J Biol Chem, Vol. 274, Issue 21, 14893-14901, May 21, 1999
Adaptor Proteins Grb2 and Crk Couple Pyk2 with Activation of
Specific Mitogen-activated Protein Kinase Cascades*
Andree
Blaukat
§,
Inga
Ivankovic-Dikic
,
Eva
Grönroos,
Fabrizio
Dolfi¶
,
George
Tokiwa**,
Kristiina
Vuori¶
, and
Ivan
Dikic§§
From the Ludwig Institute for Cancer Research, Box 595, Husargatan 3, Uppsala S-75124, Sweden, the ** Department of
Pharmacology, New York University Medical Center,
New York, New York, 10016, and the ¶ La Jolla Cancer Research
Center, The Burnham Institute, La Jolla, California 92037
 |
ABSTRACT |
The protein tyrosine kinase Pyk2 acts as an
upstream regulator of mitogen-activated protein (MAP) kinase cascades
in response to numerous extracellular signals. The precise molecular
mechanisms by which Pyk2 activates distinct MAP kinase pathways are not
yet fully understood. In this report, we provide evidence that the protein tyrosine kinase Src and adaptor proteins Grb2, Crk, and p130Cas
act as downstream mediators of Pyk2 leading to the activation of
extracellular signal-regulated kinase (ERK) and c-Jun amino-terminal kinase (JNK). Pyk2-induced activation of Src is necessary for phosphorylation of Shc and p130Cas and their association with Grb2 and
Crk, respectively, and for the activation of ERK and JNK cascades.
Expression of a Grb2 mutant with a deletion of the amino-terminal Src
homology 3 domain or the carboxyl-terminal tail of Sos strongly reduced
Pyk2-induced ERK activation, with no apparent effect on JNK activity.
Grb2 with a deleted carboxyl-terminal Src homology 3 domain partially
blocked Pyk2-induced ERK and JNK pathways, whereas expression of
dominant interfering mutants of p130Cas or Crk specifically inhibited
JNK but not ERK activation by Pyk2. Taken together, our data reveal
specific pathways that couple Pyk2 with MAP kinases: the Grb2/Sos
complex connects Pyk2 to the activation of ERK, whereas adaptor
proteins p130Cas and Crk link Pyk2 with the JNK pathway.
 |
INTRODUCTION |
The MAP1 kinase family
comprises three distinct kinases: extracellular signal-regulated kinase
(ERK), c-Jun amino-terminal kinase/stress-activated protein kinase
(JNK/SAPK), and p38 MAP kinase (1). MAP kinases have been implicated in
the regulation of several fundamental cellular processes by
transmitting extracellular signals from the cell membrane to the
nucleus (1-3). Different MAP kinases are activated by signaling
pathways composed of small GTPases and cytoplasmic kinase cascades (1).
Key components of the ERK pathway include the small GTPase Ras, the
serine/threonine kinase Raf, and MAP kinase kinase (Mek), which
phosphorylates and activates ERK (4). The JNK pathway is composed of
the Rho-related GTPases Rac and Cdc42 and a cytoplasmic kinase cascade
in which Mek4 phosphorylates and activates JNK (5, 6). Activated ERK
and JNK phosphorylate transcription factors in the nucleus, leading to
the modulation of gene expression (7).
In most cases, the rate-limiting step in activation of the ERK and JNK
pathways is the conversion of small GTPases from the inactive GDP-bound
state to their active GTP-bound form (8, 9). The GDP/GTP exchange is
modulated by guanine nucleotide exchange factors (GEFs), which promote
formation of the GTP-bound form, and by GTPase activating proteins
(GAPs), which stimulate the rate of intrinsic GTP hydrolysis of
G-proteins (8). Many GEFs for Ras and Rho-like GTPases identified in
mammalian cells are bound to adaptor proteins, such as Grb2, Crk, or
Nck (4, 8-10). These adaptor proteins are composed of a SH2 domain and of one or more SH3 domains (10). Upon cell stimulation, the SH2 domains
of Grb2, Crk, and Nck bind to tyrosine-phosphorylated docking proteins,
such as Shc, IRS-1, Frs2, Gab-1, or p130Cas, or directly to protein
receptor tyrosine kinases (4, 10). Thereby, the adaptor protein/GEF
complex is translocated to the plasma membrane, where GEFs
catalyze the GDP/GTP exchange and activate membrane-bound GTPases
(4, 10).
The proline-rich tyrosine kinase (Pyk2) and focal adhesion kinase (FAK)
constitute a distinct family of nonreceptor protein tyrosine kinases
that are regulated by a variety of extracellular stimuli (11). Pyk2 is
predominantly expressed in the central nervous system and cells derived
from hematopoietic lineages, whereas its alternatively spliced isoform
(Pyk2-H) is specifically expressed in T and B lymphocytes, monocytes,
and natural killer cells (12, 13). Pyk2 was implicated in signaling by
G protein-coupled receptors, nicotinic acetylcholine receptors, stress
stimuli, and membrane depolarization in neuronal cells (12, 14-16). In hematopoietic cells, Pyk2 and Pyk2-H are activated by the inflammatory cytokine tumor necrosis factor
, stimulation of T and B lymphocyte antigen, integrin, interleukin-2, FcRI, and chemokine receptors (13,
16-26). Interactions of Pyk2 with Src family kinases, the Grb2/Sos
complex, p130Cas, paxillin, Hic-5, and Graf were reported to regulate
intracellular signaling as well as cytoskeletal and morphological
changes of cells (12, 14, 18-20, 27-29). In addition, several reports
have shown that activation of Pyk2 is necessary for the activation of
ERK and/or JNK in different cell lines and in response to diverse
stimuli (12, 14, 16, 30-33). For example, Pyk2 is required for
activation of the JNK pathway but not for ERK in response to
angiotensin II or chemokine receptors (31, 33). In PC12 cells, Pyk2
appears to link bradykinin and lysophosphatidic acid receptors with ERK
(12, 14) and stress stimuli with the activation of JNK (16). However,
the molecular mechanisms by which Pyk2 transmits extracellular signals
to specific MAP kinase signaling networks that control diverse cell
responses are only partially understood. In this report, we show that
Src acts in concert with Grb2/Sos and p130Cas/Crk complexes to mediate
Pyk2-induced activation of specific MAP kinase cascades.
 |
EXPERIMENTAL PROCEDURES |
Reagents--
All tissue culture media and antibiotics were
obtained from Life Technologies and Sigma. LipofectAMINE was purchased
from Life Technologies. Poly(Glu-Tyr) 4:1 and all other chemicals were from Sigma. Aprotinin, leupeptin, and BM chemiluminescence blotting substrate (POD) were obtained from Roche Molecular Biochemicals. Pefabloc SC was obtained from Fluka. Rainbow protein marker,
horseradish peroxidase coupled anti-mouse IgG and
[32P]ATP were from Amersham, whereas horseradish
peroxidase-labeled protein A was from Kirkegaard & Perry Laboratories.
NitroBind nitrocellulose transfer membrane were from Micron
Separations, and protein A-Sepharose 4B was from Zymed
Laboratories Inc.
