|
J Biol Chem, Vol. 274, Issue 20, 14204-14209, May 14, 1999
Characterization of the Murine A1 Adenosine Receptor Promoter,
Potent Regulation by GATA-4 and Nkx2.5*
Scott A.
Rivkees ,
Marisa
Chen,
Jayant
Kulkarni,
Jeffrey
Browne, and
Zhiyong
Zhao
From the Yale University School of Medicine, Division of Pediatric
Endocrinology, New Haven, Connecticut 06520
 |
ABSTRACT |
Adenosine acts via A1 adenosine receptors (A1ARs)
in the heart and brain to potently influence mammalian physiology.
A1ARs are expressed very early in embryonic development, and A1ARs are among the earliest expressed G protein coupled receptors in the heart
and brain. To understand the biologic basis of A1AR expression, a
genomic fragment containing the murine A1AR promoter was cloned. Reporter assay studies using DDT1 MF2 cells that express A1ARs revealed
that 500 base pairs of the proximal A1AR promoter contained essential
elements for A1AR gene expression. Transgenic mice with A1AR proximal
promoter coupled with the -galactosidase reporter gene had heavy
labeling of the brain and atria, consistent with normal patterns of
A1AR expression. Within the proximal A1AR promoter, putative binding
sites for cardiac transcription factors GATA and Nkx2.5 were
identified. Co-expression studies revealed that GATA-4 and Nkx2.5 could
individually drive A1AR promoter activity and act synergistically to
activate A1AR expression. These observations suggest that embryonic
A1AR expression involves activation of the A1AR promoter by GATA-4 and
Nkx2.5.
 |
INTRODUCTION |
The purine nucleoside adenosine exerts potent biological effects
through specific G protein coupled receptors
(GPCRs)1 that include A1,
A2a, A2b, and A3 adenosine receptors (1). Each adenosine receptor
subtype has distinct ligand binding properties and different patterns
of tissue expression (1). A1 adenosine receptors (A1ARs) are widely
distributed in the central nervous system and act to influence neuronal
function, neurotransmitter release, and protect against seizure
activity and cerebral ischemia (2, 3). A1ARs are also expressed in the
heart, where their activation protects the myocardium against ischemia
and can terminate supraventricular arrhythmias (4, 5).
Recent evidence shows that A1AR expression begins at very early stages
of development (6). In the central nervous system, A1ARs are expressed
in neurons during periods of active neurogenesis and neuronal migration
(6). Brain regions with high levels of A1AR expression at early stages
include the hippocampus, cerebellum, and hindbrain (6). A1ARs are
expressed at even earlier stages in the myocardium when the heart is a
primitive cardiac cylinder that has not begun beating, making A1ARs the
earliest known expressed GPCR in the heart (6, 7).
Presently, our understanding of the factors that regulate A1AR gene
expression is at early stages. The human A1AR gene promoter has been
isolated and examined (8-10). The 5'-untranslated region of the human
A1AR gene contains two promoter elements, designated "A" and
"B," that are separated by an intron (9). The A and B promoters are
believed to have nonclassical TATA boxes (A, TTAAGAC; B, TTTAAA), and
the B promoter is more active than the A promoter (9). It has been
suggested that nuclear proteins bind to AGG motifs in the promoter A
region, although the identity of these proteins is unknown (10).
Recognizing the unique temporal and spatial patterns of A1AR
expression, there is considerable interest in identifying the factors
that influence A1AR gene expression. To provide additional insights
into the factors that regulate A1AR expression, we have isolated and
characterized the murine A1AR promoter (mA1ARp). We now show that 500 bp of the proximal mA1ARp contains motifs responsible for A1AR
expression in the brain and heart and that the transcriptional
activating factors GATA-4 and Nkx2.5 potently induce mA1ARp activation.
 |
MATERIALS AND METHODS |
Library Screening
A murine genomic 129/SVJ library (CLONTECH,
Palo Alto, CA) was screened with a 32P-labeled probe
generated from a 400-bp fragment from the 5'-end of the rat A1AR
cDNA (11). A positive clone of 4.5 kilobases was isolated and
purified using the polyethylene glycol (Mr 8000) precipitation method. The phage insert was subcloned into a
KpnI site in Bluescript-SKII+ (Stratagene; La Jolla, CA),
mapped by restriction digestion, and sequenced in both directions.
Production and Identification of Transgenic Mice
The 502 to +35 mA1ARp fragment was subcloned into the pNLAC
vector (12). The construct was then digested with KpnI and PstI, and the mA1AR-pNLAC DNA was gel purified (Qiagen;
Santa Clarita, CA). The purified fragment was microinjected into the pronuclei of fertilized eggs (C57/BL6) at the Yale Transgenic Center.
Injected eggs were implanted into pseudopregnant recipient mice.
Offspring were screened for the presence of the transgenes by PCR
amplification of DNA from tail biopsies using oligonucleotide primer
pairs CCGTGCATCTGCCAGTTGAG (mA1ARp) and TGGGGCAGTCGATCGGTAAGGATTC (nLAcZ). PCR conditions consisted of 30 cycles of 94 °C for 1 min,
55 °C for 45 s, and 72 °C for 2 min. PCR products were then separated on a 1.2% agarose gel.
