Advertisement
JBC

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Bab, I.
Right arrow Articles by Frenkel, B.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Bab, I.
Right arrow Articles by Frenkel, B.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

J Biol Chem, Vol. 274, Issue 20, 14474-14481, May 14, 1999


Biosynthesis of Osteogenic Growth Peptide via Alternative Translational Initiation at AUG85 of Histone H4 mRNA*

Itai BabDagger , Elisheva Smith§, Hanna GavishDagger , Malka Attar-NamdarDagger , Michael Chorev, Yu-Chen ChenDagger , Andrash MuhlradDagger , Mark J. Birnbaumparallel , Gary Stein**, and Baruch Frenkel§Dagger Dagger

From the Dagger  Bone Laboratory, Faculty of Dental Medicine, Hebrew University of Jerusalem, Jerusalem 91120, Israel, the § Departments of Orthopaedic Surgery and Biochemistry and Molecular Biology and the Institute for Genetic Medicine, University of Southern California School of Medicine, Los Angeles, California 90033, the  Division of Bone and Mineral Metabolism, Department of Medicine, Beth Israel Deaconess Medical Center, Harvard Medical School, Boston, Massachusetts 02215, the parallel  Department of Biology, Merrimack College, North Andover, Massachusetts 01845, and the ** Department of Cell Biology, University of Massachusetts Medical Center, Worcester, Massachusetts 01655

    ABSTRACT
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

The osteogenic growth peptide (OGP) is an extracellular mitogen identical to the histone H4 (H4) COOH-terminal residues 90-103, which regulates osteogenesis and hematopoiesis. By Northern analysis, OGP mRNA is indistinguishable from H4 mRNA. Indeed, cells transfected with a construct encoding [His102]H4 secreted the corresponding [His13]OGP. These results suggest production of OGP from H4 genes. Cells transfected with H4-chloramphenicol acetyltransferase (CAT) fusion genes expressed both "long" and "short" CAT proteins. The short CAT was retained following an ATG right-arrow TTG mutation of the H4 ATG initiation codon, but not following mutation of the in-frame internal ATG85 codon, which, unlike ATG1, resides within a perfect context for translational initiation. These results suggest that a PreOGP is translated starting at AUG85. The translational initiation at AUG85 could be inhibited by optimizing the nucleotide sequence surrounding ATG1 to maximally support upstream translational initiation, thus implicating leaky ribosomal scanning in usage of the internal AUG. Conversion of the predicted PreOGP to OGP was shown in a cell lysate system using synthetic [His102]H4-(85-103) as substrate. Together, our results demonstrate that H4 gene expression diverges at the translational level into the simultaneous parallel production of both H4, a nuclear structural protein, and OGP, an extracellular regulatory peptide.

    INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

Histone genes serve as templates for the synthesis of histones that package DNA during the S phase of the cell cycle, and exhibit remarkable evolutionary conservation. Each of the main five histone proteins in mammalian cells, H1, H2A, H2B, H3, and H4, is encoded by a family of genes, most of which are arranged in clusters and expressed predominantly in dividing cells (reviewed in Ref. 1). Fewer histone genes have been described (1), including one Drosophila H4 gene (2), which are replication-independent. Recently, some extranuclear functions have been proposed for histones, including microtubule stabilization by histone H1 (3), regulation of cell proliferation by histones H1 (see Ref. 4, and references therein) and H2A.X (5), repression of microbial growth by a histone H2A fragment (6), and stimulation of glucose uptake into adipocytes and myocytes by histone H4 (7).

The osteogenic growth peptide (OGP), initially isolated from regenerating bone marrow, is identical to the carboxyl-terminal residues 90-103 of histone H4 (ref. 8 and Fig. 1C). OGP is present in micromolar concentrations in the serum of mammals, including humans (8, 9), and is secreted by cultured cells such as NIH3T3 fibroblasts, MC3T3-E1 osteoblastic cells (10), and ROS 17/2.8 osteosarcoma cells (Fig. 1A). In cell culture models, OGP regulates cell proliferation and activity (8, 11). In in vivo rodent models, OGP increases bone mass (8), stimulates blood and bone marrow cellularity, and enhances engraftment of bone marrow transplants (12). The amino acid sequence identity between OGP and the carboxyl-terminal region of histone H4 prompted us to test the hypothesis that OGP is derived from histone H4 gene(s). Indeed, we demonstrate that histone H4 genes do encode OGP, and that OGP synthesis is supported by leaky ribosomal scanning through the suboptimal AUG initiator of histone H4 mRNA.

    MATERIALS AND METHODS
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

Constructs-- pCMVH4His102 (Fig. 1C) is a glycine 102 to histidine mutant histone H4 (H4) gene driven by the CMV promoter. The [His102]H4 fragment was prepared by polymerase chain reaction (PCR) using as template the plasmid pJA5 carrying a rat somatic H4 genomic sequence (Ref. 13; accession no. X13554). The forward primer, 5'-TCTTCTTGCTCCATTACTGC, started 30 nucleotides downstream of the TATA box (37 nucleotides upstream of the ATG initiator). The reverse primer, 5'-GAGggatCCGGCTCAGCCGtgGAAGCC, contained a CC right-arrow tg mutation at codon 102 and a BamHI site (substituted nucleotides are in lowercase) starting 4 base pairs downstream of the stop codon (bold). The PCR product was digested with BamHI and cloned between the PvuII and BamHI sites of the mammalian expression vector pCEP4 (Invitrogen, San Diego, CA).

Plasmids containing H4-CAT fusion genes were constructed via an intermediate construct, pSVdCAT, derived from pSV2CAT (14). In pSVdCAT, a fragment between the unique SfiI site (juxtaposed the first transcription start site) and the CAT ATG initiation codon, is replaced by 17 base pairs containing two unique restriction sites, for EcoRV and XbaI. The sequence of pSVdCAT in the fusion area downstream of the SV40 promoter is CGAGGCCGGATATCTAAGGAAGCTAATCTAGAGAAA (original pSV2CAT sequences in italics, newly introduced restriction sites underlined, CAT gene codons 2 and 3 in bold). The SV40-H4-CAT plasmids (Figs. 2A and 3A) were then constructed by inserting H4-derived coding sequences between the EcoRV and XbaI sites of pSVdCAT. In each case the insert was obtained by PCR with reverse primers (containing XbaI sites) and forward primers as depicted below, using as templates genomic clones of either a rat somatic H4 (13) or the human H4FO108 (15) histone gene. The PCR products were digested with XbaI and inserted into pSVdCAT.

