Advertisement
JBC

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Rivkees, S. A.
Right arrow Articles by Zhao, Z.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Rivkees, S. A.
Right arrow Articles by Zhao, Z.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

J Biol Chem, Vol. 274, Issue 20, 14204-14209, May 14, 1999


Characterization of the Murine A1 Adenosine Receptor Promoter, Potent Regulation by GATA-4 and Nkx2.5*

Scott A. RivkeesDagger , Marisa Chen, Jayant Kulkarni, Jeffrey Browne, and Zhiyong Zhao

From the Yale University School of Medicine, Division of Pediatric Endocrinology, New Haven, Connecticut 06520

    ABSTRACT
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

Adenosine acts via A1 adenosine receptors (A1ARs) in the heart and brain to potently influence mammalian physiology. A1ARs are expressed very early in embryonic development, and A1ARs are among the earliest expressed G protein coupled receptors in the heart and brain. To understand the biologic basis of A1AR expression, a genomic fragment containing the murine A1AR promoter was cloned. Reporter assay studies using DDT1 MF2 cells that express A1ARs revealed that 500 base pairs of the proximal A1AR promoter contained essential elements for A1AR gene expression. Transgenic mice with A1AR proximal promoter coupled with the beta -galactosidase reporter gene had heavy labeling of the brain and atria, consistent with normal patterns of A1AR expression. Within the proximal A1AR promoter, putative binding sites for cardiac transcription factors GATA and Nkx2.5 were identified. Co-expression studies revealed that GATA-4 and Nkx2.5 could individually drive A1AR promoter activity and act synergistically to activate A1AR expression. These observations suggest that embryonic A1AR expression involves activation of the A1AR promoter by GATA-4 and Nkx2.5.

    INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

The purine nucleoside adenosine exerts potent biological effects through specific G protein coupled receptors (GPCRs)1 that include A1, A2a, A2b, and A3 adenosine receptors (1). Each adenosine receptor subtype has distinct ligand binding properties and different patterns of tissue expression (1). A1 adenosine receptors (A1ARs) are widely distributed in the central nervous system and act to influence neuronal function, neurotransmitter release, and protect against seizure activity and cerebral ischemia (2, 3). A1ARs are also expressed in the heart, where their activation protects the myocardium against ischemia and can terminate supraventricular arrhythmias (4, 5).

Recent evidence shows that A1AR expression begins at very early stages of development (6). In the central nervous system, A1ARs are expressed in neurons during periods of active neurogenesis and neuronal migration (6). Brain regions with high levels of A1AR expression at early stages include the hippocampus, cerebellum, and hindbrain (6). A1ARs are expressed at even earlier stages in the myocardium when the heart is a primitive cardiac cylinder that has not begun beating, making A1ARs the earliest known expressed GPCR in the heart (6, 7).

Presently, our understanding of the factors that regulate A1AR gene expression is at early stages. The human A1AR gene promoter has been isolated and examined (8-10). The 5'-untranslated region of the human A1AR gene contains two promoter elements, designated "A" and "B," that are separated by an intron (9). The A and B promoters are believed to have nonclassical TATA boxes (A, TTAAGAC; B, TTTAAA), and the B promoter is more active than the A promoter (9). It has been suggested that nuclear proteins bind to AGG motifs in the promoter A region, although the identity of these proteins is unknown (10).

Recognizing the unique temporal and spatial patterns of A1AR expression, there is considerable interest in identifying the factors that influence A1AR gene expression. To provide additional insights into the factors that regulate A1AR expression, we have isolated and characterized the murine A1AR promoter (mA1ARp). We now show that 500 bp of the proximal mA1ARp contains motifs responsible for A1AR expression in the brain and heart and that the transcriptional activating factors GATA-4 and Nkx2.5 potently induce mA1ARp activation.

    MATERIALS AND METHODS
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

Library Screening

A murine genomic 129/SVJ library (CLONTECH, Palo Alto, CA) was screened with a 32P-labeled probe generated from a 400-bp fragment from the 5'-end of the rat A1AR cDNA (11). A positive clone of 4.5 kilobases was isolated and purified using the polyethylene glycol (Mr 8000) precipitation method. The phage insert was subcloned into a KpnI site in Bluescript-SKII+ (Stratagene; La Jolla, CA), mapped by restriction digestion, and sequenced in both directions.

Production and Identification of Transgenic Mice

The -502 to +35 mA1ARp fragment was subcloned into the pNLAC vector (12). The construct was then digested with KpnI and PstI, and the mA1AR-pNLAC DNA was gel purified (Qiagen; Santa Clarita, CA). The purified fragment was microinjected into the pronuclei of fertilized eggs (C57/BL6) at the Yale Transgenic Center. Injected eggs were implanted into pseudopregnant recipient mice. Offspring were screened for the presence of the transgenes by PCR amplification of DNA from tail biopsies using oligonucleotide primer pairs CCGTGCATCTGCCAGTTGAG (mA1ARp) and TGGGGCAGTCGATCGGTAAGGATTC (nLAcZ). PCR conditions consisted of 30 cycles of 94 °C for 1 min, 55 °C for 45 s, and 72 °C for 2 min. PCR products were then separated on a 1.2% agarose gel.

