![]()
|
|
||||||||
J Biol Chem, Vol. 274, Issue 22, 15375-15381, May 28, 1999
From the Institut für Biochemie und Molekulare Zellbiologie, Abteilung Biochemie II, Universität Göttingen, Gosslerstrasse 12d, 37073 Göttingen, Germany
| |
ABSTRACT |
|---|
|
|
|---|
The catalytic residue of eukaryotic and
prokaryotic sulfatases is a Mammalian sulfatases (see Ref. 1) are involved in the
turnover of endogenous sulfated substrates. Sulfatases of lower
eukaryotes and bacteria, on the other hand, are expressed under
conditions of sulfur starvation and function in sulfate scavenging from
exogenous substrates (2). Despite their different functions all these sulfatases form a highly conserved protein family showing strong homology on the level of both primary (3, 4) and three-dimensional structure (5, 6). Furthermore, sulfatases of prokaryotic, lower
eukaryotic, and human origin share a unique amino acid residue, a
In eukaryotic sulfatases the FGly is generated in the endoplasmic
reticulum by oxidation of a conserved cysteine residue (14, 15). This
oxidation occurs during or shortly after translocation of the nascent
polypeptide into this compartment and is directed by a linear sequence
motif starting with the residue to be modified. As shown in
vitro for human arylsulfatase A (16), this motif consists of the
dodecamer sequence CTPSRAALLTGR comprising an essential core element
(CXPXR) and a stimulating auxiliary element (AALLTGR). The core element is fully conserved, and the auxiliary element is partially conserved, among all eukaryotic members of the
sulfatase family and also in the well characterized sulfatase of
Pseudomonas aeruginosa (17).
Unlike this prokaryotic cysteine-type sulfatase, which is located in
the cytosol, the other well characterized prokaryotic sulfatase, the
arylsulfatase of Klebsiella pneumoniae (18), is a
serine-type sulfatase, which is located in the periplasm and which
carries a FGly residue that is generated by oxidation of a serine
rather than a cysteine (7). Nevertheless, the two sequence motifs
(SXPXR and SMLLTGN) are also conserved in the Klebsiella sulfatase. After expression of this protein under
strongly inducing conditions, 60% of the polypeptides carried the FGly residue, and the remaining 40% carried the serine predicted from the
DNA sequence (7).
Conversion of serine to FGly obviously is catalyzed also by
Escherichia coli, since the Klebsiella sulfatase
can be expressed in E. coli as an active enzyme (18). This
organism furthermore is able to quantitatively oxidize cysteine 51 to
FGly after overexpression of the cysteine-type sulfatase of P. aeruginosa (8). Surprisingly, no FGly modification was observed
when a mutant of the Pseudomonas sulfatase was expressed, in
which cysteine 51 was substituted by a serine. This suggests that
E. coli harbors two FGly generating systems or that a common
modification system is modulated by a cofactor (8).
Transformation of E. coli with the structural gene encoding
the Pseudomonas sulfatase (atsA) is sufficient to
obtain catalytically active and FGly-containing sulfatase protein.
Active expression of the Klebsiella sulfatase, however, was
reported to require not only the sulfatase gene (atsA) but
in addition an adjacent non-sulfatase gene termed atsB (18).
AtsB therefore was considered to function as a positive regulator of
sulfatase expression in Klebsiella. In the present study we
characterized this regulation in more detail. Data presented here show
that regulation by AtsB is not due to a function as a transcriptional
activator, as had been suggested originally (19, 20). AtsB rather plays
a crucial role in a posttranslational event, namely the conversion of
serine 72 to FGly.
Cloning of the atsBA Operon--
Genomic DNA of K. pneumoniae DSM 681 (Deutsche SammLung von Mikroorganismen,
Braunschweig, Germany) was prepared according to Ref. 21. For
generation of a subgenomic bank, 110 µg of genomic DNA were digested
with BamHI. After Southern blotting of 10% of the digest, a
positive signal was obtained in the 6.8-kbp region using a 585-bp probe
generated by PCR amplification of atsA nucleotides 2495-3079 (see Ref. 18) and labeled with [ Protein Expression and Purification--
For protein expression
the single atsA and atsB and also the bicistronic
atsBA ORFs were placed under control of the lac
promoter of pBluescript II KS or pBBR1MCS (22) (see Fig. 1). To
facilitate insertion into the multi cloning sites of these vectors we
introduced a BamHI site 3' of the atsA
stop codon (noncoding primer: CGGGATCCGGAAGAACGATAGCCGTGGTGG) and a
HindIII or KpnI site directly 5' of the ribosome
binding sites of atsA (coding primer:
CCCAAGCTTGAACAGGAGAGTCAGTCGTGA) or atsB (coding primer:
GGGGTACCAACAGTACCGGTCATTAACCG), respectively, using PCR methods.