The H4-CAT coding sequences inserted in pSVdCAT either contained full-length H4 sequences (pSVrH4CAT and pSVFO108CAT; Fig. 2A) or were truncated downstream of H4 codon 86 (constructs of the pSVrH4Delta 87-103CAT type). In the former case, the in-frame H4-CAT fusion is via a CTA leucine codon, which replaces the H4 stop codon and is followed by the GAG codon encoding glutamate 2 of CAT. In the latter case, a CTA leucine codon is introduced between the H4 GAT codon encoding aspartate 86 and the CAT gene GAG codon encoding glutamate 2. Forward primers used to generate the H4 inserts started 34 base pairs downstream of the H4 TATA box. They were 5'-aTCTTCTTGCTCCATTACTGC for pSVrH4CAT; 5'-AtCTGTCTATCGGGCTCCAGC for pSVFO108CAT; 5'-TCTTCTTGCTCCATTACTGC for pSVrH4Delta 87-103CAT and pSVrH4Delta 87-103CAT(A/T); 5'-aTCTTCTTGCTCCATTACTGCTCTACTAGGtTGTCTGG for pSVrH4Delta 87-103CAT(T/A) and pSVrH4Delta 87-103CAT(T/T); and 5'-aTCTTCTTGCTCCATTACTGCTCTgCcgccaccATGgCTGGACGAGGG for pSVrH4Delta 87-103CAT(A!/A); lowercase fonts indicate deviations from the wild type sequence, introduced to either restore an EcoRV site at the fusion point with pSVdCAT, to mutate the ATG1 initiator to tTG, or to optimize the sequence around ATG1 for efficient translation initiation. Reverse primers were 5'-ACACCGtCTagaCCGCCGAAGCCATAGAGCG for pSVrH4CAT; 5'-AGCGGCtCtagaCCTCCGAAGCCGTAGAGGG for pSVFO108CAT; 5'-GAGCGCGTACtCtAgaTCCATAGCCGTG for pSVrH4Delta 87-103CAT, pSVrH4Delta 87-103CAT (T/A), and pSVrH4Delta 87-103CAT (A!/A); and 5'-GAGCGCGTACtCtAgaTCCAaAGCCGTG for pSVrH4Delta 87-103CAT(A/T) and pSVrH4Delta 87-103CAT(T/T); lowercase fonts indicate mutations introduced to generate XbaI sites, or to mutate ATG85 to tTG (CAa on the bottom strand). Finally, pSVrH4CAT(A!/A) and pSVrH4CAT(T/A) (Fig. 5) were constructed by replacing an AvaI/BamHI fragment of pSVrH4CAT, containing a portion of the H4 gene and the CAT gene, with the respective fragment of either pSVrH4Delta 87-103CAT(A!/A) or pSVrH4Delta 87-103CAT(T/A).

Cell Culture and Transfections-- ROS 17/2.8 rat osteosarcoma cells (16) were maintained in Ham's F-12 medium supplemented with 5% fetal bovine serum (FBS). NMuMG normal mouse mammary gland cells (17) were maintained in DMEM containing 10% FBS and 10 µg/ml insulin. DU 145 human prostatic carcinoma cells (18) were maintained in DMEM/RPMI 1640 (1:1) and 10% FBS. BALB/3T3 mouse embryonic cells (19) were maintained in DMEM supplemented with 10% calf serum, 4 mM L-glutamine, 4.5 g/liter glucose, and 1 mM sodium pyruvate. CV-1 African green monkey kidney cells (20) were maintained in DMEM supplemented with 10% FBS. Media were purchased from Life Technologies, Inc., and serum was from Omega Scientific Inc., Tarzana, CA. All transfections were performed with 20 µg of DNA in 100-mm culture dishes. Stable and transient transfection of ROS 17/2.8 cells employed the calcium phosphate (21) or the DEAE-dextran methods, respectively, exactly as in Ref. 22. In some experiments, ROS 17/2.8 cells were also transiently transfected using the LipofectAMINETM reagent (Life Technologies, Inc.) according to the manufacturer's recommendations, yielding essentially the same results. The LipofectAMINETM reagent was also used for transient transfection of all the other cell lines.

Northern Blot Analysis-- Total RNA was extracted from proliferating ROS 17/2.8 cell cultures with guanidinium thiocyanate-phenol-chloroform (23) using the Trizol reagent from Life Technologies, Inc. Samples (25 µg) were electrophoresed in 1% agarose gels and blotted onto a Nylon-N+ membrane (Amersham Pharmacia Biotech). Oligonucleotide probes corresponded to the OGP amino acid sequence (8), and the codons were selected based on either a cloned H4 gene (Ref. 13; 5'-GCGCTCAAGCGCCAGGGCCGCACGCTCTATGGCTTCGGC) or codon usage frequency (Ref. 24; 5'- GCCGCCAAAGCCATACAGGGTCCGGCCCTGCCGCTTCAGGGC). The oligonucleotides were labeled by tailing with [alpha -32P]dATP using terminal deoxytransferase (Roche Molecular Biochemicals) according to the manufacturer's protocol. Prehybridization (6 h, 50 °C) and hybridization (12 h, 50 °C) were in 1× SSC solution containing 2% SDS, 2× Denhardt's solution, 1% nonfat dry milk, and 200 µg/ml salmon sperm DNA. The final wash was carried out at 50 °C with 0.1× SCC and 0.2% SDS.

Western Blot Analysis-- Cells were harvested in ice-cold phosphate-buffered saline, pelleted, and lysed in 60 mM Tris-HCl buffer containing 2% SDS. Protein concentration in cell lysates was determined using a micro-BCA protein assay kit 23235 (Pierce), and samples supplemented with 2-mercaptoethanol (2%, v/v) were subjected to SDS-polyacrylamide gel electrophoresis (12% gel). The resolved proteins were transferred to Hybond ECL nitrocellulose membrane (Amersham Pharmacia Biotech) and CAT-immunoreactive proteins visualized with anti-CAT antibodies (5Prime right-arrow 3Prime, Boulder, CO; 1:300 dilution) and anti-rabbit IgG-conjugated horse radish peroxidase (Santa Cruz Biotechnology, Santa Cruz, CA) using the ECL immunodetection kit (Amersham Pharmacia Biotech).

Peptide Synthesis and Purification-- Synthetic peptides were prepared by the standard solid phase methodology (25). Peptides in conditioned medium or in cell lysate were purified by boiling, size exclusion, and reverse phase HPLC as described previously (9).

ELISA-- The presence of OGP, [His13]OGP, and immunoreactive products was determined in HPLC fractions by ELISA (10) using corresponding polyclonal antibodies generated in rabbits challenged with maleimido-modified keyhole limpet hemocyanin conjugated with either synthetic peptide (8).

[His18]PreOGP Proteolysis-- ROS 17/2.8 cells were rinsed and harvested in phosphate-buffered saline. Whole cell extract was prepared by resuspending the cell pellet (~2 × 106 cells) in 0.5 ml of 25 mM Tris-HCl buffer containing 0.25% Triton X-100, followed by homogenization (20 strokes with a tight fitting pestle) and sonication (four intervals of 10 s). Synthetic [His18]PreOGP was incubated with ROS 17/2.8 cell extracts for 1 h at 37 °C. Peptides were isolated from the reaction mixture by boiling, size exclusion, and reverse phase HPLC and the eluted fractions subjected to ELISA using anti-[His13]OGP antibodies.