Whole Mount, beta -Galactosidase Staining

beta -Galactose staining was examined in whole-mount embryo specimens from timed pairings of male founders with wild-type female mice as described (12, 13). Embryos were dissected from the uteri and placed in individual wells in 12-well plates that contained ice-cold phosphate-buffered saline (PBS). Corresponding amniotic membranes were saved for PCR genotyping. Embryos were fixed in 0.25% glutaraldehyde for 30 min on ice. Specimens were next washed three times for 30 min in PBS. Specimens were then incubated in PBS staining solution containing 2 mM MgS04, 5 mM K3Fe(CN)6, 5 mM K4Fe(CN)6, 0.02% Nonidet P-40, 0.01% sodium deoxycholate, and 1.0 mg/ml X-gal. Specimens were then incubated overnight at 37 °C. The next day, specimens were washed in PBS and stored at 4 °C until microscopic examination. After staining, some specimens were frozen in chilled (-20 °C) 2-methylbutane, stored at -80°, and sectioned in a cryostat (10 µm), and tissue sections were examined.

Determination of Transcription Start Sites

5'-RACE-- cDNA libraries were constructed from DDT1 MF-2 cell mRNA using the 5'-RACE system (Life Technologies, Inc., Gaithersburg, MD) (14). Single-stranded cDNAs were synthesized using the antisense gene-specific primer 1 (GSP1; ATAAGGATGGCCAGTGGGATGAC) located 190 bp 5' of the initiator methionine ATG codon. The cDNAs were tailed at the 3'-end with poly(A)+ using terminal transferase and then amplified by the PCR reaction using the specific anchor oligonucleotides and the GSP2 antisense primer (GACCAAGGCAATGAGCACCTCGA), which is 40 bp 5' of the initiator methionine codon. The amplified products were then subcloned into the pCR2.1 vector using the Invitrogen TA Cloning System (Carlsbad, CA) and sequenced.

RNase Mapping-- Ribonuclease mapping was performed with an RPA II kit from Ambion (Houston, TX) (15). A 210-bp fragment of mA1AR genomic DNA that was 720-510 bp upstream of the initiator methionine was isolated by PCR (forward primer CCATCCAGTCACTAGTACGAAACAGGG; reverse primer, CTATATAAGCTTATCCTGCCTGCCAACCGGTA) was subcloned into Bluescript SKII+ (Stratagene), linearized, and transcribed in vitro with T7 RNA polymerase (Amersham Pharmacia Biotech) to yield a 32P-labeled riboprobe that was gel purified. Twenty-five micrograms of total RNA from DDT1 MF-2 cells were hybridized with the riboprobe at 45 °C for 20 h and digested with 100-fold diluted RNase solution at 37 °C for 30 min. The protected products were analyzed by 8 M urea, 7% polyacrylamide gel electrophoresis with 32P-labeled and HaeIII-digested X174 RFI DNA to determine the sizes of the products.

mA1AR Promoter-Luciferase Constructs

All constructs were prepared by ligation of PCR-generated DNA fragments into the pGL3-Basic expression vector (Promega, Madison, WI). PCR products were generated using the full-length mA1ARp construct as a template. PCR conditions consisted of 25 cycles of 94 °C for 1 min, 55 °C for 45 s, and 72 °C for 2 min using Roche Molecular Biochemicals Taq polymerase (Indianapolis, IN). PCR products were then separated on a 1.2% agarose gel and gel-eluted (Quiex II kit; Qiagen) before digestion with restriction endonucleases and ligation into pGL3. For isolation of the -502 to + 35 construct, the forward primer was AACTGGCTAGCCCTGGGTTC, and the reverse primer was TCCCAGCCCGGCCTTTC.

Specific mutations were made by the PCR overlap-extension method of Ho et al. (16). To generate the front part of mutant promoters, oligonucleotide primer pairs (primers A and B) were designed to generate a 5'-fragment of the mA1ARp. Another set of oligonucleotide primer pairs (primers C and D) were designed to generate a 3'-fragment of the mA1ARp receptor. B and C primers contained sequences that encoded for the desired mutations. PCR reactions were performed to generate A-B and C-D fragments, which were gel-eluted. Receptor fragments (A-B and C-D) were then combined in a third PCR reaction to generate a full-length A1AR using flanking primers (A and D). Flanking PCR primers contained restriction endonuclease sites for subcloning into PGL3. Mutant constructs were then sequenced.

Cell Culture and Transient Transfection

DDT1 MF-2, MDCK, HELA, and HepG2 cells were obtained from American Type Culture Collection (Rockville, MD). Cells were grown in minimal essential medium containing 10% fetal bovine serum. All media were supplemented to final concentrations of 50 IU/ml penicillin and 50 µg/ml streptomycin. The cells were maintained in a humidified 5% CO2, 95% air incubator at 37 °C.

On the day before transfection, cells were passaged into 12-well plates (22-mm per dish) so they would be about 70% confluent the next morning. Transient cell transfection was performed using LipofectAMINE (Life Technologies, Inc.); 1 µg of each test plasmid and 0.2 µg of the control plasmid pRL-CMV carrying the Renilla luciferase gene downstream of the CMV promoter were added to the medium. The next day, cells were washed twice with PBS, collected in a microcentrifuge, and incubated in 300 µl of cell lysis solution (Promega). The supernatant obtained by centrifugation for 5 min was used to measure firefly and Renilla luciferase activities. Luciferase activity was measured on 15 µl of cell extract using a TD-20/20 luminometer (Turner Designs, Sunnyvale CA) using a dual luciferase reporter assay system (Promega). Firefly luciferace activity was expressed relative to Renilla luciferase activity for all test constructs. Each sample was tested in quadruplicate. Each study was repeated at least four separate times.

