J Biol Chem, Vol. 274, Issue 22, 15454-15465, May 28, 1999
Activation of the 9E3/cCAF Chemokine by Phorbol
Esters Occurs via Multiple Signal Transduction Pathways That Converge
to MEK1/ERK2 and Activate the Elk1 Transcription Factor*
QiJing
Li,
Sucheta M.
Vaingankar,
Harry M.
Green, and
Manuela
Martins-Green
From the Department of Biology, University of California,
Riverside, California 92521
 |
ABSTRACT |
Using primary fibroblasts in culture, we have
investigated the signal transduction mechanisms by which phorbol
esters, a class of tumor promoters, activate the 9E3 gene
and its chemokine product the chicken chemotactic and angiogenic
factor. This gene is highly stimulated by phorbol 12,13-dibutyrate
(PDBu) via three pathways: (i) a small contribution through protein
kinase C (the commonly recognized pathway for these tumor promoters),
(ii) a contribution involving tyrosine kinases, and (iii) a larger
contribution via pathways that can be interrupted by dexamethasone. All
three of these pathways converge into the mitogen-activated protein
kinases, MEK1/ERK2. Using a luciferase reporter system, we show that
although both the AP-1 and PDRIIkB (a NF
B-like factor in chickens)
response elements are capable of activation in these normal cells,
regions of the 9E3 promoter containing them are
unresponsive to PDBu stimulation. In contrast, we show for the first
time that activation by PDBu occurs through a segment of the promoter
containing Elk1 response elements; deletion and mutation of these
elements abrogates 9E3/chicken chemotactic and angiogenic
factor expression. Electrophoretic mobility shift assays and functional
studies using PathDetect systems show that stimulation of the cells by
phorbol esters leads to activation of the Elk1 transcription factor,
which binds to its element in the 9E3 promoter.
 |
INTRODUCTION |
It has been known for some time that chemokines play important
roles in leukocyte chemoattraction and inflammation (1). More recently,
however, it has become increasingly clear that these small cytokines
are also involved in wound healing (2), deterrence of retroviral
infections (3), and tumorigenesis (4, 5). In the latter case,
chemokines can potentially act at several steps in the development of
tumors, and their action is dependent not only on the stimulant but
also on the environment.
Tumors develop as a result of multiple insults and chemokines could
play important roles in these events because a number of them are
stimulated by phorbol esters, injury, and oncogenes (2), all of which
have been shown to be involved in tumor promotion. Agents that promote
tumor development are called tumor promoters; they are not themselves
carcinogenic but they promote the development of tumors in areas of the
body that have been exposed to a carcinogen (6, 7). There is extensive
literature that demonstrates that phorbol esters are very effective
tumor promoters (8, 9). Wounding is also a tumor promoter because it
can cause cancer to develop at the edges of wounds inflicted in areas
that have been exposed previously to a carcinogen (10-15). The
v-src oncogene, which is the transforming protein of the
Rous sarcoma virus (a retrovirus that causes tumors in chickens), also
has been shown to be a tumor promoter (16). The 9E3 gene and
its product, the chicken chemotactic and angiogenic factor
(cCAF),1 are stimulated to
high levels by the v-src oncogene and also by phorbol esters
and wounding/inflammation (17-21). Therefore, this chemokine can
potentially be a mediator of the tumor-promoting action of these
agents. In the case of v-src, during the development of Rous
sarcoma virus-induced tumors the expression of the 9E3/cCAF occurs only in the cells of the tissues surrounding the tumor (19, 21).
At later stages of tumor growth, when 9E3/cCAF are expressed
abundantly, numerous new blood vessels develop in the area (2, 19, 21).
Because cCAF is angiogenic (22, 23) and angiogenesis is very important
for tumor growth, it is possible that this chemokine is a mediator of
the tumor-promoting actions of the v-src oncogene. In the
case of wounding, we have shown that after injury the 9E3
gene is highly expressed shortly after injury and in the granulation
(repair) tissue during wound healing (19, 21). The persistent
expression of 9E3/cCAF during the healing process coupled
with its angiogenic properties in tissues that have been exposed to a
carcinogen could mediate the tumor promotion stimulated by wounding.
