|
J Biol Chem, Vol. 274, Issue 20, 14295-14305, May 14, 1999
Translational Control of Specific Genes during
Differentiation of HL-60 Cells*
Anna M.
Krichevsky,
Esther
Metzer, and
Haim
Rosen
From the Department of Molecular Virology, The Faculty of Medicine,
Hebrew University of Jerusalem, P. O. Box 12272, Jerusalem 91120, Israel
 |
ABSTRACT |
Eukaryotic gene expression can be regulated
through selective translation of specific mRNA species.
Nevertheless, the limited number of known examples hampers the
identification of common mechanisms that regulate translation of
specific groups of genes in mammalian cells. We developed a method to
identify translationally regulated genes. This method was used to
examine the regulation of protein synthesis in HL-60 cells undergoing
monocytic differentiation. A partial screening of cellular mRNAs
identified five mRNAs whose translation was specifically inhibited
and five others that were activated as was indicated by their
mobilization onto polysomes. The specifically inhibited mRNAs
encoded ribosomal proteins, identified as members of the 5'-terminal
oligopyrimidine tract mRNA family. Most of the activated
transcripts represented uncharacterized genes. The most actively
mobilized transcript (termed TA-40) was an untranslated 1.3-kilobase
polyadenylated RNA with unusual structural features, including two
Alu-like elements. Following differentiation, a significant change in
the cytoplasmic distribution of Alu-containing mRNAs was observed,
namely, the enhancement of Alu-containing mRNAs in the polysomes.
Our findings support the notion that protein synthesis is regulated
during differentiation of HL-60 cells by both global and gene-specific
mechanisms and that Alu-like sequences within cytoplasmic mRNAs are
involved in such specific regulation.
 |
INTRODUCTION |
Translational control of eukaryotic gene expression can be broadly
classified into two major categories: global control affecting the
overall rate of protein synthesis, and selective control in which the
translation rate of mRNA subsets varies in response to biological
stimuli (1-3). While much data has been accumulated in the last two
decades regarding global control of protein synthesis (for review, see
Refs. 1 and 2), little was published on selective control systems until
recently (4-10).
Regulation of eukaryotic gene expression during developmental
processes, such as germ cell maturation and early embryonic development
in Xenopus, Caenorhabditis elegans, and
Drosophila, was demonstrated to involve selective
translation of certain mRNA species (see Ref. 11). In mammalian
cells, however, the translation of only few mRNAs was shown to be
regulated by gene-specific mechanisms during differentiation. The most
characterized example of this type of regulation is the translation of
15-lipoxygenase mRNA during red blood cell differentiation (8).
Previously, two approaches were used to identify and isolate specific
mRNAs translationally regulated during differentiation. One
approach was based on the pulse-chase labeling of cells with
radioactive amino acids, followed by two-dimensional gel
electrophoresis to identify relative changes in the translation
pattern. Candidate proteins were further characterized using various
biochemical methods, and their corresponding cDNAs were cloned and
used to quantify their respective mRNA levels (12, 13). The second
approach was based on the assumption that translationally inactive
mRNAs are present as free cytoplasmic mRNPs, whereas actively
translated mRNAs are contained within polysomes. To isolate and
identify mRNAs selectively mobilized from
mRNPs1 to polysomes, cDNA
probes were prepared from mRNPs and polysomes and hybridized against
cDNA libraries (14, 15). These studies, although limited to the
relatively abundant mRNAs, led to the identification of a group of
mRNAs encoding ribosomal proteins, elongation factors for protein
synthesis, and proteins of as yet unknown function (14). More recent
studies have established that translational efficiency of these
mRNAs correlates with the rate of cell proliferation (16). The cis
element in this type of translationally controlled mRNAs was found
to be a 5'-terminal oligopyrimidine tract (5'-TOP), and they were
termed 5'-TOP mRNAs (16).
In this study a new protocol based on the separation of polysomes from
mRNPs using sucrose gradient centrifugation followed by differential
display RT-PCR analysis is presented. This methodology identifies new
mRNAs specifically mobilized from cytoplasmic free mRNPs onto
polysomes and vice versa in the promyelocytic leukemia cell line HL-60
during cellular differentiation. Our findings suggest that Alu-like
elements within cytoplasmic mRNAs are involved in gene-specific
translation regulation.
 |
EXPERIMENTAL PROCEDURES |
Materials--
Sera, cell culture medium, and antibiotics were
provided by Biological Industries (Beit-Haemek, Israel); standard
chemicals, phorbol ester
12-O-tetradecanoyl-1-phorbol-13-acetate (TPA), dimethyl sulfoxide were purchased from Sigma. 1,25-Dehydroxyvitamin
D3 was a kind gift from Zvi Bar-Shavit (Faculty of
Medicine, HU, Jerusalem, Israel). Restriction endonucleases and Random
Priming Reagent kit were provided by New England BioLabs (Beverly, MA); AMV-Reverse Transcriptase, Taq DNA-polymerase,
RiboMAXTM Large Scale RNA Production System, wheat germ
extract, and rabbit reticulocyte nuclease-treated lysates were obtained
from Promega (Madison, WI). The rapid amplification of 5' cDNA ends
kit was obtained from Roche Molecular Biochemicals (Mannheim, Germany). Nylon membranes and radiochemicals were purchased from NEN Life Science
Products Inc. (Boston, MA).
Cell Culture--
The human cell lines K562 and HL-60 were
cultured in RPMI 1640 medium supplemented with 10% fetal calf serum,
L-glutamine, penicillin, and streptomycin. Cells were
routinely passaged twice a week to a density of 0.5-1.0 × 106 cells/ml and grown at 37 °C in 5% CO2.
Induction of differentiation (30 ml of 4 × 105
cells/ml for 140-mm plate) was performed by the addition of 50 nM TPA, 100 nM 1,25-dehydroxyvitamin
D3, or 1.25% dimethyl sulfoxide.
RNA Isolation--
Cell harvesting and sucrose gradient
separation between polysomal and subpolysomal fractions were performed
as described previously (17). Briefly, cells were collected by
centrifugation, washed with ice-cold phosphate-buffered saline, lysed
at 4 °C, and the postmitochondrial supernatant was overlaid onto a
15-45% sucrose gradient and spun at 26,000 rpm for 4 h at
4 °C. Fractions of polysomes (up to disomes) and subpolysomes (from
80 S to RNPs) were collected from the bottom of each gradient with
continuous monitoring at 260 nm and precipitated with 0.1 M
NaCl and 2.5 volumes of ethanol, the pellets were dissolved in
guanidine thiocyanate and further purified by centrifugation through
CsCl (18). Purified RNA preparations were quantified by spectrophotometry.
RNA Analysis--
For Northern blot analysis, RNA was denatured
in glyoxal and subjected to electrophoresis on 1.5% agarose gel in 10 mM sodium phosphate buffer. The RNA was transferred to a
nylon-based membrane, hybridized with the indicated
32P-random primed labeled probe, washed, and exposed to
x-ray film as described (19). The DNA probes were specific cDNAs,
prepared by PCR and labeled by random priming.
For RT-PCR analysis first-strand cDNA was synthesized with avian
myeloblastosis virus-RT in the presence of 1 µg of total RNA, 1.5 µM oligo(dT) primer, 0.2 mM of each dNTP, 50 mM Tris, pH 8.3, 40 mM KCl, 6 mM
MgCl2, 10 units of RNase inhibitor, and 10 units of avian
myeloblastosis virus-RT in a final volume of 10 µl. Reaction was
carried out for 45 min at 42 °C followed by heat inactivation for 5 min in 75 °C. For each PCR reaction we used 2 µl of the cDNA
reaction mixture, 0.2 mM of each dNTP, 2 units of
Taq polymerase, 1 times the corresponding reaction buffer provided with the enzyme, and a pair of PCR-specific primers (50 pmol
of each). The amplification was performed for 15-40 cycles (each cycle
consisted of 1 min at 93 °C, 1 min at 58 °C, and 1 min at
72 °C). The PCR products were then separated on 2.5% NuSieve 3:1
agarose gel.
