![]()
|
|
||||||||
J Biol Chem, Vol. 274, Issue 21, 14831-14837, May 21, 1999
,
,
**
From the Departments of
Pharmacology and
Biochemistry, University of Texas Southwestern Medical Center,
Dallas, Texas 75235-9041, the § Department of Food
Science, Cook College, Rutgers University,
New Brunswick, New Jersey 08901-8520, and the ¶ Department of
Biochemistry, A. B. Chandler Medical Center, University of
Kentucky College of Medicine, Lexington, Kentucky 40536
| |
ABSTRACT |
|---|
|
|
|---|
Two genes in Saccharomyces
cerevisiae, LPP1 and DPP1, with homology
to a mammalian phosphatidic acid (PA) phosphatase were identified and
disrupted. Neither single nor combined deletions resulted in growth or
secretion phenotypes. As observed previously (Toke, D. A.,
Bennett, W. L., Dillon, D. A., Wu, W.-I., Chen, X.,
Ostrander, D. B., Oshiro, J., Cremesti, A., Voelker, D. R., Fischl, A. S., and Carman, G. M. (1998) J. Biol.
Chem. 273, 3278-3284; Toke, D. A., Bennett, W. L.,
Oshiro, J., Wu, W.-I., Voelker, D. R., and Carman, G. M. (1998) J. Biol. Chem. 273, 14331-14338), the
disruption of DPP1 and LPP1 produced profound
losses of Mg2+-independent PA phosphatase activity. The
coincident attenuation of hydrolytic activity against diacylglycerol
pyrophosphate prompted an examination of the effects of these
disruptions on hydrolysis of isoprenoid pyrophosphates. Disruption of
either LPP1 or DPP1 caused respective decreases
of about 25 and 75% in Mg2+-independent hydrolysis of
several isoprenoid phosphates by particulate fractions isolated from
these cells. The particulate and cytosolic fractions from the double
disruption (lpp1 Phosphorylated lipids serve diverse roles in cellular metabolism,
including signal transduction, membrane biosynthesis, and energy
storage. These lipid phosphates are created through direct phosphorylation of lipids by lipid kinases such as diacylglycerol kinase and dolichol kinase which produce phosphatidic acid
(PA)1 and dolichyl
monophosphate (dolichyl-P), respectively. Alternatively, these
molecules can be formed by degradation of precursor molecules as in the
hydrolysis of phospholipids by phospholipase D to form PA or the
transfer of oligosaccharides from a dolichol carrier to produce
dolichyl pyrophosphate (dolichyl-P-P) or dolichyl-P (1). The
phosphorylated lipids can be metabolized by several phosphatases or
used in synthetic reactions to produce a variety of phospholipids or
dolichyl oligosaccharides (2-6).
PA serves as both a signaling molecule and as an important precursor of
several phospholipids. In signal transduction, PA, created by the
action of phospholipase D, may act directly as a second messenger or be
hydrolyzed to diacylglycerol, another well characterized signaling
molecule. At least two types of phosphatase activity can metabolize PA.
A type I activity is dependent on Mg2+ and inhibited by
N-ethylmaleimide, whereas a type II activity is independent
of Mg2+ and insensitive to the alkylating agent (3). The
type I activity in Saccharomyces cerevisiae is found in both
cytosolic and particulate fractions (7, 8). The activity in the
particulate fraction has been purified to apparent homogeneity and
corresponds to two integral membrane proteins with molecular masses of
104 and 45 kDa (9). Although these activities have been characterized extensively (9-13), the genes encoding the enzymes responsible have
not been identified.
The characterization of type II PA-phosphatase activities is more
advanced. The purification of a type II activity from the particulate
fraction of porcine thymus led to the isolation of a corresponding
cDNA from mouse kidney (14). Yeast also contains type II activities
associated with a particulate fraction (15). In S. cerevisiae, two genes have been identified that have similar hydropathy profiles and are homologous to the mammalian enzyme. The
conservation of amino acid sequence is particularly strong in three
regions thought to form the active site of the enzymes (4, 16-18). One
of the type II activities in yeast also hydrolyzed diacylglycerol
pyrophosphate (diacylglycerol-P-P) and was purified to homogeneity on
the basis of this activity (19). This enzyme proved to be one of the
identified yeast homologs (YDR284C) and has been designated
diacylglycerol-pyrophosphate phosphatase, Dpp1p. Although identified as
a pyrophosphatase, Dpp1p can further metabolize the PA formed to
diacylglycerol, albeit with lower catalytic efficiency (19). Dpp1p,
along with other enzymes that hydrolyze diacylglycerol-P-P, act on a
variety of lipid monophosphates including lysophosphatidic acid (LPA),
ceramide phosphate, sphingosine 1-phosphate, and phosphatidylglycerol
phosphate (19-21).
The second homolog from yeast (lipid phosphate phosphatase,
LPP1, YDR503c), also has broad specificity as demonstrated
by hydrolysis of PA, LPA, and diacylglycerol-P-P (15). A type II PA
phosphatase from rat liver was similar in its ability to hydrolyze many
different phosphorylated lipid substrates including those listed for
Dpp1p (21-23). Further evidence indicated that this mammalian activity
could hydrolyze dolichyl-P (23). The existence of a relatively
non-selective lipid phosphatase was also suggested by observations that
Mg2+-independent dolichyl-P phosphatase activities from
mammalian sources were inhibited by PA and LPA (24, 25). Furthermore, a
dolichyl-P phosphatase that was purified to apparent homogeneity from
the particulate fraction of porcine brain used both dolichyl-P and PA
with similar catalytic efficiency (26).