The stimulation of 9E3/cCAF to high levels by phorbol
esters, again coupled to its angiogenic properties, can potentially
mediate the tumor-promoting actions of these molecules.
Until recently, it was believed that gene activation by phorbol esters
always involves PKCs (24). PKCs are a family of serine and threonine
kinases that contain structural motifs with a high degree of sequence
homology. Most PKC isoenzymes have a conserved cysteine-rich (C1)
domain at the N terminus of the regulatory domain (25). The C1 domain
is involved in binding to diacylglycerol or its potent functional
analogues, the phorbol esters, resulting in the translocation of the
enzyme to the plasma membrane. The binding also causes a conformational
change in PKC that removes the pseudo substrate domain from the active
site, allowing substrate binding and catalysis (26). However, several
receptors of phorbol esters that are not PKCs now have been identified
(25). Examples are n-chimaerin (27), Unc-13 (28), Vav (29),
cathepsin-L (30), and protein kinase D (31). Thus it is clear that not all of the cellular effects of phorbol esters are mediated via PKC. As
a consequence, it is important to delineate the signal transduction
pathways by which chemokines are turned on by these agents so that
crucial steps in the activation process can be identified and
potentially used as targets for regulation of these genes. We have
investigated the pathway of activation of 9E3/cCAF by
phorbol esters such as phorbol 12-myristate 13-acetate and phorbol
12,13-dibutyrate (PDBu) in primary fibroblasts, the cells that most
highly express 9E3/cCAF in vivo. The work
presented here shows that activation of this chemokine by phorbol
esters involves multiple signaling pathways that culminate in
phosphorylation and activation of the MAP kinase ERK2 followed by
activation of the transcription factor Elk1, leading to
9E3/cCAF expression.
 |
MATERIALS AND METHODS |
Reagents--
The dosages used for particular experiments are
indicated in the text or in the figure captions. Bovine thrombin
(Sigma) was reconstituted in water and used at 9 units/ml. Calphostin C
(100-200 nM), genistein (15-25 µM), H-7
di-HCL (100-200 nM), tyrphostin AG1478 (5-500
nM), and PD98059 (10 µM) were all purchased
from Calbiochem and reconstituted in Me2SO.
Phorbol-12,13-dibutyrate and 4
-phorbol-12,13-dibutyrate (Biomol)
were dissolved in Me2SO and used at 5-100 nM.
Anti-phosphotyrosine PY20 (Transduction Laboratories) and 4G10 (Upstate
Biotechnology Inc.) were used for the phosphotyrosine immunoblots. ECL
reagents and secondary antibodies were conjugated to horseradish
peroxidase (Amersham Pharmacia Biotech). For each inhibitor or
activator, a range of doses was tested to determine the optimal dose
for the study in question. The Bradford assay was performed using the
DC protein assay kit (Bio-Rad).
Cell Culture--
Primary cultures of chicken embryo fibroblasts
(CEFs) were prepared from 10-day-old chicken embryos as described
previously (32). On the fourth day, secondary cultures were prepared by trypsinizing and plating the primary cells in 199 medium containing 0.3% tryptose phosphate broth and 2% donor calf serum at a density of
1.2 × 106/60-mm dish. To study the effects of phorbol
esters, 12-O-tetradecanoylphorbol-13-acetate, PMA, or PDBu
on 9E3 expression and cCAF production, we used quiescent confluent CEF (qcCEF) cultures and incubated them in serum-free 199 medium containing the specific treatment for varying times (see
"Results" for specifics). In general, prior to the addition of the
specific activator cells were incubated in serum-free 199 medium
containing the appropriate inhibitor for 30 min; incubation at 37 °C
was continued for 1 h more before removing the medium and
replacing it with fresh serum-free medium containing again the specific
inhibitor under study. At the end of the incubation period the
supernatant was collected and processed as described earlier (33).