    RESULTS
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

Histone H4 Gene Expresses OGP-- Although OGP, present abundantly in the serum and in cell culture media, is identical to the H4 carboxyl terminus, it was not known whether the two polypeptides, H4 and OGP, could be synthesized from the same template. The possible occurrence of a non-H4 mRNA that encodes OGP was addressed by Northern analysis of ROS 17/2.8 cells, which we had confirmed secrete OGP (Fig. 1A). The probe was a radiolabeled oligonucleotide complementary to the codons that most likely encode the reported OGP amino acid sequence (8) based on codon usage frequency (24). A parallel RNA blot was probed with a radiolabeled oligonucleotide complementary to the OGP-respective sequence of a known rat somatic H4 gene (Ref. 13; accession no. X13554). As shown in Fig. 1B, the "common usage" OGP probe hybridized with a single-size short transcript(s), which co-migrated with H4 mRNA. Thus, OGP is likely encoded exclusively by H4 mRNA(s), although the possibility of OGP translation from a transcript similar in size to, yet distinct from, H4 mRNA cannot be excluded.


View larger version (19K):
[in this window]
[in a new window]
 
Fig. 1.   OGP is a product of histone H4 gene(s). A, accumulation of immunoreactive OGP (irOGP) in culture medium of ROS 17/2.8 cells. Cells were cultured and irOGP determined as reported (10). Data represent mean ± S.D. obtained in triplicate culture wells at each time point. B, Northern blot analysis of ROS 17/2.8 cells with an OGP common usage codon probe. Total RNA was extracted from proliferating ROS 17/2.8 cells and two identical samples subjected to Northern blot analysis. Lane 1, the membrane was probed with an oligonucleotide complementary to a hypothetical OGP mRNA predicted from codon usage frequency (24); lane 2, a parallel membrane was probed with an oligonucleotide corresponding to the OGP domain of a rat somatic H4 gene (13). Bars represent location of the 28 and 18 S ribosomal RNA. C, schematic illustration of H4 gene and pCMVH4His102. Histone H4 gene is shown at the top with OGP represented by a shaded box and transcription start site indicated by horizontal arrow. Codons encoding H4 and OGP NH2 and COOH termini are numbered (arrowheads). pCMVH4His102 contains histidine 102-tagged (italic) histone H4 coding sequence, flanked by CMV promoter (hatched box) and SV40 intron and polyadenylation signal sequences (stippled box). Shaded box with black bar represents [His13]OGP coding sequence. OGP and [His13]OGP amino acid sequences are underlined. Arrows indicate chymotrypsin-like cleavage sites. pCMVH4His102 was constructed using pCEP4 (Invitrogen), thus providing resistance to hygromycin B. D and E, secretion of [His13]OGP by ROS 17/2.8 cells carrying pCMVH4His102. Cells were transfected with pCMVH4His102 and selected with hygromycin B. Forty-eight-hour conditioned medium was collected from the stable transfectants cultured in serum-free, bovine serum albumin-supplemented medium (8). Chromatographic fractions eluted at 17-22% acetonitrile were screened for the presence of [His13]OGP by ELISA. Peak region of ir[His13]OGP was subjected to a second reverse phase cycle using the same conditions and screened with anti-[His13]OGP antibodies (D). Control reverse phase profiles of synthetic OGP (i.e. H4-(90-103)) and [His13]OGP (i.e. [His102]H4-(90-103)) are shown in (E). ------, immunoreactivity; - - -, light absorbance. A similar [His13]OGP peak was observed in two independent experiments, but not in conditioned medium from nontransfected cells.

To directly demonstrate the synthesis of OGP from an H4 mRNA, we introduced a histidine 102-tagged H4 gene into cells and assayed medium conditioned by these cells for the corresponding tagged OGP. ROS 17/2.8 cells were stably transfected with pCMVH4His102 (Fig. 1C), containing a CMV-driven rat somatic H4 gene (13), in which the GGC glycine 102 codon was replaced by CAC, encoding histidine. If OGP is produced from this H4 gene, then the transfected cells may secrete an OGP molecule with a glycine to histidine mutation at position 13 ([His13]OGP). Secretion of [His13]OGP by the transfected cells was assayed by reversed-phase HPLC fractionation of conditioned medium and ELISA with anti-[His13]OGP antibodies. As shown in Fig. 1D, [His13]OGP was readily detectable in medium conditioned by the transfected cells. The secreted immunoreactive [His13]OGP was eluted at 19.8% acetonitrile (Fig. 1D), identical to the elution profile of synthetic [His13]OGP, and distinct from the synthetic wild type OGP, which was eluted at 20.8% acetonitrile (Fig. 1E). Identity of the immunoreactive [His13]OGP was confirmed by amino acid sequencing. No [His13]OGP was detected in medium conditioned by nontransfected ROS 17/2.8 cells (data not shown). Thus, a histidine-tagged H4 coding sequence gave rise to a secreted histidine-containing OGP mutant in transfected ROS 17/2.8 cells, suggesting that this and perhaps other H4 genes encode both H4, a component of the eukaryotic DNA packaging apparatus, and OGP, a secreted regulatory polypeptide.

Production of Long and Short CAT Proteins from H4-CAT Fusion Genes-- To further investigate the production of both H4 and OGP from H4 genes we constructed two CAT-tagged H4 genes (Fig. 2A), in which the CAT sequence, starting at its second codon, was fused in frame to the H4 coding sequence of either the rat somatic H4 gene used in Fig. 1, or to the coding sequence of a human H4 gene, H4FO108 (Ref. 15; accession no. M16707). Each of these constructs, pSVrH4CAT and pSVH4FO108CAT, encodes an H4-CAT fusion protein of ~35 kDa, comprising ~10-kDa and ~25-kDa H4 and CAT moieties, respectively. However, if the mechanism of OGP synthesis from H4 genes (Fig. 1) is not interfered with by the CAT tag, then an additional, shorter CAT derivative of ~26 kDa should be produced from each of these constructs. The two plasmids were each transiently transfected into ROS17/2.8 cells and whole cell extracts subjected to Western analysis using anti-CAT antibodies. As shown in Fig. 2B for both of these constructs (lanes 3 and 4), the 35-kDa band representing the full-length fusion protein (double arrowhead) is accompanied by a lower molecular mass CAT-immunoreactive doublet with apparent molecular masses of 25.7 kDa (arrowhead) and 24.8 kDa (small arrow). The 25.7-kDa band is consistent with the production of an OGP-CAT fusion protein from the H4-CAT genes. The 24.8-kDa CAT species, which co-migrates with a CAT protein expressed from pSV2CAT (lane 1), may represent a proteolytic product of the 35- and/or 25.7-kDa protein (see below). These results are consistent with the conclusion from Fig. 1, that the rat somatic X13554 H4 gene encodes both H4 and OGP, and suggest that this may be shared by other H4 genes.


