Advertisement
JBC

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Krichevsky, A. M.
Right arrow Articles by Rosen, H.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Krichevsky, A. M.
Right arrow Articles by Rosen, H.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

J Biol Chem, Vol. 274, Issue 20, 14295-14305, May 14, 1999


Translational Control of Specific Genes during Differentiation of HL-60 Cells*

Anna M. Krichevsky, Esther Metzer, and Haim RosenDagger

From the Department of Molecular Virology, The Faculty of Medicine, Hebrew University of Jerusalem, P. O. Box 12272, Jerusalem 91120, Israel

    ABSTRACT
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

Eukaryotic gene expression can be regulated through selective translation of specific mRNA species. Nevertheless, the limited number of known examples hampers the identification of common mechanisms that regulate translation of specific groups of genes in mammalian cells. We developed a method to identify translationally regulated genes. This method was used to examine the regulation of protein synthesis in HL-60 cells undergoing monocytic differentiation. A partial screening of cellular mRNAs identified five mRNAs whose translation was specifically inhibited and five others that were activated as was indicated by their mobilization onto polysomes. The specifically inhibited mRNAs encoded ribosomal proteins, identified as members of the 5'-terminal oligopyrimidine tract mRNA family. Most of the activated transcripts represented uncharacterized genes. The most actively mobilized transcript (termed TA-40) was an untranslated 1.3-kilobase polyadenylated RNA with unusual structural features, including two Alu-like elements. Following differentiation, a significant change in the cytoplasmic distribution of Alu-containing mRNAs was observed, namely, the enhancement of Alu-containing mRNAs in the polysomes. Our findings support the notion that protein synthesis is regulated during differentiation of HL-60 cells by both global and gene-specific mechanisms and that Alu-like sequences within cytoplasmic mRNAs are involved in such specific regulation.

    INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

Translational control of eukaryotic gene expression can be broadly classified into two major categories: global control affecting the overall rate of protein synthesis, and selective control in which the translation rate of mRNA subsets varies in response to biological stimuli (1-3). While much data has been accumulated in the last two decades regarding global control of protein synthesis (for review, see Refs. 1 and 2), little was published on selective control systems until recently (4-10).

Regulation of eukaryotic gene expression during developmental processes, such as germ cell maturation and early embryonic development in Xenopus, Caenorhabditis elegans, and Drosophila, was demonstrated to involve selective translation of certain mRNA species (see Ref. 11). In mammalian cells, however, the translation of only few mRNAs was shown to be regulated by gene-specific mechanisms during differentiation. The most characterized example of this type of regulation is the translation of 15-lipoxygenase mRNA during red blood cell differentiation (8). Previously, two approaches were used to identify and isolate specific mRNAs translationally regulated during differentiation. One approach was based on the pulse-chase labeling of cells with radioactive amino acids, followed by two-dimensional gel electrophoresis to identify relative changes in the translation pattern. Candidate proteins were further characterized using various biochemical methods, and their corresponding cDNAs were cloned and used to quantify their respective mRNA levels (12, 13). The second approach was based on the assumption that translationally inactive mRNAs are present as free cytoplasmic mRNPs, whereas actively translated mRNAs are contained within polysomes. To isolate and identify mRNAs selectively mobilized from mRNPs1 to polysomes, cDNA probes were prepared from mRNPs and polysomes and hybridized against cDNA libraries (14, 15). These studies, although limited to the relatively abundant mRNAs, led to the identification of a group of mRNAs encoding ribosomal proteins, elongation factors for protein synthesis, and proteins of as yet unknown function (14). More recent studies have established that translational efficiency of these mRNAs correlates with the rate of cell proliferation (16). The cis element in this type of translationally controlled mRNAs was found to be a 5'-terminal oligopyrimidine tract (5'-TOP), and they were termed 5'-TOP mRNAs (16).

In this study a new protocol based on the separation of polysomes from mRNPs using sucrose gradient centrifugation followed by differential display RT-PCR analysis is presented. This methodology identifies new mRNAs specifically mobilized from cytoplasmic free mRNPs onto polysomes and vice versa in the promyelocytic leukemia cell line HL-60 during cellular differentiation. Our findings suggest that Alu-like elements within cytoplasmic mRNAs are involved in gene-specific translation regulation.

    EXPERIMENTAL PROCEDURES
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

Materials-- Sera, cell culture medium, and antibiotics were provided by Biological Industries (Beit-Haemek, Israel); standard chemicals, phorbol ester 12-O-tetradecanoyl-1-phorbol-13-acetate (TPA), dimethyl sulfoxide were purchased from Sigma. 1,25-Dehydroxyvitamin D3 was a kind gift from Zvi Bar-Shavit (Faculty of Medicine, HU, Jerusalem, Israel). Restriction endonucleases and Random Priming Reagent kit were provided by New England BioLabs (Beverly, MA); AMV-Reverse Transcriptase, Taq DNA-polymerase, RiboMAXTM Large Scale RNA Production System, wheat germ extract, and rabbit reticulocyte nuclease-treated lysates were obtained from Promega (Madison, WI). The rapid amplification of 5' cDNA ends kit was obtained from Roche Molecular Biochemicals (Mannheim, Germany). Nylon membranes and radiochemicals were purchased from NEN Life Science Products Inc. (Boston, MA).

Cell Culture-- The human cell lines K562 and HL-60 were cultured in RPMI 1640 medium supplemented with 10% fetal calf serum, L-glutamine, penicillin, and streptomycin. Cells were routinely passaged twice a week to a density of 0.5-1.0 × 106 cells/ml and grown at 37 °C in 5% CO2. Induction of differentiation (30 ml of 4 × 105 cells/ml for 140-mm plate) was performed by the addition of 50 nM TPA, 100 nM 1,25-dehydroxyvitamin D3, or 1.25% dimethyl sulfoxide.

RNA Isolation-- Cell harvesting and sucrose gradient separation between polysomal and subpolysomal fractions were performed as described previously (17). Briefly, cells were collected by centrifugation, washed with ice-cold phosphate-buffered saline, lysed at 4 °C, and the postmitochondrial supernatant was overlaid onto a 15-45% sucrose gradient and spun at 26,000 rpm for 4 h at 4 °C. Fractions of polysomes (up to disomes) and subpolysomes (from 80 S to RNPs) were collected from the bottom of each gradient with continuous monitoring at 260 nm and precipitated with 0.1 M NaCl and 2.5 volumes of ethanol, the pellets were dissolved in guanidine thiocyanate and further purified by centrifugation through CsCl (18). Purified RNA preparations were quantified by spectrophotometry.

RNA Analysis-- For Northern blot analysis, RNA was denatured in glyoxal and subjected to electrophoresis on 1.5% agarose gel in 10 mM sodium phosphate buffer. The RNA was transferred to a nylon-based membrane, hybridized with the indicated 32P-random primed labeled probe, washed, and exposed to x-ray film as described (19). The DNA probes were specific cDNAs, prepared by PCR and labeled by random priming.

For RT-PCR analysis first-strand cDNA was synthesized with avian myeloblastosis virus-RT in the presence of 1 µg of total RNA, 1.5 µM oligo(dT) primer, 0.2 mM of each dNTP, 50 mM Tris, pH 8.3, 40 mM KCl, 6 mM MgCl2, 10 units of RNase inhibitor, and 10 units of avian myeloblastosis virus-RT in a final volume of 10 µl. Reaction was carried out for 45 min at 42 °C followed by heat inactivation for 5 min in 75 °C. For each PCR reaction we used 2 µl of the cDNA reaction mixture, 0.2 mM of each dNTP, 2 units of Taq polymerase, 1 times the corresponding reaction buffer provided with the enzyme, and a pair of PCR-specific primers (50 pmol of each). The amplification was performed for 15-40 cycles (each cycle consisted of 1 min at 93 °C, 1 min at 58 °C, and 1 min at 72 °C). The PCR products were then separated on 2.5% NuSieve 3:1 agarose gel.