Pretreatment with phorbol esters to down-regulate PKC activity in the
cells was performed for 18-24 h and then removed and replaced with
medium containing the appropriate treatment for 18 h when
evaluating cCAF levels. In the cases where the cell extracts were
analyzed for activation of the ERKs, the cells were pretreated with the
PDBu for 24 h, the inhibitor of MEK1/ERK (PD98059) for 1 h,
and then the activator, PDBu, at 5 mM for 5 min. Because qcCEFs are primary cells rather than a cell line, there are small variations in the basal levels of 9E3/cCAF expression from
batch to batch of cells. Therefore, for each experiment and/or
treatment of a different batch of cells, we used positive (treated
cells) and negative (untreated cells) controls.
Western Blotting--
Volumes of the cell culture supernatant
corresponding to equal amounts of protein in the cell extracts were
loaded on 20% polyacrylamide-glycerol gels and electrophoresed at
16-32 mA for about 3 h. The concentration of the protein was
determined using the Bio-Rad DC protein kit. Transfer was performed
using a semi-dry transfer apparatus (Millipore). The efficiency and
consistency of the transfer was monitored by silver-staining the gel
after the transfer. The 9E3 protein was detected using
polyclonal antibodies raised in rabbit (34) and enhanced
chemiluminescence (ECL) reagents (Amersham Pharmacia Biotech).
Northern Blot Analysis--
CEFs were homogenized and total RNA
was prepared using triZOL reagent (Life Technologies, Inc.). RNA
samples (10 µg/ml) were denatured in a formamide-formaldehyde buffer
containing ethidium bromide and separated on formaldehyde-agarose gel.
After electrophoresis, the RNA was transferred to MagnaGraph nylon
membranes (MSI Inc.), which were photographed to visualize the quality
of the rRNA and confirm equal loading and even transfer. The RNA was
UV-cross-linked to the membrane for 2 min and baked at 80 °C for
2 h. Prehybridization was performed for 6-9 h, and hybridization
with a cDNA probe was carried out for 24 h (33).
Phosphotyrosine Immunoblots--
Cell extracts were
prepared by lysing the cells in boiling 2× Laemmli buffer (containing
100 µM sodium orthovanadate) and shearing by passing
through a 26-gauge needle 10 times followed by boiling in a water bath
for 5 min. The samples were electrophoresed on a 7.5%
SDS-polyacrylamide gel and transferred to the nitrocellulose membrane
(Schleicher & Schuell) using a wet-transfer system (Bio-Rad) and
Towbin's buffer (25 mM Tris, pH 8.3, 192 mM
glycine, 0.05% SDS, 2% methanol) for 13 h at 30 V or 5 h at
60 V at 4 °C. The blots were blocked for 2 h at 37 °C in TBS
(25 mM Tris, pH 7.5, 2.7 mM KCl, 137 mM NaCl) containing 0.1% Tween 20, 2% bovine serum albumin, and 0.02% thimerosal (TBST-BSA) and then incubated with the
anti-phosphotyrosine antibodies (PY20 at 1:2500, 4G10 at 1:1000 dilutions) in TBST containing 2% bovine serum albumin for 2 h at
37 °C. The excess antibodies were washed three times for 5 min each
plus a longer 20 min wash with TBST. A second blocking step was done
for 1 h with TBST containing 5% nonfat milk. This was followed by
incubation with the appropriate secondary antibodies conjugated to
horseradish peroxidase (1:5000) for 1 h at room temperature. The
washings were performed as described for the primary antibodies. The
antibody detection was done using ECL reagents (Amersham Pharmacia
Biotech). For reprobing of the blots, the membranes were stripped by
incubation in stripping buffer (100 mM 2-mercaptoethanol,
2% SDS, and 62.5 mM Tris-HCl, pH 6.7) at 50 °C for 30 min with gentle shaking and then washed (2× for 10 min each) with
TBST, following which they were tested by ECL to ensure complete
stripping of antibodies. Finally, the membranes were washed again with
TBST (three times for 10 min) before proceeding with the reprobing.
Microdensitometry analysis was performed by laser densitometric
scanning in an LKB microdensitometer.