View larger version (26K):
[in this window]
[in a new window]
 
Fig. 2.   Production of long and short CAT proteins from histone H4-CAT fusion genes. A, schematic illustration of SV-H4-CAT constructs derived from pSV2CAT (14) by introducing full-length histone H4 coding sequences upstream of and in frame with the CAT gene. Both the H4 stop codon and the CAT initiation codon are missing in these constructs. H4 sequences are either from a rat somatic H4 (pSVrH4CAT) or the human H4FO108 (pSVH4FO108CAT) gene. Striped box, SV40 promoter and enhancer; clear boxes, sequences of either the rat or the human H4 gene; shaded boxes, OGP-respective sequence; meshed box, CAT gene and SV40 intron and polyadenylation signals. B, Western analysis of CAT-immunoreactive proteins. ROS 17/2.8 osteosarcoma cells were transiently transfected with pSV2CAT (14) (lane 1), an unrelated plasmid (lane 2), pSVH4FO108CAT (lane 3), or pSVrH4CAT (lane 4), and whole cell extract subjected to Western analysis using anti-CAT antibodies. Double arrowhead indicates the 35-kDa H4-CAT fusion protein. Arrowhead and small arrow indicate a 25.7- and a 24.8-kDa CAT-immunoreactive doublet. The 25.7-kDa band marked by arrowhead is likely OGP-CAT. Note three nonspecific bands demonstrated by cells transfected with an unrelated plasmid (lane 2). A similar ratio between the intensities of the 35- and the 25.7-kDa bands was observed in four independent experiments. The 24.8-kDa band exhibited varying degrees of relative intensity, either similar or higher than that shown here.

Production of Short CAT from H4-CAT Fusion Gene Does Not Require Proteolytic Sites at the H4 COOH Terminus-- Production of both OGP (Fig. 1D) and the short CAT proteins (Fig. 2) could occur via a chymotrypsin-like cleavage of H4 at the Tyr89-Ala90 site (Fig. 1C). To examine this possibility, we prepared a pSVrH4CAT internal deletion construct, pSVrH4Delta 87-103CAT (abbreviated A/A; Fig. 3A), in which the histone codons 87-103, containing this proteolytic site, are missing. The deleted sequence included an additional chymotrypsin-like cleavage site, between Tyr99 and Gly100 (Fig. 1A), which could have also contributed to production of the short CAT forms (Fig. 2B), but it did not include the ATG85 codon (see below). Western analysis of ROS 17/2.8 cells transfected with the A/A construct (Fig. 3B, lane 3) clearly indicates expression of two CAT species (~35 and ~25 kDa), similar to those observed with constructs containing full-length H4 sequences (Fig. 2B). This result suggests that the generation of alternative CAT products observed in cells transfected with H4-CAT fusion genes does not require proteolytic cleavage anywhere between residues 87 and 103 of the H4-CAT fusion protein.


View larger version (43K):
[in this window]
[in a new window]
 
Fig. 3.   Production of short CAT protein from H4-CAT fusion gene is dependent on intact ATG85, does not require the ATG1 initiator, and inhibited by optimizing the sequence around ATG1 to better support translational initiation. A, pSVrH4Delta 87-103CAT is schematically illustrated in relation to H4 gene. The sequence encoding H4 residues 87-103 is deleted, and the H4 GAT86 codon is fused in-frame to the CAT gene GAG2 codon. In the three constructs illustrated below pSVrH4Delta 87-103CAT (abbreviated A/A), either ATG85, ATG1, or both (indicated by A) are mutated to TTG (indicated by T). These three constructs are abbreviated as A/T, T/A and T/T, respectively. In pSVrH4Delta 87-103CAT(A!/A), the nucleotide sequence surrounding ATG1 was altered to optimize translational initiation. Box designation is as in Fig. 2A. B, Western analysis of ROS 17/2.8 cells transiently transfected with an unrelated plasmid (lane 1), pSV2CAT (14) (lane 2), A/A (lane 3), A/T (lane 4), T/A (lane 5), or T/T (lane 6). CAT immunodetection was performed as in Fig. 2B. C, same as B, with A!/A (lane 1), A/A (lane 2), and an unrelated plasmid (lane 3). Single and double arrowheads indicate CAT-immunoreactive proteins of ~25 and ~35 kDa, respectively.

De Novo Production of Short CAT from H4-CAT Fusion Gene-- Production of OGP from H4 genes could occur de novo by translational initiation at the AUG85 codon (Fig. 1C), followed by removal of five amino-terminal residues. The feasibility of such de novo synthesis was examined by constructing pSVrH4Delta 87-103CAT(T/A), which differs from pSVrH4Delta 87-103CAT in that the H4 ATG initiator is mutated to TTG (Fig. 3A). As expected, cells transfected with this construct (abbreviated T/A) do not express the ~35-kDa H4-CAT fusion protein (Fig. 3B, lane 5). However, the ~25-kDa CAT form is fully retained, indicating its production in the absence of the long CAT form, likely via translational initiation at AUG85. Enhanced expression of the short CAT from the T/A as compared with the A/A construct (Fig. 3B), confirmed with three independent pairs of plasmid preparations, may be explained by more rapid ribosomal scanning through the otherwise translated H4 codons 1-84.

ATG85 Is Required for Production of Short CAT from H4-CAT Fusion Gene-- To directly address involvement of the ATG85 codon in synthesis of the short CAT form, ROS 17/2.8 cells were transfected with pSVrH4Delta 87-103CAT(A/T), which differs from pSVrH4Delta 87-103CAT in that ATG85 is substituted by TTG. As shown in Fig. 3B (lane 4), this mutation specifically abrogated synthesis of the short CAT form, suggesting that alternative translation is indeed involved in the production of the ~25-kDa protein. Finally, neither the long nor the short CAT forms were detected in cells transfected with pSVrH4Delta 87-103CAT(T/T) (Fig. 3B, lane 6), in which both ATG1 and ATG85 had been replaced by TTG. Together, these results demonstrate that the ATG85 codon of the rat somatic H4 gene functions as an alternative translational initiator.

Translational Initiation at AUG85 Is Supported by Suboptimal Nucleotide Sequence around AUG1-- As in most other higher eukaryotic H4 genes (Table I), the initiation codon of the rat somatic X13554 H4 gene used in this study is followed by a thymidine. Because guanine in this position is the optimal nucleotide for high fidelity translational initiation (26, 27), we hypothesized that translational initiation at AUG85 occurs when ribosomal scanning fails to recognize the AUG1 codon as a translation start site (26, 27). To test this hypothesis, we constructed pSVrH4Delta 87-103CAT(A!/A) (abbreviated A!/A) in which nucleotides flanking the ATG1 codon are substituted from ACTAGGAAGATGT to GCCGCCACCATGG. The latter sequence provides the most optimal environment for translational initiation (27). As shown in Fig. 3C, pSVrH4Delta 87-103CAT(A!/A) transfected into ROS17/2.8 cells gave rise to an increased level of the ~35-kDa CAT protein, accompanied by a decrease in the ~25-kDa CAT form. Thus, optimization of the rat somatic H4 sequence around ATG1 to enhance translational initiation inhibited utilization of the alternative AUG85 initiator, suggesting that translational initiation at AUG85 is attributable primarily to leaky ribosomal scanning through AUG1.