Radioreceptor Assays

Radioligand binding studies were performed using intact cells as described (6, 11), using [3H]DPCPX (NEN Life Science Products; specific activity, 100 Ci/mmol). All determinations were done in quadruplicate.

Preparation of Nuclear Extracts

Nuclear extracts were prepared as described (17). Cultured cells were suspended in 400 µl of buffer A (10 mm HEPES (pH 7.9), 10 mM KCl, 0.1 mM EDTA, 0.1 mM EGTA, 1 mM dithiothreitol, and 0.5 mm phenylmethylsulfonyl fluoride). The homogenates were chilled on ice for 15 min, and then 25 µl of 10% Nonidet P-40 were added. After vigorous vortexing for 10 s, the nuclear fraction was precipitated by centrifugation at 15,000 × g for 5 min and suspended in 100 µl of buffer B (20 mm HEPES (pH 7.9), 0.4 M NaCl, 1 mM EDTA, 1 mM EGTA, 1 mm dithiothreitol, and 1 mm phenylmethylsulfonyl fluoride). The mixture was left on ice for 15 min with frequent agitation. Nuclear extracts were prepared by centrifugation at 15,000 × g for 5 min and stored at -80 °C. The protein concentration was determined using bicinchoninic acid (Pierce).

Electrophoretic Mobility Shift Assay

Electrophoretic mobility shift assays (EMSAs) were performed as described (18, 19). DNA-protein reactions were performed for 30 min at 30 °C in a mixture (20 µl) containing 20 mm HEPES (pH 7.9), 0.3 mM EDTA, 0.2 mM EGTA, 80 mm NaCl, 1 mm dithiothreitol, 2 µg of poly(deoxyinosine-deoxycytidine) (dI-dC), 0.1-0.4 ng 32P-labeled oligonucleotide probe, and nuclear miniextracts (2-8 µg of protein). Where indicated, the reaction was performed in the presence of unlabeled oligonucleotide competitors.

DNA-protein complexes were electrophoresed on 4% PAGE containing 6.7 mM Tris-HCl (pH 7.5), 3.3 mM sodium acetate, 2.5% glycerol, and 0.1 mM EDTA. After electrophoresis, the gel was dried and exposed to x-ray film.

Supershift assays using antibody to GATA 4 (sc-1237x; Santa Cruz Bitotechnology; Santa Cruz, CA) were preformed by incubating 0.5-2.0 µg of the antibody with 100 µg of the nuclear extract for 1 h at 4 °C. Nuclear extracts where incubated with 32P-labeled oligonucleotide probes as described above.

Sequences of oligonucleotides used in these studies were: GATA, TCTGGGGATACTTGGCTAGAC; mutated GATA, TCTGGGGTTACTTGGCTAGAC; "A" region, CTTCTGTCACGAATGGGGCACC; mutated "A" region, CTTCTGTTAAGAATGGGGCACC.

Statistical Analysis

ANOVA was used to test for differences among groups in luciferase reporter studies.

    RESULTS
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

Isolation of a Murine A1AR Promoter-- To isolate the mA1ARp, a 129SVJ murine genomic library (CLONTECH) was screened using a probe generated from the 5'-coding region of the rat A1AR. Library screening resulted in the isolation of a 4.5-kilobase genomic fragment that was sequenced in full. The 3'-region of the genomic fragment contained 700 bp that was identical to the reported sequence of the murine A1AR (250 bp noncoding and 300 bp coding) (20). At 742 and 685 bp upstream of the initiator methionine site, sequences that were identical to the human A1AR promoter "A" (TTAAGA) and "B" (TTTAAA) motifs were identified (Fig. 1).


View larger version (73K):
[in this window]
[in a new window]
 
Fig. 1.   Sequence of the proximal murine A1AR promoter. GATA and "A" (Nkx2.5 motif) and "B" (TATA box) site motifs are underlined. TSS, transcriptional start site identified by RNase mapping is bold and underlined. The initiator methionine sequence (ATG) is shown in bold. The nucleotide numbers relative to the transcriptional start site are shown in the left column.

Identification of a Transcription Start Site-- We next determined the transcription start site of the mA1ARp using complementary methods of 5'-RACE and RNase mapping. mRNA from DDT1 MF-2 cells, which is a Syrian hamster myocyte cell line that expresses A1ARs at high levels (21), was used in these studies. In our hands, the concentration of A1ARs in DDT1 MF2 cells is 253 ± 12 fmol/mg whole cell protein. Using 5'-RACE and RNase mapping, we identified a similar transcription start site 560 bp upstream of the initiation codon. Only one transcription start site was identified with each method.

Studies of A1ARp Truncation Mutants-- To identify regions of the mA1ARp involved in control of A1AR gene expression, the expression of a series of mA1ARp-luciferase constructs was examined. The mA1ARp fragments were subcloned into the pGL3 reporter vector (Promega; Madison WI); different cell types were transfected with LipofectAMINE (Life Technologies, Inc.). To control for transfection efficiency, cells were co-transfected with a Renilla control reporter vector (pRL-CMV; Promega).