The following gene-specific primers were used (the sequences are
written from 5' to 3'): GGAACATGCTGAGAAACTG and CAGGGTGTGCTTGTCAAAG for
H-ferritin; TCACCAACTGGGACGACATG and GTACAGGGATAGCACAGCCT for b-actin;
ATCCCCAGAAGCAGCATGAC, TGCAGAGTGCCGAGAAATCC and CCCATTTCATGCCGTCCTG for
TA 90 (fibulin 1D); CTCACACACACAACCATCC and GGAGTCTGGCTGTATTGTCC for TA 40; GGGAAAGCTTTCTAGTCTA and GTACTTAGGATAGCAGTAC for TA 10; GCTTGGGCCTTCCTCCATC and CTCTGTACACCCAGGAGTC for TA 12;
CTGTTCCTAATGAGCAGGGC and TCAAAACTCACACGGCAGC for TA 20;
GTTAGACCCCAATGAGACC and CACATTCCCCTTCACCTTC for TR (TR 11);
GTCTCAAGGTGTTTGACGG and AGGAGTCCGTGGGTCTTGA for TR 10;
ATCTCCTTCATCCCTCTCC and GCTTTTAGTGCTGCTTCCTC for TR 13; AGACCCTCACTGGCAAAAC and TGACCTTCTTCTTGGGACG for TR 40;
CCGCAAACTCTGTCTCAAC and GGCCTCCTCTTTGCTGATT for TR 80;
GTAACTCCACCAAGCCCATC and CCCTCTTTTCTTTTCCTCCC for VDR;
TGCAGGTGGCAGAGTGAATG and CAAGAGATTGGGGGGTGAAG for PAI-1; GATTATGTCCGGCCACGTTC and ACCCAGCCCCACAAAAAAAG for acyl-CoA;
TCTCTCCTCCCTTTCTTCCC and TCCTTCCTCTGCTTCTCACC for Il-6R;
CTGCGGAGATCACACTGAC and GCTCTTCCTCCTACACATC for HLA;
GAGTCTGCTGAAGCTATCC and AGTCTACACCACAACCACC for RepA.
For the semiquantitative RT-PCR the number of amplification cycles was
limited in order to maintain the PCR reaction within the linear range.
The optimal number of cycles for each pair of primers was determined by
withdrawn aliquots of the corresponding reactions for agarose gel
analysis after various number of cycles. The number of cycles
sufficient for detecting clearly visible bands was chosen. The relative
intensity of the DNA bands remained the same for at least four
additional cycles.
Differential Display--
Differential display of 0.5 µg of
total RNA from polysomes and from subpolysomes before and after cell
treatment was performed essentially as described by Liang and Pardee
(20, 21). For reverse transcription, 13 units/µl of Super Script II
RT (Life Technologies, Inc., Bethesda, MD) were used. PCR reactions
were performed with combinations of 10 different arbitrary 10-mer
primers (50% GC, sense primers) and 5 different
5'-T12MN-3' primers (antisense primers, where MN were GG,
GC, CG, GA, or AT).
The PCR products were labeled with 50 nM 32P
(3000 Ci/mmol), separated by 6% polyacrylamide gel electrophoresis,
and detected by autoradiography. DNA was eluted from the differentially
amplified bands, reamplified by PCR as described (20), cloned into
pCR-Script Amp SK(+) (Stratagene, La Jolla, CA), and sequenced by an
automated ABI PRISM 377 DNA Sequencer. Sequence analysis was carried
out with GCG supplied programs.
Cloning the Full-length TA-40 cDNA--
The HL-60
unidirectional cDNA library (obtained from Invitrogen, Carlsbad,
CA, number 950-07) was constructed in pcDNA I vector using
NotI dT primer and transfected into the Escherichia
coli MC1061/PC. Screening of the HL-60 cell line cDNA library
was performed by in situ hybridization with a radioactive
labeled probe (22).
In Vitro RNA Transcription and Translation--
The DNA
templates for in vitro transcription and translation were
either the TA-40 pcDNA I plasmid linearized at the XhoI site (S1) or TA-40 derived fragments. These fragments were obtained by
PCR reactions with T7 promoter primer TAATACGACTCACTATAGGG in
combination with each of the following TA-40 specific primers: CTCACACACACAACCATCC (S2), CGGATTTGGGAAACTTTTCTATAAA (S3), and AGCTGTGCTTTACATAGCAATCTT (S4). Transcription reactions with T7 RNA
polymerase were performed using the Ribo MAXTM Large Scale
RNA Production System as recommended by the supplier. The quality of
the synthesized RNA was determined by agarose gel electrophoresis.
Protein synthesis assays were carried in a standard micrococcal
nuclease-treated rabbit reticulocyte lysate reaction mixture according
to the manufacturer's instructions. Reactions containing BMV or
luciferase transcripts as templates were incubated for 40 min at
30 °C in the presence of [35S]methionine. Aliquots
were spotted onto 1-cm square filters and hot trichloroacetic acid
percipitable radioactivity was determined. Where indicated,
polyinosinic-polycytidylic acid (poly[I]·poly[C]) or TA-40
derived transcripts were added to the translation reaction prior to the
addition of BMV or luciferase transcripts. All results are
representative of at least three independent experiments.
 |
RESULTS |
A New Protocol for Identification and Isolation of Translationally
Regulated Genes--
To identify genes whose expression is
translationally regulated, we combined a sucrose gradient separation of
polysomes from mRNPs with DDRT-PCR analysis and cDNA cloning.
Polysomal and subpolysomal RNAs were purified from cells before and
after treatment. These RNA samples were subjected to a DDRT-PCR
analysis and the radioactive labeled cDNA products were separated
by polyacrylamide gel electrophoresis. This protocol is illustrated
schematically in Fig. 1. Distribution of
RNAs between polysomal and subpolysomal fractions is indicated by the
relative intensity of the bands of the same electrophoretic mobility in
adjacent lanes of the autoradiogram. Differences in the distribution of
the intensities of bands found in treated cells relative to nontreated
cells pointed toward candidates for translationally regulated
transcripts (see arrows in Fig. 1). The bands' intensity
was changed linearly in the range of 28-40 PCR cycles and thus, even
small differences in mRNA distribution could be detected (data not
shown).

View larger version (25K):
[in this window]
[in a new window]
|
Fig. 1.
Schematic illustration of differential
display procedure to detect translationally regulated mRNAs.
ps, polysomal; nps, nonpolysomal fractions.
A, candidate bands for mRNA that is mobilized
(translationally activated); B, candidate bands for mRNA
that is released (translationally repressed). At the 3' end of
oligo(dT) primer M represents A, G, or C nucleotides and
N each of the four nucleotides.
|
|
To confirm the validity of this experimental approach, the regulation
of ferritin expression was re-examined. Ferritin biosynthesis is a
classical model for gene-specific translational control (23, 24). This
model of iron-dependent regulation was thoroughly investigated and established in a number of cell lines, including the
K562 human erythroleukemia cells (25) that were used in this study as a
test model.
K562 cells were grown in suspension to a density of 5 × 105 cells/ml and then divided to untreated control culture
and to experimental culture that was exposed to 100 mM
hemin-iron for 4 h. Cytoplasmic RNA was separated by
centrifugation on sucrose gradients and analyzed (Fig.
2A). The RNAs from polysomal
and subpolysomal fractions were extracted separately. 10 µg of RNA
from each fraction were subjected to a Northern blot analysis with
32P-labeled human H-ferritin cDNA probe (Fig.
