K):
[in a new window]
Fig. 4.
Sensitivity of NH2 and COOH
termini of human G6PT to proteolytic digestion. Intact microsomes
isolated from G6PT-5'fXaFLAG-, G6PT-3'fXaFLAG-, G6PT-5'FLAG-, or
G6PT-3'FLAG-transfected COS-1 cells were subjected to digestion by
factor Xa protease as described under "Materials and Methods." Mock
transfected cells were used as controls. The presence or absence of the
FLAG epitope was analyzed by Western blot hybridization and visualized
by an anti-FLAG monoclonal antibody. The arrow indicates the
FLAG-tagged G6PT proteins.

View larger version (24K):
[in a new window]
Fig. 5.
A, Western blot analysis of G6PT
biosynthesis in transient expression assays. COS-1 cells were
transfected with the G6PT-5'FLAG, G6PT-3'FLAG, G6PT-T53N3'FLAG, or
G6PT-S55N3'FLAG construct. After incubation at 37 °C for 48 h
in the absence or presence of tunicamycin (1 µg/ml), the transfected
cultures were harvested for Western blot analysis and probed with a
monoclonal antibody against the FLAG epitope. Mock transfected cells
were used as controls. Each lane contained 20 µg proteins.
B, analysis of G6PT synthesis and processing by in
vitro transcription-translation of the G6PT-WT, G6PT-T53N, or
G6PT-S55N construct in the absence or presence of canine microsomal
membranes. L-[35S]methionine was used as the
labeled precursor and after electrophoresis, the proteins were
visualized by fluoro-autoradiography. Arrows indicate the
nonglycosylated and glycosylated G6PT.
![]()
DISCUSSION
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES
![]()
ACKNOWLEDGEMENTS
![]()
FOOTNOTES
To whom correspondence should be addressed: NICHHD, National
Institutes of Health, Bldg. 10, Rm. 9S241, Bethesda, MD 20892. Tel.:
301-496-1094; Fax: 301-402-7784; E-mail: chou{at}helix.nih.gov.
![]()
ABBREVIATIONS
![]()
REFERENCES
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES
Copyright © 1999 by The American Society for Biochemistry and Molecular Biology, Inc.
![]()
CiteULike
Complore
Connotea
Del.icio.us
Digg
Reddit
Technorati What's this?
This article has been cited by other articles:
![]() |
S.-Y. Chen, C.-J. Pan, K. Nandigama, B. C. Mansfield, S. V. Ambudkar, and J. Y. Chou The glucose-6-phosphate transporter is a phosphate-linked antiporter deficient in glycogen storage disease type Ib and Ic FASEB J, July 1, 2008; 22(7): 2206 - 2213. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Y. Kim, H. S. Jun, P. A. Mead, B. C. Mansfield, and J. Y. Chou Neutrophil stress and apoptosis underlie myeloid dysfunction in glycogen storage disease type Ib Blood, June 15, 2008; 111(12): 5704 - 5711. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. W. Sloop, A. D. Showalter, A. L. Cox, J. X. C. Cao, A. M. Siesky, H. Y. Zhang, A. R. Irizarry, S. F. Murray, S. L. Booten, E. A. Finger, et al. Specific Reduction of Hepatic Glucose 6-Phosphate Transporter-1 Ameliorates Diabetes while Avoiding Complications of Glycogen Storage Disease J. Biol. Chem., June 29, 2007; 282(26): 19113 - 19121. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Ghosh, Y. Y. Cheung, B. C. Mansfield, and J. Y. Chou Brain Contains a Functional Glucose-6-Phosphatase Complex Capable of Endogenous Glucose Production J. Biol. Chem., March 25, 2005; 280(12): 11114 - 11119. [Abstract] [Full Text] [PDF] |
||||
![]() |
L.-Y. Chen, J.-J. Shieh, B. Lin, C.-J. Pan, J.-L. Gao, P. M. Murphy, T. F. Roe, S. Moses, J. M. Ward, E. J. Lee, et al. Impaired glucose homeostasis, neutrophil trafficking and function in mice lacking the glucose-6-phosphate transporter Hum. Mol. Genet., October 1, 2003; 12(19): 2547 - 2558. [Abstract] [Full Text] [PDF] |
||||
![]() |
L.-Y. Chen, C.-J. Pan, J.-J. Shieh, and J. Y. Chou Structure-function analysis of the glucose-6-phosphate transporter deficient in glycogen storage disease type Ib Hum. Mol. Genet., December 1, 2002; 11(25): 3199 - 3207. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. D. Foster and R. C. Nordlie The Biochemistry and Molecular Biology of the Glucose-6-Phosphatase System Experimental Biology and Medicine, September 1, 2002; 227(8): 601 - 608. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Oriol, I. Martinez-Duncker, I. Chantret, R. Mollicone, and P. Codogno Common Origin and Evolution of Glycosyltransferases Using Dol-P-monosaccharides as Donor Substrate Mol. Biol. Evol., September 1, 2002; 19(9): 1451 - 1463. [Abstract] [Full Text] [PDF] |
||||
![]() |
I. Chico-Calero, M. Suarez, B. Gonzalez-Zorn, M. Scortti, J. Slaghuis, W. Goebel, The European Listeria Genome Consortium, and J. A. Vazquez-Boland Hpt, a bacterial homolog of the microsomal glucose- 6-phosphate translocase, mediates rapid intracellular proliferation in Listeria PNAS, December 21, 2001; (2001) 12363899. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Wille, A. Szekeres, O. Majdic, E. Prager, G. Staffler, J. Stockl, D. Kunthalert, E. E. Prieschl, T. Baumruker, H. Burtscher, et al. Characterization of CDw92 as a Member of the Choline Transporter-Like Protein Family Regulated Specifically on Dendritic Cells J. Immunol., November 15, 2001; 167(10): 5795 - 5804. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Jayasinghe, K. Hristova, and S. H. White MPtopo: A database of membrane protein topology Protein Sci., February 1, 2001; 10(2): 455 - 458. [Abstract] [Full Text] |
||||
![]() |
L.-Y. Chen, B. Lin, C.-J. Pan, H. Hiraiwa, and J. Y. Chou Structural Requirements for the Stability and Microsomal Transport Activity of the Human Glucose 6-Phosphate Transporter J. Biol. Chem., October 27, 2000; 275(44): 34280 - 34286. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Caraco, L. Aloj, L.-Y. Chen, J. Y. Chou, and W. C. Eckelman Cellular Release of [18F]2-Fluoro-2-deoxyglucose as a Function of the Glucose-6-phosphatase Enzyme System J. Biol. Chem., June 9, 2000; 275(24): 18489 - 18494. [Abstract] [Full Text] [PDF] |
||||
![]() |
I. Chico-Calero, M. Suarez, B. Gonzalez-Zorn, M. Scortti, J. Slaghuis, W. Goebel, T. European Listeria Genome Consortium, and J. A. Vazquez-Boland Hpt, a bacterial homolog of the microsomal glucose- 6-phosphate translocase, mediates rapid intracellular proliferation in Listeria PNAS, January 8, 2002; 99(1): 431 - 436. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| All ASBMB Journals | Molecular and Cellular Proteomics |
| Journal of Lipid Research |