The following gene-specific primers were used (the sequences are written from 5' to 3'): GGAACATGCTGAGAAACTG and CAGGGTGTGCTTGTCAAAG for H-ferritin; TCACCAACTGGGACGACATG and GTACAGGGATAGCACAGCCT for b-actin; ATCCCCAGAAGCAGCATGAC, TGCAGAGTGCCGAGAAATCC and CCCATTTCATGCCGTCCTG for TA 90 (fibulin 1D); CTCACACACACAACCATCC and GGAGTCTGGCTGTATTGTCC for TA 40; GGGAAAGCTTTCTAGTCTA and GTACTTAGGATAGCAGTAC for TA 10; GCTTGGGCCTTCCTCCATC and CTCTGTACACCCAGGAGTC for TA 12; CTGTTCCTAATGAGCAGGGC and TCAAAACTCACACGGCAGC for TA 20; GTTAGACCCCAATGAGACC and CACATTCCCCTTCACCTTC for TR (TR 11); GTCTCAAGGTGTTTGACGG and AGGAGTCCGTGGGTCTTGA for TR 10; ATCTCCTTCATCCCTCTCC and GCTTTTAGTGCTGCTTCCTC for TR 13; AGACCCTCACTGGCAAAAC and TGACCTTCTTCTTGGGACG for TR 40; CCGCAAACTCTGTCTCAAC and GGCCTCCTCTTTGCTGATT for TR 80; GTAACTCCACCAAGCCCATC and CCCTCTTTTCTTTTCCTCCC for VDR; TGCAGGTGGCAGAGTGAATG and CAAGAGATTGGGGGGTGAAG for PAI-1; GATTATGTCCGGCCACGTTC and ACCCAGCCCCACAAAAAAAG for acyl-CoA; TCTCTCCTCCCTTTCTTCCC and TCCTTCCTCTGCTTCTCACC for Il-6R; CTGCGGAGATCACACTGAC and GCTCTTCCTCCTACACATC for HLA; GAGTCTGCTGAAGCTATCC and AGTCTACACCACAACCACC for RepA.

For the semiquantitative RT-PCR the number of amplification cycles was limited in order to maintain the PCR reaction within the linear range. The optimal number of cycles for each pair of primers was determined by withdrawn aliquots of the corresponding reactions for agarose gel analysis after various number of cycles. The number of cycles sufficient for detecting clearly visible bands was chosen. The relative intensity of the DNA bands remained the same for at least four additional cycles.

Differential Display-- Differential display of 0.5 µg of total RNA from polysomes and from subpolysomes before and after cell treatment was performed essentially as described by Liang and Pardee (20, 21). For reverse transcription, 13 units/µl of Super Script II RT (Life Technologies, Inc., Bethesda, MD) were used. PCR reactions were performed with combinations of 10 different arbitrary 10-mer primers (50% GC, sense primers) and 5 different 5'-T12MN-3' primers (antisense primers, where MN were GG, GC, CG, GA, or AT).

The PCR products were labeled with 50 nM 32P (3000 Ci/mmol), separated by 6% polyacrylamide gel electrophoresis, and detected by autoradiography. DNA was eluted from the differentially amplified bands, reamplified by PCR as described (20), cloned into pCR-Script Amp SK(+) (Stratagene, La Jolla, CA), and sequenced by an automated ABI PRISM 377 DNA Sequencer. Sequence analysis was carried out with GCG supplied programs.

Cloning the Full-length TA-40 cDNA-- The HL-60 unidirectional cDNA library (obtained from Invitrogen, Carlsbad, CA, number 950-07) was constructed in pcDNA I vector using NotI dT primer and transfected into the Escherichia coli MC1061/PC. Screening of the HL-60 cell line cDNA library was performed by in situ hybridization with a radioactive labeled probe (22).

In Vitro RNA Transcription and Translation-- The DNA templates for in vitro transcription and translation were either the TA-40 pcDNA I plasmid linearized at the XhoI site (S1) or TA-40 derived fragments. These fragments were obtained by PCR reactions with T7 promoter primer TAATACGACTCACTATAGGG in combination with each of the following TA-40 specific primers: CTCACACACACAACCATCC (S2), CGGATTTGGGAAACTTTTCTATAAA (S3), and AGCTGTGCTTTACATAGCAATCTT (S4). Transcription reactions with T7 RNA polymerase were performed using the Ribo MAXTM Large Scale RNA Production System as recommended by the supplier. The quality of the synthesized RNA was determined by agarose gel electrophoresis.

Protein synthesis assays were carried in a standard micrococcal nuclease-treated rabbit reticulocyte lysate reaction mixture according to the manufacturer's instructions. Reactions containing BMV or luciferase transcripts as templates were incubated for 40 min at 30 °C in the presence of [35S]methionine. Aliquots were spotted onto 1-cm square filters and hot trichloroacetic acid percipitable radioactivity was determined. Where indicated, polyinosinic-polycytidylic acid (poly[I]·poly[C]) or TA-40 derived transcripts were added to the translation reaction prior to the addition of BMV or luciferase transcripts. All results are representative of at least three independent experiments.

    RESULTS
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

A New Protocol for Identification and Isolation of Translationally Regulated Genes-- To identify genes whose expression is translationally regulated, we combined a sucrose gradient separation of polysomes from mRNPs with DDRT-PCR analysis and cDNA cloning. Polysomal and subpolysomal RNAs were purified from cells before and after treatment. These RNA samples were subjected to a DDRT-PCR analysis and the radioactive labeled cDNA products were separated by polyacrylamide gel electrophoresis. This protocol is illustrated schematically in Fig. 1. Distribution of RNAs between polysomal and subpolysomal fractions is indicated by the relative intensity of the bands of the same electrophoretic mobility in adjacent lanes of the autoradiogram. Differences in the distribution of the intensities of bands found in treated cells relative to nontreated cells pointed toward candidates for translationally regulated transcripts (see arrows in Fig. 1). The bands' intensity was changed linearly in the range of 28-40 PCR cycles and thus, even small differences in mRNA distribution could be detected (data not shown).


View larger version (25K):
[in this window]
[in a new window]
 
Fig. 1.   Schematic illustration of differential display procedure to detect translationally regulated mRNAs. ps, polysomal; nps, nonpolysomal fractions. A, candidate bands for mRNA that is mobilized (translationally activated); B, candidate bands for mRNA that is released (translationally repressed). At the 3' end of oligo(dT) primer M represents A, G, or C nucleotides and N each of the four nucleotides.

To confirm the validity of this experimental approach, the regulation of ferritin expression was re-examined. Ferritin biosynthesis is a classical model for gene-specific translational control (23, 24). This model of iron-dependent regulation was thoroughly investigated and established in a number of cell lines, including the K562 human erythroleukemia cells (25) that were used in this study as a test model.