2B). In the untreated cells most of the H-ferritin mRNA
sedimented with the subpolysomal fraction (Fig. 2B, lanes 1 and 2), whereas, in the hemin-treated cells H-ferritin
mRNA was equally distributed between the polysomal and subpolysomal
fractions (Fig. 2B, lanes 3 and 4). Similar
results were obtained by semiquantitative RT-PCR analysis performed
with specific human H-ferritin primers (Fig. 2B, lower
panel). These results confirmed the iron-dependent
mobilization of H-ferritin mRNA onto polysomes in K562 cells. It is
worthwhile to mention that in these cells ferritin biosynthesis was
reported to be regulated at the mRNA level as well (26). RNAs from
the same samples were subjected to DDRT-PCR analysis (as described
under "Experimental Procedures"); the 10-mer arbitrary
oligonucleotides upstream primers used were: 1) 5'-AAGGTAGTGC-3', 2)
5'-CTTGATTGCC-3', 3) 5'-GCTATCACAG-3'; and the T12MN
anchored primers were: 4) 5'-T12CG-3', 5)
5'-T12AG-3', and 6) 5'-T12AT-3'. The sequences
of primers 1 and 4 were derived from the 3'-untranslated region of the
human H-ferritin mRNA (27). The sequence of primer 1 is located 120 nucleotides upstream to the poly(A) addition site, whereas primer 4 is
the H-ferritin mRNA-specific anchored primer. For a given RNA
preparation, the DDRT-PCR reactions generated highly reproducible
mobility patterns of 30-100 distinct bands, depending on the
combination of primers. The relative intensity patterns of the bands of
the same electrophoretic mobility in adjacent lanes (from control and
treated cells) were reproducible only in 70-80%. Therefore, it was
necessary to run the DDRT-PCR analysis in duplicate. An autoradiogram
of the DDRT-PCR analysis, performed with the combination of primers
numbers 1 and 4 and exposed for 2 h, is shown in Fig.
2C. An additional 25 bands appeared after a 12-h exposure
(data not shown). The arrow on the autoradiogram points at
bands with an estimated size of 130 nucleotides. Isolation and
sequencing of these DNA fragments confirmed that they corresponded to
the H-ferritin cDNA. Comparison between the signals in lanes
1 and 2 (control) and those in lanes 3 and
4 (hemin-treated) indicated that the DDRT-PCR analysis
produced similar results to those obtained by Northern blot and RT-PCR analyses (Fig. 2, B and C). This demonstrated the
feasibility to identify mobilization of specific mRNAs onto
polysomes using the DDRT-PCR analysis.

View larger version (17K):
[in this window]
[in a new window]
|
Fig. 2.
Mobilization of heavy chain ferritin mRNA
onto polysomes. A, comparison between the polysomal
profiles of controls K-562 cells and heme (100 nM)-treated
cells. Cytosolic extracts were fractionated by centrifugation through
15-45% sucrose gradient. Fractions were collected from the bottom of
each gradient with continuous monitoring at 260 nm. B,
Northern blot and RT-PCR analyses of H-ferritin mRNA. Total RNA
from nonpolysomal (lanes 1 and 3) and polysomal
(lanes 2 and 4) fractions of K-562 cells treated
with heme (lanes 3 and 4) or control untreated
cells (lanes 1 and 2) was analyzed. Ribosomal RNA
was used as a control for the amount of loaded RNA. C,
differential display RT-PCR analysis of nonpolysomal (lanes
1 and 3) and polysomal (lanes 2 and
4) fractions of K-562 cells treated with heme (lanes
3 and 4) or control untreated cells (lanes 1 and 2). The open arrow points at the bands
corresponding to H-ferritin cDNA fragment.
|
|
Identification of Translationally Regulated Genes in HL-60 Cells
Undergoing Differentiation--
Promyelocytic leukemia cell line HL-60
is one of the best studied models of cell differentiation (28, 29).
This culture comprises 90-95% of cells with
myeloblastic/promyelocytic morphology. A variety of agents can induce
differentiation of these cells either to granulocyte-like (dimethyl
sulfoxide) or to monocyte/macrophage-like (TPA or 1,25-dihydroxyvitamin
D3) cells (28).
Differentiation of HL-60 cells into monocyte/macrophage-like cells was
induced with 50 nM TPA. After 24 h of induction,
proliferation was arrested, and almost all the cells adhered in
aggregates to the plastic dish; then they spread out and acquired a
spindle-shaped morphology and prominent pseudopodia. This series of
events was confirmed microscopically in all experiments.
To compare the polysomal profiles of HL-60 cells during their
differentiation, cytoplasmic RNA from noninduced control, 12-, 24-, and
48-h treated cells was analyzed following centrifugation on sucrose
gradients (Fig. 3A). The
relative amount of polysomes decreased gradually during the course of
cellular differentiation (Fig. 3A), reflecting the growth
arrest and inhibition of overall protein synthesis associated with
cellular differentiation. To identify transcripts whose translation was
specifically regulated, we isolated RNAs from polysomal and
subpolysomal fractions of control and TPA-treated cells, and examined
them by differential display analysis (Figs. 3B and
5A). Thirty DDRT-PCR reactions, employing various
combinations of primers on each RNA sample, produced a total of about
2500 different bands. Assuming that an average of 15,000 different
species of mRNAs are expressed per cell, our analysis covered about
15% of the cellular RNAs. Most bands in this analysis represented RNA
species with unaltered polysomal/subpolysomal distribution and thus
provided multiple internal controls. Some mRNA species (type A)
were found both in polysomal and subpolysomal fractions, both before
and after treatment (Fig. 3B, m and p, in both
con and 24-h lanes). Other species (type B) were
present in subpolysomes only (about 10%, in m lanes only),
or were found exclusively in polysomes (type C; about 5%, in p
lanes only). Type B represents untranslated RNAs, whereas type C
consists of RNAs that are apparently translated very efficiently, and
therefore likely to be translationally regulated. In this study,
however, only specific mRNAs whose translation was affected by
cellular differentiation were further investigated.

View larger version (28K):
[in this window]
[in a new window]
|
Fig. 3.
Changes in translational activity in HL-60
cells undergoing differentiation. A, changes in
polysomal profiles of HL-60 differentiating cells. Cytosolic extracts
were fractionated by centrifugation through 15-45% sucrose gradient.
Fractions were collected from the bottom of each gradient with
continuous monitoring at 260 nm. PMA,
12-O-tetradecanoyl-1-phorbol-13-acetate. B,
differential display RT-PCR analysis of polysomal (p) and
nonpolysomal (m) fractions of 24-h TPA-treated cells (24 h)
or control untreated cells (con). The 10-mer arbitrary
oligonucleotides upstream primers used in these experiments were:
5'-GCTATCACAG-3' (I and III) and 5'-AGGACAGGTT-3' (II and IV). The
open arrows point at the bands corresponding to specifically
released RNAs. A few newly synthesized/significantly increased RNAs (+)
or decayed RNAs ( ) are also indicated.
|
|
Analysis of RNA from 24-h treated cells revealed few candidates for
specifically repressed RNAs (arrows in Figs. 3B
and 4a). In these cases bands derived from control cells
exhibited usually similar intensities in subpolysomes and polysomes,
whereas in treated cells the intensity of the bands from subpolysomes
was much higher than that of the polysomes (arrows in Figs.
3B and 4A). These DNA bands (designated TR10, 11, 13, 40, and 80) were purified from the gels, amplified, cloned, and
used as probes for RNA blot analysis of 10 µg of total RNA from
different fractions. Autoradiograms of these analyses are presented in
Fig. 4B. It is evident that
most of the corresponding mRNAs in the 24-h treated cells were
found in subpolysomal fractions (Fig. 4B, lanes 3 and 4). Comparison between the signals in lanes 1 and
2 (control) and those in lanes 3 and 4 (treated) indicates that the later mRNAs were no longer associated
with the polysomes upon differentiation (Fig. 4B).