9E3 Gene Promoter Cloning--
Using PCR, we isolated a
1.5-kilobase pair DNA fragment from the immediate 5'-upstream region of
the 9E3 gene (
1506 to +32). We used chicken genomic DNA as
a template and two oligonucleotides (5'-primer,
GGATGAATGGCATTTCAGTGCAC; 3'-primer, TCGACACTAGAGAGGACAGTCTCCT) for the
PCR reactions that were performed under the following conditions:
denaturing of the DNA at 94 °C for 5 min, 55 °C for ~20 min to
add, and then 94 °C for 40 s to ensure that the DNA was
denatured before starting the annealing for 2 min at 55 °C and
extension for 1.5 min at 72 °C. The 1.5-kilobase pair PCR product
was then cloned using the AT cloning system pCR2.1 (Invitrogen) and
sequenced with the UBI Sequenase kit using vector primers and internal
primers. The sequence was confirmed to be correct by comparison with
the published sequence (35).
Luciferase Reporter Construction--
The 1.5-kilobase pair
9E3 promoter region was subcloned into pSL1180 (Amersham
Pharmacia Biotech) using the SacI and EcoRV and
then subcloned into the pGL3 basic vector (Promega) using XhoI and BglII. Using this vector we obtained
constructs with
66 to +32 bp,
218 to +32 bp,
470 to +32bp, and
683 to +32 bp fragments upstream from the initiation site with
restriction enzyme digests and religations. We created the
493 Elk1
binding element mutant (pmElk1) by PCR-based methods. 5'-primer
ATacGcgTGCTTTTAATACTGCACCCT was used to substitute the
Elk1-conserved binding element (underlined; original
sequence, CAGGAT). The controls for this mutated promoter,
542 to +32
bp and
495 to +32 bp, were also obtained using PCR and the
appropriate oligonucleotides. The PCR products were cloned into the
PCR2.1 vector and sequenced to verify accuracy.
KpnI/EcoRV (on pCR2.1) and
KpnI/SmaI (on pGL3 basic) were used for further reporter construction. The reporter vector with the mutated AP-1 binding site (
114 to
107) was prepared directly from the p683 construct with the Quickchange site-directed mutagenesis kit
(Stratagene). TGACTCAT was changed into gGcCTtAT, and the mutation was
verified by endonuclease digestion (additional HaeIII site
introduced by mutagenesis) and confirmed by sequencing. All the
pGL3/9E3 promoter subclones were transformed into DH5
Escherichia coli (Life Technologies, Inc.) and prepared
using the endotoxin-free Maxiprep kit (Qiagen).
Transient Transfection, PDBu Activation, and Culture Lysates
Collection--
qcCEFs were transiently transfected with 6 µg of DNA
(4 µg of pGL3/9E3P subclone DNA cotransfected with 2 µg
of PCH110 vector (Amersham Pharmacia Biotech) containing Lac-Z as
internal transfection control) for each 35-mm dish using
Ca2PO4-mediated methods without glycerol shock.
All the reporter constructs were transfected and assayed in the same
batch of cells. The transfected qcCEFs were incubated in modified 199 medium for 36 h at 37 °C, 5% CO2 (24). Then cells
were stimulated with PDBu or LPS for 3 h prior to lysis. For the
inhibitor experiments, the qcCEFs were incubated with inhibitors for 30 min before PDBu stimulation. Cell extracts were prepared with reporter
lysis buffer according to the protocol provided by the manufacturer
(Promega) and stored in a
70 °C freezer.
Luciferase and
-Galactosidase Assay--
Cell extracts were
assayed using a Luminometer with an automated injection device
(Monolight 2010, Analytical Luminescence Laboratory). The reaction
substrate and buffer are parts of the luciferase assay system
(Promega). Aliquoted samples were used for the
-galactosidase assay
according to the procedure for the
-galactosidase enzyme assay
system (Promega). A minimum of triplicates for each experiment was
performed, and the data were expressed as mean light units of
luminescence/unit of
-galactosidase activity.
PathDetect System--
We used a cis-PathDetect system for AP-1
and a trans-PathDetect system for the Elk1. These systems were
purchased from Promega, and we followed the protocols described by the
company with the exception that we used our modified
Ca2PO4 precipitation method for cell
transfections that we have optimized in our system for lower
stress-induced background, rather than transfections with Lipofectin as
recommended in the procedure.