Whole Mount, -Galactosidase Staining
-Galactose staining was examined in whole-mount embryo
specimens from timed pairings of male founders with wild-type female mice as described (12, 13). Embryos were dissected from the uteri and
placed in individual wells in 12-well plates that contained ice-cold
phosphate-buffered saline (PBS). Corresponding amniotic membranes were
saved for PCR genotyping. Embryos were fixed in 0.25% glutaraldehyde
for 30 min on ice. Specimens were next washed three times for 30 min in
PBS. Specimens were then incubated in PBS staining solution containing
2 mM MgS04, 5 mM
K3Fe(CN)6, 5 mM
K4Fe(CN)6, 0.02% Nonidet P-40, 0.01% sodium
deoxycholate, and 1.0 mg/ml X-gal. Specimens were then incubated
overnight at 37 °C. The next day, specimens were washed in PBS and
stored at 4 °C until microscopic examination. After staining, some
specimens were frozen in chilled ( 20 °C) 2-methylbutane, stored at
80°, and sectioned in a cryostat (10 µm), and tissue sections
were examined.
Determination of Transcription Start Sites
5'-RACE--
cDNA libraries were constructed from DDT1 MF-2
cell mRNA using the 5'-RACE system (Life Technologies, Inc.,
Gaithersburg, MD) (14). Single-stranded cDNAs were synthesized
using the antisense gene-specific primer 1 (GSP1;
ATAAGGATGGCCAGTGGGATGAC) located 190 bp 5' of the initiator methionine
ATG codon. The cDNAs were tailed at the 3'-end with
poly(A)+ using terminal transferase and then amplified by
the PCR reaction using the specific anchor oligonucleotides and the
GSP2 antisense primer (GACCAAGGCAATGAGCACCTCGA), which is 40 bp 5' of
the initiator methionine codon. The amplified products were then
subcloned into the pCR2.1 vector using the Invitrogen TA Cloning System
(Carlsbad, CA) and sequenced.
RNase Mapping--
Ribonuclease mapping was performed with an
RPA II kit from Ambion (Houston, TX) (15). A 210-bp fragment of mA1AR
genomic DNA that was 720-510 bp upstream of the initiator methionine
was isolated by PCR (forward primer CCATCCAGTCACTAGTACGAAACAGGG;
reverse primer, CTATATAAGCTTATCCTGCCTGCCAACCGGTA) was subcloned into
Bluescript SKII+ (Stratagene), linearized, and transcribed in
vitro with T7 RNA polymerase (Amersham Pharmacia Biotech) to yield
a 32P-labeled riboprobe that was gel purified. Twenty-five
micrograms of total RNA from DDT1 MF-2 cells were hybridized with the
riboprobe at 45 °C for 20 h and digested with 100-fold diluted
RNase solution at 37 °C for 30 min. The protected products were
analyzed by 8 M urea, 7% polyacrylamide gel
electrophoresis with 32P-labeled and
HaeIII-digested X174 RFI DNA to determine the sizes of the products.
mA1AR Promoter-Luciferase Constructs
All constructs were prepared by ligation of PCR-generated DNA
fragments into the pGL3-Basic expression vector (Promega, Madison, WI).
PCR products were generated using the full-length mA1ARp construct as a
template. PCR conditions consisted of 25 cycles of 94 °C for 1 min,
55 °C for 45 s, and 72 °C for 2 min using Roche Molecular
Biochemicals Taq polymerase (Indianapolis, IN). PCR products
were then separated on a 1.2% agarose gel and gel-eluted (Quiex II
kit; Qiagen) before digestion with restriction endonucleases and
ligation into pGL3. For isolation of the 502 to + 35 construct, the
forward primer was AACTGGCTAGCCCTGGGTTC, and the reverse primer was TCCCAGCCCGGCCTTTC.
Specific mutations were made by the PCR overlap-extension method of Ho
et al. (16). To generate the front part of mutant promoters,
oligonucleotide primer pairs (primers A and B) were designed to
generate a 5'-fragment of the mA1ARp. Another set of oligonucleotide
primer pairs (primers C and D) were designed to generate a 3'-fragment
of the mA1ARp receptor. B and C primers contained sequences that
encoded for the desired mutations. PCR reactions were performed to
generate A-B and C-D fragments, which were gel-eluted. Receptor
fragments (A-B and C-D) were then combined in a third PCR reaction to
generate a full-length A1AR using flanking primers (A and D). Flanking
PCR primers contained restriction endonuclease sites for subcloning
into PGL3. Mutant constructs were then sequenced.
Cell Culture and Transient Transfection
DDT1 MF-2, MDCK, HELA, and HepG2 cells were obtained from
American Type Culture Collection (Rockville, MD). Cells were grown in
minimal essential medium containing 10% fetal bovine serum. All media
were supplemented to final concentrations of 50 IU/ml penicillin and 50 µg/ml streptomycin. The cells were maintained in a humidified 5%
CO2, 95% air incubator at 37 °C.
On the day before transfection, cells were passaged into 12-well plates
(22-mm per dish) so they would be about 70% confluent the next
morning. Transient cell transfection was performed using LipofectAMINE
(Life Technologies, Inc.); 1 µg of each test plasmid and 0.2 µg of
the control plasmid pRL-CMV carrying the Renilla luciferase
gene downstream of the CMV promoter were added to the medium. The next
day, cells were washed twice with PBS, collected in a microcentrifuge,
and incubated in 300 µl of cell lysis solution (Promega). The
supernatant obtained by centrifugation for 5 min was used to measure
firefly and Renilla luciferase activities. Luciferase
activity was measured on 15 µl of cell extract using a TD-20/20
luminometer (Turner Designs, Sunnyvale CA) using a dual luciferase
reporter assay system (Promega). Firefly luciferace activity was
expressed relative to Renilla luciferase activity for all
test constructs. Each sample was tested in quadruplicate. Each study
was repeated at least four separate times.