Disruption of the atsB ORF was achieved after deletion of a
882-bp NheI/StuI fragment and in-frame religation of the blunted ends (see Fig. 1).
To facilitate purification of the expressed sulfatase protein, a
C-terminal Arg-Gly-Ser-(His)6 tag was added to the AtsA
protein. This was achieved after adding a corresponding
oligonucleotide (noncoding sequence:
CGGGATCCTAGTGATGGTGATGGTGATGCGATCCTCT) to the last
atsA codon and subcloning of the PCR product as a
XhoI/BamHI fragment back into the corresponding
template plasmid.
Protein expression was achieved after transforming E. coli
DH5 Protein Analysis--
Expression of the recombinant sulfatase
protein was quantitated by Western blotting using polyclonal antibodies
raised against the native arylsulfatase protein purified from
Klebsiella (7). The used antibodies showed no
cross-reactivity with E. coli antigens after purification of
the antiserum by pre-adsorption to immobilized E. coli
protein. Protein determinations were carried out according to Bradford
or Lowry (23, 24). The activity of the recombinant sulfatase was
determined in duplicate assays using p-nitrocatechol sulfate
as a substrate (7). It was verified that these determinations were
carried out under initial rate conditions at saturating substrate concentration (Vmax determinations).
The purified AtsA-His6 protein was almost devoid of any
contaminating proteins (>95% purity), as checked by SDS-PAGE (Fig. 3,
A and C) and RP-HPLC on a C4 column (not shown).
The presence of FGly at the protein level was determined after
subjecting the purified AtsA-His6 protein to treatment with
NaB[3H]H4 under denaturing conditions,
desalting, SDS-PAGE, and fluorography (Fig. 3, A and
C), as had been described previously (8). The presence of
FGly at the peptide and amino acid level was determined after tryptic
digestion of AtsA-His6 protein, treated or not with NaB[3H]H4, and purification of tryptic
peptides by RP-HPLC, which was performed as described (8). Fractions
from RP-HPLC were analyzed by liquid scintillation counting, amino acid
sequencing, radiosequencing, and matrix-assisted laser desorption
ionization mass spectrometry using indole-2-carboxylic acid and
p-nitroaniline as a matrix (8, 10).
Cloning of the atsBA Operon--
In order to study the role of the
atsB gene on expression of active Klebsiella
arylsulfatase, encoded by the atsA gene, we needed the
cloned atsBA operon. Since the atsBA plasmid
described previously (18) was not available, we generated a subgenomic bank of Klebsiella DNA and identified the entire
atsBA operon on a 6.8-kbp BamHI fragment (see
"Experimental Procedures"). The DNA sequence of a subcloned 3832-bp
BamHI/XcmI fragment (accession number AJ131525)
revealed that the atsB ORF codes for an iron sulfur protein
consisting of 395 amino acid residues, i.e. 10 residues less
than published previously (Ref. 18, GenBankTM accession
number M31938), and lacking a signal peptide (Fig. 1). The atsA ORF, on the other
hand, encodes the arylsulfatase protein consisting of 577 amino acid
residues, i.e. 113 residues more than published by Murooka
et al. (18), and including a 20 residues signal peptide
directing translocation of this protein into the periplasm (Fig. 1).
The correctness of the revised atsA sequence was verified on
the protein level by mass spectrometry and amino acid sequencing of
several tryptic peptides of purified Klebsiella
arylsulfatase protein (7), including peptide 44 (GLTAGDAPWQ, residues
487-496), which is located within the extra 113 residues predicted
from the revised DNA sequence. This C-terminal part of the protein was
found to be essential for enzyme activity (data not shown). The protein
sequence directly following the serine 72 to be converted to FGly
(SAPARSMLLTGN, residues 72-83) is homologous to the sequence motif
directing FGly modification in human arylsulfatase A (Ref. 16, see
Introduction).
Expression of Active AtsA in E. coli Depends on Coexpression of
AtsB--
Although E. coli carries three sulfatase-related
genes (25), active endogenous sulfatases have not yet been found in
this species. Transformation of E. coli with the
atsA gene of P. aeruginosa (8) or with the
Klebsiella atsBA operon (18), however, leads to the
expression of active arylsulfatases. Since in prokaryotes arylsulfatase
expression is repressed during growth in the presence of sulfate, we
cloned the atsBA operon without its endogenous promoter into
an expression vector downstream of the lac promoter (Fig.