Tissue Culture and Transfections--
Human embryonic kidney
293T cells were maintained in Dulbecco's modified Eagle's medium
supplemented with 10% fetal calf serum, penicillin (50 units/ml), and
streptomycin (50 µg/ml). Expression vectors for hemagglutinin antigen
(HA) epitope-tagged ERK2 and JNK1 were kindly provided by C. Marshall
(Institute of Cancer Research, London, United Kingdom) and M. Karin,
(University of California, San Diego, CA), respectively. Expression
vector containing Src kinase inactive mutant (pSGTcSrcK
) was kindly
provided by S. Courtneidge (SUGEN, Inc.). The carboxyl-terminal tail of
Sos (Sos-CT), Grb2-
NSH3 (deletion of N-SH3 mutant) and Grb2-
CSH3 (deletion of C-SH3 mutant) cloned in pCGN were kindly provided by M. Gischitzky (SUGEN Inc., San Francisco, CA), pSSR
-Crk-SH2 m (Crk SH2
R38V mutant), and pSSR
-p130Cas
SD (a deletion of 213-514 amino
acids) are described elsewhere (34-37). Expression vectors containing
FLAG-tagged paxillin (pCMV-Paxillin) and a paxillin triple mutant
Y31F/Y118F/Y187F, which is unable to bind to Crk (pCMV-Pax
Y31F/Y118F/Y187F), were provided by F. Giancotti (Memorial Sloan-Kettering Cancer Center). Wild type Pyk2, Y402F mutant, and
kinase inactive mutant (PKM) of human Pyk2 cloned in pRK5 have been
described previously (14). The mutagenic oligonucleotide (GAGTCAGACATTCTTCGCAGAGATTCC) and the transoligonucleotide
(GAATTCGATATCACGCGTTGGCCGCCATGGC) were used to convert tyrosine 881 to
phenylalanine in pRK5-Pyk2 or pRK5-Pyk2-Y402F using the in
vitro mutagenesis kit from CLONTECH. The
mutation was confirmed by DNA sequencing. For transient transfections, 293T cells were grown on 6-well tissue culture plates in Dulbecco's modified Eagle's medium supplemented with 10% fetal calf serum. When
the cells had reached 50% confluence, the medium was changed to
serum-free Dulbecco's modified Eagle's medium, and the cells were
incubated with expression vectors containing indicated cDNAs. After
6 h, an equal volume of 20% fetal calf serum/Dulbecco's modified
Eagle's medium was added and cells were grown for an additional
40 h. Empty expression vector was added when necessary to equalize
the total amount of DNA transfected to 2 µg per well. Cells were
lysed in Triton lysis buffer (50 mM Hepes, pH 7.5, 150 mM NaCl, 1% Triton X-100, 10% glycerol, 1.5 mM MgCl2, 1 mM EDTA, 0.2 mM EGTA, 1 mM sodium orthovanadate, 20 mM NaF, 1 mM Pefabloc SC, 10 µg/ml aprotinin,
and 5 µg/ml leupeptin).
Immunoprecipitation and Immunoblotting--
Cell lysates were
cleared by centrifugation at 13,000 × g for 15 min at
4 °C, and total protein concentrations were determined by use of the
Bradford protein assay (Bio-Rad). Equal amounts of lysates were
subjected to immunoprecipitation with the indicated antibodies.
Anti-Pyk2 (number 600) and anti-Grb2 (50) antibodies were cross-linked
to protein A beads (Zymed Laboratories Inc.) with
dimethylpimelimidate (Pierce) as described (13). After 2 h, the
beads were pelleted and washed three times with lysis buffer and once
with phosphate-buffered saline. SDS gel loading buffer was added, the
mixture was heated to 98 °C for 2 min, and proteins were resolved by
SDS-PAGE. For immunoblot analysis, proteins were transferred to
nitrocellulose transfer membrane using a wet transfer unit from
Bio-Rad. After blocking in Tris-buffered saline (150 mM
NaCl, 20 mM Tris-HCl, pH 7.7) supplemented with 5% bovine serum albumin, the filters were incubated with the appropriate antibodies for 1-2 h, washed several times with Tris-buffered saline
containing 0.05% Triton X-100, and incubated with horseradish peroxidase-coupled anti-mouse IgG or protein A. The antibody-antigen complexes were visualized by a chemiluminescence detection system (Roche Molecular Biochemicals). To reprobe blots, they were incubated in stripping buffer (62.5 mM Tris-HCl, pH 6.7, 2% SDS, and
100 mM 2-mercaptoethanol) at 58 °C for 25 min, washed
extensively with Tris-buffered saline, reblocked as described above,
and reblotted with the appropriate antibodies. To determine Src
activity lysates of transfected 293T cells were subjected to
immunoprecipitation with anti-Src (Ab-1) antibodies and analyzed by
immunoblotting with anti-Tyr(P)-416Src antibodies that
recognize activated Src. Src kinase activity was quantified as an
increase in Tyr(P)-416Src phosphorylation as described
previously (14).
Antibodies--
Polyclonal rabbit anti-Pyk2 antisera (600) and
(623) were described previously (13). Polyclonal antibodies against
p130Cas (N-17) and ERK2 (C-14) were obtained from Santa Cruz
Biotechnology, and mouse monoclonal anti-p130Cas (P27820) and anti-Crk
(C12620) antibodies were from Transduction Laboratories. Rabbit
polyclonal anti-Crk antibodies (336) were generated against a
carboxyl-terminal peptide of Crk. Anti-HA tag antibodies (12CA5) were
purchased from Roche Molecular Biochemicals, anti-FLAG tag antibodies
(M2) were purchased from Kodak, anti-Src (Ab-1) antibodies were
purchased from Oncogene Sciences and affinity purified
anti-Tyr(P)-416Src antibodies were kindly provided by A. Laudano (University of New Hampshire). Mouse monoclonal
anti-phosphotyrosine antibodies (4G10) were obtained from C. Davis (New
York University) and rabbit polyclonal anti-phosphotyrosine antibodies
(72) were used as described previously (13). Affinity-purified
antibodies against activated ERK were kindly provided by L. Rönnstrand (Ludwig Institute for Cancer Research, Uppsala,
Sweden). The use of polyclonal antisera to Grb2 (50, 86 and 327) and
Shc (410) was described previously (38).
Pyk2 in Vitro Kinase Assays--
For exogenous substrate
phosphorylation, equal amounts of lysates from transfected 293T cells
were subjected to immunoprecipitations with antisera against Pyk2
(600). Immunoprecipitates were washed three times with lysis buffer and
once with kinase buffer (50 mM Tris-HCl, pH 7.5, 5 mM MnCl2, 5 mM MgCl2).
One-half of the immunoprecipitates was analyzed by SDS-PAGE and
immunoblotting with anti-Pyk2 antibodies (623), whereas the other half
was incubated with 50 µl of kinase buffer supplemented with 20 µg
of poly(Glu-Tyr) (4:1), 20 µM of ATP including 5 µCi of
[32P]ATP for 10 min at room temperature. The reaction was
stopped by addition of 25 µl of SDS sample buffer, boiled for 2 min,
and products were resolved by 7% SDS-PAGE. The increase in
phosphorylation of poly(Glu-Tyr) was determined by quantitation with a
bioimaging analyzer (Fuji BAS2000).
Determination of ERK and JNK Activities--
To measure ERK2
kinase activity, polyclonal anti-ERK2 antibodies or anti-HA tag
antibodies were used to precipitate ERK2 or HA-ERK2 from total cell
lysates. Precipitates were washed three times with lysis buffer and
twice with reaction buffer (10 mM Tris-HCl, pH 7.4, 10 mM MgCl2). Myelin basic protein (MBP) (10 µg)
was added to each immunoprecipitate as a substrate and kinase reactions
(total volume, ~30 µl) were initiated by addition of an ATP mix
(final concentration, 200 µM ATP, including 1 µCi of [32P]ATP), incubated at room temperature for 20 min, and
stopped by the addition of 20 µl of SDS sample buffer. The
phosphorylated MBP was resolved by 12% SDS-PAGE, and gels were cut at
the 30-kDa marker band. To assess equal kinase loads the upper part of
gels was analyzed by immunoblotting with anti-ERK2 or anti-HA
antibodies, and the lower part containing the phosphorylated substrate
was visualized by autoradiography. The amount of 32P
incorporated into MBP was quantified using a PhosphoImager.
JNK activities were determined by in vitro kinase reactions
using glutathione S-transferase (GST) c-Jun (1-79) fusion
proteins as described previously (16, 34). Briefly, lysates of cells transfected with HA-tagged JNK expression vector were incubated for
2 h on ice with polyclonal anti-HA antibodies. Immune complexes were collected on 30 µl of protein A-Sepharose beads for 30 min. The
beads were washed three times with lysis buffer and twice with reaction
buffer (40 mM HEPES, pH 7.5, 10 mM
MgCl2, 1 mM dithiothreitol) and assayed for
phosphorylation of GST-c-Jun (1-79) in a final volume of 30 µl with
100 µM ATP and 2.5 µCi of [32P]ATP. After
20 min at 30 °C the reaction was stopped by the addition of SDS
sample buffer. Following SDS-PAGE, the amount of 32P
incorporated in GST-c-Jun (1-79) was determined by PhosphoImager analysis. HA-JNK expression levels were checked by anti-HA Western blotting of immune complexes, and the level of GST-c-Jun (1-79) substrate in each lane was visualized by Coomassie Blue staining.
 |
RESULTS |
Characterization of Pyk2 Mutants--
To investigate the signaling
pathways responsible for Pyk2-induced activation of MAP kinases, we
generated a series of expression vectors encoding for Pyk2 mutants
(Fig. 1A). We first compared abilities of Pyk2, Pyk2-Y402F (tyrosine 402, the major
autophosphorylation site and direct binding site for the Src SH2
domain, was mutated to phenylalanine), Pyk2-Y881F (tyrosine 881, a
putative Grb2 binding site, was changed to phenylalanine), double
mutant Pyk2-Y402F/Y881F and PKM to induce Src activation and tyrosine
phosphorylation of proteins in human embryonic kidney 293T cells.