Semiquantitative analysis revealed no significant changes in the total
amount of TR mRNAs during the early stages of HL-60 cellular
differentiation (data not shown). The kinetics of translational repression of these TR genes was studied by semiquantitative specific RT-PCR. An example of such analysis is shown in Fig. 4C. The
release of TR-RNA from the polysomes was detected 12 h after TPA
treatment (compare lanes 1 and 2, control, to
lanes 3 and 4, 12-h treated). Expression of actin
mRNA (AC) was determined by Northern blot (Fig. 4B) and
RT-PCR (Fig. 4C) analysis to test the specificity of the
observed phenomena. It is worthwhile to mention that actin mRNA was
always found predominantly in polysomal fractions. The TR clones (TR
10, 11, 80, 13, and 40) were sequenced. Search for homologous sequences
in the Gene Banks revealed that these clones derived from the 3'
termini of the human mRNAs for ribosomal proteins L13a, L19, L11,
S27 and the mRNA for ubiquitin 52 amino acid fusion protein (the
natural hybrid between ubiquitin monomer and ribosomal protein),
respectively. All five transcripts were relatively short mRNAs
(from ~340 to ~700 nucleotides) with polypyrimidines at their 5'
end, indicating the possibility that they were members of the 5'-TOP
mRNA family. These results are in agreement with the accepted
concept of translational repression of 5'-TOP's mRNAs in
nonproliferating cells (for review, see Ref. 30).

View larger version (36K):
[in this window]
[in a new window]
|
Fig. 4.
Identification of specifically repressed
genes during differentiation of HL-60 cells. A, focus
on selected differential display RT-PCR patterns; analysis of
nonpolysomal (lanes 1 and 3) and polysomal
(lanes 2 and 4) fractions of 24-h TPA-treated
cells (lanes 3 and 4) or control untreated cells
(lanes 1 and 2). The open arrows point
at the bands corresponding to candidates for translationally repressed
RNAs (TRs). B, Northern blot analyses of
nonpolysomal (lanes 1 and 3) and polysomal
(lanes 2 and 4) fractions of 24-h TPA-treated
cells (lanes 3 and 4) or control untreated cells
(lanes 1 and 2) with TR specific probes. cDNA
fragments cloned into pCR-Script Amp SK(+) vector and amplified with
TR-specific primers were used as probes in these analyses.
C, RT-PCR analysis of nonpolysomal (lanes 1, 3, 5, and 7) and polysomal (lanes 2, 4, 6, and
8) fractions of control (lanes 1 and
2) or 12- (lanes 3 and 4), 24- (lanes 5 and 6), and 48- (lanes 7 and
8) h TPA-treated cells with TR-11 (TR) or actin
(AC) derived specific primers (see "Experimental Procedures" for
details).
|
|
Further analysis of the 48-h TPA-treated cells revealed, in addition to
the TR genes, 10 specific bands with relative enhanced intensity in the
polysomal fraction (some of them are labeled by arrows in
Fig. 5A). These bands
represented mRNA candidates for translationally activated genes and
were designated TA genes. They were isolated from the gels, amplified,
cloned, sequenced, and used as probes for RNA blot analysis. We could
not detect the corresponding RNAs in the Northern blot analysis of
HL-60 total RNA (20 µg), probably due to their low abundance in these cells. Therefore, eight pairs of TA-specific primers were used in
semiquantitative RT-PCR analysis (Fig. 5, B and
C). This analysis confirmed that five out of the eight
tested TA transcripts represented mRNAs that were mobilized onto
polysomes upon differentiation (see TA-12, 20, 90, and 40 in Fig. 5,
B and C; TA 10* showed a weaker effect of
mobilization). This polysomal mobilization was detected 12-24 h after
treatment and was not associated with notable changes in the total
amount of these mRNAs (TA-90 mRNA was slightly decreased). As
an example, TA-40 polysomal mobilization is demonstrated in Fig.
5C (compare lanes 1 and 2 with
3 and 4; actin-AC and ferritin-FE mRNAs were
tested as controls). This RT-PCR analysis also confirmed the actual low
abundance of the TA RNAs: 25-35 PCR cycles were needed to detect the
TA PCR products, compared with 15-20 cycles needed for the detection
of ribosomal proteins, actin, and ferritin PCR products. In control
gradients, EDTA was added to aliquots of each cytosolic extract just
prior to centrifugation. In these cases, polysomes were disrupted and
all of the TA, TR, ferritin, and actin transcripts were found in the
nonpolysomal fraction of the gradient (data not shown), indicating that
they had all been components of normal polysomes.

View larger version (37K):
[in this window]
[in a new window]
|
Fig. 5.
Identification of mobilized transcripts
during differentiation of HL-60 cells. A, differential
display RT-PCR analysis of polysomal (p) and nonpolysomal
(m) fractions of 48-h TPA-treated cells (48 h) or control
untreated cells (con). The 10-mer arbitrary oligonucleotides
upstream primers used in these experiments were: (i) 5'-GCTATCACAG-3';
(ii) 5'-GTCATGCACA-3'; (iii) 5'-TGGATCCAAG-3'; (iv) 5'-ATTGGGAAGG-3'.
The open arrows point at the bands corresponding to
candidates for translationally activated RNAs (TAs).
B, RT-PCR analysis of TA transcripts, performed on
nonpolysomal (lanes 1 and 3) and polysomal
(lanes 2 and 4) fractions of control (lanes
1 and 2) or 48-h TPA-treated cells (lanes 3 and 4) with TA 10, 12, 20, and 90 specific primers.
C, RT-PCR analysis of nonpolysomal (lanes 1, 3, 5, 7, and 9) and polysomal (lanes 2, 4, 6, 8,
and 10) fractions of control (lanes 1 and
2) or 12- (lanes 3 and 4), 24- (lanes 5 and 6), 48- (lanes 7 and
8), and 72- (lanes 9 and 10) h
TPA-treated cells. TA-40 (TA40), actin (AC), and
H-ferritin (FE) specific primers were used in these
reactions (see "Expermental Procedures" for details).
|
|
It is important to note that the ratio of polysomal to subpolysomal RNA
concentrations was about 7:3 in control cells, and 1:3 in 48-h treated
cells. However, the efficiency of RT and the representation of the
various mRNA molecules in the cDNA products were largely
dependent on the concentration of RNA template in the reactions. Thus,
to reliably compare between different samples we had to use an equal
amount of RNA from each fraction in the DDRT-PCR and RT-PCR analyses.
Consequently, the intensity of the signals in these experiments does
not reflect accurately the relative subcellular distribution of
mRNAs in the cell; therefore, the degree of mobilization onto the
polysomes is overestimated while the level of release from the
polysomes is underestimated. The normalization of the PhosphorImaging
quantification of the DDRT-PCR signals and of densitometric
quantification of RT-PCR signals to the RNA distribution in the cells
indicated that the relative abundance in the polysomes of four TA
transcripts was considerably enhanced, i.e. they remained in
the polysomes while most of the cellular mRNAs were released (data
not shown). TA-40 RNA was unique in that it was mobilized onto
polysomes and its absolute amount in this fraction was significantly increased.
Search of various Gene Banks revealed that these TA sequences were
homologous to some ESTs that were expressed in a variety of tissues.
The sequences of the TA clones are shown in Fig.
6. Next, ends of these TA sequences were
used to search for overlapping sequences in the data bases. This
approach allowed us to combine several ESTs into extended putative TA
transcripts. To examine the authenticity of those combined transcripts,
RT-PCR analyses were performed with one oligonucleotide that was
located within the original cloned TA sequence and with its counterpart
that was derived from the end of the new extended sequence. This
analysis revealed that the TA-90 clone derived from the 3' termini of
the human fibulin D mRNA (2810 nucleotides); the other TA
transcripts are yet unidentified genes.

View larger version (33K):
[in this window]
[in a new window]
|
Fig. 6.
Nucleotide sequences of TA clones. The
ends of sequences corresponding to the primers used in differential
display RT-PCR are underlined and marked by bold
letters.
|
|
To elucidate the regulation of TA and TR RNAs expression, the
subcellular distribution of these transcripts during various HL-60
differentiation pathways was tested. The effect of TPA, 1,25-dehydroxyvitamin D3, or dimethyl sulfoxide on the
polysomal association of TR and TA transcripts was tested by
semiquantitative RT-PCR. A summary of these analyses is presented in
Table I. Some of the TR and TA clones
were repressed (L19, L13a, and S27) or activated (TA12 and TA40) in
response to all three inducers, while others (UbA, L11, TAs-10, 20, and
90) showed differential response to the various inducers.