1), allowing controlled expression at logarithmic growth in
Luria-Bertani medium. E. coli DH5
AtsB and AtsA are coexpressed from a bicistronic transcript. Since we
wanted to study AtsA and AtsB independently, we cloned each of the two
ORFs separately downstream of the lac promoter into two
vectors carrying different selection markers, thus allowing selection
of double transformants. The AtsA protein expressed by these double
transformants showed a similar specific activity when compared with the
bicistronic expression, as concluded from the activities and Western
blot signals determined (Fig. 2A, lanes 1 and
2).
Most interestingly, expression of atsA alone did not
lead to any detectable sulfatase activity (<1 milliunits/mg of cell
protein), although the AtsA protein was produced at normal levels (Fig. 2A, lane 3). Since expression of atsB
alone also did not lead to any sulfatase activity (Fig. 2A,
lane 4), it has to be concluded that the atsB
gene product has a posttranslational function that is essential for the
AtsA arylsulfatase to gain its enzymatic activity. The dependence of
active AtsA expression on a functional atsB gene was
confirmed by the bicistronic expression of atsA together
with an atsB fragment that carried a 882-bp in-frame deletion corresponding to amino acid residues 89-382 of AtsB (see Fig.
1). As a consequence of this deletion, no arylsulfatase activity was
measurable, although the AtsA protein was present (Fig. 2A, lane 5). This rules out that the dissection of the
bicistronic gene organization abolished active AtsA expression. The
atsB gene product rather acts in trans on the
AtsA protein, as shown by the coexpression of AtsB and AtsA from two
different plasmids.
Generation of FGly Depends on AtsB--
In order to analyze the
expressed AtsA protein for the presence of FGly in position 72, the
recombinant arylsulfatase had to be purified. To facilitate
purification we expressed the AtsA protein in a His-tagged form
(AtsA-His6). This protein showed a similar catalytic
activity as wild-type AtsA (Fig. 2B, compare lanes 1 and
2). The AtsA-His6 protein was purified from the
periplasm of the cells by chromatography on nickel-agarose, yielding a
homogenous protein preparation (>95% purity), as checked by SDS-PAGE
(Fig. 3A) and RP-HPLC (not shown). This preparation showed a
specific enzymatic activity of 73 units/mg of purified protein (Fig.
2B, lane 4). As expected, the
AtsA-His6 protein purified from E. coli expressing only the structural gene but not the atsB gene
showed no activity (Fig. 2B, lane 3, and Fig.
3C).
To examine whether serine 72 was converted to FGly, the purified
AtsA-His6 proteins, expressed in the absence
(AtsA-His6(
To determine the FGly content in the recombinant
AtsA-His6(+B) protein, we analyzed its tryptic peptides
without prior treatment of the protein with
NaB[3H]H4. In the HPLC chromatogram a peptide
with a mass of 1588 Da was identified eluting at a 0.4 min earlier
retention time than the 1590-Da P2 (Fig.
5, A-C). A mass of 1587.8 Da
is predicted for the FGly 72-containing form of peptide 2 (P2*). The
presence of the FGly was verified when using p-nitroaniline
as a matrix for matrix-assisted laser desorption ionization mass
spectrometry, which led to a mass of 1708 Da for P2* (Fig.
5D). The increase in mass by 120 Da, which was not observed
for P2 (Fig. 5E), is due to a Schiff base formation of
p-nitroaniline and the formyl group of P2* (7-10). The
presence of the FGly in P2* could also be demonstrated by amino acid
sequencing. Whereas the entire sequence of P2 could be determined (Fig.
5G), almost no recovery of the residues C-terminal of position 72 (X in Fig. 5F) was observed in the case of P2*.
In addition, the signal for methionine 71 was reduced in P2*. The
presence of a FGly residue is known to block Edman degradation at the
position of the FGly and to reduce its efficiency in the preceding
cycle (7-10). From the sequencing data (Fig. 5, F and
G) the FGly content of AtsA-His6(+B) was
calculated to be 48 ± 2%. Thus, the modification degree observed
for the recombinant sulfatase in E. coli is similar to the
degree of 60% determined previously for the protein purified from
Klebsiella (7).