Radioreceptor Assays
Radioligand binding studies were performed using intact cells as
described (6, 11), using [3H]DPCPX (NEN Life Science Products;
specific activity, 100 Ci/mmol). All determinations were done in quadruplicate.
Preparation of Nuclear Extracts
Nuclear extracts were prepared as described (17). Cultured cells
were suspended in 400 µl of buffer A (10 mm HEPES (pH 7.9), 10 mM KCl, 0.1 mM EDTA, 0.1 mM EGTA, 1 mM dithiothreitol, and 0.5 mm phenylmethylsulfonyl
fluoride). The homogenates were chilled on ice for 15 min, and then 25 µl of 10% Nonidet P-40 were added. After vigorous vortexing for
10 s, the nuclear fraction was precipitated by centrifugation at
15,000 × g for 5 min and suspended in 100 µl of
buffer B (20 mm HEPES (pH 7.9), 0.4 M NaCl, 1 mM EDTA, 1 mM EGTA, 1 mm dithiothreitol, and 1 mm phenylmethylsulfonyl fluoride). The mixture was left on ice for 15 min with frequent agitation. Nuclear extracts were prepared by
centrifugation at 15,000 × g for 5 min and stored at
80 °C. The protein concentration was determined using
bicinchoninic acid (Pierce).
Electrophoretic Mobility Shift Assay
Electrophoretic mobility shift assays (EMSAs) were performed as
described (18, 19). DNA-protein reactions were performed for 30 min at
30 °C in a mixture (20 µl) containing 20 mm HEPES (pH 7.9), 0.3 mM EDTA, 0.2 mM EGTA, 80 mm NaCl, 1 mm
dithiothreitol, 2 µg of poly(deoxyinosine-deoxycytidine) (dI-dC),
0.1-0.4 ng 32P-labeled oligonucleotide probe, and nuclear
miniextracts (2-8 µg of protein). Where indicated, the reaction was
performed in the presence of unlabeled oligonucleotide competitors.
DNA-protein complexes were electrophoresed on 4% PAGE containing 6.7 mM Tris-HCl (pH 7.5), 3.3 mM sodium acetate,
2.5% glycerol, and 0.1 mM EDTA. After electrophoresis, the
gel was dried and exposed to x-ray film.
Supershift assays using antibody to GATA 4 (sc-1237x; Santa Cruz
Bitotechnology; Santa Cruz, CA) were preformed by incubating 0.5-2.0
µg of the antibody with 100 µg of the nuclear extract for 1 h
at 4 °C. Nuclear extracts where incubated with
32P-labeled oligonucleotide probes as described above.
Sequences of oligonucleotides used in these studies were: GATA,
TCTGGGGATACTTGGCTAGAC; mutated GATA, TCTGGGGTTACTTGGCTAGAC; "A"
region, CTTCTGTCACGAATGGGGCACC; mutated "A" region, CTTCTGTTAAGAATGGGGCACC.
Statistical Analysis
ANOVA was used to test for differences among groups in
luciferase reporter studies.
 |
RESULTS |
Isolation of a Murine A1AR Promoter--
To isolate the mA1ARp, a
129SVJ murine genomic library (CLONTECH) was
screened using a probe generated from the 5'-coding region of the rat
A1AR. Library screening resulted in the isolation of a 4.5-kilobase
genomic fragment that was sequenced in full. The 3'-region of the
genomic fragment contained 700 bp that was identical to the reported
sequence of the murine A1AR (250 bp noncoding and 300 bp coding) (20).
At 742 and 685 bp upstream of the initiator methionine site, sequences
that were identical to the human A1AR promoter "A" (TTAAGA) and
"B" (TTTAAA) motifs were identified (Fig.
1).

View larger version (73K):
[in this window]
[in a new window]
|
Fig. 1.
Sequence of the proximal murine A1AR
promoter. GATA and "A" (Nkx2.5 motif) and "B" (TATA box)
site motifs are underlined. TSS, transcriptional
start site identified by RNase mapping is bold and
underlined. The initiator methionine sequence (ATG) is shown
in bold. The nucleotide numbers relative to the
transcriptional start site are shown in the left
column.
|
|
Identification of a Transcription Start Site--
We next
determined the transcription start site of the mA1ARp using
complementary methods of 5'-RACE and RNase mapping. mRNA from DDT1
MF-2 cells, which is a Syrian hamster myocyte cell line that expresses
A1ARs at high levels (21), was used in these studies. In our hands, the
concentration of A1ARs in DDT1 MF2 cells is 253 ± 12 fmol/mg
whole cell protein. Using 5'-RACE and RNase mapping, we identified a
similar transcription start site 560 bp upstream of the initiation
codon. Only one transcription start site was identified with each method.
Studies of A1ARp Truncation Mutants--
To identify regions of
the mA1ARp involved in control of A1AR gene expression, the expression
of a series of mA1ARp-luciferase constructs was examined. The mA1ARp
fragments were subcloned into the pGL3 reporter vector (Promega;
Madison WI); different cell types were transfected with LipofectAMINE
(Life Technologies, Inc.). To control for transfection efficiency,
cells were co-transfected with a Renilla control reporter
vector (pRL-CMV; Promega).