This evidence and the knowledge that the yeast enzymes use multiple
substrates suggested that DPP1 and/or LPP1 may
catalyze hydrolysis of phosphorylated and pyrophosphorylated
isoprenoids. Here, evidence for such activities and their virtual
absence after disruption of LPP1 and DPP1 is
presented and discussed.
General Reagents and Methods--
All chemicals were reagent
grade. Radiochemicals, unless noted, and EN3HANCE were from
NEN Life Science Products. Triton X-100, isopentyl alcohol, isopentyl
pyrophosphate, farnesol, farnesyl pyrophosphate, geraniol, geranyl
pyrophosphate, geranylgeranyl pyrophosphate, and bovine serum albumin
were purchased from Sigma. Other reagents were obtained from the
sources indicated: Silica Gel 60 thin layer chromatography plates (EM
Science), Silica Gel-loaded SG81 chromatography paper (Whatman, Inc.),
[3H]farnesyl pyrophosphate (60 mCi/mmol), and
[3H]geranylgeranyl pyrophosphate (American Radiolabeled
Chemicals, Inc.), Tran35S-label (ICN Biochemicals),
Zymolase 100-T (Seikagaku Kogyo Co.), Glusulase (DuPont), and
oligonucleotide primers (Genosys). Molecular biology reagents were from
New England Biolabs unless otherwise noted. Protein concentration was
determined by described methods (27, 28) using bovine serum albumin as
the standard.
Yeast Media and Methods--
S. cerevisiae were
propagated in yeast extract/peptone/dextrose (YPD) or yeast nitrogen
broth (YNB) supplemented with amino acids as required. Mating,
sporulation, and other standard techniques used established methods
(29). The strains used are presented in Table I. Yeast total genomic
DNA was isolated after disruption of cells with glass beads (30).
Immunoprecipitation of carboxypeptidase Y was done as described
(31).
Isolation of LPP1 (ORF YDR503C) and DPP1 (ORF YDR284C)--
Two
yeast homologs of a mouse Mg2+-independent PA phosphatase
(14), corresponding to yeast open reading frames YDR503C and YDR284C,
were found by searching the Stanford University Saccharomyces Genome
Data base.2 During the course
of this study, these genes became known as LPP1 and
DPP1, respectively (15, 32).
LPP1 and DPP1 were amplified with total genomic DNA from yeast strain
SEY6210 using VentR® DNA Polymerase (New England Biolabs), supplied buffers, and 5% Me2SO. Oligonucleotide
primers for LPP1 (YDR503C)
(5'GTTAGGATCCGTCTGTTATCGTGGCTATTGCTCTA3' and
5'CGCGGAATTCGATCAGGTAAGCTATGCATAATGTC3') contained BamHI and
EcoRI sites for insertion into the Bluescript SK+ vector
(pBSK(+), Stratagene). Primers used to amplify DPP1 (YDR284C) (5'TTAAGAGCTCGGGAATAAACTGTTATCTAGGGTCC3' and
5'TACGCTGCAGAAAGTGATGTTGGGATTGTCCGATG3') contained
SacI and PstI sites for insertion into pBSK(+).
Amplified products were verified by sequencing.
Disruption of LPP1 and DPP1--
The LPP1 ORF in
pBSK(+) was cut with AvrII and filled by treatment with
Klenow fragment. The kanMX module (33), encoding the
NEOr gene, was inserted. The DPP1 ORF
in pBSK was digested with BbsI and BamHI to
remove the coding sequence for amino acids 73-275. After treatment
with Klenow fragment, a HIS3 gene (imidazole-glycerol phosphate dehydratase) and promoter were inserted. A plasmid containing the HIS3 gene and promoter was a gift of Hiroko Hama (Utah
State University). The construct for LPP1::Neo
disruption was excised from pBSK with BamHI and
EcoRI, whereas the construct for
DPP1::HIS3 disruption was amplified from pBSK
using the primers described above. These DNA fragments were used to
transform yeast with the LiAc method (34); colonies were selected on
the appropriate media, and total genomic DNA was isolated for analysis.
Oligonucleotide primers outside of the recombination sites were used
for amplification of the recombination locus by polymerase chain
reaction with Taq® DNA Polymerase (Roche Molecular
Biochemicals), and the products were analyzed for predicted digestion
patterns. Double disruptions were created by performing the disruption
of DPP1 in yeast containing a confirmed LPP1 disruption.
Preparation of Particulate and Cytosolic Fractions from Yeast
Strains--
Yeast cells were grown in YPD to an
A600 of approximately 1.0, and spheroplasts were
formed by treatment at 30 °C with Zymolase (1 µg/A).
All subsequent steps were performed at 4 °C. The spheroplasts were
disrupted with glass beads (0.15-0.25 mm diameter) by vigorous mixing
in a buffer consisting of 10 mM Tris-Cl (pH 7.5), 1 mM EDTA, and 1 mM dithiothreitol. Beads and
unbroken cells were sedimented by centrifugation for 5 min at 500 × g. The homogenate was separated by centrifugation for 60 min at 100,000 × g into supernatant (cytosol) and
particulate fractions. The particulate fraction was resuspended in the
same buffer by homogenization with a 22-gauge needle and syringe.
Fractions were frozen in liquid nitrogen and stored at Purification of Dpp1p--
Dpp1p (diacylglycerol-P-P
phosphatase) was purified from wild-type S. cerevisiae as
described by Wu et al. (19).