The present study demonstrates that the atsB gene
product is required for FGly modification in the arylsulfatase of
K. pneumoniae. This modification is a prerequisite for
sulfatase activity, as had been shown previously for other pro- and
eukaryotic sulfatases (8-10). In the absence of a functional
atsB gene inactive sulfatase polypeptides were synthesized
lacking the FGly. In the presence of atsB, however, 48% of
the recombinant sulfatase molecules, expressed in His-tagged form in
E. coli, carried the FGly leading to an overall specific
activity of 73 units/mg of purified protein. This approximately agrees
with the modification efficiency of 60% and a specific activity of 123 units/mg determined for the wild-type protein purified from K. pneumoniae. Extrapolated to 100% FGly content, activities of 152 or 205 units/mg, respectively, are calculated for the two protein
preparations. These results rule out that AtsB acts as a
transcriptional activator, as had been suggested originally (19, 20).
AtsB rather plays an essential role in the posttranslational oxidation
of a conserved serine to FGly.
The data, furthermore, show that FGly formation involves an
enzyme-mediated process. This agrees with the finding that in man a
genetic defect is the cause for the lack of FGly in sulfatases from
multiple sulfatase deficiency patients (10, 13). In E. coli,
absence of AtsB does not lead to a general deficiency of FGly
formation. While oxidation of serine to FGly is abolished under these
conditions, oxidation of cysteine in the sulfatase of P. aeruginosa occurs with maximum efficiency (8). Thus, E. coli obviously harbors a second FGly-generating system that is
independent of atsB and may specifically oxidize cysteine
but not serine. The latter is concluded from the observation that substitution of the critical cysteine by serine abolished FGly formation in the Pseudomonas sulfatase (8). Whether or not the Klebsiella atsB gene would promote FGly formation in
this substitution mutant remains to be investigated. Modification of both serine-type and cysteine-type sulfatases most likely occurs in the
cytosol, since in the former case the AtsB protein, and in the latter
case the sulfatase itself, lack a signal peptide.
Although no endogenous sulfatase activity has ever been measured
in E. coli, this species carries two genes encoding putative serine-type sulfatases termed aslA and f571
(GenBankTM accession numbers M87049 and U00096). Like the
Klebsiella atsA gene, also aslA and
f571 have an adjacent gene in the same operon
(aslB and f390, respectively) encoding an AtsB
homolog of about 400 amino acids (25). These homologs did not take over function in the absence of AtsB. All three AtsB homologs are 34-41% identical and represent iron sulfur proteins that comprise three conserved cysteine clusters, each consisting of 3-5 cysteines with
short and conserved distances between these cysteines (25). Most iron
sulfur proteins are involved in redox reactions and function as
electron transfer proteins (26). Therefore we speculate that also AtsB
functions as an oxidoreductase oxidizing the critical serine of the
unfolded sulfatase polypeptide during or shortly after synthesis and,
at the same time, transferring electrons to an acceptor molecule. AtsB
may act directly on the sulfatase polypeptide or may oxidize and
thereby regenerate the electron acceptor.
The role of AtsB homologs in sulfatase activation is highlighted by a
paper reporting that Bacteroides thetaiotaomicron mutated in
the atsB-related chuR gene is defective in the
utilization of two sulfated substrates, namely chondroitin sulfate and
heparin (27). No chondroitin sulfatase activity was detectable in this mutant, which, however, was ascribed to transcriptional regulation of
chondroitin sulfate and heparin utilizing genes by chuR.
Further AtsB homologs that are similar in size, but carry only 1 or 2 cysteine clusters, can also be found among a group of proteins involved
in the synthesis of cofactors such as PQQ, molybdopterin, Fe-Mo
cofactor, tungsten cofactor, or heme d1 (28-32).
Interestingly, one of the homologs without known function is YidF of
E. coli and is encoded in the yid operon also
coding for the cysteine-type sulfatase YidJ (33). YidF is a 165-amino
acids protein showing 19% identity to the C-terminal half of AtsB. It
may therefore be involved in FGly modification of cysteine-type
sulfatases (25).
-formylglycine. In the sulfatase of
Klebsiella pneumoniae the formylglycine is generated by
posttranslational oxidation of serine 72. We cloned the
atsBA operon of K. pneumoniae and found that
the sulfatase was expressed in inactive form in Escherichia coli transformed with the structural gene (atsA).
Coexpression of the atsB gene, however, led to production
of high sulfatase activity, indicating that the atsB gene
product plays a posttranslational role that is essential for the
sulfatase to gain its catalytic activity. This was verified after
purification of the sulfatase from the periplasm of the cells. Peptide
analysis of the protein expressed in the presence of AtsB revealed that
half of the polypeptides carried the formylglycine at position 72, while the remaining polypeptides carried the encoded serine. The
inactive sulfatase expressed in the absence of AtsB carried exclusively
serine 72, demonstrating that the atsB gene is required for
formylglycine modification. This gene encodes a 395-amino acid residue
iron sulfur protein that has a cytosolic localization and is supposed to directly or indirectly catalyze the oxidation of the serine to formylglycine.