Electrophoretic Mobility Shift Assays (EMSA)--
Cells were
treated as described earlier and nuclear extracts were prepared as
described previously (36). Protein concentration was determined with
the DC protein assay kit (Bio-Rad). 10 µg of extracted nuclear
protein was used for each binding reaction with 2 ng of
[
-32P]ATP-labeled probe containing the conserved Elk-1
binding element (wild type, ATCAGGATGCTTTTAATACTGCACC CT
(bold indicates the binding site for the Elk1 transcription
factor)) in EMSA buffer (188 mM NaCl, 50 mM
HEPES, pH 7.9, 2.5 mM EDTA, pH 8.0, 2.5 mM dithiothreitol, and 20% glycerol). 30 ng of unlabeled probe was used
for the competition assay, and 1 µl of anti-Phorpho Elk1(Ser-383) antibody (NE Biolab) was added for the supershift assay. Samples were
assayed in 6% nondenaturing polyacrylamide gel electrophoresis.
 |
RESULTS |
Stimulation of 9E3/cCAF by Phorbol Esters--
qcCEFs do not
express the 9E3/cCAF or they express it at very low levels.
However, upon stimulation with PDBu, the levels of the 9E3
mRNA increase dramatically. The rise in mRNA is first seen at 7 min, and it peaks at 3-6 h and declines thereafter (Fig. 1A). cCAF production after
stimulation by PDBu shows that the protein accumulates in the culture
supernatant (Fig. 1B). Accumulation is
dose-dependent (Fig. 1C) and is specific; the
Me2SO used as solvent for PDBu did not significantly
stimulate 9E3/cCAF (Fig. 1, D and
E).

View larger version (32K):
[in this window]
[in a new window]
|
Fig. 1.
Phorbol esters activate
9E3/cCAF. qcCEFs were treated with PDBu
(PdiBt) in serum-free medium for the indicated time
intervals. A, cells were treated with 100 nM
PDBu; after the incubation period, Northern blot analysis of total RNA
was performed using a full-length cDNA probe for
9E3/cCAF. The bottom panel shows EtBr staining of
the 28 S rRNA to show consistency of loading of the samples. The levels
of 9E3 mRNA (1.2 kilobase pairs) increase very rapidly,
peaking at 3-6 h and declining to much lower levels by 18 h.
B, immunoblot analysis of cCAF present in the supernatant of
treated cells using a polyclonal antibody developed against the whole
cCAF molecule. Normalization was done by loading equal amounts of
protein in each well. The protein accumulated in the supernatant
suggesting steady production and stability of the molecule.
C, immunoblot analysis of dose-dependent
stimulation of cCAF. Northern blot (D) and immunoblot
analysis (E) of cells treated with Me2SO
(DMSO) or PDBu show that the vehicle (Me2SO) for
the phorbol esters and the inhibitors does not significantly stimulate
expression of this chemokine.
|
|
It has been considered for a long time that phorbol esters exert their
effects on cells primarily through the activation of PKC isoforms that
contain the cysteine-rich (C1) domain to which phorbol esters bind
(37). Therefore, we investigated the possibility that stimulation of
9E3/cCAF by phorbol esters occurs via activation of these
classical PKCs. We treated cells with PDBu for 24 h to down-regulate total PKC activity by causing proteolytic degradation of
these kinases (38-40) followed by restimulation with PDBu. The result
was only moderately reduced expression compared with that stimulated by
PDBu without pretreatment (Fig.
2A). These observations suggest that activation of PKC represents only part of the stimulation of the 9E3/cCAF by phorbol esters. These results were
confirmed by treatment of cells with calphostin C, a specific inhibitor of PKC that competes with phorbol esters for the binding of the C1
domain in the regulatory region of PKC, and we found that
9E3 expression and production of cCAF were minimally blocked
by this inhibitor (Fig. 2, B and C). Similar
results were obtained when the cells were treated with H7
dihydrochloride, a broad spectrum inhibitor of Ser/Thr kinases that
also inhibits PKC (Fig. 2, B and C). None of
these inhibitors by themselves cause stimulation of 9E3/cCAF
(33). In addition, we also found that the 4
-isomer of PDBu
(4
-PDBu), which does not activate PKC (41), stimulates 9E3 expression and cCAF production almost as efficiently as
PDBu (Fig. 3, A and
B). This stimulation, much like that by PDBu, is time- (Fig.