To examine the specificity of the observed responses, studies were
performed in HeLa and HEPG2 cells that do not express A1ARs and in DDT1
MF2 and MDCK cells that do express A1ARs (DDT1 MF-2, 236 ± 19 fmol/mg protein; MDCK, 45 ± 9 fmol/mg protein). Although we saw
reporter expression in all cell types in which luciferase activity was
driven by a control CMV-luciferase promoter (CMV-PGL3; Promega), no
reporter expression was seen for any of the mA1ARp fragments tested in
HEPG2 or HeLa cells (n = 4 separate studies using
reporter constructs shown in Fig. 2). In
contrast, we saw specific reporter activity after we transfected the
DDT1 MF-2 and MDCK cells with mA1ARp gene fragments (Fig. 2).

View larger version (11K):
[in this window]
[in a new window]
|
Fig. 2.
The proximal region of the A1AR promoter most
potently drives A1AR gene expression. DDT1 MF-2 cells were
transiently transfected with progressively shorter murine A1AR promoter
truncation constructs. The increase in luciferase activity (-fold
induction) relative to the reporter vector alone is shown. Data are
corrected for transfection efficiency that was assessed by
co-transfecting cells with a Renilla luciferace vector
(pRL-CMV). Bars are averages of quadruplicate determinations
and are representative of five such studies. Sizes of constructs in
kilobases are depicted to left of open bars.
+1 represents the transcription start site. Ctrl,
control. *, p < 0.05; **, p < 0.01 ANOVA. Standard errors were less than 5% of mean values.
|
|
Next, the expression of a broad series of mA1ARp truncation constructs
was examined in DDT1 MF-2 cells. With progressive deletion of the 5'
region of the A1ARp, reporter activity increased (Fig. 2). Additional
truncation studies showed that, when base pairs from 500 to 250
were deleted, reporter expression declined (Fig. 3).

View larger version (15K):
[in this window]
[in a new window]
|
Fig. 3.
Definition of the regions within the proximal
A1AR promoter ( 502 to +35) that drive A1AR gene expression. DDT1
MF-2 cells were transiently transfected with the A1AR promoter
truncation constructs shown. Bars are averages of
quadruplicate determinations and are representative of four such
studies. The relative location of GATA and "A" and "B" motifs
are shown. +1, represents transcriptional start site.
CTRL, control. *, p < 0.05; **,
p < 0.01 ANOVA. Standard errors were less than 5% of
mean values.
|
|
Generation of A1ARp-nlacZ Transgenic Mice--
Because in
vitro truncation reporter studies indicated that the proximal 500 bp of the mA1AR promoter resulted in high levels of reporter expression
in cells that contain A1ARs, we next tested if this region played a
role in A1AR expression in vivo. The proximal mA1ARp ( 502
to +35) fragment was thus linked with a previously characterized
-galactosidase reporter construct for generation of transgenic mice
(12, 13). The construct was injected into 100 murine oocytes that were
then implanted into the uteri of pseudo-pregnant female mice. Forty
mice were subsequently born, four males of which were positive for the
mA1ARp-nlacZ transgene and were studied.
To analyze patterns of reporter gene expression during early
development, founder males were mated with wild-type females. -Galactosidase activity was examined in embryos, which were
genotyped by PCR. In the embryos that were positive for the transgene
(from two lines 5163 and 5174), a blue reaction product was present over the brain, spinal cord, and atria between PC 8.5-13 (Fig. 4). In contrast, no color reaction was
seen in littermates that did not express the transgene (Fig. 4). This
pattern of expression is identical to that seen by in situ
hybridization or receptor-labeling autoradiography (6).

View larger version (92K):
[in this window]
[in a new window]
|
Fig. 4.
Brightfield image of a post-conceptual day
12.5 embryo showing expression of
-galactosidase in the brain, spinal cord, and atria
of a transgenic mouse in which -galactosidase
expression is driven by the 502- to +35-bp proximal A1AR promoter
(right panel). Please note the presence of heavy
labeling (dark areas) of the brain, spinal cord, and atria.
In comparison, there is no labeling of a littermate that does not
express the transgene (left panel). CTX, cerebral
cortex; PF, pontine flexure; SC, spinal cord;
A, atria.
|
|
Mutagenesis Studies of Putative GATA, Nkx2.5 Binding Sites, and
TTTAAA Box Motif--
Next, we attempted to identify motifs within the
proximal mA1ARp ( 502 to +35) where transcription factors may bind.
When we examined sequences within this region, we identified putative GATA, Nkx2.5 binding sites, and a potential TATA box. At position 434, a GGATAC motif was identified. This motif differs from the classical GATA binding motif of (A/T)GATA(A/G), but is shown to bind
GATA proteins (22, 23). At position 243, the sequence TTAAGAA was
identified, which is similar to the Nkx2.5 binding motif TNAAGTA (24,
25). This motif is similar to the "A" promoter of the human A1ARp.
At 85, the motif TTTAAA was identified that corresponds with the
"B" promoter of the human A1ARp.
To test the roles of these motifs on promoter activity, each was
mutated and reporter assays were performed. Following conversion of the
GATA motif to GTTA, reporter activity was markedly reduced (Fig.
5). Following conversion of the TTAAGAA
motif to TTATGAA, reporter activity was reduced by 50% (Fig. 5).
Following conversion of TTTAAA to TCTACA, reporter activity was reduced
by 70% (Fig. 5).

View larger version (17K):
[in this window]
[in a new window]
|
Fig. 5.