K562 cells were grown in suspension to a density of 5 × 105 cells/ml and then divided to untreated control culture and to experimental culture that was exposed to 100 mM hemin-iron for 4 h. Cytoplasmic RNA was separated by centrifugation on sucrose gradients and analyzed (Fig. 2A). The RNAs from polysomal and subpolysomal fractions were extracted separately. 10 µg of RNA from each fraction were subjected to a Northern blot analysis with 32P-labeled human H-ferritin cDNA probe (Fig. 2B). In the untreated cells most of the H-ferritin mRNA sedimented with the subpolysomal fraction (Fig. 2B, lanes 1 and 2), whereas, in the hemin-treated cells H-ferritin mRNA was equally distributed between the polysomal and subpolysomal fractions (Fig. 2B, lanes 3 and 4). Similar results were obtained by semiquantitative RT-PCR analysis performed with specific human H-ferritin primers (Fig. 2B, lower panel). These results confirmed the iron-dependent mobilization of H-ferritin mRNA onto polysomes in K562 cells. It is worthwhile to mention that in these cells ferritin biosynthesis was reported to be regulated at the mRNA level as well (26). RNAs from the same samples were subjected to DDRT-PCR analysis (as described under "Experimental Procedures"); the 10-mer arbitrary oligonucleotides upstream primers used were: 1) 5'-AAGGTAGTGC-3', 2) 5'-CTTGATTGCC-3', 3) 5'-GCTATCACAG-3'; and the T12MN anchored primers were: 4) 5'-T12CG-3', 5) 5'-T12AG-3', and 6) 5'-T12AT-3'. The sequences of primers 1 and 4 were derived from the 3'-untranslated region of the human H-ferritin mRNA (27). The sequence of primer 1 is located 120 nucleotides upstream to the poly(A) addition site, whereas primer 4 is the H-ferritin mRNA-specific anchored primer. For a given RNA preparation, the DDRT-PCR reactions generated highly reproducible mobility patterns of 30-100 distinct bands, depending on the combination of primers. The relative intensity patterns of the bands of the same electrophoretic mobility in adjacent lanes (from control and treated cells) were reproducible only in 70-80%. Therefore, it was necessary to run the DDRT-PCR analysis in duplicate. An autoradiogram of the DDRT-PCR analysis, performed with the combination of primers numbers 1 and 4 and exposed for 2 h, is shown in Fig. 2C. An additional 25 bands appeared after a 12-h exposure (data not shown). The arrow on the autoradiogram points at bands with an estimated size of 130 nucleotides. Isolation and sequencing of these DNA fragments confirmed that they corresponded to the H-ferritin cDNA. Comparison between the signals in lanes 1 and 2 (control) and those in lanes 3 and 4 (hemin-treated) indicated that the DDRT-PCR analysis produced similar results to those obtained by Northern blot and RT-PCR analyses (Fig. 2, B and C). This demonstrated the feasibility to identify mobilization of specific mRNAs onto polysomes using the DDRT-PCR analysis.


View larger version (17K):
[in this window]
[in a new window]
 
Fig. 2.   Mobilization of heavy chain ferritin mRNA onto polysomes. A, comparison between the polysomal profiles of controls K-562 cells and heme (100 nM)-treated cells. Cytosolic extracts were fractionated by centrifugation through 15-45% sucrose gradient. Fractions were collected from the bottom of each gradient with continuous monitoring at 260 nm. B, Northern blot and RT-PCR analyses of H-ferritin mRNA. Total RNA from nonpolysomal (lanes 1 and 3) and polysomal (lanes 2 and 4) fractions of K-562 cells treated with heme (lanes 3 and 4) or control untreated cells (lanes 1 and 2) was analyzed. Ribosomal RNA was used as a control for the amount of loaded RNA. C, differential display RT-PCR analysis of nonpolysomal (lanes 1 and 3) and polysomal (lanes 2 and 4) fractions of K-562 cells treated with heme (lanes 3 and 4) or control untreated cells (lanes 1 and 2). The open arrow points at the bands corresponding to H-ferritin cDNA fragment.

Identification of Translationally Regulated Genes in HL-60 Cells Undergoing Differentiation-- Promyelocytic leukemia cell line HL-60 is one of the best studied models of cell differentiation (28, 29). This culture comprises 90-95% of cells with myeloblastic/promyelocytic morphology. A variety of agents can induce differentiation of these cells either to granulocyte-like (dimethyl sulfoxide) or to monocyte/macrophage-like (TPA or 1,25-dihydroxyvitamin D3) cells (28).

Differentiation of HL-60 cells into monocyte/macrophage-like cells was induced with 50 nM TPA. After 24 h of induction, proliferation was arrested, and almost all the cells adhered in aggregates to the plastic dish; then they spread out and acquired a spindle-shaped morphology and prominent pseudopodia. This series of events was confirmed microscopically in all experiments.

To compare the polysomal profiles of HL-60 cells during their differentiation, cytoplasmic RNA from noninduced control, 12-, 24-, and 48-h treated cells was analyzed following centrifugation on sucrose gradients (Fig. 3A). The relative amount of polysomes decreased gradually during the course of cellular differentiation (Fig. 3A), reflecting the growth arrest and inhibition of overall protein synthesis associated with cellular differentiation. To identify transcripts whose translation was specifically regulated, we isolated RNAs from polysomal and subpolysomal fractions of control and TPA-treated cells, and examined them by differential display analysis (Figs. 3B and 5A). Thirty DDRT-PCR reactions, employing various combinations of primers on each RNA sample, produced a total of about 2500 different bands. Assuming that an average of 15,000 different species of mRNAs are expressed per cell, our analysis covered about 15% of the cellular RNAs. Most bands in this analysis represented RNA species with unaltered polysomal/subpolysomal distribution and thus provided multiple internal controls. Some mRNA species (type A) were found both in polysomal and subpolysomal fractions, both before and after treatment (Fig. 3B, m and p, in both con and 24-h lanes). Other species (type B) were present in subpolysomes only (about 10%, in m lanes only), or were found exclusively in polysomes (type C; about 5%, in p lanes only). Type B represents untranslated RNAs, whereas type C consists of RNAs that are apparently translated very efficiently, and therefore likely to be translationally regulated. In this study, however, only specific mRNAs whose translation was affected by cellular differentiation were further investigated.


View larger version (28K):
[in this window]
[in a new window]
 
Fig. 3.   Changes in translational activity in HL-60 cells undergoing differentiation. A, changes in polysomal profiles of HL-60 differentiating cells. Cytosolic extracts were fractionated by centrifugation through 15-45% sucrose gradient. Fractions were collected from the bottom of each gradient with continuous monitoring at 260 nm. PMA, 12-O-tetradecanoyl-1-phorbol-13-acetate. B, differential display RT-PCR analysis of polysomal (p) and nonpolysomal (m) fractions of 24-h TPA-treated cells (24 h) or control untreated cells (con). The 10-mer arbitrary oligonucleotides upstream primers used in these experiments were: 5'-GCTATCACAG-3' (I and III) and 5'-AGGACAGGTT-3' (II and IV). The open arrows point at the bands corresponding to specifically released RNAs. A few newly synthesized/significantly increased RNAs (+) or decayed RNAs (-) are also indicated.