To examine the specificity of the observed responses, studies were performed in HeLa and HEPG2 cells that do not express A1ARs and in DDT1 MF2 and MDCK cells that do express A1ARs (DDT1 MF-2, 236 ± 19 fmol/mg protein; MDCK, 45 ± 9 fmol/mg protein). Although we saw reporter expression in all cell types in which luciferase activity was driven by a control CMV-luciferase promoter (CMV-PGL3; Promega), no reporter expression was seen for any of the mA1ARp fragments tested in HEPG2 or HeLa cells (n = 4 separate studies using reporter constructs shown in Fig. 2). In contrast, we saw specific reporter activity after we transfected the DDT1 MF-2 and MDCK cells with mA1ARp gene fragments (Fig. 2).


View larger version (11K):
[in this window]
[in a new window]
 
Fig. 2.   The proximal region of the A1AR promoter most potently drives A1AR gene expression. DDT1 MF-2 cells were transiently transfected with progressively shorter murine A1AR promoter truncation constructs. The increase in luciferase activity (-fold induction) relative to the reporter vector alone is shown. Data are corrected for transfection efficiency that was assessed by co-transfecting cells with a Renilla luciferace vector (pRL-CMV). Bars are averages of quadruplicate determinations and are representative of five such studies. Sizes of constructs in kilobases are depicted to left of open bars. +1 represents the transcription start site. Ctrl, control. *, p < 0.05; **, p < 0.01 ANOVA. Standard errors were less than 5% of mean values.

Next, the expression of a broad series of mA1ARp truncation constructs was examined in DDT1 MF-2 cells. With progressive deletion of the 5' region of the A1ARp, reporter activity increased (Fig. 2). Additional truncation studies showed that, when base pairs from -500 to -250 were deleted, reporter expression declined (Fig. 3).


View larger version (15K):
[in this window]
[in a new window]
 
Fig. 3.   Definition of the regions within the proximal A1AR promoter (-502 to +35) that drive A1AR gene expression. DDT1 MF-2 cells were transiently transfected with the A1AR promoter truncation constructs shown. Bars are averages of quadruplicate determinations and are representative of four such studies. The relative location of GATA and "A" and "B" motifs are shown. +1, represents transcriptional start site. CTRL, control. *, p < 0.05; **, p < 0.01 ANOVA. Standard errors were less than 5% of mean values.

Generation of A1ARp-nlacZ Transgenic Mice-- Because in vitro truncation reporter studies indicated that the proximal 500 bp of the mA1AR promoter resulted in high levels of reporter expression in cells that contain A1ARs, we next tested if this region played a role in A1AR expression in vivo. The proximal mA1ARp (-502 to +35) fragment was thus linked with a previously characterized beta -galactosidase reporter construct for generation of transgenic mice (12, 13). The construct was injected into 100 murine oocytes that were then implanted into the uteri of pseudo-pregnant female mice. Forty mice were subsequently born, four males of which were positive for the mA1ARp-nlacZ transgene and were studied.

To analyze patterns of reporter gene expression during early development, founder males were mated with wild-type females. beta -Galactosidase activity was examined in embryos, which were genotyped by PCR. In the embryos that were positive for the transgene (from two lines 5163 and 5174), a blue reaction product was present over the brain, spinal cord, and atria between PC 8.5-13 (Fig. 4). In contrast, no color reaction was seen in littermates that did not express the transgene (Fig. 4). This pattern of expression is identical to that seen by in situ hybridization or receptor-labeling autoradiography (6).


View larger version (92K):
[in this window]
[in a new window]
 
Fig. 4.   Brightfield image of a post-conceptual day 12.5 embryo showing expression of beta -galactosidase in the brain, spinal cord, and atria of a transgenic mouse in which beta -galactosidase expression is driven by the -502- to +35-bp proximal A1AR promoter (right panel). Please note the presence of heavy labeling (dark areas) of the brain, spinal cord, and atria. In comparison, there is no labeling of a littermate that does not express the transgene (left panel). CTX, cerebral cortex; PF, pontine flexure; SC, spinal cord; A, atria.

Mutagenesis Studies of Putative GATA, Nkx2.5 Binding Sites, and TTTAAA Box Motif-- Next, we attempted to identify motifs within the proximal mA1ARp (-502 to +35) where transcription factors may bind. When we examined sequences within this region, we identified putative GATA, Nkx2.5 binding sites, and a potential TATA box. At position -434, a GGATAC motif was identified. This motif differs from the classical GATA binding motif of (A/T)GATA(A/G), but is shown to bind GATA proteins (22, 23). At position -243, the sequence TTAAGAA was identified, which is similar to the Nkx2.5 binding motif TNAAGTA (24, 25). This motif is similar to the "A" promoter of the human A1ARp. At -85, the motif TTTAAA was identified that corresponds with the "B" promoter of the human A1ARp.

To test the roles of these motifs on promoter activity, each was mutated and reporter assays were performed. Following conversion of the GATA motif to GTTA, reporter activity was markedly reduced (Fig. 5). Following conversion of the TTAAGAA motif to TTATGAA, reporter activity was reduced by 50% (Fig. 5). Following conversion of TTTAAA to TCTACA, reporter activity was reduced by 70% (Fig. 5).


View larger version (17K):
[in this window]
[in a new window]
 
Fig. 5.   Mutation of the GATA and "A" and "B" motifs reduces A1AR promoter activity. DDT1 MF-2 cells were transiently transfected with the -502- to +35-bp A1AR-luciferase promoter construct containing point mutations in either the GATA or "A" or "B" motifs. Bars are averages of quadruplicate determinations and are representative of four such studies. *, p < 0.05; **, p < 0.01 ANOVA. Standard errors were less than 5% of mean values.