Expression of Pyk2 or Pyk2-Y881F increased the phosphotyrosine content
of cellular proteins and strongly activated endogenous Src proteins,
whereas Pyk2-Y402F and Pyk2-Y402F/Y881F were severely impaired (to more than 90%) in their ability to undergo autophosphorylation, activate Src, and phosphorylate other cellular proteins (Fig. 1, B
and C). PKM was completely unable to activate Src or to
induce any tyrosine phosphorylation of cellular proteins (Fig. 1,
B and C). In order to further analyze the
enzymatic properties of different Pyk2 mutants, we compared their
in vitro kinase activities, measured by phosphorylation of
the substrate poly(Glu-Tyr). Pyk2 and Pyk2-Y881F exhibited similar
catalytic activities, whereas Pyk2-Y402F and Pyk2-Y402F/Y881F had
decreased activities (15-35%) as compared with the wild type enzyme
(Fig. 1D). The observed decrease in catalytic activities
in vitro of these mutants could not account for the major
reduction in their ability to phosphorylate cellular proteins in
vivo (compare Fig. 1D to Fig. 1B). The fact
that Pyk2-Y402F and Pyk2-Y402F/Y881F are unable to activate Src (Fig.
1C) indicates that activation of Src kinases by binding to
Tyr-402 of Pyk2 plays a critical role in mediating Pyk2-induced
phosphorylation of cellular proteins.

View larger version (22K):
[in this window]
[in a new window]
|
Fig. 1.
Characterization of Pyk2 mutants.
A, schematic diagram of different Pyk2 forms used in this
study. Shading denotes the catalytic region of Pyk2. All
constructs were subcloned in the pRK5 expression vector. B,
human 293T cells were transfected with expression vectors encoding Pyk2
constructs. Approximately 20 µg of total cell lysates were separated
on 7% SDS-PAGE gels and subsequently analyzed by immunoblotting with
4G10 anti-phosphotyrosine antibodies (anti-PTyr), and
anti-Pyk2 (623). C, the same lysates as in B were
subjected to immunoprecipitation with antibodies against Src and
immunoblotted with anti-Tyr(P)-416Src or anti-Src (Ab1)
antibodies. Src kinase activity was quantified as an increase in
phosphorylation of Tyr-416 of Src and presented as mean ± S.D.
from three independent experiments. D, Pyk2 or different
Pyk2 mutants were immunoprecipitated from lysates of 293T cells and
subjected to in vitro kinase reactions using poly(Glu-Tyr)
as an exogenous substrate. Fold increase in phosphorylation of
poly(Glu-Tyr) is indicated. Bottom panel, a proportion of
each Pyk2 immunoprecipitate was separated by 7% SDS-PAGE and
immunoblotted with anti-Pyk2 antibodies (623). Results shown are from a
representative experiment out of three with similar results.
|
|
Tyrosines 881 and 402 of Pyk2 Are Necessary to Link Pyk2 with
Grb2-mediated Pathways--
We were further interested to identify
cellular proteins that link Pyk2 with the activation of MAP kinases.
Pyk2 was suggested to activate ERK by directly binding the Grb2/Sos
complex or indirectly via Grb2 binding to tyrosine-phosphorylated Shc
proteins (12, 14, 39). We therefore analyzed the ability of different
Pyk2 mutants expressed in 293T cells to interact with Grb2. Expression of wild type Pyk2 or Pyk2-Y881F mutant induced phosphorylation of Shc
and its association with Grb2 (Fig.
2A), whereas expression of
Pyk2-Y402F, Pyk2-Y402F/Y881F, or PKM did not lead to any significant increase in tyrosine phosphorylation of Shc or its association with
Grb2 (Fig. 2A). In parallel, the same cell lysates were
subjected to immunoprecipitation with anti-Pyk2 and anti-Grb2
antibodies and analyzed by immunoblotting with respective antibodies.
Wild type Pyk2 was associated with Grb2, whereas mutation of Tyr-881 to
phenylalanine in Pyk2 led to a complete loss of its ability to
co-precipitate with Grb2 (Fig. 2B), confirming that Tyr-881 of Pyk2 serves as a direct binding site for Grb2. We also found that
Pyk2-Y402F, Pyk2-Y402F/Y881F, and PKM were not able to bind and
co-precipitate Grb2 (Fig. 2B). In addition, when Pyk2 was co-transfected with the increasing amounts of a Src kinase inactive mutant (SrcK
), the ability of Pyk2 to bind Grb2 was significantly reduced (Fig. 2C). These data, together with previous
findings (12, 39), suggest that the kinase activity of Pyk2,
autophosphorylation on Tyr-402 and transphosphorylation of Tyr-881 of
Pyk2 by Src kinases are necessary to link Pyk2 with Grb2.

View larger version (29K):
[in this window]
[in a new window]
|
Fig. 2.
Pyk2 connections to Grb2-mediated
pathways. A, human 293T cells were transiently
transfected with the indicated expression constructs, and cell lysates
were subjected to immunoprecipitation with anti-Shc antibodies (410),
followed by immunoblotting with anti-Tyr(P) (4G10;
anti-pTyr), anti-Shc (410), and anti-Grb2 (86) antibodies.
B, cell lysates from A were subjected to
immunoprecipitation with anti-Pyk2 (600) and anti-Grb2 (50) antibodies.
Co-precipitation of Pyk2 and Grb2 was monitored by immunoblotting with
anti-Pyk2 (623) or anti-Grb2 (86) antibodies, respectively.
C, 293T cells were transiently transfected with indicated
vectors. Total cell lysates were immunoblotted with anti-Tyr(P) (4G10;
anti-pTyr), anti-Pyk2 (623), and anti-Src (Ab-1) antibodies
(left panel). In addition, the same lysates were incubated
with anti-Grb2 antibodies (50), and immunoprecipitants were further
analyzed by immunoblotting with anti-Pyk2 (623) and anti-Grb2 (86)
antibodies (right panel).
|
|
Src Binding to Tyr-402 Mediates Pyk2-induced Activation of ERK and
JNK--
Because expression of Pyk2 has been shown to stimulate both
ERK and JNK activities in 293T cells (12, 14, 16), we were further
interested to analyze the ability of the Pyk2 mutants to activate
different MAP kinases in these cells. Lysates of transfected 293T cells
were assayed for activation of ERK2 by immunoblotting with antibodies
specific for activated ERK2 or by in vitro kinase reaction
using MBP as a substrate. In both experiments, expression of Pyk2 leads
to approximately 4-5-fold increase in HA-ERK2 activity (Fig.
3A). Expression of Pyk2-Y402F
or Pyk2-Y402F/Y881F did not lead to any significant activation of
HA-ERK2 kinases (Fig. 3A), whereas the mutation of Tyr-881
in Pyk2 led to approximately 20% reduction in its ability to activate
ERK2 when compared with wild type Pyk2 (Fig. 3A). Given the
fact that phosphorylation of Shc was intact upon expression of
Pyk2-Y881F in the same cells (Fig. 2A), these results
suggested that Shc-linked Grb2/Sos pathways may be largely sufficient
to substitute for the loss of direct Grb2 binding to Pyk2. Identical
results were obtained in 293T cells transfected with Pyk2 and Pyk2
mutants when analyzed for activation of endogenous ERKs (Fig.