Analysis of RNA from 24-h treated cells revealed few candidates for specifically repressed RNAs (arrows in Figs. 3B and 4a). In these cases bands derived from control cells exhibited usually similar intensities in subpolysomes and polysomes, whereas in treated cells the intensity of the bands from subpolysomes was much higher than that of the polysomes (arrows in Figs. 3B and 4A). These DNA bands (designated TR10, 11, 13, 40, and 80) were purified from the gels, amplified, cloned, and used as probes for RNA blot analysis of 10 µg of total RNA from different fractions. Autoradiograms of these analyses are presented in Fig. 4B. It is evident that most of the corresponding mRNAs in the 24-h treated cells were found in subpolysomal fractions (Fig. 4B, lanes 3 and 4). Comparison between the signals in lanes 1 and 2 (control) and those in lanes 3 and 4 (treated) indicates that the later mRNAs were no longer associated with the polysomes upon differentiation (Fig. 4B). Semiquantitative analysis revealed no significant changes in the total amount of TR mRNAs during the early stages of HL-60 cellular differentiation (data not shown). The kinetics of translational repression of these TR genes was studied by semiquantitative specific RT-PCR. An example of such analysis is shown in Fig. 4C. The release of TR-RNA from the polysomes was detected 12 h after TPA treatment (compare lanes 1 and 2, control, to lanes 3 and 4, 12-h treated). Expression of actin mRNA (AC) was determined by Northern blot (Fig. 4B) and RT-PCR (Fig. 4C) analysis to test the specificity of the observed phenomena. It is worthwhile to mention that actin mRNA was always found predominantly in polysomal fractions. The TR clones (TR 10, 11, 80, 13, and 40) were sequenced. Search for homologous sequences in the Gene Banks revealed that these clones derived from the 3' termini of the human mRNAs for ribosomal proteins L13a, L19, L11, S27 and the mRNA for ubiquitin 52 amino acid fusion protein (the natural hybrid between ubiquitin monomer and ribosomal protein), respectively. All five transcripts were relatively short mRNAs (from ~340 to ~700 nucleotides) with polypyrimidines at their 5' end, indicating the possibility that they were members of the 5'-TOP mRNA family. These results are in agreement with the accepted concept of translational repression of 5'-TOP's mRNAs in nonproliferating cells (for review, see Ref. 30).


View larger version (36K):
[in this window]
[in a new window]
 
Fig. 4.   Identification of specifically repressed genes during differentiation of HL-60 cells. A, focus on selected differential display RT-PCR patterns; analysis of nonpolysomal (lanes 1 and 3) and polysomal (lanes 2 and 4) fractions of 24-h TPA-treated cells (lanes 3 and 4) or control untreated cells (lanes 1 and 2). The open arrows point at the bands corresponding to candidates for translationally repressed RNAs (TRs). B, Northern blot analyses of nonpolysomal (lanes 1 and 3) and polysomal (lanes 2 and 4) fractions of 24-h TPA-treated cells (lanes 3 and 4) or control untreated cells (lanes 1 and 2) with TR specific probes. cDNA fragments cloned into pCR-Script Amp SK(+) vector and amplified with TR-specific primers were used as probes in these analyses. C, RT-PCR analysis of nonpolysomal (lanes 1, 3, 5, and 7) and polysomal (lanes 2, 4, 6, and 8) fractions of control (lanes 1 and 2) or 12- (lanes 3 and 4), 24- (lanes 5 and 6), and 48- (lanes 7 and 8) h TPA-treated cells with TR-11 (TR) or actin (AC) derived specific primers (see "Experimental Procedures" for details).

Further analysis of the 48-h TPA-treated cells revealed, in addition to the TR genes, 10 specific bands with relative enhanced intensity in the polysomal fraction (some of them are labeled by arrows in Fig. 5A). These bands represented mRNA candidates for translationally activated genes and were designated TA genes. They were isolated from the gels, amplified, cloned, sequenced, and used as probes for RNA blot analysis. We could not detect the corresponding RNAs in the Northern blot analysis of HL-60 total RNA (20 µg), probably due to their low abundance in these cells. Therefore, eight pairs of TA-specific primers were used in semiquantitative RT-PCR analysis (Fig. 5, B and C). This analysis confirmed that five out of the eight tested TA transcripts represented mRNAs that were mobilized onto polysomes upon differentiation (see TA-12, 20, 90, and 40 in Fig. 5, B and C; TA 10* showed a weaker effect of mobilization). This polysomal mobilization was detected 12-24 h after treatment and was not associated with notable changes in the total amount of these mRNAs (TA-90 mRNA was slightly decreased). As an example, TA-40 polysomal mobilization is demonstrated in Fig. 5C (compare lanes 1 and 2 with 3 and 4; actin-AC and ferritin-FE mRNAs were tested as controls). This RT-PCR analysis also confirmed the actual low abundance of the TA RNAs: 25-35 PCR cycles were needed to detect the TA PCR products, compared with 15-20 cycles needed for the detection of ribosomal proteins, actin, and ferritin PCR products. In control gradients, EDTA was added to aliquots of each cytosolic extract just prior to centrifugation. In these cases, polysomes were disrupted and all of the TA, TR, ferritin, and actin transcripts were found in the nonpolysomal fraction of the gradient (data not shown), indicating that they had all been components of normal polysomes.


View larger version (37K):
[in this window]
[in a new window]
 
Fig. 5.   Identification of mobilized transcripts during differentiation of HL-60 cells. A, differential display RT-PCR analysis of polysomal (p) and nonpolysomal (m) fractions of 48-h TPA-treated cells (48 h) or control untreated cells (con). The 10-mer arbitrary oligonucleotides upstream primers used in these experiments were: (i) 5'-GCTATCACAG-3'; (ii) 5'-GTCATGCACA-3'; (iii) 5'-TGGATCCAAG-3'; (iv) 5'-ATTGGGAAGG-3'. The open arrows point at the bands corresponding to candidates for translationally activated RNAs (TAs). B, RT-PCR analysis of TA transcripts, performed on nonpolysomal (lanes 1 and 3) and polysomal (lanes 2 and 4) fractions of control (lanes 1 and 2) or 48-h TPA-treated cells (lanes 3 and 4) with TA 10, 12, 20, and 90 specific primers. C, RT-PCR analysis of nonpolysomal (lanes 1, 3, 5, 7, and 9) and polysomal (lanes 2, 4, 6, 8, and 10) fractions of control (lanes 1 and 2) or 12- (lanes 3 and 4), 24- (lanes 5 and 6), 48- (lanes 7 and 8), and 72- (lanes 9 and 10) h TPA-treated cells. TA-40 (TA40), actin (AC), and H-ferritin (FE) specific primers were used in these reactions (see "Expermental Procedures" for details).

It is important to note that the ratio of polysomal to subpolysomal RNA concentrations was about 7:3 in control cells, and 1:3 in 48-h treated cells. However, the efficiency of RT and the representation of the various mRNA molecules in the cDNA products were largely dependent on the concentration of RNA template in the reactions. Thus, to reliably compare between different samples we had to use an equal amount of RNA from each fraction in the DDRT-PCR and RT-PCR analyses. Consequently, the intensity of the signals in these experiments does not reflect accurately the relative subcellular distribution of mRNAs in the cell; therefore, the degree of mobilization onto the polysomes is overestimated while the level of release from the polysomes is underestimated. The normalization of the PhosphorImaging quantification of the DDRT-PCR signals and of densitometric quantification of RT-PCR signals to the RNA distribution in the cells indicated that the relative abundance in the polysomes of four TA transcripts was considerably enhanced, i.e. they remained in the polysomes while most of the cellular mRNAs were released (data not shown). TA-40 RNA was unique in that it was mobilized onto polysomes and its absolute amount in this fraction was significantly increased.

Search of various Gene Banks revealed that these TA sequences were homologous to some ESTs that were expressed in a variety of tissues. The sequences of the TA clones are shown in Fig. 6. Next, ends of these TA sequences were used to search for overlapping sequences in the data bases. This approach allowed us to combine several ESTs into extended putative TA transcripts. To examine the authenticity of those combined transcripts, RT-PCR analyses were performed with one oligonucleotide that was located within the original cloned TA sequence and with its counterpart that was derived from the end of the new extended sequence. This analysis revealed that the TA-90 clone derived from the 3' termini of the human fibulin D mRNA (2810 nucleotides); the other TA transcripts are yet unidentified genes.


View larger version (33K):
[in this window]
[in a new window]
 
Fig. 6.   Nucleotide sequences of TA clones. The ends of sequences corresponding to the primers used in differential display RT-PCR are underlined and marked by bold letters.