![]()
INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES
-formylglycine (FGly),1
that is essential for catalytic activity (7-10). Like the FGly all
other putative active site residues are conserved (11). This reflects
the importance of the catalytic mechanism underlying sulfate
ester cleavage, during which the FGly acts as the catalytic residue (6,
12). Failure to generate the FGly residue is the cause of multiple
sulfatase deficiency, a rare but fatal human lysosomal storage disorder
(10, 13).
![]()
EXPERIMENTAL PROCEDURES
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES
-32P]dCTP
(Rediprime DNA Labeling, Amersham Pharmacia Biotech). After electrophoretic separation of the remaining digest, 5-8-kbp fragments were recovered from the gel, cloned into pBluescript II KS (Stratagene) and transformed into E. coli DH5
by electroporation.
Positive clones were identified first by colony hybridization using the probe described above and, second, by sulfatase assays using
5-bromo-6-chloro-3-indoxyl sulfate (Biosynth) or
p-nitrocatechol sulfate (Sigma) as a substrate (7, 17). The
atsA and atsB ORFs were localized by restriction mapping (cf. Ref. 18) and DNA sequencing. Thereby it turned out that the atsB ORF was 30 bp shorter and the
atsA ORF 339 bp longer than published previously (18). The
entire atsBA operon was subcloned as a 3832-bp
BamHI/XcmI fragment (clone pATSBA#R5), and both
DNA strands were sequenced using Big-Dye Terminator Cycle Sequencing
(Perkin-Elmer Biosystems). The sequence obtained was deposited in the
EBI data base (accession number AJ131525).
with pBluescript II KS containing the described ats
constructs. For coexpression of atsA and atsB
from two different plasmids (Fig. 2A) a double
transformation was performed using atsA cloned into pBBR1MCS
and atsB cloned into pBluescript II KS. Double transformants were selected due to their ampicillin and chloramphenicol resistance. The presence of the two genes was verified by PCR analysis. The transformed cells were grown aerobically in Luria-Bertani medium with
constant shaking at 37 °C. After 2-3 h 1 mM isopropyl
thiogalactopyranoside was added and growth continued for another 5-6
h. Preparation of periplasm from these cells and purification of the
His6-tagged proteins on nickel-nitrilotriacetic
acid-agarose (Qiagen) under native conditions was carried out according
to the protocols (The QIAexpressionist) given by the manufacturer.
![]()
RESULTS
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

View larger version (14K):
[in a new window]
Fig. 1.
Cloning of the atsB and
atsA ORFs downstream of the lac
promoter. The atsBA operon was subcloned from a
genomic 6.8-kbp BamHI fragment into pBluescript II KS (see
"Experimental Procedures"). For this purpose a 3' BamHI,
a 5' KpnI, and an intercistronic HindIII site
were introduced, the latter two sites directly upstream of the ribosome
binding sites (RBS) of atsB and atsA.
Thereby the contiguous atsBA cistrons, as shown in the
scheme, or each of the two ORFs could be placed under control of the
lac promoter. The atsB gene encodes a cytosolic
protein consisting of 395 amino acids. This ORF was disrupted and
religated in frame after deleting 882 bp between the blunted
NheI and the StuI site, as indicated. This
construct is referred to as atsBdelA
(see Fig. 2A). The atsA gene encodes a
periplasmic protein consisting of 577 amino acids including a signal
peptide (SP) of 20 residues. The start and stop codons are
given below the scheme and, in addition, the triplett encoding the
serine 72 of AtsA, which undergoes FGly modification. The wild-type
atsBA sequence was deposited in the EBI data base (accession
number AJ131525).
transformed with the
atsBA plasmid was found to express high arylsulfatase
activities reaching a maximum of 2-3 units/mg of cell protein after
aerobic growth for 5-6 h in the presence of isopropyl
thiogalactopyranoside (Fig. 2A, lane 1). The
recombinant AtsA protein was detected by Western blotting using
antibodies against the purified Klebsiella arylsulfatase (Fig. 2) and was found to be located in the periplasm (not shown). Its
electrophoretic mobility was in agreement with the predicted mass of
62,230 Da (Figs. 2 and 3A) and
was identical to the mobility of the arylsulfatase purified from
Klebsiella (not shown).