Preparation of Substrates--
[32P]PA was
synthesized from diolene and [ Enzyme Assays--
PA phosphatase activity was measured using
micelles formed by sonication of a mixture containing 500 µM dioleoyl-PA, [32P]dioleoyl-PA
(1000-2000 cpm/nmol), and 0.5% Triton X-100. Reactions were performed
for 30 min at 30 °C in 50 µl of 100 mM MES (pH 6.5), 1 mM EDTA, 1 mM EGTA, and 1 mM
dithiothreitol. Assays were stopped with 200 µl of 10%
trichloroacetic acid and 100 µl of 1% bovine serum albumen, mixed
vigorously, and spun for 10 min at 4500 × g (Beckman
J-6). An aliquot (290 µl) of the resulting supernatant was removed
and analyzed for released inorganic phosphate by liquid scintillation
counting. This assay was modified from a previous description (35,
38).
Dolichyl-P phosphatase activity was measured basically as described
(39). A mixture of unlabeled dolichyl-P (500 µM) and dolichyl-[32P]P (50 cpm/pmol) was dispersed by
ultrasonication in 1% Triton X-100. This substrate was mixed with the
source of enzyme activity in buffer A (50 mM Tris-Cl (pH
7.4), 3 mM EDTA) to a total volume of 50 µl. The final
concentration of substrate was 50 µM dolichyl-P and 0.1%
Triton X-100. After incubation for 30 min at 30 °C, reactions were
stopped by extraction with organic solvent (39) or with trichloroacetic
acid and bovine serum albumin as described for the assay of PA
phosphatase. Released phosphate was determined by liquid scintillation counting.
Dolichyl-P-P phosphatase activity was measured as described (37), but
with the following modifications. Dolichyl-P-P (100 µM)
and [
Farnesyl pyrophosphate (farnesyl-P-P) and geranylgeranyl-P-P
phosphatase activities were measured as follows. Enzymatic reactions (20 µl) contained buffer A, the source of activity, 0.1% Triton X-100, and 0.4 µmol of either [3H]farnesyl-P-P (500 cpm/pmol) or [3H]geranylgeranyl-P-P (500 cpm/pmol).
Lipids were initially dispersed in 1% Triton X-100 by sonication.
Following incubation for 5 min at 30 °C, enzymatic reactions were
stopped by the addition of 80 µl of methanol. Insoluble material was
sedimented by centrifugation. The supernatant was removed, dried under
a stream of nitrogen gas, dissolved in 20 µl of water-saturated
butanol, and chromatographed on Silica Gel G60 thin layer plates using
a mobile phase consisting of isopropyl alcohol/NH4OH/water
(6:3:1). Appropriate standards were co-chromatographed for
identification of substrate and products. Developed plates were
air-dried and scanned for radioactivity using a Bioscan Imaging System
200-IBM.
Hydrolysis of diacylglycerol-P-P by purified Dpp1p was measured by
following the release of water-soluble [32P]phosphate
from chloroform-soluble [
Mannosylphosphoryldolichol synthase (Man-P-Dol synthase) activity was
assayed, and initial rates were determined as described previously
(41).
Two Genes from Yeast Encoding Putative Homologs of a Mouse
Mg2+-independent PA Phosphatase Gene--
Two putative
yeast proteins (YDR503c and YDR284c) with 49% similarity at the amino
acid level to the published sequence for a mouse
Mg2+-independent PA phosphatase (14) were identified in the
S. cerevisiae genome. During the course of this study, these
genes were termed LPP1 (lipid phosphate phosphatase) and
DPP1 (diacylglycerol-pyrophosphate phosphatase),
respectively (15, 32). The amino acid sequences of LPP1 and
DPP1 are 51% similar and 26% identical to each other. The
proteins encoded by these three genes share a common hydropathy plot
(14, 42), which suggests up to six potential membrane-spanning segments. They belong to a broader family of eukaryotic and prokaryotic proteins, which share significant amino acid identity in three distinct
regions, and are all thought to be acid phosphatases that use
phosphorylated lipids and/or carbohydrates as substrates (16-18).
Growth of Yeast with Disrupted LPP1 and DPP1--
LPP1
and DPP1 were disrupted both singly and in combination. This
was done in both MATa (SEY6211) and MAT Mg2+-independent and
Mg2+-dependent PA Phosphatase in the Wild-type
and Disrupted Strains--
Biochemical analysis of cellular extracts
revealed substantial changes in lipid phosphatase activities in the
disrupted strains. Particulate fractions prepared from
lpp1 The Disruption of LPP1 and DPP1 Caused Decreases in the
Dephosphorylation of Substrates Other Than PA--
Particulate
fractions from wild-type yeast dephosphorylated both dolichyl-P and
dolichyl-P-P in the absence of Mg2+ (Fig.
2A). The rates of hydrolysis
of dolichyl-P (1.2 nmol/min/mg) and dolichyl-P-P (0.5 nmol/min/mg) were
substantial albeit less than for PA (3.1 nmol/min/mg). Rates of
dephosphorylation of dolichyl-P catalyzed by the particulate fractions
prepared from lpp1
Since dolichyl-P-P phosphatase activity was diminished in the
particulate fraction of the yeast strains where the genes
LPP1 and DPP1 were disrupted, two other
biologically relevant isoprenoid pyrophosphates, farnesyl-P-P and
geranylgeranyl-P-P, were examined. When compared with the wild-type
strain, the decreases in rates of hydrolysis of farnesyl-P-P and
geranylgeranyl-P-P paralleled the decreases in the hydrolysis of
dolichyl-P-P by the particulate fractions from lpp1 Examination of the Lipid Phosphatase Activity in the
Cytosol--
The vast majority of Mg2+-independent lipid
phosphatase activity (for PA, dolichyl-P, and dolichyl-P-P) was found
in particulate fractions (>95%, data not shown). In contrast, the PA
phosphatase activity in the cytosol of yeast has been reported to be
Mg2+-dependent (7, 8). The addition of
Mg2+ to cytosol from the wild-type strain of yeast produced
a robust stimulation (8.5-fold) of PA phosphatase activity (Fig.