To elucidate the regulation of TA and TR RNAs expression, the subcellular distribution of these transcripts during various HL-60 differentiation pathways was tested. The effect of TPA, 1,25-dehydroxyvitamin D3, or dimethyl sulfoxide on the polysomal association of TR and TA transcripts was tested by semiquantitative RT-PCR. A summary of these analyses is presented in Table I. Some of the TR and TA clones were repressed (L19, L13a, and S27) or activated (TA12 and TA40) in response to all three inducers, while others (UbA, L11, TAs-10, 20, and 90) showed differential response to the various inducers.

                              
View this table:
[in this window]
[in a new window]
 
Table I
Changes in the relative abundance of mRNAs in the polysomes upon different pathways of HL-60 cellular differentiation
The results were obtained by semiquantitative RT-PCR reactions that were repeated at least 3 times (see "Experimental Procedures" and "Results" for details).

The TA-40 Transcript-- For further investigation we selected the TA-40 transcript which demonstrated the strongest effect of mobilization onto the polysomes upon TPA, 1,25-dehydroxyvitamin D3, or dimethyl sulfoxide treatments. It was found that TA-40 is expressed in a variety of human cells and cell lines, such as primary fibroblasts, PBL, skin keratinocytes, Jarket cells, different lines of B-lymthocytes, MCF7, 293, SK-N-SH, HepG2 and K562 cell lines, and in mouse and rat tissues. Similarly to the observation in HL-60 cells, TA-40 RNA was mobilized to polysomes upon TPA induction of K-562 differentiation. Based upon Northern blot analysis of 7 µg of poly(A)+ RNA it was estimated that the full-length of TA-40 RNA is about 1.3 kilobases (data not shown). To obtain a full-length human TA-40 cDNA, we screened an HL-60 cDNA library using a TA-40 specific hybridization probe. Four clones containing sequence homologues to TA-40 were isolated, characterized, and sequenced. The complete sequence consists of 1318 nucleotides (Fig. 7). The authenticity of the 5' end was confirmed by sequence analysis of 5' rapid amplification of cDNA end products (data not shown). Sequence analysis reveals that the TA-40 RNA is A/U-rich (65%) and includes two Alu-like elements. At the 5' end of the molecule (position 10-315) we identified an Alu dimer sequence that is 82.0% similar to the Alu consensus. The second Alu sequence, the longer monomer with a 80.4% similarity to Alu consensus, is located downstream at position 832-974. The rest of the molecule consists of TA-40-specific sequences, which are remarkably A/U-rich (74%).


View larger version (106K):
[in this window]
[in a new window]
 
Fig. 7.   Nucleotide sequence of TA-40 cDNA. The Alu repetitive elements (both present in an opposite orientation with respect to the TA-40 transcript) are underlined. Asterisks mark the ends of original clone isolated from differential display RT-PCR.

The search for an open reading frame (open reading frame) revealed, unexpectedly, that the longest open reading frame encoded for only 47 amino acids (nucleotides 857-1000). If this 47-amino acid polypeptide is the product of the TA-40 gene in vivo, the TA-40 RNA would be unusual in three respects. (i) Its 5'-untranslated region would contain at least eight AUGs. AUG codons in 5'-untranslated regions usually block translation from downstream open reading frames and require specific regulatory mechanisms to overcome inhibition. (ii) The coding sequence would contain Alu-like element. (iii) The putative initiator AUG for the 47-amino acid open reading frame would lie within an non-optimal context for translation initiation (TTTTGAGAUGG versus the GCCPuCCAUGG consensus, where Pu is purine) (31).

To determine translatability of TA-40 RNA, the transcript was synthesized from the TA-40 cDNA and translated both in rabbit reticulocyte lysate and in wheat germ extract in the presence of [35S]methionine. While translation of control RNAs (luciferase and BMV mRNAs) was very efficient, no protein synthesis was detected from the TA-40 transcript. Therefore, we suggested that although this transcript is specifically associated with polysomes and is polyadenylated, it does not serve as mRNA, but rather is the final product of the TA-40 gene and might have a regulatory role. To test this idea, the effect of the full-length TA-40 RNA on the in vitro translation was examined. In the translation system (rabbit reticulocyte lysate) used in these experiments, TA-40 RNA (S1) suppressed 50% of the translation of luciferase mRNA, as did 50 ng/ml double-stranded RNA poly(I)·poly(C) (see Fig. 8B), a known powerful inhibitor of protein synthesis (32). To further study this inhibitory activity, we prepared TA-40-derived shorter transcripts (S2, S3, and S4, Fig. 8A) and tested their effects on translation. These molecules possessed inhibitory activity: S2, the 1180-nucleotide transcript, inhibited protein synthesis to 36% of the control activity and even the shortest S4 transcript, carrying mainly the Alu element, reduced translation significantly. In control reactions, addition of RNA templates such as pCITE and BMV RNAs enhanced translation to 173 and 283%, respectively (Fig. 8B).


View larger version (32K):
[in this window]
[in a new window]
 
Fig. 8.   TA-40 derived transcripts inhibit translation in rabbit reticulocyte lysates. A, schematic presentation of TA-40-derived transcripts (S1, S2, S3, and S4). T7 promoter, 5' and 3' ends of the TA-40 clone, the R site, intron, and location of the Alu similar elements are indicated. The multicloning sites (MCS) derived from the pcDNA I vector. Nucleotides are numbered above. B, effect of TA-40 derived transcripts on the translation of luciferase mRNA. Reaction mixtures of protein synthesis of 25 µl, containing 200 ng of luciferase mRNA, were incubated with the indicated transcripts (S1, 100 ng of a full-length TA-40 transcript; S2-S4 were added at equimolar amounts). Translation was determined by incorporation of [35S] methionine. Background without mRNA was subtracted and data were expressed as the percent of translation seen with luciferase mRNA in the absence of additional RNA (Con).

Alu-containing Transcripts-- One of the features of the extended TA sequences were the Alu-like elements identified in three out of five of our selected transcripts (TA-40, TA-12, and TA-10). This observation raised the possibility that those elements were characteristic of a group of RNAs that were selectively associated with polysomes in our experiments. To examine this possibility we have selected at random nine Alu-containing mRNAs that were reported to be expressed in HL-60 cells throughout its monocytic differentiation and investigated their cytoplasmic distribution. Semiquantitative RT-PCR analyses revealed that in addition to a moderate increase in the total amount of these mRNAs (1.1-2.3-fold), there was a predominant change in the distribution between polysomal and subpolysomal fractions of eight out of nine selected Alu-containing mRNAs. Thus, their relative abundance in polysomes increased substantially during HL-60 cellular differentiation. These Alu-containing mRNAs encoded for: vitamin D receptor, plasminogen activator inhibitor-1, acyl-coenzyme A, tumor necrosis factor receptor p75, C5a anaphylatoxin receptor, intracellular adhesion molecule-1, and receptors for interleukin-1 and interleukin-6. The most prominent examples are shown in Fig. 9. Most of these mRNAs are of significant importance in differentiation and functioning of the monocyte. Some non Alu-containing mRNAs were tested as control. For most of them the distribution between polysomal and subpolysomal fractions did not change (see Fig. 9, replication protein A, HLA class I and ferritin). Another type of mRNAs, those for ribosomal proteins, were specifically released from polysomes in differentiated cells (an example is L13a in Fig. 9). These observations indicate that in HL-60 cells undergoing differentiation Alu elements characterize a specific group of transcripts whose association with polysomes is coordinately regulated.


View larger version (37K):
[in this window]
[in a new window]
 
Fig. 9.   Changes in distribution of Alu-containing mRNAs between polysomal and subpolysomal fractions. Semiquantitative RT-PCR analysis of different Alu-containing mRNAs, performed on subpolysomal (lanes 1 and 3) and polysomal (lanes 2 and 4) fractions of control (lanes 1 and 2) or 48-h TPA-treated cells (lanes 3 and 4) with specific primers.