3B). PKM was completely unable to activate ERK when
transfected in 293T cells (Fig. 3B), which is consistent
with previous reports (12, 14). In addition, we have previously
reported that inhibition of endogenous Src by expression of Csk leads
to inhibition of Pyk2-induced ERK activation (14).

View larger version (24K):
[in this window]
[in a new window]
|
Fig. 3.
Activation of ERK and JNK by different Pyk2
mutants. A, 293T cells were transiently transfected
with HA-ERK2 together with an empty vector (pRK5) or with indicated
Pyk2 constructs. Left panel, cell lysates were analyzed by
immunoblotting with antibodies against Pyk2 (623), HA-tag, or
antibodies specific for activated ERK2 (anti-pERK2).
Right panel, ERK2 activation was measured in serum-starved
cells by immune complex kinase assays using MBP as a substrate. The
amount of 32P incorporated into MBP was determined using a
bioimaging analyzer. Fold increase in phosphorylation of MBP is
indicated. The levels of HA-ERK2 were analyzed by immunoblotting with
anti-HA antibodies. B, total cell lysates of 293T cells
transfected with indicated Pyk2 vectors were subjected to
immunoblotting with anti-ERK2 (C-16) antibodies and antibodies specific
for activated ERK2 (anti-pERK2). C, 293T cells
were transfected with HA-tagged JNK1 (0.5 µg) and Pyk2 cDNAs (1 µg) as indicated, and JNK kinase assays were performed. JNK activity
was determined by quantitation of the level of GST-c-Jun (1-79)
phosphorylation with a bioimaging analyzer. Shown is a plot indicating
fold increase in JNK activity relative to that of activity from cells
transfected with the wild type Pyk2. D, 293T cells were
transfected with HA-tagged JNK1 (0.5 µg), Pyk2 cDNAs (1 µg),
and increasing amounts of Src kinase inactive mutant (SrcK ) as
indicated, and JNK kinase assays were performed. Shown is a plot
indicating fold increase in JNK activity relative to that of activity
from cells transfected with the wild type Pyk2.
|
|
We next tested the activation of JNK in the same cells. Expression of
wild type Pyk2 in 293T cells led to a 5-fold increase in JNK activity,
measured by in vitro phosphorylation of a GST-c-Jun (1-79)
fusion protein (16) (Fig. 3C). JNK activation induced by the
expression of Pyk2-Y402F, Pyk2-Y402F/Y881F, and PKM was significantly
weaker (up to 50-60%) when compared with values obtained by
expression of Pyk2 or Pyk2-Y881F (Fig. 3C). In order to
strengthen the importance of Tyr-402-mediated Src activation for the
ability of Pyk2 to induce JNK activation, we have co-expressed Pyk2
with a Src kinase inactive mutant and analyzed the activation of JNK in
these cells. Pyk2-induced increase in JNK activation was significantly
reduced in the presence of increasing amounts of a dominant interfering
form of Src (Fig. 3D). Together, these findings indicate
that the kinase activity of Pyk2 and Tyr-402-linked activation of Src
kinases play major roles in pathways connecting Pyk2 with activation of
ERK and JNK.
Differential Quantitative Requirements for Grb2 SH3 Domain-mediated
Pathways in Regulating Pyk2-induced Activation of ERK and JNK--
In
order to analyze the involvement of Grb2 and Sos in the Pyk2-induced
activation of ERK or JNK, we made use of dominant interfering forms of
Grb2 and Sos. Expression of Grb2 variants with a deletion of the
carboxyl-terminal SH3 domain (Grb2-
NSH3), a deletion of the
carboxyl-terminal SH3 domain of Grb2 (Grb2-
CSH3), or expression of
the carboxyl-terminal tail of Sos (Sos-CT) were previously shown to
dissociate the endogenous Grb2/Sos complex and act as dominant
interfering mutants on activation of the ERK pathway by several stimuli
(14, 40, 41). Because Pyk2 can activate ERK by both direct binding of
Grb2/Sos complex to Pyk2 or indirectly by binding to Shc (Fig. 2),
expression of dominant interfering mutants of Grb2 or Sos should block
both pathways by which Pyk2 potentially activates ERK. Expression of
Pyk2 together with Grb2-
NSH3 or Sos-CT led to a strong inhibition of
Pyk2-induced ERK activation (Fig.
4A), whereas Grb2-
CSH3 was
only partially efficient (Fig. 4A). Surprisingly,
Grb2-
CSH3, but neither Grb2-
NSH3 nor Sos-CT, reduced the JNK
activity upon Pyk2 overexpression (Fig. 4B). We further
tested whether Grb2 and CrkII can enhance the ability of Pyk2 to
activate MAP kinase pathways. Overexpression of Grb2 to approximately
5-fold over endogenous levels together with Pyk2 led to a strong
increase in Pyk2-induced ERK activation, whereas 5-fold overexpression
of CrkII did not significantly affect the ability of Pyk2 to activate
ERK (Fig. 4A). In addition, co-expression of wild type Grb2
or CrkII with Pyk2 in 293T cells led to an increase in JNK activation
as compared with the JNK activation induced by expression of Pyk2 alone
(Fig. 4B). It appears, therefore, that a Grb2/Sos complex
formation is essential in coupling Pyk2 with ERK, whereas
CrkII-mediated and additional Grb2-SH3 domain-mediated pathway may be
important for the activation of JNK.

View larger version (15K):
[in this window]
[in a new window]
|
Fig. 4.
The Grb2/Sos complex links Pyk2 with ERK
activation. A, 293T cells were transiently transfected
with HA-ERK2 (0.5 µg) and additional expression vectors: empty vector
alone (pRK5), a Pyk2 construct (Pyk2), or Pyk2 together with
vectors encoding Grb2, CrkII, Grb2 with a deleted amino-terminal SH3
domain (Grb2- NSH3), Grb2 with a deleted SH3 domain
(Grb2- CSH3), or the carboxyl-terminal tail of Sos
(Sos-CT), respectively. ERK2 was immunoprecipitated, and
activity was measured by in vitro kinase reactions. The
graph indicates percentage in ERK activity relative to that measured
with Pyk2 expression vector alone from three independent experiments.
Statistical significance was calculated using a Student's t
test for paired samples; *, p < 0.05. B,
cells were transfected with HA-tagged JNK1 (0.5 µg) together with
pRK5 (1 µg), Pyk2 (0.5 µg of Pyk2 + 0.5 µg of pRK5), or Pyk2 (0.5 µg) plus 0.5 µg of the following cDNAs: Grb2- NSH3,
Grb2- CSH3, Sos-CT, Grb2, or CrkII, respectively. JNK kinase assays
were performed, and data are presented as differences in JNK activity
relative to the values obtained in cells transfected with Pyk2
expression vector alone.
|
|
Pyk2 Induces Phosphorylation of p130Cas and Its Association with
Crk via Activation of Src Kinases--
Because we have observed that
co-expression of Pyk2 and the adaptor protein CrkII leads to an
increase in JNK activity as compared with cells expressing Pyk2 alone
(Fig. 4B), and because it has been demonstrated that the
docking protein p130Cas constitutively associates with Pyk2 (18), we
were interested to study the role of Crk and p130Cas in Pyk2 signaling.
It is known that phosphorylated p130Cas serves as an anchoring protein
for the SH2 domain of Crk (42). We therefore examined whether
phosphorylated p130Cas recruits Crk upon expression of Pyk2 and tested
the requirement of specific tyrosine residues of Pyk2 to induce p130Cas
phosphorylation and association with Crk. Expression of Pyk2 or
Pyk2-Y881F led to a pronounced phosphorylation of p130Cas and its
association with Crk (Fig. 5). In
contrast, Pyk2-Y402, Pyk2-Y402F/Y881F, and PKM were unable to induce
either tyrosine phosphorylation of p130Cas or its association with Crk
(Fig. 5). This also indicates that p130Cas might be phosphorylated by
Src, which is activated upon binding to Tyr-402 of Pyk2 (Fig.
1C). Indeed, overexpression of a Src kinase inactive mutant
together with Pyk2 led to a decrease in Pyk2-induced p130Cas
phosphorylation (Fig. 5A, right panel). The fact that
p130Cas constitutively binds to all Pyk2 mutants but recruits Crk
only in cells expressing wild type Pyk2 or Pyk2-Y881F suggests that
differential phosphorylation of p130Cas regulates signal
transmission to Crk proteins (Fig. 5B).