3C) and dose- (not shown) dependent, albeit not as efficient
as the stimulation by PDBu. These results taken together strongly
suggest that 9E3/cCAF stimulation by phorbol esters occurs primarily via PKC-independent pathway(s).

View larger version (40K):
[in this window]
[in a new window]
|
Fig. 2.
Activation of 9E3/cCAF by
PDBu occurs primarily via PKC-independent pathway(s).
A, immunoblot analysis of cCAF. qcCEFs were pretreated
(+) or not ( ) with PDBu (PdiBt) (200 nM) for 24 h to down-regulate PKC. This treatment was
followed by a 1-h exposure to thrombin (9 units/ml), an activator of
9E3cCAF known to stimulate this gene independently of PKC
(24), or with PDBu (100 nM) followed by removal of the
medium and incubation of the cells with fresh serum-free medium for
18 h. Only partial inhibition of the stimulation of cCAF by PDBu
was observed when PKC was down-regulated. B, Northern blot
analysis of 9E3 mRNA stimulation in cells treated with
PDBu (100 nM) and treated with PDBu in the presence of
inhibitors of PKC, calphostin C (Cal) (200 nM)
or H7 dihydrochloride (H7) (200 nM).
Bottom panel shows EtBr staining of 28 S rRNA showing
consistency of sample loading. C, immunoblot analysis of
cCAF produced by cells treated with PDBu in the presence of the
inhibitors used in B confirmed partial inhibition by H7 and
calphostin C.
|
|

View larger version (53K):
[in this window]
[in a new window]
|
Fig. 3.
Effects of the biologically inert isomer of
PDBu, 4 -PDBu, on cCAF production.
A, Northern blot analysis using a full-length cDNA probe
for 9E3 and immunoblot with a polyclonal antibody to cCAF
(B) show that 4 -PDBu (PdiBt) (100 nM) stimulated the expression of 9E3/cCAF,
although at lower levels than PDBu. C, the effect is
time-dependent. DMSO, Me2SO.
|
|
To investigate the possibility that the pathway of activation of
9E3/cCAF by phorbol esters involves tyrosine kinase
activation, as it does for stimulation by thrombin (33), we used
inhibitors of tyrosine kinases. Herbymicin, an inhibitor of the
c-src family of tyrosine kinases, had no inhibitory effect
on the PDBu stimulation of 9E3/cCAF (not shown). Similarly,
tyrphostin, a selective inhibitor for the epidermal growth factor
receptor tyrosine kinase, had essentially no effect on PDBu stimulation
of this gene (Fig. 4A), whereas the broad spectrum tyrosine kinase inhibitor genistein produced
a distinct decrease in the stimulation of 9E3/cCAF. The same
results were observed for cCAF protein levels (not shown). The
inhibition of cCAF production when the cells were treated with
calphostin C (inhibitor of PKC) and genistein (inhibitor of tyrosine
kinases) was additive, but significant cCAF stimulation by PDBu
remained (Fig. 4, B and C), suggesting yet other
pathways of stimulation for this gene by PDBu.

View larger version (33K):
[in this window]
[in a new window]
|
Fig. 4.
Effect of inhibitors of tyrosine kinases on
the stimulation of 9E3/cCAF by PDBu.
A, Northern blot analysis using a full-length cDNA probe
for 9E3 to show the expression of this gene stimulated by
PDBu in the presence of tyrosine kinase inhibitors. The general
inhibitor genistein (Gen) (25 µM) partially
inhibits the stimulation of 9E3/cCAF by PDBu
(PdiBt), whereas tyrophostin AG1478 (Tyr) (500 nM), which is known to specifically inhibit the epidermal
growth factor receptor tyrosine kinase, had no discernible effect.
B, immunoblot analysis of cCAF stimulated by PDBu in the
presence of calphostin C (Cal) (inhibitor of PKC), genistein
(inhibitor of tyrosine kinases), and the combination of the two.
C, quantitation of the data in B was performed by
microdensitometer; four consecutive readings of each band were taken.