1C). Similar amounts of
Mg2+-dependent PA phosphatase activity were
observed in the cytosol from the lpp1 Comparison of Man-P-Dol Synthase Activity in Wild-type and Mutant
Strains--
The reduction in hydrolytic activity for dolichyl
phosphates in the double mutant raises the possibility that the pools
of these lipids might be altered. The enzymatic transfer of
[3H]mannose from GDP-[3H]mannose to
endogenous dolichyl-P was used to assess the cellular pool of the
isoprenoid monophosphate accessible to Man-P-Dol synthase in
particulate fractions from wild-type and disrupted strains of yeast.
The initial rates and extents of this reaction catalyzed by Man-P-Dol
synthase were indistinguishable in the particulate fractions derived
from the various strains (data not shown). These results suggest that
the disruption of LPP1 and/or DPP1 does not affect the endogenous pool of dolichyl-P.
Specificity of Purified Dpp1p for Isoprenoid Compounds--
The
recognition of various isoprenyl phosphate esters by purified Dpp1p was
tested by competition for hydrolysis of diacylglycerol-P-P at
subsaturating concentrations. In this manner, either inhibitory or
stimulatory effects on enzyme activity could be observed. Isopentenyl pyrophosphate (IC50 = 1.92 mol %), geranyl pyrophosphate
(IC50 = 0.43 mol %), farnesyl-P-P (IC50 = 0.29 mol %), and geranylgeranyl-P-P (IC50 = 0.26 mol %)
inhibited diacylglycerol-P-P phosphatase activity with potencies that
increase with the chain length of the isoprenoid. In contrast,
diacylglycerol-pyrophosphate phosphatase activity was not affected by
the alcohol derivatives of these isoprenoid compounds indicating that
inhibition was dependent on the presence of the pyrophosphate moieties
(Fig. 5).
A kinetic analysis of hydrolysis of diacylglycerol-P-P by Dpp1p
exhibited saturation kinetics in both the absence and presence of
farnesyl-P-P (Fig. 6A) or
geranylgeranyl-P-P (Fig. 6B). Each of the isoprenoid
compounds affected the apparent Km value for
diacylglycerol-P-P phosphatase activity but had no effect on
Vmax. These results are consistent with
farnesyl-P-P and geranylgeranyl-P-P being competitive inhibitors of
diacylglycerol-P-P phosphatase. Replots of the data in Fig. 6 were
linear and were used to calculate Ki values for
farnesyl-P-P and geranylgeranyl-P-P of 0.3 and 0.1 mol %,
respectively.
Dephosphorylation of Geranylgeranyl Pyrophosphate by
Dpp1p--
The action of geranylgeranyl-P-P as a competitive inhibitor
of diacylglycerol-P-P phosphatase activity and the attenuation of
hydrolytic activity for this molecule by disruption of DPP1 and LPP1 indicated that Dpp1p would utilize
geranylgeranyl-P-P as a substrate. Therefore, the formation of
geranylgeranyl-P from geranylgeranyl-P-P was assessed using substrate
labeled in the geranyl moiety of the compound. Indeed, the
diacylglycerol-P-P phosphatase enzyme catalyzed a
time-dependent dephosphorylation of geranylgeranyl-P-P
(Fig. 7A). The production of
geranylgeranyl-P was linear for 30 min. After this time the apparent
production of geranylgeranyl-P was reduced, whereas production of
geranylgeraniol increased (data not shown). This indicated that the
enzyme could also catalyze the dephosphorylation of geranylgeranyl
phosphate. The effect of pH on the geranylgeranyl-P-P phosphatase
reaction is shown in Fig. 7B. The enzyme exhibited a pH
optimum between 5.0 and 5.5.
The dependence of geranylgeranyl-P-P phosphatase activity on the
concentration of geranylgeranyl-P-P was examined using mixed micelles
of Triton X-100 and geranylgeranyl-P-P. The concentration of the
substrate was expressed as a surface concentration (in mol %). The
enzyme catalyzed a dose-dependent dephosphorylation of
geranylgeranyl-P-P and exhibited saturation kinetics (Fig. 7C). A double-reciprocal plot of the data was linear and was
used to calculate a Vmax of 90 units/mg and a
Km of 0.18 mol %. This compares with reported
Vmax and Km values for diacylglycerol-P-P of 172 units/mg (at pH 6.5) and 0.55 mol % (19).
However, subsequent studies have determined the pH optimum of Dpp1p for
diacylglycerol-P-P to be 5.0 and the Vmax at
this pH is 260 units/mg.3.
Thus, at their pH optima, the specificity constants
(Vmax/Km) for
diacylglycerol-P-P and geranylgeranyl-P-P are 472 and 500, respectively, indicating that both are equally good substrates for the enzyme.
Two genes with homology to a Mg2+-independent PA
phosphatase from mouse were identified in the S. cerevisiae
genome. The disruption of these genes produced dramatic reductions in
the amount of Mg2+-independent PA phosphatase activity in
lysates and particulate fractions from the mutant strains. Consistent
with previous studies (15, 32), these data indicate that the two genes,
DPP1 and LPP1, account for most of the
Mg2+-independent PA phosphatase activity in yeast. The
predominant association of these activities with particulate fractions
is consistent with the predicted structure of the two proteins.