                              
View this table:
[in this window]
[in a new window]
 
Table I
Context of ATG1 and ATG85 of representative H4 genes
The nucleotide sequence flanking the first and 85th codons of representative histone H4 genes are shown for some higher and lower eukaryotic organisms. Horizontal arrows indicate the two genes used in the present study. ATG1 and ATG85 are in bold, as are nucleotides at positions -3 and +4 relative to each ATG (the A being +1). Nucleotides at these positions that do not comply with the (A/G) NNATGG consensus for translational initiation (26, 27) are in lowercase.

Conversion of PreOGP (H4-(85-103)) to OGP (H4-(90-103))-- Translational initiation at AUG85 of H4 genes predicts the synthesis of a 19-amino acid peptide, H4-(85-103), hereby designated PreOGP, which may be converted to OGP by removal of its five amino-terminal residues. To experimentally address this post-translational modification, we followed the fate of synthetic [His18]PreOGP upon incubation with ROS 17/2.8 whole cell lysate. The synthetic PreOGP was tagged with histidine 18 in order to eliminate possible misinterpretation of the results due to the presence of endogenous wild type OGP. HPLC fractions of peptides isolated from the reaction mixture after 1 h of incubation at 37 °C were screened by ELISA with anti-[His13]OGP antibodies. In addition to the [His18]PreOGP substrate eluted at 40 min, two [His13]OGP-immunoreactive peaks were observed (Fig. 4A). The major peak had a retention time of 25 min, identical to that of [His13]OGP, and was confirmed as such by amino acid sequencing. Sequencing of a second, smaller peak, with a retention time of 8.3 min, revealed it was identical to the five carboxyl-terminal residues (positions 15-19) of [His18]PreOGP (i.e. [His102]H4-(99-103)), and this was corroborated by the identical retention time of a synthetic [His102]H4-(99-103) peptide (Fig. 4B). Interestingly, this pentapeptide, known as historphin, has opiate-like and chronotropic effects in heart muscle and intestine (28). Thus, ROS 17/2.8 cells exhibit proteolytic activities capable of converting PreOGP mainly to OGP, and, to a lesser extent, to historphin (OGP-(10-14)).


View larger version (24K):
[in this window]
[in a new window]
 
Fig. 4.   Conversion of PreOGP to OGP. Nine nanomoles of synthetic [His18]PreOGP (i.e. [His102]H4-(85-103)) were incubated with ROS 17/2.8 cell extract (3.4 mg of protein) at 37 °C for 1 h. Peptides were isolated from the reaction mixture and subjected to reverse phase HPLC, followed by ELISA with anti-[His13]OGP antibodies. A, chromatographic fractions eluted at 14-37% acetonitrile were screened for the presence of [His13]OGP and immunoreactive peptides. Similar results were reproduced in four independent experiments. ------, cell extract incubated with [His18]PreOGP; - - -, control extract without exogenously added peptide. B, control reverse phase profile of synthetic [His18]PreOGP (i.e. [His102]H4-(85-103)), [His13]OGP (i.e. [His102]H4-(90-103)) and [His13]OGP-(10-14) (i.e. [His102]H4-(99-103)).

Leaky Ribosomal Scanning of H4-CAT mRNA and Proteolysis of H4-CAT Protein Give Rise to Different Short CAT Products-- Deletion of the PreOGP sequence from the H4-CAT fusion gene did not significantly lessen the amount of the short CAT product relative to the full-length H4-CAT fusion protein (compare the 25.7-kDa product of pSVrH4CAT in Fig. 2B to the short CAT product of pSVrH4Delta 87-103CAT in Fig. 3B). This observation suggests that in the context of full-length H4, the proteolytic site involved in the conversion of PreOGP to OGP (Fig. 4) is inaccessible to proteolytic cleavage. If the site was accessible, then the PreOGP-containing construct, pSVrH4CAT (Fig. 2B), would have yielded a higher short/long CAT ratio, because generation of the short CAT from this construct would have been the consequence of both leaky ribosomal scanning (same as in pSVrH4Delta 87-103CAT) and proteolytic processing of the long CAT. To further test this hypothesis, we constructed pSVrH4CAT(A!/A) (Fig. 5A), containing a full-length H4-CAT gene, in which the nucleotide sequence surrounding ATG1 was altered as in pSVrH4Delta 87-103CAT(A!/A) (Fig. 3) to minimize leaky ribosomal scanning. As shown in Fig. 5B, the optimization of ATG1 resulted in obliteration of the 25.7-kDa CAT-immunoreactive band (single arrowhead) in transfected ROS 17/2.8 cells, suggesting that this protein (probably OGP-CAT) is synthesized primarily via leaky ribosomal scanning, and not by proteolysis of full-length H4-CAT. Thus, the CAT-tagged H4 protein apparently escaped the proteolytic activity demonstrated in Fig. 4 using PreOGP as substrate.


View larger version (36K):
[in this window]
[in a new window]
 
Fig. 5.   Peptides corresponding to the H4 carboxyl terminus are produced by either leaky ribosomal scanning, proteolysis, or both. A, schematic illustration of (i) pSVrH4CAT(A!/A), which differs from pSVrH4CAT (Fig. 2A) in that the nucleotide sequence flanking ATG1 is modified to increase its fidelity as a translational initiator; and (ii) pSVrH4CAT(T/A), an additional derivative of pSVrH4CAT, in which the ATG1 codon is mutated to TTG. The parent pSVrH4CAT construct is shown at the top. Box designations as in Fig. 2A. B, Western blot analysis showing CAT-immunoreactive proteins in ROS 17/2.8 cells transfected with either pSVrH4CAT (lane 1), pSVrH4CAT(A!/A) (lane 2), pSVrH4CAT(T/A) (lane 3), or an unrelated plasmid (lane 4). Double arrowhead indicates the 35-kDa H4-CAT fusion protein. Arrowhead and small arrow mark 25.7-kDa (likely OGP-CAT) and 24.8-kDa (possibly H4-(99-103)CAT) CAT-immunoreactive products, respectively. C, model for biosynthesis of H4 carboxyl-terminal peptides. PreOGP is produced by alternative translational initiation at AUG85, then proteolyzed to yield OGP. OGP is slowly converted to OGP-(10-14) (i.e. H4-(99-103)), which, in addition, can be produced from full-length H4 by proteolytic cleavage. The question marks (?) denote that precise identity of the NH2 termini of the 25.7- and 24.8-kDa proteins have not been established. The CAT derivatives are illustrated to directly reflect the actual data. A and M represent AUG codon and methionine residue, respectively. The H4 and OGP-based synonyms for H4 carboxyl-terminal peptides are presented in the box at the lower left corner.