View larger version (26K):
[in a new window]
Fig. 2.
Active expression of Klebsiella
sulfatase depends on coexpression of AtsB. A, the
atsBA operon, atsA or atsB, was
expressed in E. coli DH5
at logarithmic growth in the
presence of isopropyl thiogalactopyranoside (see "Experimental
Procedures"). Furthermore, the two genes were coexpressed from two
different plasmids (atsA + atsB, see
"Experimental Procedures"). For explanation of the
atsBdelA operon, carrying an in-frame
deletion in the atsB ORF, see Fig. 1. After expression, the
periplasm of the cells was assayed for sulfatase activity and protein
content. The expressed sulfatase protein (AtsA) was detected by Western
blotting after loading either equal amounts of sulfatase activity, or
if no activity was detectable, equal volumes of periplasm on the SDS
gel. The loaded protein and sulfatase activity are given below each
lane. B, AtsA was expressed with or without a C-terminal
His6 tag in the absence or presence of the atsB
gene, as indicated. The periplasm of the expressing cells was analyzed
as is described in A. For comparison lane 4 shows
the AtsA-His6(+B) protein (see "Results") purified on
nickel-agarose from the periplasm of cells expressing the
atsBA-His6 operon.

View larger version (39K):
[in a new window]
Fig. 3.
Treatment with
NaB[3H]H4 labels the tryptic peptide 2 of
Klebsiella sulfatase only after coexpression with
AtsB. A and C, purified
AtsA-His6(+B) protein (A) and
AtsA-His6(
B) protein (C) were subjected to
reduction with NaB[3H]H4 under denaturing
conditions. After desalting, aliquots were subjected to SDS-PAGE
followed by Coomassie Blue staining (Co) and fluorography
(Fl). The amount of protein loaded on the gel was 2 µg
(A, C) corresponding to 145 milliunits (A) or 0 milliunits (C) in the original protein preparation.
B and D, the major part of the desalted sulfatase
proteins was digested with trypsin, and the resulting tryptic peptides
were separated by RP-HPLC. The UV absorbance and the radioactivity
(shaded area) associated with the peptides are shown. The
position of the peptide 2 (P2), as identified by mass
spectrometry (not shown) and amino acid sequencing (Fig. 4A and B), is
indicated. The material eluting from the RP column 1 min earlier than
P2 and containing radioactivity two times above background (B,
D) is not a derivative of P2, and its radioactivity was not
released during 15 cycles of radiosequencing (not shown, cf.
Fig. 4C).
B)) or presence of AtsB
(AtsA-His6(+B)), were denatured and incubated with
NaB[3H]H4. This treatment reduces the formyl
group of FGly leading to formation of a [3H]serine
residue (7-10). After gel filtration aliquots of the protein samples
were analyzed by SDS-PAGE, followed by Coomassie Blue staining and
fluorography. Thereby it turned out that AtsA-His6(+B) carried a 3H label, whereas AtsA-His6(
B) did
not (Fig. 3, A and C). The proteins were
subjected to digestion with trypsin, and the tryptic peptides were
separated by RP-HPLC. The radioactivity recovered during chromatography
of the AtsA-His6(+B) peptides was found to be associated
with a single tryptic peptide showing a mass of 1590 Da (Fig.
3B). A mass of 1589.8 Da is predicted for the serine
72-containing form of peptide 2 (P2) comprising residues 63-76 of the
AtsA protein. In the corresponding fractions of the tryptic peptides of
AtsA-His6(
B) a 1590-Da peptide was also identified; the
radioactivity measured in these fractions, however, did not exceed the
background level (Fig. 3D). Sequencing of the 1590-Da peptides in both cases led to the amino acid sequence of P2 comprising a serine in position 72 (Fig. 4,
A and B). However, only in the case of P2 from
AtsA-His6(+B) radioactivity was released in the 10th
sequencing cycle corresponding to serine 72 (Fig. 4C). This indicates that prior to reduction FGly had been present in position 72, which by treatment with NaB[3H]H4 was reduced
to [3H]serine. On the contrary, no release of
radioactivity in any of 15 cycles was observed during sequencing of the
HPLC fractions containing P2 from AtsA-His6(
B) (not
shown). In conclusion, the atsB gene product is required to
oxidize serine 72 to FGly in the newly synthesized sulfatase
polypeptide.

View larger version (34K):
[in a new window]
Fig. 4.
Treatment with
NaB[3H]H4 labels Klebsiella
sulfatase in position 72 only after coexpression with AtsB.