View larger version (25K):
[in this window]
[in a new window]
|
Fig. 5.
Pyk2 induces association of p130Cas and Crk
via activation of Src. A, total lysates from 293T cells
transfected with indicated cDNAs were subjected to
immunoprecipitation with polyclonal anti-phosphotyrosine antibodies
(72) and analyzed by immunoblotting with anti-p130Cas (P27820)
antibodies. Lysates used in the right panel are from the
same experiment as that described in Fig. 2C. B,
293T cells were transiently transfected with indicated Pyk2 expression
vectors (1 µg) together with pSSR-CrkII (0.5 µg) and pSSR-p130Cas
(0.5 µg). Lysates were subjected to immunoprecipitation with
anti-p130Cas (N-17, P27820) antibodies and analyzed by immunoblotting
with anti-Tyr(P) (4G10; anti-PTyr), anti-Pyk2 (623),
anti-Crk (C12620), and anti-p130Cas (P27820) antibodies.
|
|
The p130Cas/Crk Complex Specificaly Links Pyk2 with the JNK
Pathway--
We next analyzed a role for p130Cas and Crk in mediating
ERK and JNK activities downstream of Pyk2. Deletion of the substrate domain (amino acids 213-514) of p130Cas (p130Cas-
SD) or a mutation in the SH2 domain of Crk (Crk-SH2M-R38V) were previously shown to
interfere with endogenous p130Cas/Crk signaling (34, 35). Activation of
Pyk2-induced JNK and ERK was analyzed in cells co-expressing Pyk2 with
p130Cas-
SD or Crk-SH2M. The Pyk2-induced activation of ERK was not
blocked by the presence of p130Cas-
SD or Crk-SH2M (Fig.
6A). In contrast, expression
of p130Cas-
SD and Crk-SH2M together with Pyk2 led to strong
reduction in the JNK activity when compared with cells expressing Pyk2
alone (Fig. 6B). Hence, the p130Cas/Crk complex seems to
specifically link Pyk2 with activation of JNK. These results are
consistent with data showing that expression of Crk leads to an
increase in JNK, but not a significant increase in ERK activity (Fig.
4) (34).

View larger version (23K):
[in this window]
[in a new window]
|
Fig. 6.
The p130Cas/Crk complex specifically couples
Pyk2 with activation of JNK. A, 293T cells were
transfected with the indicated plasmids, and ERK2 activity was measured
by kinase assays using MBP as a substrate. Shown are percentages of ERK
activity compared with that induced by expression of Pyk2 alone.
B, 293T cells were transfected with HA-tagged JNK1 (1 µg)
together with pRK5 (1 µg), Pyk2 (0.5 µg of Pyk2 + 0.5 µg of
pRK5), Pyk2 (0.5 µg) plus p130Cas SD (0.5 µg), and Pyk2 (0.5 µg) plus CrkII-SH2M (0.5 µg), and JNK kinase assays were performed.
Left, GST-c-Jun (1-79) phosphorylation on an autoradiogram
together with levels of HA-JNK1 analyzed by immunoblotting with anti-HA
antibodies are shown. Right, the amount of 32P
incorporated into GST-c-Jun (1-79) was determined using a
PhosphoImager. Shown is a graph indicating differences in JNK activity
relative to the values obtained in cells transfected with Pyk2
expression vector alone. The values shown represent the average of at
least three separate experiments. C, 293T cells were
transfected with HA-tagged JNK1 (1 µg) together with pRK5 (1 µg),
Pyk2 (0.5 µg of Pyk2 + 0.5 µg of pRK5), Pyk2 (0.5 µg) plus
paxillin (Pax) (0.5 µg of pCMV-FLAG paxillin) in duplicate and Pyk2
(0.5 µg) plus Pax-Y31F/Y118F/Y187F (0.5 µg of pCMV-FLAG paxillin
Y31F/Y118F/Y187F) in duplicate, and JNK kinase assays were performed.
Phosphorylation of GST-c-Jun (1-79) and levels of HA-JNK1 are shown in
the left panel. Total cell lysates were blotted with
anti-FLAG antibodies (M2) to demonstrate the expression level of
FLAG-tagged paxillin constructs (right panel). Results shown
are from a representative experiment out of two with similar
results.
|
|
Recent evidence also suggested that Crk binding to paxillin might play
an important role in signaling by IGF-1 and growth hormone receptors
(43, 44). Paxillin contains three tyrosines (Tyr-31, Tyr-118, and
Tyr-181) in Tyr-X-X-Pro motifs that are optimal
for binding to the Crk-SH2 domain (45, 46). In addition, it is well
established that paxillin constitutively associates with Pyk2 (20, 27)
and could thus link Pyk2 to the Crk-mediated activation of JNK. In
order to test this hypothesis, we co-expressed Pyk2 with either
paxillin or a paxillin triple mutant in which Tyr-31, Tyr-118, and
Tyr-187 were mutated to phenylalanine. This mutant form of paxillin is
unable to bind to Crk (46). Overexpression of paxillin or paxillin
Y31F/Y118F/Y187F mutant did not significantly change the ability of
Pyk2 to induce JNK activation, suggesting that Crk binding to paxillin
does not link Pyk2 with the JNK pathway in 293T cells (Fig.
6C).
 |
DISCUSSION |
Pyk2 plays important roles in signal transmission from a broad
range of transmembrane receptors toward the MAP kinase module in
various cell types (12-33). The expression of dominant interfering mutants of Pyk2 has been shown to block ERK activation in response to
membrane depolarization, stimulation of bradykinin, lysophosphatidic acid, or adrenergic G-protein-coupled receptors (12, 14, 32). Pyk2
mutants were also shown to reduce the JNK signaling in response to
osmotic stress stimuli, UV irradiation or chemokine treatment (16, 33).
So far, very little is known about the signals downstream of Pyk2 that
mediate the selective activation of the ERK pathway versus
JNK pathway.
In the present study, we have identified Src, Grb2/Sos, and p130Cas/Crk
complexes as critical factors in coupling Pyk2 with the activation of
MAP kinase cascades (Fig. 7). A mutant
form of Pyk2 (Pyk2-Y402F) that is unable to bind and activate Src is impaired in its ability to induce association of Grb2 with Shc, binding
of Crk to p130Cas and stimulation of the ERK and JNK cascades. This is
supported with data showing that inhibition of Src kinases by
expression of Csk or Src kinase inactive mutants not only leads to
strong reduction of Pyk2 tyrosine phosphorylation and its association with Grb2, but also inhibits phosphorylation of p130Cas and activation of ERK and JNK induced by Pyk2 (Figs. 1-3 and 5) (14). The functional significance and mechanisms behind the formation of a Pyk2/Src complex
resemble those described for interactions between FAK and Src (47, 48).
Calalb et al. (49) have demonstrated that phosphorylation of
tyrosines 576 and 577 of FAK by Src is necessary for maximal FAK kinase
activity. These residues correspond to tyrosines 579 and 580 of human
Pyk2 and are located within the activation loop of the catalytic
domain, a region responsible for phosphorylation-dependent
regulation of protein kinase activity. The observation that Pyk2-Y402F
displays partially reduced kinase activity might also indicate that
phosphorylation in the catalytic domain of Pyk2 by activated Src is a
prerequisite for full kinase activity of Pyk2. It appears therefore
that the formation of a Pyk2-Src complex via binding to Tyr-402 might
have a dual function. On one hand, it allows Src to phosphorylate Pyk2
within the carboxyl terminus (Tyr-881) and probably within the
catalytic domain (Tyr-579 and Tyr-580), which promotes Grb2 binding and
enhances Pyk2 kinase activity, respectively. On the other hand,
activated Src bound to Pyk2 might directly phosphorylate adjacent
cellular proteins, such as Shc and p130Cas, and thus amplifies signals
from Pyk2 to downstream effectors. Therefore, it is not surprising that Pyk2-Y402F, which fails to complex with Src, is very weakly tyrosine-phosphorylated and is unable to induce phosphorylation of
other cellular proteins (Fig. 1).