View this table:
[in this window]
[in a new window]
|
Table I
Changes in the relative abundance of mRNAs in the polysomes upon
different pathways of HL-60 cellular differentiation
The results were obtained by semiquantitative RT-PCR reactions that
were repeated at least 3 times (see "Experimental Procedures" and
"Results" for details).
|
|
The TA-40 Transcript--
For further investigation we selected
the TA-40 transcript which demonstrated the strongest effect of
mobilization onto the polysomes upon TPA, 1,25-dehydroxyvitamin
D3, or dimethyl sulfoxide treatments. It was found that
TA-40 is expressed in a variety of human cells and cell lines, such as
primary fibroblasts, PBL, skin keratinocytes, Jarket cells, different
lines of B-lymthocytes, MCF7, 293, SK-N-SH, HepG2 and K562 cell lines,
and in mouse and rat tissues. Similarly to the observation in HL-60
cells, TA-40 RNA was mobilized to polysomes upon TPA induction of K-562
differentiation. Based upon Northern blot analysis of 7 µg of
poly(A)+ RNA it was estimated that the full-length of TA-40
RNA is about 1.3 kilobases (data not shown). To obtain a full-length
human TA-40 cDNA, we screened an HL-60 cDNA library using a
TA-40 specific hybridization probe. Four clones containing sequence
homologues to TA-40 were isolated, characterized, and sequenced. The
complete sequence consists of 1318 nucleotides (Fig.
7). The authenticity of the 5' end was
confirmed by sequence analysis of 5' rapid amplification of cDNA
end products (data not shown). Sequence analysis reveals that the TA-40
RNA is A/U-rich (65%) and includes two Alu-like elements. At the 5'
end of the molecule (position 10-315) we identified an Alu dimer
sequence that is 82.0% similar to the Alu consensus. The second Alu
sequence, the longer monomer with a 80.4% similarity to Alu consensus,
is located downstream at position 832-974. The rest of the molecule
consists of TA-40-specific sequences, which are remarkably A/U-rich
(74%).

View larger version (106K):
[in this window]
[in a new window]
|
Fig. 7.
Nucleotide sequence of TA-40 cDNA.
The Alu repetitive elements (both present in an opposite orientation
with respect to the TA-40 transcript) are underlined.
Asterisks mark the ends of original clone isolated from
differential display RT-PCR.
|
|
The search for an open reading frame (open reading frame) revealed,
unexpectedly, that the longest open reading frame encoded for only 47 amino acids (nucleotides 857-1000). If this 47-amino acid polypeptide
is the product of the TA-40 gene in vivo, the TA-40 RNA
would be unusual in three respects. (i) Its 5'-untranslated region
would contain at least eight AUGs. AUG codons in 5'-untranslated regions usually block translation from downstream open reading frames
and require specific regulatory mechanisms to overcome inhibition. (ii)
The coding sequence would contain Alu-like element. (iii) The putative
initiator AUG for the 47-amino acid open reading frame would lie within
an non-optimal context for translation initiation (TTTTGAGAUGG
versus the GCCPuCCAUGG consensus, where Pu is purine)
(31).
To determine translatability of TA-40 RNA, the transcript was
synthesized from the TA-40 cDNA and translated both in rabbit reticulocyte lysate and in wheat germ extract in the presence of
[35S]methionine. While translation of control RNAs
(luciferase and BMV mRNAs) was very efficient, no protein synthesis
was detected from the TA-40 transcript. Therefore, we suggested that
although this transcript is specifically associated with polysomes and is polyadenylated, it does not serve as mRNA, but rather is the final product of the TA-40 gene and might have a regulatory role. To
test this idea, the effect of the full-length TA-40 RNA on the in
vitro translation was examined. In the translation system (rabbit
reticulocyte lysate) used in these experiments, TA-40 RNA (S1)
suppressed 50% of the translation of luciferase mRNA, as did 50 ng/ml double-stranded RNA poly(I)·poly(C) (see Fig. 8B), a known powerful
inhibitor of protein synthesis (32). To further study this inhibitory
activity, we prepared TA-40-derived shorter transcripts (S2, S3, and
S4, Fig. 8A) and tested their effects on translation. These
molecules possessed inhibitory activity: S2, the 1180-nucleotide
transcript, inhibited protein synthesis to 36% of the control activity
and even the shortest S4 transcript, carrying mainly the Alu element,
reduced translation significantly. In control reactions, addition of
RNA templates such as pCITE and BMV RNAs enhanced translation to 173 and 283%, respectively (Fig. 8B).

View larger version (32K):
[in this window]
[in a new window]
|
Fig. 8.
TA-40 derived transcripts inhibit translation
in rabbit reticulocyte lysates. A, schematic
presentation of TA-40-derived transcripts (S1, S2, S3, and
S4). T7 promoter, 5' and 3' ends of the TA-40 clone, the R
site, intron, and location of the Alu similar elements are indicated.
The multicloning sites (MCS) derived from the pcDNA I
vector. Nucleotides are numbered above. B, effect
of TA-40 derived transcripts on the translation of luciferase mRNA.
Reaction mixtures of protein synthesis of 25 µl, containing 200 ng of
luciferase mRNA, were incubated with the indicated transcripts (S1,
100 ng of a full-length TA-40 transcript; S2-S4 were added at equimolar
amounts). Translation was determined by incorporation of
[35S] methionine. Background without mRNA was
subtracted and data were expressed as the percent of translation seen
with luciferase mRNA in the absence of additional RNA (Con).
|
|
Alu-containing Transcripts--
One of the features of the
extended TA sequences were the Alu-like elements identified in three
out of five of our selected transcripts (TA-40, TA-12, and TA-10). This
observation raised the possibility that those elements were
characteristic of a group of RNAs that were selectively associated with
polysomes in our experiments. To examine this possibility we have
selected at random nine Alu-containing mRNAs that were reported to
be expressed in HL-60 cells throughout its monocytic differentiation
and investigated their cytoplasmic distribution. Semiquantitative
RT-PCR analyses revealed that in addition to a moderate increase in the
total amount of these mRNAs (1.1-2.3-fold), there was a
predominant change in the distribution between polysomal and
subpolysomal fractions of eight out of nine selected Alu-containing
mRNAs. Thus, their relative abundance in polysomes increased
substantially during HL-60 cellular differentiation. These
Alu-containing mRNAs encoded for: vitamin D receptor, plasminogen
activator inhibitor-1, acyl-coenzyme A, tumor necrosis factor receptor
p75, C5a anaphylatoxin receptor, intracellular adhesion molecule-1, and
receptors for interleukin-1 and interleukin-6. The most prominent
examples are shown in Fig. 9. Most of
these mRNAs are of significant importance in differentiation and
functioning of the monocyte. Some non Alu-containing mRNAs were
tested as control. For most of them the distribution between polysomal
and subpolysomal fractions did not change (see Fig. 9, replication
protein A, HLA class I and ferritin). Another type of mRNAs, those
for ribosomal proteins, were specifically released from polysomes in
differentiated cells (an example is L13a in Fig. 9). These
observations indicate that in HL-60 cells undergoing differentiation
Alu elements characterize a specific group of transcripts whose
association with polysomes is coordinately regulated.

View larger version (37K):
[in this window]
[in a new window]
|
Fig. 9.
Changes in distribution of Alu-containing
mRNAs between polysomal and subpolysomal fractions.
Semiquantitative RT-PCR analysis of different Alu-containing mRNAs,
performed on subpolysomal (lanes 1 and 3) and
polysomal (lanes 2 and 4) fractions of control
(lanes 1 and 2) or 48-h TPA-treated cells
(lanes 3 and 4) with specific primers.
|
|
 |
DISCUSSION |
In the present study we demonstrate that HL-60 cellular
differentiation involves both global and gene-specific regulation of
translation. The changes in polysomal profiles along differentiation strongly suggest that the general inhibition of protein synthesis is
established at translation initiation (Fig. 3A). To study
gene-specific translational control a new experimental protocol for
the identification and isolation of such regulated genes was designed.