The tryptic peptide 2 recovered after RP-HPLC of the tryptic
digests of NaB[3H]H4-treated
AtsA-His6(+B) and AtsA-His6(
B) protein (see
Fig. 3, B and D, respectively) was
subjected to amino acid sequencing (A, B) or radiosequencing
(C). This peptide comprises residues 63-76 of the
Klebsiella arylsulfatase. The amount of each
phenylthiohydantoin amino acid (A, B) or the radioactivity
(C) released per cycle and the type of amino acid identified
(abscissa) is given. The 3H label of P2 of
AtsA-His6(+B) was released in the 10th cycle (C)
corresponding to serine 72 (A), hence indicating the
presence of FGly in this position prior to reduction with
NaB[3H]H4. On the contrary, no 3H
label was recovered during 15 sequencing cycles when the background
radioactivity coeluting with P2 of AtsA-His6(
B) (see Fig.
3D) was subjected to radiosequencing (not shown).

View larger version (24K):
[in a new window]
Fig. 5.
Half of the recombinant Klebsiella
sulfatase polypeptides undergo FGly modification after
coexpression with AtsB in E. coli. AtsA-His6(+B)
protein was denatured and digested with trypsin. During RP-HPLC of the
resulting tryptic peptides two adjacent peaks were recovered
(A) containing peptides with masses of 1588 Da
(B) and 1590 Da (C), which agree with the masses
of the FGly 72 and serine 72 containing forms of peptide 2 (P2* and P2), respectively. Mass determination
was carried out by matrix-assisted laser desorption ionization mass
spectrometry using indole-2-carboxylic acid (ICA) as a
matrix (B, C); the masses given are corrected for
protonation. The presence or absence of FGly 72 in P2* and P2,
respectively, was demonstrated when using p-nitroaniline
(pNA) as a matrix, which led to the formation of a 1708-Da
Schiff base of p-nitroaniline with P2* (D) but
not P2 (E). Furthermore, amino acid sequencing was blocked
in P2* at the position of the FGly (X in F) but
not in P2 lacking FGly (G), as had been described for the
FGly-modified and nonmodified peptides of other sulfatases (see
"Results"). From the amount of amino acids recovered in cycles 1, 3, 4, and 5 (F and G), a modification efficiency
(P2*/(P2*+P2)) of 48 ± 2% is calculated. It should be noted that
P2* and P2 were not quantitatively separated during HPLC
(A), as indicated by the observation that low amounts of P2*
contaminating the P2 fraction gave rise to Schiff base formation with
p-nitroaniline (E).
![]()
DISCUSSION
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES
| |
ACKNOWLEDGEMENTS |
|---|
We thank Petra Schlotterhose and Katja Unthan-Hermeling for technical assistance, Klaus Neifer for peptide and DNA sequencing, and Enno Hartmann for his help in data base screening.
| |
FOOTNOTES |
|---|
* This work was supported by the Deutsche Forschungsgemeinschaft and the Fonds der Chemischen Industrie.The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
The nucleotide sequence(s) reported in this paper has been submitted to the GenBankTM/EMBL Data Bank with accession number(s) AJ131525.
To whom correspondence should be addressed: Tel.: 49-551-395976;
Fax: 49-551-395979; E-mail: dierks{at}ukb2-00.uni-bc.gwdg.de.
| |
ABBREVIATIONS |
|---|
The abbreviations used are:
FGly, C
-formylglycine;
AtsA-His6(±B), His-tagged
AtsA protein expressed in the presence or absence of atsB;
ORF, open reading frame;
P2, serine 72-containing form of tryptic
peptide 2;
P2*, FGly 72-containing form of tryptic peptide 2;
PAGE, polyacrylamide gel electrophoresis;
RP-HPLC, reversed phase
high-performance liquid chromatography;
kbp, kilobase pair(s);
bp, base pair(s);
PCR, polymerase chain reaction.