Mutation of the GATA and "A" and "B"
motifs reduces A1AR promoter activity. DDT1 MF-2 cells were
transiently transfected with the 502- to +35-bp A1AR-luciferase
promoter construct containing point mutations in either the GATA or
"A" or "B" motifs. Bars are averages of
quadruplicate determinations and are representative of four such
studies. *, p < 0.05; **, p < 0.01 ANOVA. Standard errors were less than 5% of mean values.
|
|
Influence of GATA-4 and Nkx2.5 on A1ARp Expression--
Because
GATA-4 and Nkx2.5 are important for heart development (26), and the
mA1ARp contains putative GATA and Nkx2.5 binding sites, we next tested
if GATA-4 and Nkx2.5 influence mA1ARp expression. A1ARp activity was
thus examined after co-transfection with constructs driving the
expression of GATA-4 or Nkx2.5 (provided by Dr. Robert Schwartz). These
studies were performed in DDT1 MF-2 and HeLa cells.
In each cell line, co-expression of GATA-4 with 502 to +35 mA1ARp
reporter constructs resulted in 20-40-fold increases in receptor
expression for the constructs containing the GATA binding motif (Fig.
6). However, when the GATA motif was
mutated to GTTA, there was no increased reporter activity (Fig. 6).

View larger version (20K):
[in this window]
[in a new window]
|
Fig. 6.
GATA-4 and Nkx2.5 regulate A1AR promoter
activity. HeLa cells were transfected with wild-type or mutated
502- to +35-bp A1AR-luciferase promoter constructs (0.5 µg/22-mm
dish), and with GATA-4, Nkx2.5, or control (CON) expression
vectors (0.5 µg/dish). Bars are averages of quadruplicate
determinations and are representative of four such studies. *,
p < 0.05; **, p < 0.01 ANOVA.
Standard errors were less than 5% of mean values.
|
|
Following co-expression of Nkx2.5 with the mA1ARp reporter construct,
mA1ARp reporter activity increased 15-fold (Fig. 6). However, when the
Nkx2.5 motif was mutated to TCTACA, increased reporter activity was not
seen (Fig. 6).
We also tested if Nkx2.5 and GATA-4 acted synergistically to drive A1AR
expression, similar to that observed for the atrial natriuretic factor
promoter (27, 28). Co-transfection studies were therefore performed by
transfecting cells with amounts of Nkx2.5 and GATA-4 expression
constructs that individually did not induce reporter expression (Fig.
7). The studies showed that Nkx2.5 and
GATA-4 acted synergistically to induce mA1ARp expression (Fig. 7).

View larger version (13K):
[in this window]
[in a new window]
|
Fig. 7.
Synergistic effects of GATA-4 and or Nkx2.5
on A1AR promoter expression. HeLa cells were transfected with the
wild-type A1AR promoter construct (0.2 µg/22-mm dish), and with
GATA-4, Nkx2.5, or control (CON) expression vectors (0.05 µg/dish). Bars are averages of quadruplicate
determinations and are representative of four such studies. *,
p < 0.05; **, p < 0.01 ANOVA.
Standard errors were less than 5% of mean values.
|
|
EMSA of Nuclear Extracts Interacting with GATA and Nkx2.5
Sites--
EMSA assays were next performed to test if the putative
GATA and Nkx2.5 binding motifs interact with nuclear proteins. When a
radiolabeled 20-bp oligonucleotide containing the GATA binding motif
was incubated with DDT-MF2 cell nuclear extracts, one prominent band
was seen (Fig. 8). When studies were
performed with increasing concentrations of unlabeled oligonucleotides,
the amount of radioactivity of the band decreased (Fig. 8). When the
GATA site was mutated to GTTA, the amount of labeling of the band was
markedly reduced (Fig. 8). When antibody against GATA-4 was added to
the nuclear extracts, the size of the band representing the protein-DNA
complex was shifted to a higher molecular weight (Fig. 8).

View larger version (45K):
[in this window]
[in a new window]
|
Fig. 8.
Gel shift assays showing interaction between
GATA-4 and the mA1ARp. Assays were performed with a
32P-labeled oligonucleotide (40 fmol, 3 × 104 cpm/reaction). Lane 1, DNA, no nuclear
extract; lanes 2-4, DNA plus 2 µg of nuclear extract
without competitor (lane 2), with GATA-4 binding site
competitor (lane 3), and with mutated GATA-4 binding site
competitor (M). For supershift studies, 2 µg of nuclear
extract was preincubated with GATA-4 antisera for 30 min. F,
free DNA; B, DNA bound by nuclear extract; S, DNA
bound by nuclear extract incubated with GATA-4 antisera.
|
|
When a radiolabeled 20-bp oligonucleotide containing the Nkx2.5 binding
motif was incubated with DDT1 MF-2 cell nuclear extracts, one prominent
band was seen (Fig. 9). When studies were
performed with increasing concentrations of unlabeled oligonucleotides, the amount of radioactivity of the band decreased (Fig. 9). When the
Nkx2.5 site in the competitor oligonucleotide was mutated to TCTACA,
the amount of labeling was not reduced (Fig. 9). Because Nkx2.5
antibody was not available to us, we did not perform Nkx2.5 supershift
studies.

View larger version (46K):
[in this window]
[in a new window]
|
Fig. 9.
Gel shift and assays showing interaction
between Nkx2.5 and the mA1ARp. Assays were performed with a
32P-labeled oligonucleotide (40 fmol, 3 × 104 cpm/reaction). Lanes 1-4 and 7,
DNA plus 2.5 µg of nuclear extract without competitor (lane
1), with mutated Nkx2.5 oligonucleotide competitor (lane
2), and with different concentrations of NKX competitor
(lanes 3 and 4); lane 5, no DNA
extract. F, free DNA; B, DNA specifically bound
by nuclear extract.
|
|
 |
DISCUSSION |
To begin to identify the factors that regulate the expression of
A1ARs, we isolated the murine A1AR promoter. Showing that the genomic
fragment isolated contained a murine A1AR promoter, patterns of
-galactosidase expression in mA1ARp-nlacZ mice were temporally and
spatially similar to patterns of A1AR expression seen in rodents (6).