Enzymes identified as PA hydrolases have been shown to dephosphorylate
several other lipid phosphates (4, 14, 19-21, 32, 43, 44). Purified
Dpp1p was further shown to first remove the Several functions could be attributed to these isoprenoid phosphatases.
Conversion of polyisoprenyl pyrophosphates to monophosphates could be
required for the re-cycling of the carrier lipid for another round of
lipid intermediate synthesis when dolichyl-P-P is released during
primary N-glycosylation of proteins. A
polyisoprenyl-pyrophosphate phosphatase would also be necessary for the
dephosphorylation of the long chain polyisoprenyl pyrophosphate
intermediate formed in the de novo pathway for dolichyl-P
biosynthesis prior to the reduction of the Considering the important roles for dolichyl-P-P and dolichyl-P
phosphatases, and the large attenuation of hydrolytic activity for
dolichyl-P and, especially, dolichyl-P-P, it is surprising that defects
in glycosylation or changes in the accessible dolichyl-P pool were not
observed in the lpp1 The reductions in the rates of dephosphorylation of farnesyl-P-P and
geranylgeranyl-P-P in the disrupted strains are also intriguing.
Previous data have shown that levels of diacylglycerol-P-P increase in
yeast membranes when DPP1 is disrupted (32). It remains to
be determined if comparable increases in the isoprenyl substrates
(including dolichyl-P-P) are characteristics of the lpp1 Interestingly, a "salvage pathway" for farnesol and geranylgeraniol
has been described recently in mammalian cells that can allow the free
isoprenols to be re-utilized for protein isoprenylation (51) presumably
after conversion to the isoprenyl phosphates. Although similar kinase
activities are not described in yeast, their presence in mammalian
cells may indicate that there are pools of farnesol and geranylgeraniol
that must be phosphorylated to be used by the cell. The free isoprenols
could be formed in yeast by the combined action of the phosphatases
described here or perhaps by the "turnover" of isoprenylated
proteins. The metabolic balance in dephosphorylation and
rephosphorylation of farnesyl-P-P and geranylgeranyl-P-P could play a
role in the regulation of their cellular levels.
dpp1
) showed essentially complete
loss of Mg2+-independent hydrolytic activity toward
dolichyl phosphate (dolichyl-P), dolichyl pyrophosphate (dolichyl-P-P),
farnesyl pyrophosphate (farnesyl-P-P), and geranylgeranyl pyrophosphate
(geranylgeranyl-P-P). However, a modest Mg2+-stimulated
activity toward PA and dolichyl-P was retained in cytosol from
lpp1
dpp1
cells. The action of Dpp1p on
isoprenyl pyrophosphates was confirmed by characterization of the
hydrolysis of geranylgeranyl-P-P by the purified protein. These results
indicate that LPP1 and DPP1 account for most of
the hydrolytic activities toward dolichyl-P-P, dolichyl-P,
farnesyl-P-P, and geranylgeranyl-P-P but also suggest that yeast
contain other enzymes capable of dephosphorylating these essential
isoprenoid intermediates.
![]()
INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES
![]()
EXPERIMENTAL PROCEDURES
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES
70 °C.
-32P]ATP using
diacylglycerol kinase from Escherichia coli (35).
[32P]Dolichyl-P was synthesized chemically (36).
[
-32P]Dolichyl-P-P and unlabeled dolichyl-P-P were
prepared by chemical synthesis from dolichyl-P (37). Diacylglycerol-P-P
and [
-32P]diacylglycerol-P-P were synthesized
enzymatically using purified Catharanthus roseus
phosphatidate kinase as described (19).
-32P]dolichyl-P-P (approximately 200 cpm/pmol)
were dispersed by sonication with 1% Triton X-100. Reactions were
performed in 50 µl of buffer A with 10 µM
[
-32P]dolichyl-P-P in 0.1% Triton X-100. After
incubation at 30 °C for 10 min, assays were terminated and analyzed
for inorganic phosphate as described above.
-32P]diacylglycerol-P-P
(10,000 cpm/nmol) as described (19). The reaction mixture contained 50 mM sodium citrate (pH 5.0), 0.1 mM
diacylglycerol-P-P, 2 mM Triton X-100, 10 mM
-mercaptoethanol, and enzyme in a total volume of 0.1 ml. Hydrolysis
of geranylgeranyl-P-P was measured by monitoring the formation of
[3H]geranylgeranyl-P from
[3H]geranylgeranyl-P-P (40,000 cpm/nmol). The reaction
mixture contained 50 mM sodium citrate buffer (pH 5.0), 0.1 mM geranylgeranyl-P-P, 2 mM Triton X-100, and
enzyme in a total volume of 0.1 ml. The product, geranylgeranyl-P, was
separated from geranylgeranyl-P-P by paper chromatography using
Na2EDTA-treated SG81 paper (40) and development with
chloroform/methanol/ammonium hydroxide/water (65:35:4:4). The positions
of the labeled lipids on chromatograms were determined by fluorography
using EN3HANCE and compared with standards. The amount of
each labeled lipid was determined by liquid scintillation counting. All
enzyme assays were conducted in triplicate for 20 min at 30 °C. The
average standard deviation of the assays was ±5%. The enzyme
reactions were linear with time and protein concentration. A unit of
enzymatic activity was defined as the amount of enzyme that catalyzed
the formation of 1 µmol of product/min unless otherwise indicated.
![]()
RESULTS
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES
(SEY6210) strains (52) as listed in Table
I. Cells with either single or double disruptions were viable, and their growth patterns were
indistinguishable from wild-type cells on rich (YPD) media.