This protocol is based on RT-PCR amplification of the entire population
of mRNAs derived from polysomal and subpolysomal fractions. This
experimental approach can identify mRNAs specifically mobilized
onto or released from polysomes, independent of changes in the overall
rate of protein synthesis. This analysis is highly sensitive and
enables detection of differentially regulated RNAs even if expressed at very low levels (<1 pg out of 1 µg of total cytoplasmic RNA for the
TAs transcripts). Furthermore, this experimental approach does not
require prior nucleic acid or protein sequences knowledge, and allows a
non-preferential and comprehensive analysis of many thousand bands. The
patterns obtained in the DDRT-PCR analyses are reproducible (70-80%
similarity in independent experiments), and the subcellular
distribution of most candidate bands is confirmed by standard techniques.
The DDRT-PCR analyses demonstrate that the relative distribution of
most bands within polysomal and subpolysomal fractions remains
unaltered during differentiation. Hence, as the total amount of
polysomal RNA significantly decreases during this process, it is likely
to assume that translation of almost all mRNAs is inhibited to the
same extent. These results agree with a previous report (33), and
indicate that at early stages of myeloid cell differentiation most of
the "decreasing proteins" are translationally regulated.
Screening of 10-20% of the cellular mRNA revealed that in
conditions of overall inhibition of protein synthesis, 15 bands were
mobilized onto polysomes and 11 bands were specifically released. Examination of 13 candidate bands from the two groups indicated that 5 transcripts were activated, 5 other transcripts were specifically repressed to a much greater extent than the overall inhibition of
protein synthesis, and 3 transcripts remained unchanged. The five
repressed mRNAs encode ribosomal proteins. The vast majority of
vertebrate ribosomal protein mRNAs with complete sequence
information available contain a 5'-TOP (30). Some of them were reported to be translationally regulated in a growth-dependent
manner (30). We found new members of this family (rpL11, rpL19, and
rpS27), whose translation was repressed during the differentiation of HL-60 cells and was likely regulated by the
5'-TOP-dependent mechanism. In addition, the observed
inducer-specific response supports the notion that the 5'-TOP element,
per se, is necessary, but not sufficient to confer the
specificity for this type of regulation.
Only one "activated" clone, TA-90, represents a previously
characterized mRNA. The TA-90 clone expands and completes the
sequence of the 3' end of fibulin-1D mRNA, an alternatively spliced
form of the human fibulin-1 gene, encoding extracellular matrix and blood proteins (34). Homologous sequences to the other four mobilized
TA RNAs were found in the ESTs GeneBank only, thus representing uncharacterized genes. Sequence analyses of the full-length transcripts may reveal a common cis-element(s) that is involved in such specific regulation. However, RNA levels of those genes were very low in HL-60
cells, as well as in all other tested cell lines (<1 pg per 1 µg of
total RNA or per 40 ng of poly(A)+ RNA), complicating the
cloning of the corresponding full length cDNAs.
The most actively mobilized transcript onto polysomes during HL-60
differentiation was TA-40 RNA. TA-40 is expressed in various species in
many types of cells. Its corresponding genomic sequence is mapped to
human chromosome 16p12 and contains a single intron of 156 nucleotides
(data not shown). This evolutionary conserved transcript apparently
represents an unusual example of noncoding mature polyadenylated RNA
that is associated with polysomes.
Sequence analysis reveals that in addition to two Alu-like elements,
the 1.3-kilobase TA-40 RNA contains several ARE elements. These AU-rich
elements are loosely defined as AUUUA sequences located within
uracil-rich regions and were recently reported to be involved in the
regulation of mRNA and snRNA stability (35). Further analysis of
the TA-40 transcript reveals several regions with an extensive
similarity or complementarity to 28 S rRNA. The site at position
893-911 (site "R" in Fig. 8A) is of special interest because 16 out of its 19 nucleotides are complementary to one
of the "universal cores" of 28 S rRNA (positions 4480-4498 in
human 28 S rRNA) (36-38). The calculated free energy ( G)
of the putative interaction between the R site and the universal core
described above is 14 kcal/mol, raising the possibility of a stable
base pairing. The R site lies within an Alu-like sequence, nevertheless, it is TA-40 specific and is not found within the Alu
consensus. It is worthwhile to mention that complementarity between
rRNAs and mRNAs has been recently proposed to function in
translational control in eukaryotic cells (39).
The actively mobilized TA-40 RNA is also capable of inhibiting
translation in vitro. Even the short fragment of TA-40 (390 nucleotides), carrying mainly the Alu-dimer element, exhibits significant inhibitory activity. Although the in vitro
experimental system has distinct limitations, these results support the
idea that TA-40 RNA plays a role in regulating the translational
activity in HL-60 cells during differentiation. The most
physiologically relevant examples of noncoding cytoplasmic regulatory
RNAs are 7SL and lin-4 RNAs. lin-4 is a regulatory gene in
C. elegans. Lin-4 gene products are noncoding RNAs that
control the expression of two proteins, Lin-14 and Lin-28, that are
essential in C. elegans development. It is believed that the
noncoding lin-4 RNA can base pair with specific elements in the
3'-untranslated region of lin-14 and lin-28 mRNAs and cause their
translational repression (40). The other example, 7SL RNA, is an
essential component of the mammalian signal recognition particle and is
the suggested evolutionary source of Alu sequences (41, 42). 7SL RNA is
involved in transient translational arrest during translocation of
nascent polypeptide to the endoplasmic reticulum. The Alu-homologous
region of 7SL RNA mediates this arrest activity (43, 44). It is
noteworthy that both Alu and 7SL transfected genes suppress protein
synthesis and proliferation in HeLa cells (45). Recent data indicate
that overexpressed full-length Alu transcripts stimulate translation in
293 cells by binding and antagonizing PKR activation (46). These
observations demonstrate that Alu RNAs might interact with the
translational machinery and affect it (43-46).
Here, a significant change in the cytoplasmic distribution of
Alu-containing mRNAs with their enhancement in the polysomes was
observed during differentiation of HL-60 cells. In most cases this
phenomenon was associated with an increase in the steady state levels
of these mRNAs in the cytoplasm, indicating that expression of the
corresponding genes was regulated at the mRNA level as well.
Importantly, about 5% of human cDNAs contain Alu elements (47) and
several reports have indicated that the expression of RNAs containing
Alu sequences is associated with cell growth and differentiation
(48-50). Most of the identified Alu containing translationally
activated mRNAs are of primary importance in differentiation and
functioning of the monocyte. For example, tumor necrosis factor receptor p75 is the major surface tumor necrosis factor binding molecule in HL-60 cells induced to macrophagic, but not to granulocytic differentiation. It is also predominant in monocytes isolated from
peripheral blood (51). Tumor necrosis factor-R75 apparently mediates
tumor necrosis factor- autocrine loop in TPA-induced HL-60 cells
macrophage differentiation, thus promoting interactions with the
extracellular matrix, a key event for maturation and migration of
monocytes (52).
The general picture emerging is that upon differentiation in HL-60
cells a mechanism regulating overall inhibition of protein synthesis is
activated, and most mRNAs are released from the polysomes. In
addition to this global control, 1) the 5'-TOP mRNAs are
specifically released to a much greater extent than most mRNAs; 2)
a 1.3-kilobase noncoding RNA molecule represents the most actively
mobilized RNA onto polysomes and contains some putative regulatory
elements; and 3) a group of Alu-containing transcripts is retained or
even mobilized onto the polysomes. Sequence analysis revealed that Alu
was the only common element among these mRNAs. This observation, together with accumulating evidence for interaction of Alu-like elements with translational machinery, support the idea that Alu elements might be involved in the selective association of these transcripts with the polysomes.
 |
ACKNOWLEDGEMENTS |
We thank Alexander Rubinsky for technical
assistance. We also thank Haim Ovadia, Alik Honigman, and Zvi
Bar-Shavit for helpful comments on the manuscript.
 |
FOOTNOTES |
*
This work was supported by a grant from the Israel Science
Foundation.The costs of publication of this
article were defrayed in part by the
payment of page charges. The article
must therefore be hereby marked
"advertisement" in
accordance with 18 U.S.C. Section
1734 solely to indicate this fact.