When we compared human and murine A1AR promoter sequences, we detected
several similarities among the genes, further supporting the notion
that we isolated a murine A1AR promoter.
In the human A1ARp, two promoter motifs designated "A" and "B"
have been identified and shown to represent distinct transcriptional start sites (9). In the murine A1AR promoter, we identified identical
motifs that were separated by 160 bp, whereas these motifs are
separated by 650 bp in the human gene (9). Based on our mA1ARp
truncation, mutation, and gel-shift studies, we believe that the
"A" motif is a Nkx2.5 binding site. The "B" motif appears to be
an unconventional TATA box similar to that reported for other genes
(29, 30). Whereas there is evidence for two transcriptional start sites
in the human A1ARp, we only observed one transcriptional start site for
the murine A1AR promoter.
To characterize the mA1ARp, reporter assays were performed using Syrian
hamster smooth muscle DDT1 MF-2 cells since they express A1ARs at high
levels (21). We had hoped to examine murine A1AR promoter expression in
murine cell lines that express endogenous A1ARs. However, we are
unaware of murine cell lines expressing A1ARs at levels detectable by
radioligand binding studies. Fortunately, although DDT1 MF-2 cell lines
are not of murine origin, mA1ARp expression was readily apparent in
these cells.
Studies of murine A1AR promoter truncation mutants showed that the
reporter constructs spanning the region from 502 to +35 had the
highest levels of activity. In contrast, when the distal regions of the
mA1ARp were present in reporter constructs, receptor expression was
greatly reduced, raising the possibility that this region contains
binding domains for repression elements. Sequence analysis of the 502
to +35 fragment suggested the presence of GATA and Nkx2.5 binding
sites; no other GATA or Nkx binding motifs were found within this
region. Mutation of the GATA or Nkx2.5 motifs resulted in reduction in
promoter expression, suggesting that these sites play important roles
in endogenous A1AR gene expression. When co-transfection studies were
performed using GATA-4 and Nkx2.5 expression vectors, increased
promoter activity was observed, supporting the notion that GATA-4 and
Nkx2.5 can activate A1AR gene expression.
When cells were transfected with both GATA-4 and Nkx2.5, synergistic
effects on mA1ARp activity were observed. In mice, GATA-4 and Nkx2.5
are expressed in the heart as early as postconceptual day 6.5 and play
a role in driving cardiac gene expression (31-33). Recently, Nkx2.5
and GATA-4 have been shown to directly interact to drive the expression
of the atrial natriuretic factor (ANF) promoter (27, 28), as we
observed for the murine A1AR promoter.
Both ANF and A1ARs are expressed in the heart at early developmental
stages (27, 28), although cardiac A1AR expression occurs at even
earlier ages than ANF cardiac expression (6). It is thus tempting to
speculate that GATA-4 and Nkx2.5 play a role in the early cardiac
expression of A1ARs and ANF. Interestingly, Nkx2.5 is also expressed in
the tongue during early gestation (33); we also observed A1AR gene
expression in the tongue at the same developmental stages (6).
Whereas GATA-4 and Nkx2.5 may play a role in cardiac A1AR expression,
these factors are not expressed in the central nervous system (31-33).
Thus, other transcriptional activating factors will play a role in A1AR
expression in the brain. Currently, the identity of these factors is unknown.
Overall, we now show that the proximal promoter of the murine A1AR
contains critical elements for A1AR gene expression in the brain and
heart. Murine A1AR promoter activity also appears to be potently
regulated by the transcriptional activating factors GATA-4 and Nkx2.5,
which interact at a specific site in the proximal A1AR promoter. Future
studies are indicated to identify additional promoter regions and
transcriptional regulators that influence A1AR expression in other
important sites of adenosine action.
 |
ACKNOWLEDGEMENTS |
Dr. Jean Lachowicz is thanked for assistance
in some of these studies. Dr. Robert J. Schwartz is thanked for
providing GATA-4 and Nkx2.5 expression constructs. Dr. Patrick
Gallagher is thanked for technical suggestions.
 |
FOOTNOTES |
*
These studies were supported by National Institutes of
Health Grants R01-NS33539 and R01HL58442 (to S. A. R.).The costs of publication of this
article were defrayed in part by the
payment of page charges. The article
must therefore be hereby marked
"advertisement" in
accordance with 18 U.S.C. Section
1734 solely to indicate this fact.
The nucleotide sequence(s) reported in this paper has been submitted to the GenBankTM/EMBL Data Bank with accession number(s) AF133099.
To whom correspondence should be addressed: Yale Pediatrics, P. O.
Box 208081, New Haven, CT 06520. Tel.: 203-737-5975; Fax: 203-737-5972;
E-mail: Scott.Rivkees{at}Yale.edu.
 |
ABBREVIATIONS |
The abbreviations used are:
GPCR, G protein
coupled receptor;
A1AR, A1 adenosine receptor;
mA1ARp, murine A1AR
promoter;
bp, base pair(s);
PCR, polymerase chain reaction;
PBS, phosphate-buffered saline;
EMSA, Electrophoretic mobility shift assay;
ANOVA, analysis of variance;
RACE, rapid amplification of cDNA
ends;
ANF, atrial natriuretic factor;
X-gal, 5-bromo-4-chloro-3-indolyl
-D-galactopyranoside.
 |
REFERENCES |
-
Olah, M. E.,
and Stiles, G. L.