    DISCUSSION
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

In the present study we demonstrate that HL-60 cellular differentiation involves both global and gene-specific regulation of translation. The changes in polysomal profiles along differentiation strongly suggest that the general inhibition of protein synthesis is established at translation initiation (Fig. 3A). To study gene-specific translational control a new experimental protocol for the identification and isolation of such regulated genes was designed. This protocol is based on RT-PCR amplification of the entire population of mRNAs derived from polysomal and subpolysomal fractions. This experimental approach can identify mRNAs specifically mobilized onto or released from polysomes, independent of changes in the overall rate of protein synthesis. This analysis is highly sensitive and enables detection of differentially regulated RNAs even if expressed at very low levels (<1 pg out of 1 µg of total cytoplasmic RNA for the TAs transcripts). Furthermore, this experimental approach does not require prior nucleic acid or protein sequences knowledge, and allows a non-preferential and comprehensive analysis of many thousand bands. The patterns obtained in the DDRT-PCR analyses are reproducible (70-80% similarity in independent experiments), and the subcellular distribution of most candidate bands is confirmed by standard techniques.

The DDRT-PCR analyses demonstrate that the relative distribution of most bands within polysomal and subpolysomal fractions remains unaltered during differentiation. Hence, as the total amount of polysomal RNA significantly decreases during this process, it is likely to assume that translation of almost all mRNAs is inhibited to the same extent. These results agree with a previous report (33), and indicate that at early stages of myeloid cell differentiation most of the "decreasing proteins" are translationally regulated.

Screening of 10-20% of the cellular mRNA revealed that in conditions of overall inhibition of protein synthesis, 15 bands were mobilized onto polysomes and 11 bands were specifically released. Examination of 13 candidate bands from the two groups indicated that 5 transcripts were activated, 5 other transcripts were specifically repressed to a much greater extent than the overall inhibition of protein synthesis, and 3 transcripts remained unchanged. The five repressed mRNAs encode ribosomal proteins. The vast majority of vertebrate ribosomal protein mRNAs with complete sequence information available contain a 5'-TOP (30). Some of them were reported to be translationally regulated in a growth-dependent manner (30). We found new members of this family (rpL11, rpL19, and rpS27), whose translation was repressed during the differentiation of HL-60 cells and was likely regulated by the 5'-TOP-dependent mechanism. In addition, the observed inducer-specific response supports the notion that the 5'-TOP element, per se, is necessary, but not sufficient to confer the specificity for this type of regulation.

Only one "activated" clone, TA-90, represents a previously characterized mRNA. The TA-90 clone expands and completes the sequence of the 3' end of fibulin-1D mRNA, an alternatively spliced form of the human fibulin-1 gene, encoding extracellular matrix and blood proteins (34). Homologous sequences to the other four mobilized TA RNAs were found in the ESTs GeneBank only, thus representing uncharacterized genes. Sequence analyses of the full-length transcripts may reveal a common cis-element(s) that is involved in such specific regulation. However, RNA levels of those genes were very low in HL-60 cells, as well as in all other tested cell lines (<1 pg per 1 µg of total RNA or per 40 ng of poly(A)+ RNA), complicating the cloning of the corresponding full length cDNAs.

The most actively mobilized transcript onto polysomes during HL-60 differentiation was TA-40 RNA. TA-40 is expressed in various species in many types of cells. Its corresponding genomic sequence is mapped to human chromosome 16p12 and contains a single intron of 156 nucleotides (data not shown). This evolutionary conserved transcript apparently represents an unusual example of noncoding mature polyadenylated RNA that is associated with polysomes.

Sequence analysis reveals that in addition to two Alu-like elements, the 1.3-kilobase TA-40 RNA contains several ARE elements. These AU-rich elements are loosely defined as AUUUA sequences located within uracil-rich regions and were recently reported to be involved in the regulation of mRNA and snRNA stability (35). Further analysis of the TA-40 transcript reveals several regions with an extensive similarity or complementarity to 28 S rRNA. The site at position 893-911 (site "R" in Fig. 8A) is of special interest because 16 out of its 19 nucleotides are complementary to one of the "universal cores" of 28 S rRNA (positions 4480-4498 in human 28 S rRNA) (36-38). The calculated free energy (Delta G) of the putative interaction between the R site and the universal core described above is -14 kcal/mol, raising the possibility of a stable base pairing. The R site lies within an Alu-like sequence, nevertheless, it is TA-40 specific and is not found within the Alu consensus. It is worthwhile to mention that complementarity between rRNAs and mRNAs has been recently proposed to function in translational control in eukaryotic cells (39).

The actively mobilized TA-40 RNA is also capable of inhibiting translation in vitro. Even the short fragment of TA-40 (390 nucleotides), carrying mainly the Alu-dimer element, exhibits significant inhibitory activity. Although the in vitro experimental system has distinct limitations, these results support the idea that TA-40 RNA plays a role in regulating the translational activity in HL-60 cells during differentiation. The most physiologically relevant examples of noncoding cytoplasmic regulatory RNAs are 7SL and lin-4 RNAs. lin-4 is a regulatory gene in C. elegans. Lin-4 gene products are noncoding RNAs that control the expression of two proteins, Lin-14 and Lin-28, that are essential in C. elegans development. It is believed that the noncoding lin-4 RNA can base pair with specific elements in the 3'-untranslated region of lin-14 and lin-28 mRNAs and cause their translational repression (40). The other example, 7SL RNA, is an essential component of the mammalian signal recognition particle and is the suggested evolutionary source of Alu sequences (41, 42). 7SL RNA is involved in transient translational arrest during translocation of nascent polypeptide to the endoplasmic reticulum. The Alu-homologous region of 7SL RNA mediates this arrest activity (43, 44). It is noteworthy that both Alu and 7SL transfected genes suppress protein synthesis and proliferation in HeLa cells (45). Recent data indicate that overexpressed full-length Alu transcripts stimulate translation in 293 cells by binding and antagonizing PKR activation (46). These observations demonstrate that Alu RNAs might interact with the translational machinery and affect it (43-46).

Here, a significant change in the cytoplasmic distribution of Alu-containing mRNAs with their enhancement in the polysomes was observed during differentiation of HL-60 cells. In most cases this phenomenon was associated with an increase in the steady state levels of these mRNAs in the cytoplasm, indicating that expression of the corresponding genes was regulated at the mRNA level as well. Importantly, about 5% of human cDNAs contain Alu elements (47) and several reports have indicated that the expression of RNAs containing Alu sequences is associated with cell growth and differentiation (48-50). Most of the identified Alu containing translationally activated mRNAs are of primary importance in differentiation and functioning of the monocyte. For example, tumor necrosis factor receptor p75 is the major surface tumor necrosis factor binding molecule in HL-60 cells induced to macrophagic, but not to granulocytic differentiation. It is also predominant in monocytes isolated from peripheral blood (51). Tumor necrosis factor-R75 apparently mediates tumor necrosis factor-alpha autocrine loop in TPA-induced HL-60 cells macrophage differentiation, thus promoting interactions with the extracellular matrix, a key event for maturation and migration of monocytes (52).

The general picture emerging is that upon differentiation in HL-60 cells a mechanism regulating overall inhibition of protein synthesis is activated, and most mRNAs are released from the polysomes. In addition to this global control, 1) the 5'-TOP mRNAs are specifically released to a much greater extent than most mRNAs; 2) a 1.3-kilobase noncoding RNA molecule represents the most actively mobilized RNA onto polysomes and contains some putative regulatory elements; and 3) a group of Alu-containing transcripts is retained or even mobilized onto the polysomes. Sequence analysis revealed that Alu was the only common element among these mRNAs. This observation, together with accumulating evidence for interaction of Alu-like elements with translational machinery, support the idea that Alu elements might be involved in the selective association of these transcripts with the polysomes.