Influence of GATA-4 and Nkx2.5 on A1ARp Expression-- Because GATA-4 and Nkx2.5 are important for heart development (26), and the mA1ARp contains putative GATA and Nkx2.5 binding sites, we next tested if GATA-4 and Nkx2.5 influence mA1ARp expression. A1ARp activity was thus examined after co-transfection with constructs driving the expression of GATA-4 or Nkx2.5 (provided by Dr. Robert Schwartz). These studies were performed in DDT1 MF-2 and HeLa cells.

In each cell line, co-expression of GATA-4 with -502 to +35 mA1ARp reporter constructs resulted in 20-40-fold increases in receptor expression for the constructs containing the GATA binding motif (Fig. 6). However, when the GATA motif was mutated to GTTA, there was no increased reporter activity (Fig. 6).


View larger version (20K):
[in this window]
[in a new window]
 
Fig. 6.   GATA-4 and Nkx2.5 regulate A1AR promoter activity. HeLa cells were transfected with wild-type or mutated -502- to +35-bp A1AR-luciferase promoter constructs (0.5 µg/22-mm dish), and with GATA-4, Nkx2.5, or control (CON) expression vectors (0.5 µg/dish). Bars are averages of quadruplicate determinations and are representative of four such studies. *, p < 0.05; **, p < 0.01 ANOVA. Standard errors were less than 5% of mean values.

Following co-expression of Nkx2.5 with the mA1ARp reporter construct, mA1ARp reporter activity increased 15-fold (Fig. 6). However, when the Nkx2.5 motif was mutated to TCTACA, increased reporter activity was not seen (Fig. 6).

We also tested if Nkx2.5 and GATA-4 acted synergistically to drive A1AR expression, similar to that observed for the atrial natriuretic factor promoter (27, 28). Co-transfection studies were therefore performed by transfecting cells with amounts of Nkx2.5 and GATA-4 expression constructs that individually did not induce reporter expression (Fig. 7). The studies showed that Nkx2.5 and GATA-4 acted synergistically to induce mA1ARp expression (Fig. 7).


View larger version (13K):
[in this window]
[in a new window]
 
Fig. 7.   Synergistic effects of GATA-4 and or Nkx2.5 on A1AR promoter expression. HeLa cells were transfected with the wild-type A1AR promoter construct (0.2 µg/22-mm dish), and with GATA-4, Nkx2.5, or control (CON) expression vectors (0.05 µg/dish). Bars are averages of quadruplicate determinations and are representative of four such studies. *, p < 0.05; **, p < 0.01 ANOVA. Standard errors were less than 5% of mean values.

EMSA of Nuclear Extracts Interacting with GATA and Nkx2.5 Sites-- EMSA assays were next performed to test if the putative GATA and Nkx2.5 binding motifs interact with nuclear proteins. When a radiolabeled 20-bp oligonucleotide containing the GATA binding motif was incubated with DDT-MF2 cell nuclear extracts, one prominent band was seen (Fig. 8). When studies were performed with increasing concentrations of unlabeled oligonucleotides, the amount of radioactivity of the band decreased (Fig. 8). When the GATA site was mutated to GTTA, the amount of labeling of the band was markedly reduced (Fig. 8). When antibody against GATA-4 was added to the nuclear extracts, the size of the band representing the protein-DNA complex was shifted to a higher molecular weight (Fig. 8).


View larger version (45K):
[in this window]
[in a new window]
 
Fig. 8.   Gel shift assays showing interaction between GATA-4 and the mA1ARp. Assays were performed with a 32P-labeled oligonucleotide (40 fmol, 3 × 104 cpm/reaction). Lane 1, DNA, no nuclear extract; lanes 2-4, DNA plus 2 µg of nuclear extract without competitor (lane 2), with GATA-4 binding site competitor (lane 3), and with mutated GATA-4 binding site competitor (M). For supershift studies, 2 µg of nuclear extract was preincubated with GATA-4 antisera for 30 min. F, free DNA; B, DNA bound by nuclear extract; S, DNA bound by nuclear extract incubated with GATA-4 antisera.

When a radiolabeled 20-bp oligonucleotide containing the Nkx2.5 binding motif was incubated with DDT1 MF-2 cell nuclear extracts, one prominent band was seen (Fig. 9). When studies were performed with increasing concentrations of unlabeled oligonucleotides, the amount of radioactivity of the band decreased (Fig. 9). When the Nkx2.5 site in the competitor oligonucleotide was mutated to TCTACA, the amount of labeling was not reduced (Fig. 9). Because Nkx2.5 antibody was not available to us, we did not perform Nkx2.5 supershift studies.


View larger version (46K):
[in this window]
[in a new window]
 
Fig. 9.   Gel shift and assays showing interaction between Nkx2.5 and the mA1ARp. Assays were performed with a 32P-labeled oligonucleotide (40 fmol, 3 × 104 cpm/reaction). Lanes 1-4 and 7, DNA plus 2.5 µg of nuclear extract without competitor (lane 1), with mutated Nkx2.5 oligonucleotide competitor (lane 2), and with different concentrations of NKX competitor (lanes 3 and 4); lane 5, no DNA extract. F, free DNA; B, DNA specifically bound by nuclear extract.