The nucleotide sequence(s) reported in this paper has been submitted to the GenBankTM/EMBL Data Bank with accession number(s) AF126109 (TA 40), AF126110 (fibulin 1D), AA026960, AA767440, and AA256467 (homologous to TA 10, 12, and 20, respectively).
To whom correspondence should be addressed. Tel.: 972-2-6758409;
Fax: 972-2-6784010; E-mail: hrose{at}md2.huji.ac.il.
 |
ABBREVIATIONS |
The abbreviations used are:
RNP, ribonucleoprotein;
5'-TOP, 5'-terminal oligopyrimidine tract;
RT-PCR, reverse transcriptase-polymerase chain reactio;
DDRT-PCR, differential
display RT-PCR;
TPA, 12-O-tetradecanoyl-1-phorbol-13-acetate;
BMV, Brome mosaic
virus.
 |
REFERENCES |
-
Hershey, J. W. B.
(1991)
Annu. Rev. Biochem.
60,
717-755[CrossRef][Medline]
[Order article via Infotrieve]
-
Merrick, W. C.
(1992)
Microbiol. Rev.
56,
291-315[Abstract/Free Full Text]
-
Mathews, M. B.,
Sonenberg, N.,
and Hershey, J. W. B.
(1996)
in
Translational Control (Hershey, J. W. B., Mathews, M. B., and Sonenberg, N., eds), pp. 1-29, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY
-
Bernstein, J.,
Shefler, I.,
and Elroy-Stein, O.
(1995)
J. Biol. Chem.
270,
10559-10565[Abstract/Free Full Text]
-
Fu, L.,
and Benchimol, S.
(1997)
EMBO J.
16,
4117-4125[CrossRef][Medline]
[Order article via Infotrieve]
-
Hengst, L.,
and Reed, S. I.
(1996)
Science
271,
1861-1864[Abstract]
-
Imataka, H.,
Nakayama, K.,
Yasumoto, K.,
Mizuno, A.,
Fujii-Kuriyama, Y.,
and Hayami, M.
(1994)
J. Biol. Chem.
269,
20668-20673[Abstract/Free Full Text]
-
Ostareck, D. H.,
Ostareck-Lederer, A.,
Wilm, M.,
Thiele, B. J.,
Mann, M.,
and Hentze, M. W.
(1997)
Cell
89,
597-606[CrossRef][Medline]
[Order article via Infotrieve]
-
Rousseau, D,
Kaspar, R.,
Rosenwald, I.,
Gehrke, L.,
and Sonenberg, N.
(1996)
Proc. Natl. Acad. Sci. U. S. A.
93,
1065-1070[Abstract/Free Full Text]
-
Vagner, S.,
Gensac, M. C.,
Maret, A.,
Bayard, F.,
Amalric, F.,
Prats, H.,
and Prats, A. C.
(1995)
Mol. Cell. Biol.
15,
35-44[Abstract]
-
Wickers, M.,
Kimble, J.,
and Strickland, S.
(1996)
in
Translational Control (Hershey, J. W. B., Mathews, M. B., and Sonenberg, N., eds), pp. 433-450, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY
-
Jefferies, H. B. J.,
Thomas, G.,
and Thomas, G.
(1994)
J. Biol. Chem.
269,
4367-4372[Abstract/Free Full Text]
-
Thomas, G.,
and Thomas, G.
(1986)
J. Cell Biol.
103,
2137-2144[Abstract/Free Full Text]
-
Loreni, F.,
Francesconi, A.,
Jappelli, R.,
and Amaldi, F.
(1992)
Nucleic Acids Res.
20,
1859-1863[Abstract/Free Full Text]
-
Yenofsky, R.,
Bergmann, I.,
and Brawerman, G.
(1982)
Biochemistry
21,
3909-3913[CrossRef][Medline]
[Order article via Infotrieve]
-
Avni, D.,
Shama, S.,
Loreni, F.,
and Meyuhas, O.
(1994)
Mol. Cell. Biol.
14,
3822-3833[Abstract/Free Full Text]
-
Meyuhas, O.,
Thompson, J. R.,
and Perry, R. P.
(1987)
Mol. Cell. Biol.
7,
2691-2699[Abstract/Free Full Text]
-
Chirgwin, J. M.,
Przybyla, A. E.,
MacDonald, R. J.,
and Rutter, W. J.
(1979)
Biochemistry
18,
5294-5299[CrossRef][Medline]
[Order article via Infotrieve]
-
Rosen, H.,
and Polakiewicz, R.
(1989)
Brain Res. Dev.
46,
123-129[CrossRef][Medline]
[Order article via Infotrieve]
-
Liang, P.,
and Pardee, A. B.
(1995)
in
Current Protocols in Molecular Biology (Ausubel, F. M., Brent, R., Kingston, R. E., Moore, D. D., Seidman, J. G., Smith, J. A., and Struhl, K., eds), pp. 15.8.1-15.8.8, John Wiley and Sons, Inc., New York
-
Liang, P.,
and Pardee, A. B.
(1992)
Science
257,
967-971[Abstract/Free Full Text]
-
Strauss, W. M.
(1995)
in
Current Protocols in Molecular Biology (Ausubel, F. M., Brent, R., Kingston, R. E., Moore, D. D., Seidman, J. G., Smith, J. A., and Struhl, K., eds), pp. 6.3.1-6.3.6, John Wiley and Sons, Inc., New York
-
Klausner, R. D.,
Rouault, T. A.,
and Harford, J. B.
(1993)
Cell
72,
19-28[CrossRef][Medline]
[Order article via Infotrieve]
-
Melefors, O.,
and Hentze, M. W.
(1993)
BioEssays
15,
85-89[CrossRef][Medline]
[Order article via Infotrieve]
-
Mattia, E.,
Josic, D.,
Ashwell, G.,
Klausner, R.,
and van Renswoude, J.
(1986)
J. Biol. Chem.
261,
4587-4593[Abstract/Free Full Text]
-
Mattia, E.,
den-Blaauwen, J.,
Ashwell, G.,
and van-Renswoude, J.
(1989)
Proc. Natl. Acad. Sci. U. S. A.
86,
1801-5[Abstract/Free Full Text]
-
Chou, C. C.,
Gatti, R. A.,
Fuller, M. L.,
Concan, P.,
Wong, A.,
Chada, S.,
Davis, R. C.,
and Salser, W. A.
(1986)
Mol. Cell. Biol.
6,
566-573[Abstract/Free Full Text]
-
Birnie, G. D.
(1988)
Br. J. Cancer
58,
41-45
-
Tsiftsoglou, A. S.,
and Robinson, S. H.
(1985)
Int. J. Cell. Cloning
3,
349-366[Abstract]
-
Meyuhas, O.,
Avni, D.,
and Shama, S.
(1996)
in
Translational Control (Hershey, J. W. B., Mathews, M. B., and Sonenberg, N., eds), pp. 363-388, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY
-
Kozak, M.
(1991)
J. Cell Biol.
115,
887-903[Abstract/Free Full Text]
-
Jackson, R. J.
(1991)
in
Translation in Eukaryotes (Trachsel, H., ed), pp. 193-229, CRC Press, Boca Raton, FL
-
Hoffman-Liebermann, B.,
Liebermann, D.,
and Sachs, L.
(1981)
Dev. Biol.
81,
255-265[CrossRef][Medline]
[Order article via Infotrieve]
-
Tran, H.,
Mattei, M.,
Godina, S.,
and Argraves, W. S.
(1997)
Matrix Biol.