Unlike the 25.7-kDa OGP-CAT protein, the 24.8-kDa CAT species (Fig. 2B, small arrow) was resistant to sealing of the leaky ATG1. Its retention in cells transfected with pSVrH4CAT(A!/A) (Fig. 5, lane 2) suggests a biosynthetic pathway distinct from that of the 25.7-kDa OGP-CAT, perhaps proteolysis of full-length H4-CAT. To test this possibility, we constructed and transfected cells with pSVrH4CAT(T/A), containing a full-length H4-CAT gene in which ATG1 had been mutated to TTG. As shown in Fig. 5 (lane 3), the expected absence of full-length H4-CAT in these cells is accompanied by specific loss of most, although clearly not all, of the 24.8-kDa CAT form, suggesting that it was indeed generated primarily from H4-CAT by proteolysis. The residual 24.8-kDa CAT form suggests that it may also be produced, to a limited extent, by proteolysis of the 25.7-kDa CAT form. The pathways contributing to production of the 25.7-kDa (OGP-CAT?) and the 24.8-kDa (OGP-(10-14)-CAT?) proteins are schematically illustrated in Fig. 5C.

Cell Type-dependent Ratio between "Long CAT" and "Short CAT" Produced from H4-CAT Fusion Gene-- Because H4 is expressed ubiquitously, it was of interest to assess whether translational initiation at AUG85 would occur in any cell versus the exclusive utilization of the AUG1 codon by selected cell types. pSVrH4Delta 87-103CAT (Fig. 2) was transfected into five randomly selected cell lines, and the ratio between the long and the short CAT forms evaluated by Western blot analysis using anti-CAT antibodies. As shown in Fig. 6, all the cells tested expressed both the long and the short CAT species. ROS 17/2.8 and two other cell lines, DU 145 human prostatic carcinoma cells and CV-1 monkey kidney cells, expressed the full-length H4-CAT protein at levels that are severalfold higher than the expression of the short CAT protein. The short CAT was expressed at levels equal to or higher than the long CAT in NMuNG mouse mammary gland cells and BALB/3T3 mouse embryonic cells, respectively. These results suggest that the dual function of H4 mRNA leading to the biosynthesis of distinct products, is shared by many cells, but the ratio between the two products, H4 and PreOGP, depends significantly on the cell type. The mechanisms responsible for this cell type-specific regulation remain to be explored.


View larger version (38K):
[in this window]
[in a new window]
 
Fig. 6.   Alternative utilization of H4 mRNA as a function of cell type. Five cell lines were each transfected with pSVrH4Delta 87-103CAT (Fig. 3A), and CAT-immunoreactive proteins visualized by Western analysis of cell extracts using anti-CAT antibodies. Double and single arrowheads represent the 35- and 25-kDa CAT-immunoreactive proteins, respectively. Lane 1, purified CAT; lane 2, ROS 17/2.8 osteosarcoma cells; lane 3, NMuMG normal mouse mammary gland cells; lane 4, DU145 prostate cancer cells; lane 5, BALB/3T3 embryonic cells; lane 6, CV1 monkey kidney cells. Similar results were obtained in three independent transfections.


    DISCUSSION
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

OGP is a regulator of cell growth and activity identical to the carboxyl terminus of H4 (H4-(90-103)). Similar to all other histone genes, the H4 genes are present in higher eukaryotes in multiple copies and they typically lack introns (1, 29). All mammalian H4 genes encode the same polypeptide. Significant diversity observed in the third position of most codons as well as outside the protein-coding sequence is assumed to ensure expression in a variety of cells under broad physiological conditions. OGP could be a de novo translational product of any of the multiple H4 gene copies or a post-translational cleavage product of H4 protein. It could also be a product of an H4-related gene or an H4-fragmented gene. The Northern blot analysis carried out herein demonstrated that OGP mRNA(s) is indistinguishable from H4 mRNA(s) (Fig. 1). Furthermore, we altered a rat somatic H4 gene (X13554) at codon 102, and showed that this bona fide H4 gene gave rise to the anticipated OGP mutant in transfected cells (Fig. 1). Since selection of the rat somatic H4 gene, as well as the human H4FO108 gene (see below) was random, our results suggest that OGP is produced from these and probably other H4 genes.

H4-derived constructs, based on either the rat somatic (X13554) or the human H4 FO108 (M16707) genes, in which the H4 coding sequences were fused in frame to the bacterial CAT gene lacking its ATG initiation codon, gave rise to both long and short CAT-containing proteins (Fig. 2), consistent with the production of OGP from H4 genes. By deletion and point mutations of the rat H4-CAT fusion gene, it was demonstrated that production of the long and short proteins depends on ATG1 and ATG85, respectively, suggesting that translation can start at either of these methionine codons (Fig. 3). In addition, we showed that the predicted translation product of the downstream initiation (H4-(85-103)), which we have designated PreOGP, is processed to OGP by a ROS 17/2.8 cell extract (Fig. 4). It therefore appears that the H4 mRNA is translated simultaneously to both H4 protein and PreOGP. The latter is then converted to OGP.

The PreOGP-to-OGP pathway may be mediated by either limited exopeptidase activity or a specific endopeptidase. Either way, a CAT-tagged H4 protein did not serve as a substrate for this activity in transfected cells (Fig. 5), possibly reflecting sequestration of the proteolytic site when residing within a full-length H4 protein sequence. As opposed to H4 proteolysis, de novo synthesis of OGP via alternative translation of H4 mRNA, as suggested by the present study, facilitates the production and secretion of OGP independently of H4 protein synthesis. Furthermore, OGP synthesis by alternative translation avoids production of a truncated H4 protein (amino acids 1-89), which may be undesirable to the cell. Although irrelevant to OGP biosynthesis, our experiments with CAT-tagged H4 genes also disclosed proteolysis of the H4 peptide sequence at a site within the OGP domain (Fig. 5). This activity may be related to the limited production of OGP-(10-14) from PreOGP and/or OGP (Fig. 4). This proteolytic activity seems to favor the full-length H4 over PreOGP or OGP as substrate (Fig. 5). Thus, we propose three previously unidentified processes in H4 gene expression: (i) alternative translational initiation at AUG85, giving rise to PreOGP; (ii) proteolysis between Tyr5 and Ala6 of the PreOGP, thus yielding OGP; and (iii) proteolysis at a further COOH-terminal site, with full-length H4 as the preferred substrate. Possible roles for the latter proteolytic activity include synthesis of OGP-(10-14) and, perhaps, regulation of H4 stability and availability for DNA packaging.