    DISCUSSION
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

To begin to identify the factors that regulate the expression of A1ARs, we isolated the murine A1AR promoter. Showing that the genomic fragment isolated contained a murine A1AR promoter, patterns of beta -galactosidase expression in mA1ARp-nlacZ mice were temporally and spatially similar to patterns of A1AR expression seen in rodents (6). When we compared human and murine A1AR promoter sequences, we detected several similarities among the genes, further supporting the notion that we isolated a murine A1AR promoter.

In the human A1ARp, two promoter motifs designated "A" and "B" have been identified and shown to represent distinct transcriptional start sites (9). In the murine A1AR promoter, we identified identical motifs that were separated by 160 bp, whereas these motifs are separated by 650 bp in the human gene (9). Based on our mA1ARp truncation, mutation, and gel-shift studies, we believe that the "A" motif is a Nkx2.5 binding site. The "B" motif appears to be an unconventional TATA box similar to that reported for other genes (29, 30). Whereas there is evidence for two transcriptional start sites in the human A1ARp, we only observed one transcriptional start site for the murine A1AR promoter.

To characterize the mA1ARp, reporter assays were performed using Syrian hamster smooth muscle DDT1 MF-2 cells since they express A1ARs at high levels (21). We had hoped to examine murine A1AR promoter expression in murine cell lines that express endogenous A1ARs. However, we are unaware of murine cell lines expressing A1ARs at levels detectable by radioligand binding studies. Fortunately, although DDT1 MF-2 cell lines are not of murine origin, mA1ARp expression was readily apparent in these cells.

Studies of murine A1AR promoter truncation mutants showed that the reporter constructs spanning the region from -502 to +35 had the highest levels of activity. In contrast, when the distal regions of the mA1ARp were present in reporter constructs, receptor expression was greatly reduced, raising the possibility that this region contains binding domains for repression elements. Sequence analysis of the -502 to +35 fragment suggested the presence of GATA and Nkx2.5 binding sites; no other GATA or Nkx binding motifs were found within this region. Mutation of the GATA or Nkx2.5 motifs resulted in reduction in promoter expression, suggesting that these sites play important roles in endogenous A1AR gene expression. When co-transfection studies were performed using GATA-4 and Nkx2.5 expression vectors, increased promoter activity was observed, supporting the notion that GATA-4 and Nkx2.5 can activate A1AR gene expression.

When cells were transfected with both GATA-4 and Nkx2.5, synergistic effects on mA1ARp activity were observed. In mice, GATA-4 and Nkx2.5 are expressed in the heart as early as postconceptual day 6.5 and play a role in driving cardiac gene expression (31-33). Recently, Nkx2.5 and GATA-4 have been shown to directly interact to drive the expression of the atrial natriuretic factor (ANF) promoter (27, 28), as we observed for the murine A1AR promoter.

Both ANF and A1ARs are expressed in the heart at early developmental stages (27, 28), although cardiac A1AR expression occurs at even earlier ages than ANF cardiac expression (6). It is thus tempting to speculate that GATA-4 and Nkx2.5 play a role in the early cardiac expression of A1ARs and ANF. Interestingly, Nkx2.5 is also expressed in the tongue during early gestation (33); we also observed A1AR gene expression in the tongue at the same developmental stages (6).

Whereas GATA-4 and Nkx2.5 may play a role in cardiac A1AR expression, these factors are not expressed in the central nervous system (31-33). Thus, other transcriptional activating factors will play a role in A1AR expression in the brain. Currently, the identity of these factors is unknown.

Overall, we now show that the proximal promoter of the murine A1AR contains critical elements for A1AR gene expression in the brain and heart. Murine A1AR promoter activity also appears to be potently regulated by the transcriptional activating factors GATA-4 and Nkx2.5, which interact at a specific site in the proximal A1AR promoter. Future studies are indicated to identify additional promoter regions and transcriptional regulators that influence A1AR expression in other important sites of adenosine action.

    ACKNOWLEDGEMENTS

Dr. Jean Lachowicz is thanked for assistance in some of these studies. Dr. Robert J. Schwartz is thanked for providing GATA-4 and Nkx2.5 expression constructs. Dr. Patrick Gallagher is thanked for technical suggestions.

    FOOTNOTES

* These studies were supported by National Institutes of Health Grants R01-NS33539 and R01HL58442 (to S. A. R.).The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

The nucleotide sequence(s) reported in this paper has been submitted to the GenBankTM/EMBL Data Bank with accession number(s) AF133099.

Dagger To whom correspondence should be addressed: Yale Pediatrics, P. O. Box 208081, New Haven, CT 06520. Tel.: 203-737-5975; Fax: 203-737-5972; E-mail: Scott.Rivkees{at}Yale.edu.

    ABBREVIATIONS

The abbreviations used are: GPCR, G protein coupled receptor; A1AR, A1 adenosine receptor; mA1ARp, murine A1AR promoter; bp, base pair(s); PCR, polymerase chain reaction; PBS, phosphate-buffered saline; EMSA, Electrophoretic mobility shift assay; ANOVA, analysis of variance; RACE, rapid amplification of cDNA ends; ANF, atrial natriuretic factor; X-gal, 5-bromo-4-chloro-3-indolyl beta -D-galactopyranoside.