Bars represent S.D. A cumulative decrease was observed when
the two classes of inhibitors were used simultaneously.
|
|
It has been known for some time that expression of chemokine genes
triggered by a variety of stimuli is inhibited by glucocorticoids (42-45). In most cases tested, these anti-inflammatory agents activate the glucocorticoid receptor that, in turn, interacts with and inactivates transcription factors that are important in chemokine gene
expression (46). Dexamethasone is an example of an anti-inflammatory glucocorticoid that inhibits chemokine gene activation (44). Because
9E3/cCAF is stimulated by phorbol esters and plays an important role in the inflammatory response (22), we treated qcCEFs
with PDBu in the presence of dexamethasone to determine whether this
anti-inflammatory agent inhibited 9E3/cCAF stimulated by
this phorbol ester. Dexamethasone significantly decreased cCAF production stimulated by PDBu but did not eliminate it (Fig.
5A). Treatment of qcCEFs with
PDBu in the presence of dexamethasone, calphostin C, and genistein
simultaneously, however, reduced cCAF production to that of the control
(Fig. 5B). These inhibitors were all used at doses chosen
for optimal activity (see "Materials and Methods") without
adversely affecting the cells as judged by their morphology,
appearance, adhesion to the culture dish, and percent of cell death,
even when applied simultaneously (see fig. 5 legend for doses applied).
This is further illustrated by the fact that the combination of
inhibitors did not significantly affect the basal level of cCAF
produced by the treated cells, which is comparable to the levels of the
control (Fig. 5B).

View larger version (36K):
[in this window]
[in a new window]
|
Fig. 5.
Dexamethasone inhibition of cCAF stimulated
by PDBu. A, immunoblot analysis of cCAF using a
polyclonal antibody to the whole molecule. Dexamethasone
(Dex) (100 nM) significantly inhibited
production of cCAF stimulated by PDBu (PdiBt). B,
dexamethasone (100 nM), in conjunction with calphostin C
(Cal) (200 nM), and genistein (Gen)
(25 µM) caused complete inhibition of cCAF stimulation by
PDBu.
|
|
Signaling Events Leading to 9E3/cCAF Expression Involve ERK2
Activation--
As shown above, phorbol esters stimulate the
expression of 9E3/cCAF via multiple pathways; a smaller
contribution was made by PKC and tyrosine kinases and a more
significant contribution from pathway(s) inhibited by dexamethasone.
The MAP kinase ERK2 is a convergence point for many different signaling
pathways (47-49). Hence, we investigated if this kinase becomes
phosphorylated after stimulation by PDBu and if activation of this
enzyme is responsible for stimulation of 9E3/cCAF via any of
these pathways.
Immunoblot analysis using anti-phosphotyrosine antibodies showed that a
protein with molecular mass of 42 kDa was differentially phosphorylated
on tyrosines (Fig. 6A) with
the maximum phosphorylation occurring at 2 min after stimulation and
declining thereafter. We stripped and reprobed the anti-phosphotyrosine
blots with anti-ERK2 antibodies and determined that the 42-kDa protein
co-migrated with ERK2 (Fig. 6B). To determine if ERK2
phosphorylation/activation is involved in the signaling pathway(s)
inhibited by dexamethasone, we treated cells in the presence or absence
of this glucocorticoid and found that this inhibitor partially
eliminated ERK2 phosphorylation on tyrosines (Fig.
7, A and B),
suggesting that the decrease in cCAF production upon treatment with
dexamethasone (Fig. 5B) is linked to ERK2 activation. A
specific inhibitor of ERK2 is not available; however, MEK1
(mitogen-activated protein kinase kinase), which can be selectively
inhibited by PD98059 (50-54), is directly upstream from ERK2 in the
MAP kinase signaling cascade and is the specific kinase responsible for
both phosphorylation and activation of ERK2 (55, 56). Therefore, to
determine if ERK2 is a convergence point for the various signaling
pathways stimulated by PDBu, which lead to expression of this
chemokine, we treated cells with PD98059. This inhibitor was highly
effective in blocking PDBu-stimulated phosphorylation of ERK2 (Fig. 7,
C and D) and eliminated cCAF production when the
cells were treated with PDBu in the presence of PD98059 (Fig.