(1995)
Annu. Rev. Pharmacol. Toxicol.
35,
581-606[CrossRef][Medline]
[Order article via Infotrieve]
-
Brundege, J. M.,
and Dunwiddie, T. V.
(1997)
Adv. Pharmacol.
39,
353-391
-
Higgins, M. J.,
Hosseinzadeh, H.,
MacGregor, D. G.,
Ogilvy, H.,
and Stone, T. W.
(1994)
Pharm. World Sci.
16,
62-68[CrossRef][Medline]
[Order article via Infotrieve]
-
Shryock, J. C.,
and Belardinelli, L.
(1997)
Am. J. Cardiol.
79,
2-10
-
Linden, J.
(1991)
FASEB J.
5,
2668-2676[Abstract]
-
Rivkees, S. A.
(1995)
Brain Res. Dev. Brain Res.
89,
202-213[Medline]
[Order article via Infotrieve]
-
Hofman, P. L.,
Hiatt, K.,
Yoder, M. C.,
and Rivkees, S. A.
(1997)
Am. J. Physiol.
273,
R1374-R1380[Abstract/Free Full Text]
-
Ren, H.,
and Stiles, G. L.
(1994)
Proc. Natl. Acad. Sci. U. S. A.
91,
4864-4866[Abstract/Free Full Text]
-
Ren, H.,
and Stiles, G. L.
(1995)
Mol. Pharmacol.
48,
975-980[Abstract]
-
Ren, H.,
and Stiles, G. L.
(1998)
Mol. Pharmacol.
53,
43-51[Abstract/Free Full Text]
-
Reppert, S. M.,
Weaver, D. R.,
Stehle, J. H.,
and Rivkees, S. A.
(1991)
Mol. Endocrinol.
5,
1037-1048[Abstract/Free Full Text]
-
Hoyle, G. W.,
Mercer, E. H.,
Palmiter, R. D.,
and Brinster, R. L.
(1994)
J. Neurosci.
14,
2455-2463[Abstract]
-
Behringer, R. R.,
Crotty, D. A.,
Tennyson, V. M.,
Brinster, R. L.,
Palmiter, R. D.,
and Wolgemuth, D. J.
(1993)
Development
117,
823-833[Abstract]
-
Kriangkum, J.,
Vainshtein, I.,
and Elliott, J. F.
(1992)
Nucleic Acids Res.
20,
3793-3794[Free Full Text]
-
Gutkowska, J.,
Tremblay, J.,
Antakly, T.,
Meyer, R.,
Mukaddam-Daher, S.,
and Nemer, M.
(1993)
Endocrinology
132,
693-700[Abstract/Free Full Text]
-
Ho, S. N.,
Hunt, H. D.,
Horton, R. M.,
Pullen, J. K.,
and Pease, L. R.
(1989)
Gene
77,
51-59[CrossRef][Medline]
[Order article via Infotrieve]
-
Engeland, K.,
Andrews, N. C.,
and Mathey-Prevot, B.
(1995)
J. Biol. Chem.
270,
24572-24579[Abstract/Free Full Text]
-
Cheskis, B.,
Lemon, B. D.,
Uskokovic, M.,
Lomedico, P. T.,
and Freedman, L. P.
(1995)
Mol. Endocrinol.
9,
1814-1824[Abstract/Free Full Text]
-
Scott, V.,
Clark, A. R.,
and Docherty, K.
(1994)
Methods Mol. Biol.
31,
339-347[Medline]
[Order article via Infotrieve]
-
Marquardt, D. L.,
Walker, L. L.,
and Heinemann, S.
(1994)
J. Immunol.
152,
4508-4515[Abstract]
-
Ramkumar, V.,
Olah, M. E.,
Jacobson, K. A.,
and Stiles, G. L.
(1991)
Mol. Pharmacol.
40,
639-647[Abstract]
-
Ko, L. J.,
and Engel, J. D.
(1993)
Mol. Cell. Biol.
13,
4011-4022[Abstract/Free Full Text]
-
Merika, M.,
and Orkin, S. H.
(1993)
Mol. Cell. Biol.
13,
3999-4010[Abstract/Free Full Text]
-
Chen, C. Y.,
Croissant, J.,
Majesky, M.,
Topouzis, S.,
McQuinn, T.,
Frankovsky, M. J.,
and Schwartz, R. J.
(1996)
Dev. Genet.
19,
119-130[CrossRef][Medline]
[Order article via Infotrieve]
-
Chen, C. Y.,
and Schwartz, R. J.
(1995)
J. Biol. Chem.
270,
15628-15633[Abstract/Free Full Text]
-
Lints, T. J.,
Parsons, L. M.,
Hartley, L.,
Lyons, I.,
and Harvey, R. P.
(1993)
Development
119,
419-431[Abstract]
-
Durocher, D.,
Charron, F.,
Warren, R.,
Schwartz, R. J.,
and Nemer, M.
(1997)
EMBO J.
16,
5687-5696[CrossRef][Medline]
[Order article via Infotrieve]
-
Sepulveda, J. L.,
Belaguli, N.,
Nigam, V.,
Chen, C. Y.,
Nemer, M.,
and Schwartz, R. J.
(1998)
Mol. Cell. Biol.
18,
3405-3415[Abstract/Free Full Text]
-
Fenton, S. E.,
Groce, N. S.,
and Lee, D. C.