    ACKNOWLEDGEMENTS

We thank Alexander Rubinsky for technical assistance. We also thank Haim Ovadia, Alik Honigman, and Zvi Bar-Shavit for helpful comments on the manuscript.

    FOOTNOTES

* This work was supported by a grant from the Israel Science Foundation.The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

The nucleotide sequence(s) reported in this paper has been submitted to the GenBankTM/EMBL Data Bank with accession number(s) AF126109 (TA 40), AF126110 (fibulin 1D), AA026960, AA767440, and AA256467 (homologous to TA 10, 12, and 20, respectively).

Dagger To whom correspondence should be addressed. Tel.: 972-2-6758409; Fax: 972-2-6784010; E-mail: hrose{at}md2.huji.ac.il.

    ABBREVIATIONS

The abbreviations used are: RNP, ribonucleoprotein; 5'-TOP, 5'-terminal oligopyrimidine tract; RT-PCR, reverse transcriptase-polymerase chain reactio; DDRT-PCR, differential display RT-PCR; TPA, 12-O-tetradecanoyl-1-phorbol-13-acetate; BMV, Brome mosaic virus.

    REFERENCES
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES
  1. Hershey, J. W. B. (1991) Annu. Rev. Biochem. 60, 717-755[CrossRef][Medline] [Order article via Infotrieve]
  2. Merrick, W. C. (1992) Microbiol. Rev. 56, 291-315[Abstract/Free Full Text]
  3. Mathews, M. B., Sonenberg, N., and Hershey, J. W. B. (1996) in Translational Control (Hershey, J. W. B., Mathews, M. B., and Sonenberg, N., eds), pp. 1-29, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY
  4. Bernstein, J., Shefler, I., and Elroy-Stein, O. (1995) J. Biol. Chem. 270, 10559-10565[Abstract/Free Full Text]
  5. Fu, L., and Benchimol, S. (1997) EMBO J. 16, 4117-4125[CrossRef][Medline] [Order article via Infotrieve]
  6. Hengst, L., and Reed, S. I. (1996) Science 271, 1861-1864[Abstract]
  7. Imataka, H., Nakayama, K., Yasumoto, K., Mizuno, A., Fujii-Kuriyama, Y., and Hayami, M. (1994) J. Biol. Chem. 269, 20668-20673[Abstract/Free Full Text]
  8. Ostareck, D. H., Ostareck-Lederer, A., Wilm, M., Thiele, B. J., Mann, M., and Hentze, M. W. (1997) Cell 89, 597-606[CrossRef][Medline] [Order article via Infotrieve]
  9. Rousseau, D, Kaspar, R., Rosenwald, I., Gehrke, L., and Sonenberg, N. (1996) Proc. Natl. Acad. Sci. U. S. A. 93, 1065-1070[Abstract/Free Full Text]
  10. Vagner, S., Gensac, M. C., Maret, A., Bayard, F., Amalric, F., Prats, H., and Prats, A. C. (1995) Mol. Cell. Biol. 15, 35-44[Abstract]
  11. Wickers, M., Kimble, J., and Strickland, S. (1996) in Translational Control (Hershey, J. W. B., Mathews, M. B., and Sonenberg, N., eds), pp. 433-450, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY
  12. Jefferies, H. B. J., Thomas, G., and Thomas, G. (1994) J. Biol. Chem. 269, 4367-4372[Abstract/Free Full Text]
  13. Thomas, G., and Thomas, G. (1986) J. Cell Biol. 103, 2137-2144[Abstract/Free Full Text]
  14. Loreni, F., Francesconi, A., Jappelli, R., and Amaldi, F. (1992) Nucleic Acids Res. 20, 1859-1863[Abstract/Free Full Text]
  15. Yenofsky, R., Bergmann, I., and Brawerman, G. (1982) Biochemistry 21, 3909-3913[CrossRef][Medline] [Order article via Infotrieve]
  16. Avni, D., Shama, S., Loreni, F., and Meyuhas, O. (1994) Mol. Cell. Biol. 14, 3822-3833[Abstract/Free Full Text]
  17. Meyuhas, O., Thompson, J. R., and Perry, R. P. (1987) Mol. Cell. Biol. 7, 2691-2699[Abstract/Free Full Text]
  18. Chirgwin, J. M., Przybyla, A. E., MacDonald, R. J., and Rutter, W. J. (1979) Biochemistry 18, 5294-5299[CrossRef][Medline] [Order article via Infotrieve]
  19. Rosen, H., and Polakiewicz, R. (1989) Brain Res. Dev. 46, 123-129[CrossRef][Medline] [Order article via Infotrieve]
  20. Liang, P., and Pardee, A. B. (1995) in Current Protocols in Molecular Biology (Ausubel, F. M., Brent, R., Kingston, R. E., Moore, D. D., Seidman, J. G., Smith, J. A., and Struhl, K., eds), pp. 15.8.1-15.8.8, John Wiley and Sons, Inc., New York
  21. Liang, P., and Pardee, A. B. (1992) Science 257, 967-971[Abstract/Free Full Text]
  22. Strauss, W. M. (1995) in Current Protocols in Molecular Biology (Ausubel, F. M., Brent, R., Kingston, R. E., Moore, D. D., Seidman, J. G., Smith, J. A., and Struhl, K., eds), pp. 6.3.1-6.3.6, John Wiley and Sons, Inc., New York
  23. Klausner, R. D., Rouault, T. A., and Harford, J. B. (1993) Cell 72, 19-28[CrossRef][Medline] [Order article via Infotrieve]
  24. Melefors, O., and Hentze, M. W. (1993) BioEssays 15, 85-89[CrossRef][Medline] [Order article via Infotrieve]
  25. Mattia, E., Josic, D., Ashwell, G., Klausner, R., and van Renswoude, J. (1986) J. Biol. Chem. 261, 4587-4593[Abstract/Free Full Text]
  26. Mattia, E., den-Blaauwen, J., Ashwell, G., and van-Renswoude, J. (1989) Proc. Natl. Acad. Sci. U. S. A. 86, 1801-5[Abstract/Free Full Text]
  27. Chou, C. C., Gatti, R. A., Fuller, M. L., Concan, P., Wong, A., Chada, S., Davis, R. C., and Salser, W. A. (1986) Mol. Cell. Biol. 6, 566-573[Abstract/Free Full Text]
  28. Birnie, G. D. (1988) Br. J. Cancer 58, 41-45
  29. Tsiftsoglou, A. S., and Robinson, S. H. (1985) Int. J. Cell. Cloning 3, 349-366[Abstract]
  30. Meyuhas, O., Avni, D., and Shama, S. (1996) in Translational Control (Hershey, J. W. B., Mathews, M. B., and Sonenberg, N., eds), pp. 363-388, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY
  31. Kozak, M. (1991) J. Cell Biol. 115, 887-903[Abstract/Free Full Text]
  32. Jackson, R. J. (1991) in Translation in Eukaryotes (Trachsel, H., ed), pp. 193-229, CRC Press, Boca Raton, FL
  33. Hoffman-Liebermann, B., Liebermann, D., and Sachs, L. (1981) Dev. Biol. 81, 255-265[CrossRef][Medline] [Order article via Infotrieve]
  34. Tran, H., Mattei, M., Godina, S., and Argraves, W. S. (1997) Matrix Biol. 15, 479-493[CrossRef][Medline] [Order article via Infotrieve]
  35. Fan, X- H. C., Myer, V. E., and Steitz, J. A. (1997) Genes Dev. 11, 2557-2568[Abstract/Free Full Text]
  36. Gonzalez, I. L., Gorski, J. L., Campen, T. J., Dorney, D. J., Erickson, J. M., Sylvester, J. E., and Schmickel, R. D. (1985) Proc. Natl. Acad. Sci. U. S. A. 82, 7666-7670[Abstract/Free Full Text]
  37. Noller, H. F. (1991) Annu. Rev. Biochem. 60, 191-227[Medline] [Order article via Infotrieve]
  38. Spahn, C. M. T., Schafer, M. A., Krayevsky, A. A., and Nierhaus, K. H. (1996) J. Biol. Chem. 271, 32857-32862[Abstract/Free Full Text]
  39. Tranque, P., Hu, M. C-Y., Edelman, D. M., and Mauro, V. P. (1998) Proc. Natl. Acad. Sci. U. S. A. 95, 12238-12243[Abstract/Free Full Text]
  40. Moss, E. G., Lee, R. C., and Ambros, V. (1997) Cell 88, 637-646[CrossRef][Medline] [Order article via Infotrieve]
  41. Gundelfinger, E. D., Krause, E., Melli, M., and Dobberstein, B. (1983) Nucleic Acids Res. 11, 7363-7374[Abstract/Free Full Text]
  42. Ullu, E., and Tschudi, C. (1984) Nature 312, 171-172[Medline] [Order article via Infotrieve]
  43. Chang, D. Y., Newitt, J. A., Hsu, K., Bernstein, H. D., and Maraia, R. J. (1997) Nucleic Acids Res. 25, 1117-1122[Abstract/Free Full Text]
  44. Siegel, V., and Walter, P. (1986) Nature 320, 81-84[CrossRef][Medline] [Order article via Infotrieve]
  45. Sakamoto, K., Fordis, C. M., Corsico, C. D., Howard, T. H., and Howard, B. H. (1991) J. Biol. Chem. 266, 3031-3038[Abstract/Free Full Text]
  46. Chu, W-M., Ballard, R., Carpick, B. W., Williams, B. R. G., and Schmid, C. W. (1998) Mol. Cell. Biol. 18, 58-68[Abstract/Free Full Text]
  47. Yulug, I. G., Yulug, A., and Fisher, E. M. (1995) Genomic 27, 544-548[CrossRef][Medline] [Order article via Infotrieve]
  48. Howard, B. H., and Sakamoto, K. (1990) New Biol. 2, 759-770[Medline] [Order article via Infotrieve]
  49. Ryoo, H. M., van-Wijnen, A. J., Stein, J. L., Lian, J. B., and Stein, G. S. (1997) J. Cell. Biochem. 64, 106-116[CrossRef][Medline] [Order article via Infotrieve]
  50. Vidal, F., Mougneau, E., Glaichenhaus, N., Vaigot, P., Darmon, M., and Cuzin, F. (1993) Proc. Natl. Acad. Sci. U. S. A. 90, 208-212[Abstract/Free Full Text]
  51. Winzen, R., Wallach, D., Engelmann, H., Nophar, Y., Brakebusch, C., Kemper, O., Resch, K., and Holtmann, H. (1992) J. Immunol. 148, 3454-3460[Abstract]
  52. Xie, B., Laouar, A., and Huberman, E. (1998) J. Biol. Chem. 273, 11583-11588[Abstract/Free Full Text]