View larger version (26K):
[in this window]
[in a new window]
|
Fig. 7.
Links between Pyk2 and MAP kinases. Pyk2
is activated by various transmembrane receptors via an increase in
intracellular Ca2+ and the activation of PKC. Upon
activation, Pyk2 transiently associates with Src by binding of the SH2
domain of Src to autophosphorylated Tyr-402 of Pyk2. This leads to the
activation of Src, which in turn phosphorylates Pyk2 and adjacent Shc
and p130Cas, thus creating direct binding sites for SH2 domains of
adaptor proteins Grb2 and Crk, respectively. Crk can recruit additional
proteins to the Pyk2 complex, such as C3G and DOCK180, leading to JNK
activation, whereas Grb2 translocates the guanine exchange factor Sos
necessary for Pyk2-induced ERK activation.
|
|
It is well established that a key event in regulation of the ERK
pathway is the translocation of an adaptor protein/Ras GEF complex,
such as Grb2/Sos, to the vicinity of membrane-localized Ras (4). In the
case of Pyk2, translocation of the Grb2/Sos complex is mediated by
direct binding of the SH2 domain of Grb2 to Tyr-881 of Pyk2 or by
association with the tyrosine-phosphorylated adaptor protein Shc (Fig.
2). Expression of Grb2 with a deletion of the amino-terminal SH3 domain
or the carboxyl-terminal tail of Sos led to strong inhibition of
Pyk2-induced ERK, but no JNK activation (Fig. 4). Hence, the Grb2/Sos
complex is largely necessary for stimulation of the ERK pathway upon
activation of Pyk2. These results are consistent with data showing that
Grb2 and Sos act downstream of Pyk2 and link lysophosphatidic acid and
bradykinin receptors with the ERK cascade (14). Surprisingly,
expression of Grb2 with a deletion of the carboxyl-terminal SH3 domain
also inhibited Pyk2-induced JNK activity (Fig. 3). This suggests the existence of additional effectors bound to the SH3 domain of Grb2 that
are involved in Pyk2-induced activation of JNK. It has been previously
observed that the C-SH3 domain of Grb2 binds only weakly to Sos
proline-rich sequences and is dispensable for signaling to the Ras
pathway in Drosophila (50-52). Furthermore, several biochemical evidence indicates that Grb2 SH3 domains have additional effectors and that multiple pools of Grb2 may exist in mammalian cells.
For example, Vav was found to associate primarily with the carboxyl
terminus, whereas C3G bound selectively to the amino-terminal SH3
domain of Grb2 (53). Vav contains a Dbl domain able to regulate Rho-like GTPases and thus acts as an upstream regulator of the JNK
pathway (54). In addition, the carboxyl-terminal SH3 domain of Grb2
binds strongly to proline-rich sequences of the hematopoietic progenitor kinase-1 (HPK1) (55). HPK1 is a serine/threonine protein
kinase that has been shown to interact with the mixed lineage kinase
(MLK3), which in turn, can stimulate MEKK4, thereby leading to the
activation of JNK (5, 56). Recent findings by Pomerance et
al. (57) indicate that the carboxyl-terminal SH3 domain of Grb2
can also bind directly to MEKK1 and thus links EGF receptors with JNK
activation. These findings suggest that Grb2 may couple to cytoplasmic
serine/threonine kinases via its carboxyl-terminal SH3 domain and
directly activate JNK.
Furthermore, our studies have revealed a new role for the p130Cas/Crk
complex in signaling by Pyk2. Recent data have shown that Pyk2
expression and activation can enhance the tyrosine phosphorylation of
p130Cas, which is constitutively bound to Pyk2 (27). In this report, we
show that Src, and not Pyk2 itself, mediates phosphorylation of p130Cas
and that formation of a p130Cas/Crk complex specifically links Pyk2
with the activation of JNK (Figs. 5 and 6). Once phosphorylated, p130Cas acts as a docking protein to recruit Crk and its effectors (58,
59). The SH3 domains of Crk bind to several effectors able to activate
JNK, including C3G, DOCK180, and Sos (60-62). Pioneering work by H. Hanafusa and co-workers (61) showed that transient expression of Crk
leads to the activation of JNK in 293T cells, which is mediated by the
guanine nucleotide exchange factor C3G. DOCK180 has previously been
implicated in up-regulation of the p130Cas/Crk-mediated signaling
pathways and was shown to activate Rac1 and JNK (34, 59, 63). Recent
evidence suggests that Sos may directly act as an GEF for Rac, which
could in turn activate the JNK signaling cascade (64). Consistent with
these observations, overexpression of Sos in Cos-7 cells leads to
activation of JNK (34). However, Pyk2-induced JNK activation was not
inhibited by expression of a dominant interfering form of Sos, whereas
ERK activity was efficiently blocked (Figs. 4 and 6). This suggests that Sos specifically links Pyk2 with the ERK, but not JNK, cascade in
293T cells. The fact that dominant interfering mutants of p130Cas and
Crk partial inhibited (up to 50-60%) Pyk2-induced JNK activation (Fig. 6), indicated to the presence of redundant signaling pathways involved in Pyk2-mediated JNK activation. Other cellular proteins bound
to Pyk2 might therefore be involved in regulation of the JNK cascade.
Paxillin is an adaptor protein that constitutively binds to the
carboxyl-terminal tail of Pyk2 (20, 27) and is complexed with Crk in
IGF-1 and growth hormone-stimulated cells (43, 44). These data indicate
that paxillin could couple Pyk2 with Crk-mediated JNK activation.
Expression of a paxillin mutant that cannot bind to Crk together with
Pyk2 had no effect on the ability of Pyk2 to activate JNK (Fig.
6C), indicating that Crk binding to paxillin is dispensable
for Pyk2-mediated JNK activation. In accordance with these data, it has
been recently shown that the CrkII/p130Cas, but not CrkII/paxillin,
complex formation is required for cytoskeleton organization and
anchorage-dependent DNA synthesis in Rat-1 fibroblasts (65).
Additional cellular proteins, such as Graf (the GTPase-activating
protein for Rho), Nirs (amino-terminal domain-interacting receptors),
and Pap proteins, were also shown to constitutively associate with Pyk2
and participate in broad range of signaling pathways in cells (28,
66-68). Whether they directly or indirectly participate in
Pyk2-induced JNK activation remains to be investigated.
In conclusion, these data indicate that Src acts in concert with
adaptor proteins Grb2 and p130Cas/Crk linking Pyk2 to ERK and JNK
pathways, respectively. The results of the present study fully support
a model in which the formation of Pyk2-Src complexes, by Src binding to
autophosphorylated Tyr-402, is critical for phosphorylation of Shc,
p130Cas, and Pyk2 itself (Fig. 7). Thereby, binding sites for SH2
domains of the adaptor proteins Grb2 and Crk are created, which in turn
recruit different effector proteins that activate ERK and JNK cascades.
The specificity in signaling by various Grb2 and Crk effector pathways
in different physiological processes remains to be further
investigated. One could anticipate that tissue-specific expression
and/or mutual interactions of Grb2 and Crk effectors will correlate
well with the threshold activation of a target pathway, ERK or JNK, in
a particular cell type and in response to specific stimuli.
 |
ACKNOWLEDGEMENTS |
We thank S. Courtneidge, C. Marshall, M. Karin, F. Giancotti, L. Rönnstrand, M. Gischitzky, A. Laudano, M. Matsuda, and H. Hirai for providing reagents. We also thank
J. Schlessinger for the initial support in the course of these studies.
 |
FOOTNOTES |
*
The costs of publication of this
article were defrayed in part by the
payment of page charges. The article
must therefore be hereby marked
"advertisement" in
accordance with 18 U.S.C. Section
1734 solely to indicate this fact.
These authors contributed equally to this work.
§
Supported by a fellowship from the Deutsche Forschungs Gemeinschaft.
Supported by a fellowship from the American-Italian Cancer Foundation.

A PEW Scholar in biomedical sciences and supported by National
Institutes of Health Grant CA71560.