Translational initiation at an AUG codon that is not the first following the transcription start site is uncommon for genes encoding structural proteins but rather frequently observed in genes encoding regulatory polypeptides such as cytokines, receptors, protein kinases, transcription factors, and growth factors (reviewed in Ref. 30). Unlike viral genes, downstream translational initiation of cellular genes usually reflects the presence of an mRNA molecule which starts 3' of the first ATG (reviewed in Ref. 30). However, translational initiation at a downstream AUG codon can also be mediated by internal ribosome entry, which has been demonstrated initially in viral and more recently in cellular genes (see Ref. 31, and references therein). Finally, when the first AUG is weak due to primary sequence context, length, or structure of flanking sequences, initiation at such a site may be "leaky" leading to alternative utilization of a downstream AUG (reviewed in Ref. 30). Translational initiation at AUG85 of H4 mRNAs seems to be mediated primarily by leaky ribosomal scanning through the imperfect sequence context of the AUG1 codon, as evidenced by the inhibition of downstream translational initiation observed following optimization of the suboptimal AUG1 (Figs. 2C and 5). Although alternative translation via a leaky ribosomal scanning is not unprecedented (30), the synthesis of H4 protein and OGP from H4 mRNA is striking in that the two products apparently have diverse functions.

Fidelity of ATG initiators is primarily determined by the nucleotides occupying positions -3 and +4 relative to the A of the ATG, defined as +1. Optimally, these nucleotides should be a purine and a guanine, respectively. Indeed, at least one of them is found in most cellular mRNAs (32). All higher eukaryotic H4 genes known to us, from both animals and plants, have a purine at position -3. However, position +4 is usually occupied by a thymidine, or more rarely by an adenine, but never by a guanine (Table I). Although the combination of a purine at -3 and a thymidine at +4 is still rather efficient in supporting translational initiation, the deviation from the optimal sequence is sufficient to cause some leaky ribosomal scanning, thereby allowing alternative translational initiation at a second AUG (26). Thus, based on sequence analysis, leaky ribosomal scanning through AUG1, demonstrated in the present study for one randomly selected H4 gene, may be a common feature of many, if not, all H4 genes in higher eukaryotes, animals and plants alike. Leaky scanning may be further enhanced in atypical H4 genes with short leaders (33), such as the mouse clone 12 H4 gene (Ref. 34; accession no. X13235). In addition, utilization of the AUG85 codon to initiate translation from any given H4 mRNA may vary as a function of the cell type (Fig. 6) and/or the physiological conditions.

Our results suggest that ATG85 of the rat X13554 H4 gene is utilized as an alternative translational initiator to the suboptimally flanked AUG1 codon. AUG85 itself resides within an optimal context for translational initiation, not only in this specific gene, but almost in every eukaryotic H4 gene (Table I). Thus, the combination of a suboptimal AUG1 and an optimal ATG85 appears to be a hallmark of higher eukaryotic H4 genes, lending support to the hypothesis that OGP synthesis by alternative translation of H4 genes occurs in many eukaryotic organisms and may have an important evolutionary conserved role(s). Interestingly, the 85th residue of Styela plicata, as well as most lower eukaryotic H4 genes, is a leucine (Table I), demonstrating that a methionine in this position is not imposed by structural requirements for DNA packaging. It is tempting to speculate that the selection of H4-AUG85 by higher eukaryotes is related to mechanisms in these organisms, versus others (35) that allow leaky ribosomal scanning through imperfect 5' proximal initiators. That OGP is ubiquitously expressed in higher eukaryotic cells is suggested not only by sequence analysis of H4 genes, but also by the identification of OGP in conditioned medium of all cell lines thus far tested: MC3T3-E1 osteoblasts, NIH3T3 fibroblasts (10) and ROS 17/2.8 osteosarcoma cells (this paper). This conclusion is further supported by the demonstration of long and short CAT forms produced from an H4-CAT fusion gene in five randomly selected cell types from different species (Fig. 6). Still, the variation in the long/short CAT ratio exhibited by these cells may suggest preferential expression of OGP by certain cell types. In terms of biological activity, however, OGP production is probably just one component in a complex regulatory system, where additional factors, such as receptors for OGP and their connections with intracellular signaling networks, are most likely involved in determining the OGP target cell selectivity and the nature of the cellular response.

In summary, as suggested by sequence analysis of eukaryotic H4 genes, the present study demonstrates some leaky ribosomal scanning through AUG1 of H4 mRNA, resulting in alternative translational initiation at AUG85.The predicted alternative translation product, H4-(85-103) has been designated PreOGP, as it is proteolytically processed to OGP (e.g. H4-(90-103)), a circulating peptide that regulates cell growth and activity. This biosynthetic mechanism, apparently operative in many, if not all, eukaryotic cycling cells, may play a crucial role in the previously reported positive feedback circuit of OGP, which controls cell proliferation (10, 12), as well as in the linkage between cell growth and differentiation.

    ACKNOWLEDGEMENTS

We thank Drs. Janet Stein, Jane Lian, and especially Dr. Andrè van Wijnen for critical comments, Lian Liang and Rebecca Redman for technical assistance, and Diane Gegala for secretarial support.

    FOOTNOTES

* This work was supported by the Small Grant Program of University of Massachusetts Medical Center, by Grant IRG-58-007-40 from the American Cancer Society, by a faculty developmental grant from Merrimack College, and by Grant 6305194 from the Ministry of Science and The Arts, Government of Israel.The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

Dagger Dagger To whom correspondence should be addressed: Inst. for Genetic Medicine, University of Southern California School of Medicine, 2250 Alcazar St., CSC/IGM240, Los Angeles, CA 90033. Tel.: 323-442-1322; Fax: 323-442-2764; E-mail: frenkel{at}hsc.usc.edu.

    ABBREVIATIONS

The abbreviations used are: OGP, osteogenic growth peptide; PreOGP, 19-amino acid peptide, H4-(85-103); CAT, chloramphenicol acetyltransferase; FBS, fetal bovine serum; DMEM, Dulbecco's modified Eagle's medium; HPLC, high performance liquid chromatography; ELISA, enzyme-linked immunosorbent assay; PCR<, polymerase chain reaction..