Furthermore, various minimal media, different carbon sources, varying
osmolality, and ranges of temperatures (16-40 °C) produced no
differential effects on growth. Haploid SEY6211 lpp1
dpp1
(MATa) and SEY6210 lpp1
dpp1
(MAT
) were able to mate with one another;
the resulting SEY6211/SEY6210 lpp1
/lpp1
dpp1
/dpp1
diploid cells were able to sporulate, and all
haploid offspring were viable. These results are consistent with
previous reports (15, 32). The movement of carboxypeptidase Y through
the secretory pathway was unaltered in lpp1
dpp1
mutant cells when compared with wild-type cells (data not shown). In
addition, correct glycosylation of carboxypeptidase Y indicated that
the general glycosylation machinery was intact in cells lacking Lpp1p
and Dpp1p. Despite an extensive search, no obvious growth or
morphological mutant phenotypes were found associated with the
lpp1 and dpp1 null alleles.
Strains of S. cerevisiae used in this work
1, dpp1
1, and lpp1
1 dpp1
1 refer
to SEY6211 strains unless explicitly stated.
and dpp1
strains exhibited only 77 and
24%, respectively, of the Mg2+-independent PA phosphatase
activity present in the wild-type strain. The disruption of both genes
(lpp1
dpp1
strain) resulted in a particulate fraction
with less than 3% of parental activity (Fig.
1A, open bars). The
Mg2+-dependent PA phosphatase activities
associated with the cytosol were unchanged in disrupted strains (Fig.
1C, solid bars; data not shown). However, the
apparent Mg2+-dependent PA phosphatase activity
in particulate fractions increased significantly in preparations from
dpp1
and lpp1
dpp1
cells (Fig.
1B). This increase could represent a compensatory response by the mutant cells for the loss of the Mg2+-independent
activity and may be responsible for the difficulty in observing a
physiological phenotype in the disrupted strains.

View larger version (19K):
[in a new window]
Fig. 1.
PA phosphatase activity in the wild-type (WT)
and disrupted strains of S. cerevisiae in the presence
and absence of Mg2+. A, particulate
fractions were prepared from the indicated strains of S. cerevisiae and assayed for PA phosphatase activity in the absence
(open bars) or presence (filled bars) of
Mg2+ as described under "Experimental Procedures."
B, the amount of PA phosphatase activity in particulate
fractions due solely to stimulation by the presence of Mg2+
(difference between the shaded and open bars in
A). C, PA phosphatase activity in cytosolic
fractions of WT and lpp1
dpp1
cells measured in either
the absence or presence of Mg2+ as indicated.
, dpp1
, and lpp1
dpp1
strains were 80, 16, and 0.5%, respectively, of activity
in the wild-type strain (Fig. 2). The same samples yielded relative
rates for the dephosphorylation of dolichyl-P-P of 91, 25, and 1%
(Fig. 2). These changes, observed in the absence of Mg2+,
closely parallel the altered rates for Mg2+-independent PA
phosphatase activity. Similar losses in activity were observed in
multiple preparations and homogenates of the cells. In contrast to PA
(Fig. 1B), a small Mg2+-dependent
hydrolysis of dolichyl-P and dolichyl-P-P in particulate preparations
from lpp1
dpp1
cells was unchanged from wild type (data not shown).

View larger version (29K):
[in a new window]
Fig. 2.
Dephosphorylation of PA, dolichyl-P, and
dolichyl-P-P by particulate fractions from wild-type and disrupted
strains of S. cerevisiae. A,
particulate fractions of the wild-type (WT), lpp1
,
dpp1
, and lpp1
dpp1
strains of S. cerevisiae were prepared and assayed for phosphatase activity
using PA (open bars), dolichyl-P (striped bars),
and dolichyl-P-P (solid bars) as substrates. B,
the specific activities from the disrupted strains are expressed as a
percentage of wild-type activities.
,
dpp1
, and lpp1
dpp1
strains (Fig.
3).

View larger version (29K):
[in a new window]
Fig. 3.
Dephosphorylation of dolichyl-P-P,
farnesyl-P-P, and geranylgeranyl-P-P by particulate fractions from
wild-type (WT), lpp1
, dpp1
, and lpp1
dpp1
strains of S. cerevisiae.
Particulate fractions from the indicated strains were prepared and
assayed in the absence of Mg2+ for phosphatase activity
using the substrates dolichyl-P-P (open bars), farnesyl-P-P
(striped bars), and geranylgeranyl-P-P (solid
bars) as described under "Experimental Procedures."
Phosphatase activity is expressed as the percentage of wild-type
specific activity for each substrate. Wild-type activities were 0.51, 3.4, and 2.1 nmol/min/mg for dolichyl-P-P, geranylgeranyl-P-P and
farnesyl-P-P, respectively.
dpp1
strain,
although Mg2+-independent activity was virtually absent
(Fig. 1C). The specific activity for dephosphorylation of
dolichyl-P in cytosol was much lower than for PA (Figs. 1C
and 4), but the profile was similar (Fig.
4) in that a 5.5-fold stimulation was
observed with the addition of magnesium. Mg2+-independent
dolichyl-P phosphatase activity was lost in the double mutant, yet the
specific activity for dolichyl-P in the presence of Mg2+
was equivalent to the wild-type strain (Fig. 4). In contrast, Mg2+ did not stimulate the hydrolysis of dolichyl-P-P in
cytosol from either wild-type or the lpp1
dpp1
strains
(Fig. 4). Both cytosol and the particulate fraction from the
lpp1
dpp1
strain were essentially devoid of
dolichyl-P-P phosphatase activity in either the presence or absence of
Mg2+ (Figs. 2 and 4). These results indicate that the
activities encoded by the genes LPP1 and DPP1 may
account for the modest Mg2+-independent activities in
cytosol but do not account for the Mg2+-dependent hydrolysis of PA and dolichyl-P.