§§
Research fellow of the Boehringer Ingelheim Fonds. To whom
correspondence should be addressed. Tel.: 46-18-160-403; Fax:
46-18-160-420; E-mail: Ivan.Dikic{at}licr.uu.se.
 |
ABBREVIATIONS |
The abbreviations used are:
MAP, mitogen-activated protein;
ERK, extracellular signal-regulated kinase;
JNK, c-Jun amino-terminal kinase;
GEF, guanine nucleotide exchange
factor;
FAK, focal adhesion kinase;
GST, glutathione
S-transferase;
MBP, myelin basic protein;
HA, hemagglutinin
antigen;
PKM, Pyk2 kinase inactive mutant;
PAGE, polyacrylamide
gel electrophoresis;
SH, Src homology;
Sos-CT, carboxyl-terminal
tail of sos.
 |
REFERENCES |
-
Robinson, M. J.,
and Cobb, M. H.
(1997)
Curr. Opin. Cell Biol.
9,
180-186[CrossRef][Medline]
[Order article via Infotrieve]
-
Marshall, C. J.
(1995)
Cell
80,
179-185[CrossRef][Medline]
[Order article via Infotrieve]
-
Karin, M.
(1995)
J. Biol. Chem.
270,
16483-16486[Free Full Text]
-
Schlessinger, J.
(1993)
Trends Biochem. Sci.
18,
273-275[CrossRef][Medline]
[Order article via Infotrieve]
-
Davis, R. J.
(1993)
J. Biol. Chem.
268,
14553-14556[Free Full Text]
-
Kyriakis, J. M.,
and Avruch, J.
(1996)
J. Biol. Chem.
271,
24313-24316[Free Full Text]
-
Treisman, R.
(1996)
Curr. Opin. Cell Biol.
8,
205-215[CrossRef][Medline]
[Order article via Infotrieve]
-
Polakis, P.,
and McCormick, F.
(1993)
J. Biol. Chem.
268,
9157-9160[Abstract/Free Full Text]
-
Cerione, R. A.,
and Zheng, Y.
(1996)
Curr. Opin. Cell Biol.
8,
216-222[CrossRef][Medline]
[Order article via Infotrieve]
-
Pawson, T.,
and Scott, J. D.
(1997)
Science
278,
2075-2080[Abstract/Free Full Text]
-
Neet, K.,
and Hunter, T.
(1996)
Genes Cells
1,
147-169[Abstract]
-
Lev, S.,
Moreno, H.,
Martinez, R.,
Canoll, P.,
Peles, E.,
Musacchio, J. M.,
Plowman, G. D.,
Rudy, B.,
and Schlessinger, J.
(1995)
Nature
376,
737-745[CrossRef][Medline]
[Order article via Infotrieve]
-
Dikic, I.,
Dikic, I.,
and Schlessinger, J.
(1998)
J. Biol. Chem.
273,
14301-14308[Abstract/Free Full Text]
-
Dikic, I.,
Tokiwa, G.,
Lev, S.,
Courtneidge, S. A.,
and Schlessinger, J.
(1996)
Nature
383,
547-550[CrossRef][Medline]
[Order article via Infotrieve]
-
Siciliano, J. C.,
Toutant, M.,
Derkinderen, P.,
Sasaki, T.,
and Girault, J. A.
(1996)
J. Biol. Chem.
271,
28942-28946[Abstract/Free Full Text]
-
Tokiwa, G.,
Dikic, I.,
Lev, S.,
and Schlessinger, J.
(1996)
Science
273,
792-794[Abstract]
-
Avraham, S.,
London, R.,
Fu, Y.,
Ota, S.,
Hiregowdara, D.,
Li, Y.,
Jiang, S.,
Pasztor, L. M.,
White, R. A.,
Groopman, J. E.,
and Avraham, H.
(1995)
J. Biol. Chem.
270,
27742-27751[Abstract/Free Full Text]
-
Ganju, R. K.,
Hatch, W. C.,
Avraham, H.,
Ona, M. A.,
Druker, B.,
Avraham, S.,
and Groopman, J. E.
(1997)
J. Exp. Med.
185,
1055-1064[Abstract/Free Full Text]
-
Qian, D.,
Lev, S.,
van Oers, N. S. C.,
Dikic, I.,
Schlessinger, J.,
and Weiss, A.
(1997)
J. Exp. Med.
185,
1253-1259[Abstract/Free Full Text]
-
Gismondi, A.,
Bisogno, L.,
Mainiero, F.,
Palmieri, G.,
Piccoli, M.,
Frati, L.,
and Santoni, A.
(1997)
J. Immunol.
159,
3364-3372[Abstract]
-
Raja, S.,
Avraham, S.,
and Avraham, H.
(1997)
J. Biol. Chem
272,
10941-10947[Abstract/Free Full Text]
-
Davis, C.,
Dikic, I.,
Unutmaz, D.,
Hill, C. M.,
Arthos, J.,
Siani, M.,
Thompson, D. A.,
Schlessinger, J.,
and Littman, D. R.
(1997)
J. Exp. Med.
186,
1793-1798[Abstract/Free Full Text]
-
Miyazaki, T.,
Takaoka, A.,
Noqueira, L.,
Dikic, I.,
Fujii, H.,
Tsujino, S.,
Mitani, Y.,
Maeda, M.,
Schlessinger, J.,
and Taniguchi, T.
(1998)
Genes Dev.
12,
770-775[Abstract/Free Full Text]
-
Astier, A.,
Manie, S. N.,
Avraham, H.,
Hirai, H.,
Law, S. F.,
Zhang, Y.,
Golemis, E. A.,
Fu, Y.,
Druker, B. J.,
Haghayeghi, N.,
Freedman, A. S.,
and Avraham, S.
(1997)
J. Biol. Chem.
272,
19719-19724[Abstract/Free Full Text]
-
Li, X.,
Hunter, D.,
Morris, J.,
Haskill, J. S.,
and Earp, H. S.
(1998)
J. Biol. Chem.
273,
9361-9364[Abstract/Free Full Text]
-
Okazaki, H.,
Zhang, J.,
Hamawy, M. M.,
and Siraganian, R. P.
(1997)
J. Biol. Chem.
272,
32443-32447[Abstract/Free Full Text]
-
Salgia, R.,
Avraham, S.,
Pisick, E.,
Li, J-L.,
Raja, S.,
Greenfield, E. A.,
Sattler, M.,
Avraham, H.,
and Griffin, J. D.
(1996)
J. Biol. Chem.
271,
31222-31226[Abstract/Free Full Text]
-
Ohba, T.,
Ishino, M.,
Aoto, H.,
and Sasaki, T.
(1998)
Biochem. J.
330,
1249-1254
-
Matsuya, M.,
Sasaki, H.,
Aoto, H.,
Mitaka, T.,
Nagura, K.,
Ohba, T.,
Ishino, M.,
Takahashi, S.,
Suzuki, R.,
and Sasaki, T.
(1998)
J. Biol. Chem.
273,
1003-1014[Abstract/Free Full Text]
-
Hatch, W. C.,
Ganju, R. K.,
Hiregowdara, D.,
Avraham, S.,
and Groopman, J. E.
(1998)
Blood
91,
3967-3973[Abstract/Free Full Text]
-
Yu, H.,
Li, X.,
Marchetto, G. S.,
Dy, R.,
Hunter, D.,
Calvo, B.,
Dawson, T. L.,
Wilm, M.,
Anderegg, R. J.,
Graves, L. M.,
and Earp, H. S.
(1996)
J. Biol. Chem.
271,
29993-29998[Abstract/Free Full Text]
-
Della Rocca, G. J.,
van Biesen, T.,
Daaka, Y.,
Luttrell, D. K.,
Luttrell, L. M.,
and Lefkowitz, R. J.
(1997)
J. Biol. Chem.
272,
19125-19132[Abstract/Free Full Text]
-
Ganju, R. K.,
Dutt, P.,
Wu, L.,
Newman, W.,
Avraham, H.,
Avraham, S.,
and Groopman, J. E.
(1998)
Blood
91,
791-797[Abstract/Free Full Text]
-
Dolfi, F.,
Garzia-Guzman, M.,
Ojaniemi, M.,
Nakamura, H.,
Matsuda, M.,
and Vuori, K.
(1998)
Proc. Natl. Acad. Sci. U. S. A.