    REFERENCES
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES
  1. Olah, M. E., and Stiles, G. L. (1995) Annu. Rev. Pharmacol. Toxicol. 35, 581-606[CrossRef][Medline] [Order article via Infotrieve]
  2. Brundege, J. M., and Dunwiddie, T. V. (1997) Adv. Pharmacol. 39, 353-391
  3. Higgins, M. J., Hosseinzadeh, H., MacGregor, D. G., Ogilvy, H., and Stone, T. W. (1994) Pharm. World Sci. 16, 62-68[CrossRef][Medline] [Order article via Infotrieve]
  4. Shryock, J. C., and Belardinelli, L. (1997) Am. J. Cardiol. 79, 2-10
  5. Linden, J. (1991) FASEB J. 5, 2668-2676[Abstract]
  6. Rivkees, S. A. (1995) Brain Res. Dev. Brain Res. 89, 202-213[Medline] [Order article via Infotrieve]
  7. Hofman, P. L., Hiatt, K., Yoder, M. C., and Rivkees, S. A. (1997) Am. J. Physiol. 273, R1374-R1380[Abstract/Free Full Text]
  8. Ren, H., and Stiles, G. L. (1994) Proc. Natl. Acad. Sci. U. S. A. 91, 4864-4866[Abstract/Free Full Text]
  9. Ren, H., and Stiles, G. L. (1995) Mol. Pharmacol. 48, 975-980[Abstract]
  10. Ren, H., and Stiles, G. L. (1998) Mol. Pharmacol. 53, 43-51[Abstract/Free Full Text]
  11. Reppert, S. M., Weaver, D. R., Stehle, J. H., and Rivkees, S. A. (1991) Mol. Endocrinol. 5, 1037-1048[Abstract/Free Full Text]
  12. Hoyle, G. W., Mercer, E. H., Palmiter, R. D., and Brinster, R. L. (1994) J. Neurosci. 14, 2455-2463[Abstract]
  13. Behringer, R. R., Crotty, D. A., Tennyson, V. M., Brinster, R. L., Palmiter, R. D., and Wolgemuth, D. J. (1993) Development 117, 823-833[Abstract]
  14. Kriangkum, J., Vainshtein, I., and Elliott, J. F. (1992) Nucleic Acids Res. 20, 3793-3794[Free Full Text]
  15. Gutkowska, J., Tremblay, J., Antakly, T., Meyer, R., Mukaddam-Daher, S., and Nemer, M. (1993) Endocrinology 132, 693-700[Abstract/Free Full Text]
  16. Ho, S. N., Hunt, H. D., Horton, R. M., Pullen, J. K., and Pease, L. R. (1989) Gene 77, 51-59[CrossRef][Medline] [Order article via Infotrieve]
  17. Engeland, K., Andrews, N. C., and Mathey-Prevot, B. (1995) J. Biol. Chem. 270, 24572-24579[Abstract/Free Full Text]
  18. Cheskis, B., Lemon, B. D., Uskokovic, M., Lomedico, P. T., and Freedman, L. P. (1995) Mol. Endocrinol. 9, 1814-1824[Abstract/Free Full Text]
  19. Scott, V., Clark, A. R., and Docherty, K. (1994) Methods Mol. Biol. 31, 339-347[Medline] [Order article via Infotrieve]
  20. Marquardt, D. L., Walker, L. L., and Heinemann, S. (1994) J. Immunol. 152, 4508-4515[Abstract]
  21. Ramkumar, V., Olah, M. E., Jacobson, K. A., and Stiles, G. L. (1991) Mol. Pharmacol. 40, 639-647[Abstract]
  22. Ko, L. J., and Engel, J. D. (1993) Mol. Cell. Biol. 13, 4011-4022[Abstract/Free Full Text]
  23. Merika, M., and Orkin, S. H. (1993) Mol. Cell. Biol. 13, 3999-4010[Abstract/Free Full Text]
  24. Chen, C. Y., Croissant, J., Majesky, M., Topouzis, S., McQuinn, T., Frankovsky, M. J., and Schwartz, R. J. (1996) Dev. Genet. 19, 119-130[CrossRef][Medline] [Order article via Infotrieve]
  25. Chen, C. Y., and Schwartz, R. J. (1995) J. Biol. Chem. 270, 15628-15633[Abstract/Free Full Text]
  26. Lints, T. J., Parsons, L. M., Hartley, L., Lyons, I., and Harvey, R. P. (1993) Development 119, 419-431[Abstract]
  27. Durocher, D., Charron, F., Warren, R., Schwartz, R. J., and Nemer, M. (1997) EMBO J. 16, 5687-5696[CrossRef][Medline] [Order article via Infotrieve]
  28. Sepulveda, J. L., Belaguli, N., Nigam, V., Chen, C. Y., Nemer, M., and Schwartz, R. J. (1998) Mol. Cell. Biol. 18, 3405-3415[Abstract/Free Full Text]
  29. Fenton, S. E., Groce, N. S., and Lee, D. C. (1996) J. Biol. Chem. 271, 30870-30878[Abstract/Free Full Text]
  30. Mullick, J., Addya, S., Sucharov, C., and Avadhani, N. G. (1995) Biochemistry 34, 13729-13742[CrossRef][Medline] [Order article via Infotrieve]
  31. Heikinheimo, M., Scandrett, J. M., and Wilson, D. B. (1994) Dev. Biol. 164, 361-373[CrossRef][Medline] [Order article via Infotrieve]
  32. Grepin, C., Robitaille, L., Antakly, T., and Nemer, M. (1995) Mol. Cell. Biol. 15, 4095-4102[Abstract]
  33. Lints, T. J., Parsons, L. M., Hartley, L., Lyons, I., and Harvey, R. P. (1993) Development 119, 969[Medline] [Order article via Infotrieve]