The lack of action on dolichyl-P-P clearly distinguishes the
specificity of the enzyme responsible for the
Mg2+-dependent cytosolic activity from that of
Lpp1p and Dpp1p.

View larger version (21K):
[in a new window]
Fig. 4.
Dephosphorylation of dolichyl-P and
dolichyl-P-P by cytosolic fractions of wild-type (WT) and lpp1
dpp1
strains. Cytosolic fractions of the indicated
strains of S. cerevisiae were prepared and assayed for
phosphatase activity with either dolichyl-P or dolichyl-P-P as the
substrate and either the presence or absence of Mg2+ as
indicated.

View larger version (27K):
[in a new window]
Fig. 5.
Inhibition of diacylglycerol-pyrophosphate
phosphatase activity of purified Dpp1p by other phosphorylated
isoprenoids. Diacylglycerol-pyrophosphate (DGPP)
phosphatase activity was measured under standard assay conditions with
0.3 mol % diacylglycerol pyrophosphate (bulk concentration of 0.1 mM) in the absence and presence of the indicated
concentrations of isopentyl alcohol (
), geraniol (
), farnesol
(
), isopentyl pyrophosphate (
), geranyl pyrophosphate (
),
farnesyl pyrophosphate (
), and geranylgeranyl pyrophosphate
(filled circle with white dot).

View larger version (22K):
[in a new window]
Fig. 6.
Kinetic analysis of the inhibitory action of
farnesyl and geranylgeranyl pyrophosphate on the hydrolysis of
diacylglycerol pyrophosphate by Dpp1p. A, the
phosphatase activity of Dpp1p was measured as a function of the surface
concentration (mol %) of diacylglycerol pyrophosphate (substrate, bulk
concentration 0.1 mM) at set surface concentrations of
farnesyl pyrophosphate of 0 (
), 0.15 (
), 0.45 (
), and 0.75 (
) mol %. The data are plotted as 1/diacylglycerol-pyrophosphate
phosphatase (units/mg) versus the reciprocal of the
diacylglycerol pyrophosphate surface concentration. The
inset is a replot of the slopes versus the
concentration of farnesyl pyrophosphate. B, phosphatase
activity of Dpp1p was measured as a function of the surface
concentration (in mol %) of diacylglycerol pyrophosphate (bulk
concentration 0.1 mM) at set surface concentrations of
geranylgeranyl pyrophosphate of 0 (
), 0.15 (
), 0.45 (
), and
0.75 (
) mol %. The data are plotted as 1/diacylglycerol
pyrophosphate phosphatase (units/mg) versus the reciprocal
of the diacylglycerol pyrophosphate surface concentration. The
inset is a replot of the slopes versus the
concentration of geranylgeranyl pyrophosphate. The lines
drawn in each of the panels were determined by least squares
analysis. Abbreviations used are: DGPP, diacylglycerol
pyrophosphate; FPP, farnesyl pyrophosphate; GGPP,
geranylgeranyl pyrophosphate.

View larger version (23K):
[in a new window]
Fig. 7.
Hydrolysis of geranylgeranyl pyrophosphate
(GGPP) by isolated Dpp1p; effect of time, pH, and
concentration of substrate. A, hydrolysis of 2 nmol of
[3H]geranylgeranyl pyrophosphate was assessed at the
indicated time intervals. The production of geranylgeranyl phosphate
was determined by paper chromatography with SG 81 paper as described
under "Experimental Procedures." B, the
geranylgeranyl-pyrophosphate phosphatase activity of Dpp1p was measured
at the indicated pH values with 50 mM citrate/maleate/Tris
buffer. C, the geranylgeranyl-pyrophosphate phosphatase
activity of the Dpp1p was measured as a function of the surface
concentration (in mol %) of geranylgeranyl pyrophosphate. The molar
concentration of geranylgeranyl pyrophosphate was held constant at 0.1 mM, whereas the Triton X-100 concentration was varied. The
inset is a replot of 1/V (units/mg)
versus the reciprocal surface concentration of
geranylgeranyl pyrophosphate. The line was determined by least squares
analysis.
![]()
DISCUSSION
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES
- and subsequently the
-phosphate from diacylglycerol-P-P and the resulting PA (19). The
catalytic efficiency
(Vmax/Km) for the hydrolysis
of diacylglycerol-P-P was 10-fold greater than that for PA. In this
study, the potential spectrum of action of Lpp1p and Dpp1p was further
extended to the dephosphorylation of isoprenoid mono- and diphosphates,
and purified Dpp1p was shown to dephosphorylate geranylgeranyl-P-P with
specificity constants indistinguishable from those obtained with
diacylglycerol-P-P. The results represent the first demonstration that
dolichyl-P, dolichyl-P-P, farnesyl-P-P, and geranylgeranyl-P-P are
dephosphorylated by activities in yeast and that most of this activity
is due to expression of Dpp1p and Lpp1p.
-isoprene unit (45, 46).