95,
15394-15399[Abstract/Free Full Text]
-
Klemke, R. L.,
Leng, J.,
Molander, R.,
Brooks, P. C.,
Vuori, K.,
and Cheresh, D. A.
(1998)
J. Cell Biol.
140,
961-972[Abstract/Free Full Text]
-
Matsuda, M.,
Tanaka, S.,
Nagata, S.,
Kojima, A.,
Kurata, T.,
and Shibuya, M.
(1992)
Mol. Cell. Biol.
12,
3482-3489[Abstract/Free Full Text]
-
Nakamoto, T.,
Sakai, R.,
Ozawa, K.,
Yazaki, Y.,
and Hirai, H.
(1996)
J. Biol. Chem.
271,
8959-8965[Abstract/Free Full Text]
-
Dikic, I.,
Batzer, A. G.,
Blaikie, P.,
Obermeier, A.,
Ullrich, A.,
Schlessinger, J.,
and Margolis, B.
(1995)
J. Biol. Chem.
270,
15125-15129[Abstract/Free Full Text]
-
Felsch, J. S.,
Cachero, T. G.,
and Peralta, E. G.
(1998)
Proc. Natl. Acad. Sci. U. S. A.
95,
5051-5056[Abstract/Free Full Text]
-
Gishizky, M. L.,
Cortez, D.,
and Pendergast, A. M.
(1995)
Proc. Natl. Acad. Sci. U. S. A.
92,
10889-10893[Abstract/Free Full Text]
-
Xie, Y.,
Pendergast, A. M.,
and Hung, M. C.
(1995)
J. Biol. Chem.
270,
30717-30724[Abstract/Free Full Text]
-
Sakai, R.,
Iwamatsu, A.,
Hirano, N.,
Ogawa, S.,
Tanaka, T.,
Mano, H.,
Yazaki, Y.,
and Hirai, H.
(1994)
EMBO J.
13,
3748-3756[Medline]
[Order article via Infotrieve]
-
Butler, A. A.,
Blakesley, V. A.,
Koval, A.,
deJong, R.,
Groffen, J.,
and LeRoith, D.
(1997)
J. Biol. Chem.
272,
27660-27664[Abstract/Free Full Text]
-
Zhu, T.,
Goh, E. L.,
LeRoith, D.,
and Lobie, P.
(1998)
J. Biol. Chem.
273,
33864-33875[Abstract/Free Full Text]
-
Songyang, Z.,
Shoelson, S. E.,
Chaudhuri, M.,
Gish, G.,
Pawson, T.,
Haser, W. G.,
King, F.,
Roberts, T.,
Ratnofsky, S.,
Lechleider, R. J.,
et al..
(1993)
Cell
72,
767-778[CrossRef][Medline]
[Order article via Infotrieve]
-
Salgia, R.,
Uemura, N.,
Okuda, K.,
Li, J. L.,
Pisick, E.,
Sattler, M.,
de Jong, R.,
Druker, B.,
Heisterkamp, N.,
Chen, L. B.,
and Groffen, J.
(1995)
J. Biol. Chem.
270,
29145-29150[Abstract/Free Full Text]
-
Schlaepfer, D. D.,
and Hunter, T.
(1998)
Trends Cell Biol.
8,
151-157[CrossRef][Medline]
[Order article via Infotrieve]
-
Schlaepfer, D. D.,
and Hunter, T.
(1996)
Mol. Cell. Biol.
16,
5623-5633[Abstract]
-
Calalb, M. B.,
Polte, T. R.,
and Hanks, S. K.
(1995)
Mol. Cell. Biol.
15,
954-963[Abstract]
-
Wu, X.,
Knudsen, B.,
Feller, S.,
Zheng, J.,
Sali, A.,
Cowburn, D.,
Hanafusa, H.,
and Kuriyan, J.
(1995)
Structure
3,
215-226[Medline]
[Order article via Infotrieve]
-
Simon, J. A.,
and Schreiber, S. L.
(1995)
Chem. Biol.
2,
53-56[CrossRef][Medline]
[Order article via Infotrieve]
-
Raabe, T.,
Olivier, J. P.,
Dickson, B.,
Liu, X.,
Gish, G. D.,
Pawson, T.,
and Hafen, E.
(1995)
EMBO J.
14,
2509-2518[Medline]
[Order article via Infotrieve]
-
Smit, L.,
van der Horst, G.,
and Borst, J.
(1996)
J. Biol. Chem.
271,
8564-8569[Abstract/Free Full Text]
-
Cantrell, D.
(1998)
Curr. Biol.
8,
535-538
-
Anafi, M.,
Kiefer, F.,
Gish, G. D.,
Mbamalu, G.,
Iscove, N. N.,
and Pawson, T.
(1997)
J. Biol. Chem.
272,
27804-27811[Abstract/Free Full Text]
-
Kiefer, F.,
Tibbles, L. A.,
Anafi, M.,
Janssen, A.,
Zanke, B. W.,
Lassam, N.,
Pawson, T.,
Woodgett, J. R.,
and Iscove, N. N.
(1996)
EMBO J.
15,
7013-7025[Medline]
[Order article via Infotrieve]
-
Pomerance, M.,
Multon, M.-C.,
Parker, F.,
Venot, C.,
Blondeau, J.-P.,
Tocque, B.,
and Schweghoffer, F.
(1998)
J. Biol. Chem.
273,
24301-24304[Abstract/Free Full Text]
-
Vuori, K.,
Hirai, H.,
Aizawa, S.,
and Ruoslahti, E.
(1996)
Mol. Cell. Biol.
16,
2606-2613[Abstract]
-
Kiyokawa, E.,
Hashimoto, Y.,
Kurata, T.,
Sugimura, H.,
and Matsuda, M.
(1998)
J. Biol. Chem.
273,
24479-24484[Abstract/Free Full Text]
-
Kiyokawa, E.,
Mochizuki, N.,
Kurata, T.,
and Matsuda, M.
(1997)
Crit. Rev. Oncog.
8,
329-342[Medline]
[Order article via Infotrieve]
-
Tanaka, S.,
Ouchi, T.,
and Hanafusa, H.
(1997)
Proc. Natl. Acad. Sci. U. S. A.
94,
2356-2361[Abstract/Free Full Text]
-
Posern, G.,
Zheng, J.,
Knudsen, B. S.,
Kardinal, C.,
Muller, K. B.,
Voss, J.,
Shishido, T.,
Cowburn, D.,
Cheng, G.,
Wang, B.,
Kruh, G. D.,
Burrell, S. K.,
Jacobson, C. A.,
Lenz, D. M.,
Zamborelli, T. J.,
Adermann, K.,
Hanafusa, H.,
and Feller, S. M.
(1998)
Oncogene
16,
1903-1912[CrossRef][Medline]
[Order article via Infotrieve]
-
Kiyokawa, E.,
Hashimoto, Y.,
Kobayashi, S.,
Sugimura, H.,
Kurata, T.,
and Matsuda, M.
(1998)
Genes Dev.
12,
3331-3336[Abstract/Free Full Text]
-
Nimnual, A. S.,
Yatsula, B. A.,
and Bar-Sagi, D.
(1998)
Science
279,
560-563[Abstract/Free Full Text]
-
Nakashima, N.,
Rose, D. W.,
Xiao, S.,
Egawa, K.,
Martin, S. S.,
Haruta, T.,
Saltiel, A. R.,
and Olefsky, J. M.
(1999)
J. Biol. Chem.
274,
3001-3008[Abstract/Free Full Text]
-
Hildebrand, J. D.,
Taylor, J. M.,
and Parsons, J. T.
(1996)
Mol. Cell. Biol.
16,
3169-3178[Abstract]
-
Lev, S.,
Hernandez, J.,
Martinez, R.,
Chen, A.,
Plowman, G.,
and Schlessinger, J.
(1999)
Mol. Cell. Biol.
19,
2278-2288[Abstract/Free Full Text]
-
Andreev, J.,
Simon, J.-P.,
Sabatini, D. D.,
Kam, J.,
Plowman, G.,
Randazzo, P. A.,
and Schlessinger, J.
(1999)
Mol. Cell. Biol.
19,
2338-2350[Abstract/Free Full Text]
Copyright © 1999 by The American Society for Biochemistry and Molecular Biology, Inc.