15,
479-493[CrossRef][Medline]
[Order article via Infotrieve]
-
Fan, X- H. C.,
Myer, V. E.,
and Steitz, J. A.
(1997)
Genes Dev.
11,
2557-2568[Abstract/Free Full Text]
-
Gonzalez, I. L.,
Gorski, J. L.,
Campen, T. J.,
Dorney, D. J.,
Erickson, J. M.,
Sylvester, J. E.,
and Schmickel, R. D.
(1985)
Proc. Natl. Acad. Sci. U. S. A.
82,
7666-7670[Abstract/Free Full Text]
-
Noller, H. F.
(1991)
Annu. Rev. Biochem.
60,
191-227[Medline]
[Order article via Infotrieve]
-
Spahn, C. M. T.,
Schafer, M. A.,
Krayevsky, A. A.,
and Nierhaus, K. H.
(1996)
J. Biol. Chem.
271,
32857-32862[Abstract/Free Full Text]
-
Tranque, P.,
Hu, M. C-Y.,
Edelman, D. M.,
and Mauro, V. P.
(1998)
Proc. Natl. Acad. Sci. U. S. A.
95,
12238-12243[Abstract/Free Full Text]
-
Moss, E. G.,
Lee, R. C.,
and Ambros, V.
(1997)
Cell
88,
637-646[CrossRef][Medline]
[Order article via Infotrieve]
-
Gundelfinger, E. D.,
Krause, E.,
Melli, M.,
and Dobberstein, B.
(1983)
Nucleic Acids Res.
11,
7363-7374[Abstract/Free Full Text]
-
Ullu, E.,
and Tschudi, C.
(1984)
Nature
312,
171-172[Medline]
[Order article via Infotrieve]
-
Chang, D. Y.,
Newitt, J. A.,
Hsu, K.,
Bernstein, H. D.,
and Maraia, R. J.
(1997)
Nucleic Acids Res.
25,
1117-1122[Abstract/Free Full Text]
-
Siegel, V.,
and Walter, P.
(1986)
Nature
320,
81-84[CrossRef][Medline]
[Order article via Infotrieve]
-
Sakamoto, K.,
Fordis, C. M.,
Corsico, C. D.,
Howard, T. H.,
and Howard, B. H.
(1991)
J. Biol. Chem.
266,
3031-3038[Abstract/Free Full Text]
-
Chu, W-M.,
Ballard, R.,
Carpick, B. W.,
Williams, B. R. G.,
and Schmid, C. W.
(1998)
Mol. Cell. Biol.
18,
58-68[Abstract/Free Full Text]
-
Yulug, I. G.,
Yulug, A.,
and Fisher, E. M.
(1995)
Genomic
27,
544-548[CrossRef][Medline]
[Order article via Infotrieve]
-
Howard, B. H.,
and Sakamoto, K.
(1990)
New Biol.
2,
759-770[Medline]
[Order article via Infotrieve]
-
Ryoo, H. M.,
van-Wijnen, A. J.,
Stein, J. L.,
Lian, J. B.,
and Stein, G. S.
(1997)
J. Cell. Biochem.
64,
106-116[CrossRef][Medline]
[Order article via Infotrieve]
-
Vidal, F.,
Mougneau, E.,
Glaichenhaus, N.,
Vaigot, P.,
Darmon, M.,
and Cuzin, F.
(1993)
Proc. Natl. Acad. Sci. U. S. A.
90,
208-212[Abstract/Free Full Text]
-
Winzen, R.,
Wallach, D.,
Engelmann, H.,
Nophar, Y.,
Brakebusch, C.,
Kemper, O.,
Resch, K.,
and Holtmann, H.
(1992)
J. Immunol.
148,
3454-3460[Abstract]
-
Xie, B.,
Laouar, A.,
and Huberman, E.
(1998)
J. Biol. Chem.
273,
11583-11588[Abstract/Free Full Text]
Copyright © 1999 by The American Society for Biochemistry and Molecular Biology, Inc.

CiteULike Complore Connotea Del.icio.us Digg Reddit Technorati What's this?
This article has been cited by other articles:

|
 |

|
 |
 
R. Yamashita, Y. Suzuki, N. Takeuchi, H. Wakaguri, T. Ueda, S. Sugano, and K. Nakai
Comprehensive detection of human terminal oligo-pyrimidine (TOP) genes and analysis of their characteristics
Nucleic Acids Res.,
June 1, 2008;
36(11):
3707 - 3715.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. Sharma, J. Masri, O. D. Jo, A. Bernath, J. Martin, A. Funk, and J. Gera
Protein Kinase C Regulates Internal Initiation of Translation of the GATA-4 mRNA following Vasopressin-induced Hypertrophy of Cardiac Myocytes
J. Biol. Chem.,
March 30, 2007;
282(13):
9505 - 9516.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
L. A. Noon, A. J. L. Clark, P. J. O'Shaughnessy, and P. J. King
A CCAAT/Enhancer-Binding Protein Site at -87 Is Required for the Activation of a Novel Murine Melanocortin 2-Receptor Promoter at Late Stages during Adipogenesis
Endocrinology,
December 1, 2006;
147(12):
6019 - 6026.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
D. Edgil, C. Polacek, and E. Harris
Dengue Virus Utilizes a Novel Strategy for Translation Initiation When Cap-Dependent Translation Is Inhibited
J. Virol.,
March 15, 2006;
80(6):
2976 - 2986.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. Cho, J. H. Kim, S. H. Back, and S. K. Jang
Polypyrimidine Tract-Binding Protein Enhances the Internal Ribosomal Entry Site-Dependent Translation of p27Kip1 mRNA and Modulates Transition from G1 to S Phase
Mol. Cell. Biol.,
February 15, 2005;
25(4):
1283 - 1297.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
Y. H. Choi, M. J. Park, K. W. Kim, H. C. Lee, Y. H. Choi, and J. Cheong
The orphan nuclear receptor SHP is involved in monocytic differentiation, and its expression is increased by c-Jun
J. Leukoc. Biol.,
November 1, 2004;
76(5):
1082 - 1088.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
N. Takeuchi and T. Ueda
Down-regulation of the Mitochondrial Translation System during Terminal Differentiation of HL-60 cells by 12-O-Tetradecanoyl-1-phorbol-13-acetate: COMPARISON WITH THE CYTOPLASMIC TRANSLATION SYSTEM
J. Biol. Chem.,
November 14, 2003;
278(46):
45318 - 45324.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
K. Maas, S. Chan, J. Parker, A. Slater, J. Moore, N. Olsen, and T. M. Aune
Cutting Edge: Molecular Portrait of Human Autoimmune Disease
J. Immunol.,
July 1, 2002;
169(1):
5 - 9.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. S. Carter and P. Sarnow
Distinct mRNAs That Encode La Autoantigen Are Differentially Expressed and Contain Internal Ribosome Entry Sites
J. Biol. Chem.,
September 1, 2000;
275(36):
28301 - 28307.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
F. Peiretti, S. Lopez, P. Deprez-Beauclair, B. Bonardo, I. Juhan-Vague, and G. Nalbone
Inhibition of p70S6 Kinase during Transforming Growth Factor-beta 1/Vitamin D3-induced Monocyte Differentiation of HL-60 Cells Allows Tumor Necrosis Factor-alpha to Stimulate Plasminogen Activator Inhibitor-1 Synthesis
J. Biol. Chem.,
August 17, 2001;
276(34):
32214 - 32219.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. L. Kroll, D. Barth-Baus, and J. O. Hensold
The Carboxyl-terminal Domain of the Granulocyte Colony-stimulating Factor Receptor Uncouples Ribosomal Biogenesis from Cell Cycle Progression in Differentiating 32D Myeloid Cells
J. Biol. Chem.,
December 21, 2001;
276(52):
49410 - 49418.
[Abstract]
[Full Text]
[PDF]
|
 |
|
Copyright © 1999 by the American Society for Biochemistry and Molecular Biology.
|
Advertisement
Advertisement
|