| |
REFERENCES |
|---|
|
|
|---|
This article has been cited by other articles:
![]() |
O. Berteau, A. Guillot, A. Benjdia, and S. Rabot A New Type of Bacterial Sulfatase Reveals a Novel Maturation Pathway in Prokaryotes J. Biol. Chem., August 11, 2006; 281(32): 22464 - 22470. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Sardiello, I. Annunziata, G. Roma, and A. Ballabio Sulfatases and sulfatase modifying factors: an exclusive and promiscuous relationship Hum. Mol. Genet., November 1, 2005; 14(21): 3203 - 3217. [Abstract] [Full Text] [PDF] |
||||
![]() |
Q. Fang, J. Peng, and T. Dierks Post-translational Formylglycine Modification of Bacterial Sulfatases by the Radical S-Adenosylmethionine Protein AtsB J. Biol. Chem., April 9, 2004; 279(15): 14570 - 14578. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Marquordt, Q. Fang, E. Will, J. Peng, K. von Figura, and T. Dierks Posttranslational Modification of Serine to Formylglycine in Bacterial Sulfatases. RECOGNITION OF THE MODIFICATION MOTIF BY THE IRON-SULFUR PROTEIN AtsB J. Biol. Chem., January 17, 2003; 278(4): 2212 - 2218. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Fey, M. Balleininger, L. V. Borissenko, B. Schmidt, K. von Figura, and T. Dierks Characterization of Posttranslational Formylglycine Formation by Luminal Components of the Endoplasmic Reticulum J. Biol. Chem., December 7, 2001; 276(50): 47021 - 47028. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Datta, Y. Mori, K. Takagi, K. Kawaguchi, Z.-W. Chen, T. Okajima, S.'i. Kuroda, T. Ikeda, K. Kano, K. Tanizawa, et al. Structure of a quinohemoprotein amine dehydrogenase with an uncommon redox cofactor and highly unusual crosslinking PNAS, November 15, 2001; (2001) 241429098. [Abstract] [Full Text] [PDF] |
||||
![]() |
I. Vandenberghe, J.-K. Kim, B. Devreese, A. Hacisalihoglu, H. Iwabuki, T. Okajima, S.'i. Kuroda, O. Adachi, J. A. Jongejan, J. A. Duine, et al. The Covalent Structure of the Small Subunit from Pseudomonas putida Amine Dehydrogenase Reveals the Presence of Three Novel Types of Internal Cross-linkages, All Involving Cysteine in a Thioether Bond J. Biol. Chem., November 9, 2001; 276(46): 42923 - 42931. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Xie and W. A. van der Donk Homemade cofactors: Self-processing in galactose oxidase PNAS, November 6, 2001; 98(23): 12863 - 12865. [Full Text] [PDF] |
||||
![]() |
J. A. Hoffman, J. L. Badger, Y. Zhang, S.-H. Huang, and K. S. Kim Escherichia coli K1 aslA Contributes to Invasion of Brain Microvascular Endothelial Cells In Vitro and In Vivo Infect. Immun., September 1, 2000; 68(9): 5062 - 5067. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. H. J. Bennik, P. J. Pomposiello, D. F. Thorne, and B. Demple Defining a rob Regulon in Escherichia coli by Using Transposon Mutagenesis J. Bacteriol., July 1, 2000; 182(13): 3794 - 3801. [Abstract] [Full Text] |
||||
![]() |
D. P. Wright, C. G. Knight, S. G. Parkar, D. L. Christie, and A. M. Roberton Cloning of a Mucin-Desulfating Sulfatase Gene from Prevotella Strain RS2 and Its Expression Using a Bacteroides Recombinant System J. Bacteriol., June 1, 2000; 182(11): 3002 - 3007. [Abstract] [Full Text] |
||||
![]() |
A. Kahnert, P. Vermeij, C. Wietek, P. James, T. Leisinger, and M. A. Kertesz The ssu Locus Plays a Key Role in Organosulfur Metabolism in Pseudomonas putida S-313 J. Bacteriol., May 15, 2000; 182(10): 2869 - 2878. [Abstract] [Full Text] |
||||
![]() |
A. Satoh, J.-K. Kim, I. Miyahara, B. Devreese, I. Vandenberghe, A. Hacisalihoglu, T. Okajima, S.'i. Kuroda, O. Adachi, J. A. Duine, et al. Crystal Structure of Quinohemoprotein Amine Dehydrogenase from Pseudomonas putida. IDENTIFICATION OF A NOVEL QUINONE COFACTOR ENCAGED BY MULTIPLE THIOETHER CROSS-BRIDGES J. Biol. Chem., January 18, 2002; 277(4): 2830 - 2834. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Datta, Y. Mori, K. Takagi, K. Kawaguchi, Z.-W. Chen, T. Okajima, S.'i. Kuroda, T. Ikeda, K. Kano, K. Tanizawa, et al. Structure of a quinohemoprotein amine dehydrogenase with an uncommon redox cofactor and highly unusual crosslinking PNAS, December 4, 2001; 98(25): 14268 - 14273. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| All ASBMB Journals | Molecular and Cellular Proteomics |
| Journal of Lipid Research |