The metabolic and functional significance of the dephosphorylation of
dolichyl-P is not completely understood. Nevertheless, dolichyl-P
phosphatase activity has been characterized from several sources (25,
37, 47, 48). Such a reaction could be important for the topological redistribution of dolichols. Man-P-Dol and glucosylphosphoryldolichol are formed on the cytosolic face of the endoplasmic reticulum and then
diffuse transversely to the lumenal monolayer where they function as
glycosyl donors (46). Dephosphorylation of the dolichyl-P molecules
formed during the lumenal mannosylation and glucosylation reactions
might be important to allow free dolichol to diffuse back to the
cytosolic face of the endoplasmic reticulum. Dolichyl-P could then be
re-synthesized by dolichol kinase and utilized again as a glycosyl
carrier lipid.
dpp1
strain. A novel
Mg2+-dependent dolichyl-P phosphatase activity
was noted in the cytosolic fraction of yeast. It is possible that this
activity could compensate for the loss of Mg2+-independent
activity in the disrupted strains. However, no
Mg2+-dependent dolichyl-P-Pase activity was
noted in the cytosol. The results raise the possibility that there is
another enzyme(s) in yeast capable of degrading dolichyl-P-P that may
not be active under conditions used for the in vitro assays
in this study.
dpp1
strain. The significance of dephosphorylation of the farnesyl and geranylgeranyl compounds to cellular physiology is not
known. Two activities that were described in microsomal preparations from rat liver appeared to be quite specific for either farnesyl-P-P or
geranylgeranyl-P-P (49). Such specificity was not apparent with
purified Dpp1p. Both microsomal activities were reported to have
Km values in the low micromolar range and exhibited pH optima of 5.5 to 6.0 (49), properties similar to those described for
Dpp1p. It is possible that Dpp1p and possibly Lpp1p could act to
prevent a toxic accumulation of isoprenoid pyrophosphates. Such an
accumulation could occur if hydroxymethylglutaryl-CoA reductase were
not down-regulated concurrently with squalene synthase activity, a
later step in ergosterol synthesis. A situation such as this is created
artificially in the erg9 mutant (squalene synthase). This
could cause an accumulation of farnesyl-P-P that is toxic to the cell
or upset the synthesis of dolichol and ubiquinone or the isoprenylation
of protein. Overexpression of the ERG20 gene (farnesyl-P-P
synthase) in an erg9 mutant background led to a dramatic
increase in the level of dolichol (50). It is possible that the
farnesyl-P-P pool is shunted in this direction, but dephosphorylation
of farnesyl-P-P may also be important.
| |
FOOTNOTES |
|---|
* This work was supported by National Institutes of Health Grant GM31954, the Robert A. Welch Foundation, and the Alfred and Mabel Gilman Professorship in Molecular Pharmacology (to P. C. S.), National Institutes of Health Grants GM28140 (to G. M. C.), GM36065 (to C. J. W.), and GM55301, American Cancer Society Grant RPG-92-017-01-CB, and the March of Dimes Basil O'Conner award (to B. F. H.).The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
** To whom correspondence should be addressed: Dept. of Pharmacology, University of Texas Southwestern Medical School, 5323 Harry Hines Blvd., Dallas, TX 75235-9041. Tel: 214-648-2835; Fax: 214-648-2971; E-mail: sternwei{at}UTSW.swmed.edu.
2 Stanford University Saccharomyces Genome Data base address: http://genome-www.stanford.edu/Saccharomyces/.
3 X. Chen and G. M. Carman, unpublished data.
| |
ABBREVIATIONS |
|---|
The abbreviations used are: PA, phosphatidic acid; LPA, lysophosphatidic acid; Man-P-Dol, mannosylphosphoryldolichol; dolichyl-P, dolichyl phosphate; dolichyl-P-P, dolichyl pyrophosphate; MES, 4-morpholineethanesulfonic acid; ORF, open reading frame.
| |
REFERENCES |
|---|
|
|
|---|
This article has been cited by other articles:
![]() |
G.-S. Han, S. Siniossoglou, and G. M. Carman The Cellular Functions of the Yeast Lipin Homolog Pah1p Are Dependent on Its Phosphatidate Phosphatase Activity J. Biol. Chem., December 21, 2007; 282(51): 37026 - 37035. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. H. M. L. P. Navarathna, J. M. Hornby, N. Krishnan, A. Parkhurst, G. E. Duhamel, and K. W. Nickerson Effect of Farnesol on a Mouse Model of Systemic Candidiasis, Determined by Use of a DPP3 Knockout Mutant of Candida albicans Infect. Immun., April 1, 2007; 75(4): 1609 - 1618. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Fukunaga, M. Arita, M. Takahashi, A. J. Morris, M. Pfeffer, and B. D. Levy Identification and Functional Characterization of a Presqualene Diphosphate Phosphatase J. Biol. Chem., April 7, 2006; 281(14): 9490 - 9497. [Abstract] [Full Text] [PDF] |
||||
![]() |
G.-S. Han, W.-I Wu, and G. M. Carman The Saccharomyces cerevisiae Lipin Homolog Is a Mg2+-dependent Phosphatidate Phosphatase Enzyme J. Biol. Chem., April 7, 2006; 281(14): 9210 - 9218. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Eichler and M. W. W. Adams Posttranslational Protein Modification in Archaea Microbiol. Mol. Biol. Rev., September 1, 2005; 69(3): 393 - 425. [Abstract] [Full Text] [PDF] |
||||
![]() |
G.-S. Han, C. N. Johnston, and G. M. Carman Vacuole Membrane Topography of the DPP1-encoded Diacylglycerol Pyrophosphate Phosphatase Catalytic Site from Saccharomyces cerevisiae J. Biol. Chem., February 13, 2004; 279(7): 5338 - 5345. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Oshiro, G.-S. Han, W. M. Iwanyshyn, K. Conover, and G. M. Carman Regulation of the Yeast DPP1-encoded Diacylglycerol Pyrophosphate Phosphatase by Transcription Factor Gis1p J. Biol. Chem., August 22, 2003; 278(34): 31495 - 31503. [Abstract] [Full Text] [PDF] |