Copyright © 1999 by The American Society for Biochemistry and Molecular Biology, Inc.
Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
FASEB J.Home page
C. C. Wendler, M. Busovsky-McNeal, S. Ghatpande, A. Kalinowski, K. S. Russell, and S. A. Rivkees
Embryonic caffeine exposure induces adverse effects in adulthood
FASEB J, April 1, 2009; 23(4): 1272 - 1278.
[Abstract] [Full Text] [PDF]


Home page
FASEB J.Home page
S. Tsutsui, D. Vergote, N. Shariat, K. Warren, S. S. G. Ferguson, and C. Power
Glucocorticoids regulate innate immunity in a model of multiple sclerosis: reciprocal interactions between the A1 adenosine receptor and {beta}-arrestin-1 in monocytoid cells
FASEB J, March 1, 2008; 22(3): 786 - 796.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
C. C. Wendler, S. Amatya, C. McClaskey, S. Ghatpande, B. B. Fredholm, and S. A. Rivkees
A1 adenosine receptors play an essential role in protecting the embryo against hypoxia
PNAS, June 5, 2007; 104(23): 9697 - 9702.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
B. Ritz-Laser, A. Mamin, T. Brun, I. Avril, V. M. Schwitzgebel, and J. Philippe
The Zinc Finger-Containing Transcription Factor Gata-4 Is Expressed in the Developing Endocrine Pancreas and Activates Glucagon Gene Expression
Mol. Endocrinol., March 1, 2005; 19(3): 759 - 770.
[Abstract] [Full Text] [PDF]


Home page
Cardiovasc ResHome page
V. L.F. Linhares, N. A.S. Almeida, D. C. Menezes, D. A. Elliott, D. Lai, E. C. Beyer, A. C. Campos de Carvalho, and M. W. Costa
Transcriptional regulation of the murine Connexin40 promoter by cardiac factors Nkx2-5, GATA4 and Tbx5
Cardiovasc Res, December 1, 2004; 64(3): 402 - 411.
[Abstract] [Full Text] [PDF]


Home page
Cardiovasc ResHome page
S. Pikkarainen, H. Tokola, R. Kerkela, and H. Ruskoaho
GATA transcription factors in the developing and adult heart
Cardiovasc Res, August 1, 2004; 63(2): 196 - 207.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
M. Dentice, C. Morisco, M. Vitale, G. Rossi, G. Fenzi, and D. Salvatore
The Different Cardiac Expression of the Type 2 Iodothyronine Deiodinase Gene between Human and Rat Is Related to the Differential Response of the dio2 Genes to Nkx-2.5 and GATA-4 Transcription Factors
Mol. Endocrinol., August 1, 2003; 17(8): 1508 - 1521.
[Abstract] [Full Text] [PDF]


Home page
Circ. Res.Home page
H. Akazawa and I. Komuro
Roles of Cardiac Transcription Factors in Cardiac Hypertrophy
Circ. Res., May 30, 2003; 92(10): 1079 - 1088.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
Y.-S. Dai, P. Cserjesi, B. E. Markham, and J. D. Molkentin
The Transcription Factors GATA4 and dHAND Physically Interact to Synergistically Activate Cardiac Gene Expression through a p300-dependent Mechanism
J. Biol. Chem., June 28, 2002; 277(27): 24390 - 24398.
[Abstract] [Full Text] [PDF]


Home page
Pharmacol. Rev.Home page
B. B. Fredholm, A. P. IJzerman, K. A. Jacobson, K.-N. Klotz, and J. Linden
International Union of Pharmacology. XXV. Nomenclature and Classification of Adenosine Receptors
Pharmacol. Rev., December 1, 2001; 53(4): 527 - 552.
[Abstract] [Full Text] [PDF]


Home page
JCBHome page
S. Palmer, N. Groves, A. Schindeler, T. Yeoh, C. Biben, C.-C. Wang, D. B. Sparrow, L. Barnett, N. A. Jenkins, N. G. Copeland, et al.
The Small Muscle-specific Protein Csl Modifies Cell Shape and Promotes Myocyte Fusion in an Insulin-like Growth Factor 1-dependent Manner
J. Cell Biol., May 21, 2001; 153(5): 985 - 998.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
W. Zhu, I. Shiojima, Y. Hiroi, Y. Zou, H. Akazawa, M. Mizukami, H. Toko, Y. Yazaki, R. Nagai, and I. Komuro
Functional Analyses of Three Csx/Nkx-2.5 Mutations That Cause Human Congenital Heart Disease
J. Biol. Chem., November 3, 2000; 275(45): 35291 - 35296.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
J. D. Molkentin
The Zinc Finger-containing Transcription Factors GATA-4, -5, and -6. UBIQUITOUSLY EXPRESSED REGULATORS OF TISSUE-SPECIFIC GENE EXPRESSION
J. Biol. Chem., December 8, 2000; 275(50): 38949 - 38952.
[Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Rivkees, S. A.
Right arrow Articles by Zhao, Z.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Rivkees, S. A.
Right arrow Articles by Zhao, Z.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 All ASBMB Journals   Molecular and Cellular Proteomics 
 Journal of Lipid Research   ASBMB Today 
Copyright © 1999 by the American Society for Biochemistry and Molecular Biology.
Advertisement
spacer
Advertisement
Advertisement