    REFERENCES
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES
  1. Doenecke, D., Albig, W., Bode, C., Drabent, B., Franke, K., Gavenis, K., and Witt, O. (1997) Histochem. Cell Biol. 107, 1-10[CrossRef][Medline] [Order article via Infotrieve]
  2. Akhmanova, A., Miedema, K., and Hennig, W. (1996) FEBS Lett. 388, 219-222[CrossRef][Medline] [Order article via Infotrieve]
  3. Multigner, L., Gagnon, J., Van-Dorselaer, A., and Job, D. (1992) Nature 360, 33-39[CrossRef][Medline] [Order article via Infotrieve]
  4. Class, R., Lindman, S., Fassbender, C., Leinenbach, H., P., Rawer, S., Enrich, J., G., Brady, L. W., and Zeppezauer, M. (1996) Am. J. Clin. Oncol. 19, 522-531[CrossRef][Medline] [Order article via Infotrieve]
  5. Watabe, Y., Kuramochi, H., Furuya, Y., Inagaki, N., Seino, S., Kimura, S., and Shimazaki, J. (1996) J. Biol. Chem. 271, 25126-25130[Abstract/Free Full Text]
  6. Kim, H. S., Park, C. B., Kim, M. S., and Kim, S. C. (1996) Biochem. Biophys. Res. Commun. 229, 381-387[CrossRef][Medline] [Order article via Infotrieve]
  7. Louters, L. L., Michele, D. E., and Pearson, J. D. (1996) Biochimie 78, 39-45[Medline] [Order article via Infotrieve]
  8. Bab, I., Gazit, D., Chorev, M., Muhlrad, A., Shteyer, A., Greenberg, Z., Namdar, M., and Kahn, A. (1992) EMBO J. 11, 1867-1873[Medline] [Order article via Infotrieve]
  9. Greenberg, Z., Chorev, M., Muhlrad, A., Shteyer, A., Namdar-Attar, M., Casap, N., Tartakovsky, A., Vidson, M., and Bab, I. (1995) J. Clin. Endocrinol. Metab. 80, 2330-2335[Abstract]
  10. Greenberg, Z., Gavish, H., Muhlrad, A., Chorev, M., Shteyer, A, AttarNamdar, M., Tartakovsky, A., and Bab, I. (1997) J. Cell. Biochem. 65, 359-367[CrossRef][Medline] [Order article via Infotrieve]
  11. Robinson, D., Bab, I., and Nevo, Z. (1995) J. Bone Miner. Res. 10, 690-696[Medline] [Order article via Infotrieve]
  12. Gurevitch, O., Slavin, S., Muhlrad, A., Shteyer, A., Gazit, D., Chorev, M., Vidson, M., Namdar-Attar, M., Berger, E., Bleiberg, I., and Bab, I. (1996) Blood 88, 4719-4724[Abstract/Free Full Text]
  13. Wolfe, S. A., Anderson, J. V., Grimes, S. R., Stein, G. S., and Stein, J. S. (1989) Biochim. Biophys. Acta 1007, 140-150[Medline] [Order article via Infotrieve]
  14. Gorman, C. M., Moffat, L. F., and Howard, B. H. (1982) Mol. Cell. Biol. 2, 1044-1051[Abstract/Free Full Text]
  15. Pauli, U., Chrysogelos, S., Stein, G., Stein, J., and Nick, H. (1987) Science 236, 1308-1311[Abstract/Free Full Text]
  16. Majeska, R. J., Rodan, S. B., and Rodan, G. A. (1980) Endocrinology 107, 1494-1503[Abstract/Free Full Text]
  17. Maiyar, A. C., Huang, A. J., Phu, P. T., Cha, H. H., and Firestone, G. L. (1996) J. Biol. Chem. 271, 12414-12422[Abstract/Free Full Text]
  18. Schuur, E. R., Henderson, G. A., Kmetec, L. A., Miller, J. D., Lamparski, H. G., and Henderson, D. R. (1996) J. Biol. Chem. 271, 7043-7051[Abstract/Free Full Text]
  19. Kogerman, P., Sy, M. S., and Culp, L. A. (1998) Clin. Exp. Metastasis 16, 83-93[CrossRef][Medline] [Order article via Infotrieve]
  20. Brinkmeier, M. L., Gordon, D. F., Dowding, J. M., Saunders, T. L., Kendall, S. K., Sarapura, V. D., Wood, W. M., Ridgway, E. C., and Camper, S. A. (1998) Mol. Endocrinol. 12, 622-63321[Abstract/Free Full Text]
  21. Chen, C., and Okayama, H. (1987) Mol. Cell. Biol. 7, 2745-2752[Abstract/Free Full Text]
  22. Frenkel, B., Montecino, M., Green, J., Aslam, F., Desai, R., Banerjee, C., Stein, J. L., Lian, J. B., and Stein, G. S. (1996) Endocrinology 137, 1080-1088[Abstract]
  23. Chomezynski, P., and Sacchi, N. (1987) Anal. Biochem. 162, 156-159[Medline] [Order article via Infotrieve]
  24. Lathe, R. (1985) J. Mol. Biol. 183, 1-12[CrossRef][Medline] [Order article via Infotrieve]
  25. Barany, G., and Merrifield, R. B. (1979) in The Peptides/1 (Gross, E., and Meienhofer, J., eds), pp. 1-284, Academic Press, New York
  26. Kozak, M. (1986) Cell 44, 283-292[CrossRef][Medline] [Order article via Infotrieve]
  27. Kozak, M. (1989) Mol. Cell. Biol. 9, 5073-5080[Abstract/Free Full Text]
  28. Kharchenko, E. P., Bagrov, A. I., and Sokolova, T. V (1987) Biulleten Eksperimentalnoi Biologii i Meditsiny 103, 418-20[CrossRef][Medline] [Order article via Infotrieve]
  29. Wells, D., and McBride, C. (1989) Nucleic Acids Res. 17 (suppl.), 311-346
  30. Kozak, M. (1991) J. Cell Biol. 115, 887-903[Abstract/Free Full Text]
  31. Gan, W., La Celle, M., and Rhoads, R. E. (1998) J. Biol. Chem. 273, 5006-5012[Abstract/Free Full Text]
  32. Kozak, M. (1987) Nucleic Acids Res. 15, 8125-8148[Abstract/Free Full Text]
  33. Kozak, M. (1991) Gene Exp. 1, 111-115
  34. Meier, V. S., Bohni, R., and Schumperli, D. (1989) Nucleic Acids Res. 17, 795[Free Full Text]
  35. Merrick, W. C., and Hershey, J. W. B. (1996) in Translational Control (Hershey, J. W. B., Mathews, M., and Sonenberg, N., eds), pp. 31-69, Cold Spring Harbor Press, Cold Spring Harbor, NY


Copyright © 1999 by The American Society for Biochemistry and Molecular Biology, Inc.
Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
RNAHome page
D. Matsuda and T. W. Dreher
Close spacing of AUG initiation codons confers dicistronic character on a eukaryotic mRNA
RNA, July 1, 2006; 12(7): 1338 - 1349.
[Abstract] [Full Text] [PDF]


Home page
Nucleic Acids ResHome page
E. Smith, T. E. Meyerrose, T. Kohler, M. Namdar-Attar, N. Bab, O. Lahat, T. Noh, J. Li, M. W. Karaman, J. G. Hacia, et al.
Leaky ribosomal scanning in mammalian genomes: significance of histone H4 alternative translation in vivo
Nucleic Acids Res., March 1, 2005; 33(4): 1298 - 1308.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
M. M. Martin, B. M. Willardson, G. F. Burton, C. R. White, J. N. McLaughlin, S. M. Bray, J. W. Ogilvie Jr., and T. S. Elton
Human Angiotensin II Type 1 Receptor Isoforms Encoded by Messenger RNA Splice Variants Are Functionally Distinct
Mol. Endocrinol., February 1, 2001; 15(2): 281 - 293.
[Abstract] [Full Text]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Bab, I.
Right arrow Articles by Frenkel, B.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Bab, I.
Right arrow Articles by Frenkel, B.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 All ASBMB Journals   Molecular and Cellular Proteomics 
 Journal of Lipid Research   ASBMB Today 
Copyright © 1999 by the American Society for Biochemistry and Molecular Biology.
Advertisement
spacer
Advertisement
Advertisement