Copyright © 1999 by The American Society for Biochemistry and Molecular Biology, Inc.
Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
Nucleic Acids ResHome page
R. Yamashita, Y. Suzuki, N. Takeuchi, H. Wakaguri, T. Ueda, S. Sugano, and K. Nakai
Comprehensive detection of human terminal oligo-pyrimidine (TOP) genes and analysis of their characteristics
Nucleic Acids Res., June 1, 2008; 36(11): 3707 - 3715.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
A. Sharma, J. Masri, O. D. Jo, A. Bernath, J. Martin, A. Funk, and J. Gera
Protein Kinase C Regulates Internal Initiation of Translation of the GATA-4 mRNA following Vasopressin-induced Hypertrophy of Cardiac Myocytes
J. Biol. Chem., March 30, 2007; 282(13): 9505 - 9516.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
L. A. Noon, A. J. L. Clark, P. J. O'Shaughnessy, and P. J. King
A CCAAT/Enhancer-Binding Protein Site at -87 Is Required for the Activation of a Novel Murine Melanocortin 2-Receptor Promoter at Late Stages during Adipogenesis
Endocrinology, December 1, 2006; 147(12): 6019 - 6026.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
D. Edgil, C. Polacek, and E. Harris
Dengue Virus Utilizes a Novel Strategy for Translation Initiation When Cap-Dependent Translation Is Inhibited
J. Virol., March 15, 2006; 80(6): 2976 - 2986.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
S. Cho, J. H. Kim, S. H. Back, and S. K. Jang
Polypyrimidine Tract-Binding Protein Enhances the Internal Ribosomal Entry Site-Dependent Translation of p27Kip1 mRNA and Modulates Transition from G1 to S Phase
Mol. Cell. Biol., February 15, 2005; 25(4): 1283 - 1297.
[Abstract] [Full Text] [PDF]


Home page
J. Leukoc. Biol.Home page
Y. H. Choi, M. J. Park, K. W. Kim, H. C. Lee, Y. H. Choi, and J. Cheong
The orphan nuclear receptor SHP is involved in monocytic differentiation, and its expression is increased by c-Jun
J. Leukoc. Biol., November 1, 2004; 76(5): 1082 - 1088.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
N. Takeuchi and T. Ueda
Down-regulation of the Mitochondrial Translation System during Terminal Differentiation of HL-60 cells by 12-O-Tetradecanoyl-1-phorbol-13-acetate: COMPARISON WITH THE CYTOPLASMIC TRANSLATION SYSTEM
J. Biol. Chem., November 14, 2003; 278(46): 45318 - 45324.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
K. Maas, S. Chan, J. Parker, A. Slater, J. Moore, N. Olsen, and T. M. Aune
Cutting Edge: Molecular Portrait of Human Autoimmune Disease
J. Immunol., July 1, 2002; 169(1): 5 - 9.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
M. S. Carter and P. Sarnow
Distinct mRNAs That Encode La Autoantigen Are Differentially Expressed and Contain Internal Ribosome Entry Sites
J. Biol. Chem., September 1, 2000; 275(36): 28301 - 28307.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
F. Peiretti, S. Lopez, P. Deprez-Beauclair, B. Bonardo, I. Juhan-Vague, and G. Nalbone
Inhibition of p70S6 Kinase during Transforming Growth Factor-beta 1/Vitamin D3-induced Monocyte Differentiation of HL-60 Cells Allows Tumor Necrosis Factor-alpha to Stimulate Plasminogen Activator Inhibitor-1 Synthesis
J. Biol. Chem., August 17, 2001; 276(34): 32214 - 32219.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
S. L. Kroll, D. Barth-Baus, and J. O. Hensold
The Carboxyl-terminal Domain of the Granulocyte Colony-stimulating Factor Receptor Uncouples Ribosomal Biogenesis from Cell Cycle Progression in Differentiating 32D Myeloid Cells
J. Biol. Chem., December 21, 2001; 276(52): 49410 - 49418.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Krichevsky, A. M.
Right arrow Articles by Rosen, H.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Krichevsky, A. M.
Right arrow Articles by Rosen, H.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 All ASBMB Journals   Molecular and Cellular Proteomics 
 Journal of Lipid Research   ASBMB Today 
Copyright © 1999 by the American Society for Biochemistry and Molecular Biology.
Advertisement
spacer
Advertisement
Advertisement