(1996)
J. Biol. Chem.
271,
30870-30878[Abstract/Free Full Text]
-
Mullick, J.,
Addya, S.,
Sucharov, C.,
and Avadhani, N. G.
(1995)
Biochemistry
34,
13729-13742[CrossRef][Medline]
[Order article via Infotrieve]
-
Heikinheimo, M.,
Scandrett, J. M.,
and Wilson, D. B.
(1994)
Dev. Biol.
164,
361-373[CrossRef][Medline]
[Order article via Infotrieve]
-
Grepin, C.,
Robitaille, L.,
Antakly, T.,
and Nemer, M.
(1995)
Mol. Cell. Biol.
15,
4095-4102[Abstract]
-
Lints, T. J.,
Parsons, L. M.,
Hartley, L.,
Lyons, I.,
and Harvey, R. P.
(1993)
Development
119,
969[Medline]
[Order article via Infotrieve]
Copyright © 1999 by The American Society for Biochemistry and Molecular Biology, Inc.

CiteULike Complore Connotea Del.icio.us Digg Reddit Technorati What's this?
This article has been cited by other articles:

|
 |

|
 |
 
C. C. Wendler, M. Busovsky-McNeal, S. Ghatpande, A. Kalinowski, K. S. Russell, and S. A. Rivkees
Embryonic caffeine exposure induces adverse effects in adulthood
FASEB J,
April 1, 2009;
23(4):
1272 - 1278.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. Tsutsui, D. Vergote, N. Shariat, K. Warren, S. S. G. Ferguson, and C. Power
Glucocorticoids regulate innate immunity in a model of multiple sclerosis: reciprocal interactions between the A1 adenosine receptor and {beta}-arrestin-1 in monocytoid cells
FASEB J,
March 1, 2008;
22(3):
786 - 796.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
C. C. Wendler, S. Amatya, C. McClaskey, S. Ghatpande, B. B. Fredholm, and S. A. Rivkees
A1 adenosine receptors play an essential role in protecting the embryo against hypoxia
PNAS,
June 5, 2007;
104(23):
9697 - 9702.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
B. Ritz-Laser, A. Mamin, T. Brun, I. Avril, V. M. Schwitzgebel, and J. Philippe
The Zinc Finger-Containing Transcription Factor Gata-4 Is Expressed in the Developing Endocrine Pancreas and Activates Glucagon Gene Expression
Mol. Endocrinol.,
March 1, 2005;
19(3):
759 - 770.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
V. L.F. Linhares, N. A.S. Almeida, D. C. Menezes, D. A. Elliott, D. Lai, E. C. Beyer, A. C. Campos de Carvalho, and M. W. Costa
Transcriptional regulation of the murine Connexin40 promoter by cardiac factors Nkx2-5, GATA4 and Tbx5
Cardiovasc Res,
December 1, 2004;
64(3):
402 - 411.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. Pikkarainen, H. Tokola, R. Kerkela, and H. Ruskoaho
GATA transcription factors in the developing and adult heart
Cardiovasc Res,
August 1, 2004;
63(2):
196 - 207.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. Dentice, C. Morisco, M. Vitale, G. Rossi, G. Fenzi, and D. Salvatore
The Different Cardiac Expression of the Type 2 Iodothyronine Deiodinase Gene between Human and Rat Is Related to the Differential Response of the dio2 Genes to Nkx-2.5 and GATA-4 Transcription Factors
Mol. Endocrinol.,
August 1, 2003;
17(8):
1508 - 1521.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
H. Akazawa and I. Komuro
Roles of Cardiac Transcription Factors in Cardiac Hypertrophy
Circ. Res.,
May 30, 2003;
92(10):
1079 - 1088.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
Y.-S. Dai, P. Cserjesi, B. E. Markham, and J. D. Molkentin
The Transcription Factors GATA4 and dHAND Physically Interact to Synergistically Activate Cardiac Gene Expression through a p300-dependent Mechanism
J. Biol. Chem.,
June 28, 2002;
277(27):
24390 - 24398.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
B. B. Fredholm, A. P. IJzerman, K. A. Jacobson, K.-N. Klotz, and J. Linden
International Union of Pharmacology. XXV. Nomenclature and Classification of Adenosine Receptors
Pharmacol. Rev.,
December 1, 2001;
53(4):
527 - 552.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. Palmer, N. Groves, A. Schindeler, T. Yeoh, C. Biben, C.-C. Wang, D. B. Sparrow, L. Barnett, N. A. Jenkins, N. G. Copeland, et al.
The Small Muscle-specific Protein Csl Modifies Cell Shape and Promotes Myocyte Fusion in an Insulin-like Growth Factor 1-dependent Manner
J. Cell Biol.,
May 21, 2001;
153(5):
985 - 998.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
W. Zhu, I. Shiojima, Y. Hiroi, Y. Zou, H. Akazawa, M. Mizukami, H. Toko, Y. Yazaki, R. Nagai, and I. Komuro
Functional Analyses of Three Csx/Nkx-2.5 Mutations That Cause Human Congenital Heart Disease
J. Biol. Chem.,
November 3, 2000;
275(45):
35291 - 35296.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. D. Molkentin
The Zinc Finger-containing Transcription Factors GATA-4, -5, and -6. UBIQUITOUSLY EXPRESSED REGULATORS OF TISSUE-SPECIFIC GENE EXPRESSION
J. Biol. Chem.,
December 8, 2000;
275(50):
38949 - 38952.
[Full Text]
[PDF]
|
 |
|
Copyright © 1999 by the American Society for Biochemistry and Molecular Biology.
|
Advertisement
Advertisement
|