7E). These results, taken together, strongly suggest that
the multiple pathways activated by PDBu, which lead to
9E3/cCAF expression, converge in ERK2. In addition,
dexamethasone as well as PD98059 eliminated cCAF production stimulated
by 4
-PDBu (Fig. 7F).

View larger version (42K):
[in this window]
[in a new window]
|
Fig. 6.
Differential phosphorylation of a 42-kDa
protein produced by qcCEFs treated with PDBu. Cell extracts of
qcCEFs treated with PDBu (100 nM) for the indicated time
intervals were resolved on SDS-polyacrylamide gel electrophoresis (7%)
followed by immunoblot analysis using antibodies to phosphotyrosines
(A) or to ERK2 (B). A, a
42-kDa protein was phosphorylated, reaching a peak at 2 min after
stimulation. B, the blot in A was stripped and
reprobed with antibodies to ERK2 showing that ERK2 co-migrates with the
differentially phosphorylated protein. This immunoblot also illustrates
the even loading of protein in the various samples of the blot.
|
|

View larger version (50K):
[in this window]
[in a new window]
|
Fig. 7.
ERK2 activation is involved in the
stimulation of cCAF by PDBu. A, dexamethasone
(Dex) (100 nM) inhibits the phosphorylation of
ERK2 when qcCEFs are stimulated by PDBu (PdiBt).
B, the same blot when probed with antibodies to ERK2 shows
equal loading of protein. C, effects of PD98059, a specific
inhibitor of MEK1 kinase that phosphorylates and activates ERK2.
Cell-extracts were analyzed by immunoblotting using
anti-phosphotyrosine antibodies. Inhibition of the MEK1 kinase prevents
phosphorylation of ERK2. D, the same blot was stripped and
reprobed with anti-ERK2 antibodies to show the amounts of the ERK2
protein in each lane. E, blocking phosphorylation of ERK2
inhibited the stimulation of cCAF in cells treated with PDBu.
F, stimulation by 4 -PDBu is completely inhibited by both
dexamethasone and PD98059.
|
|
Analysis of the 9E3/cCAF Promoter in Response to PDBu--
Further
information on the pathways involved in the stimulation of
9E3/cCAF by PDBu can be elicited by determining the active elements of the gene promoter (Fig.
8A). Therefore, we used a promoter region of the 9E3 gene (
683 to +32 bp), which
contains DNA binding elements that can potentially be activated by the pathways identified above, and cloned it into the pGL3 luciferase reporter system (Promega). This region of the promoter (p683) contains
the consensus binding sequences for the transcription factors Elk1,
AP-1, and PDRII
B (the chicken equivalent of NF
B) (57-59) and the
CAAT box for C/EBP. We found that when this construct was transfected
into our primary normal fibroblasts, expression of luciferase was
highly stimulated by PDBu (Fig. 8A, I). To
determine the crucial areas of the promoter for activation, we
subcloned fragments of the larger promoter region into the reporter
system. The intermediate length fragments,
470 to +32 bp and
218 to +32 bp, eliminate the two putative Elk1 response elements, and the
smallest fragment,
66 to +32 bp, contains only the TATA box. The
470 to +32 bp piece showed a small amount of stimulation (twice as
much as the control) (Fig. 8A, II), but the other
two constructs showed virtually no stimulation upon PDBu treatment (Fig. 8A, III and IV), although the
PDRII
B and the AP-1 binding elements are still present in the
218
to +32 bp construct. Me2SO, which was used to dissolve the
PDBu and the inhibitors, showed a slight increase of activation of the
reporter system over the control (Fig. 8). These results correlate very
well with those obtained with northern blot and immunoblot analysis. In
addition, we found that the stimulation by PDBu was completely
inhibited by PD98059 in a dose-dependent manner (Fig.
8B) and that a dose dependence of inhibition was also
observed with dexamethasone (Fig. 8C) but total inhibition
was not obtained; the highest dose still left twice as much activation
as the control.

View larger version (34K):
[in this window]
[in a new window]
|
Fig. 8.
Constructs of the 9E3 gene
promoter, their responsiveness to PDBu and to the inhibitors PD98059
and dexamethasone. A, schematic representation of four
reporter gene constructs containing the 9E3 promoter region
up to 683 bp and showing the presence of consensus DNA binding
elements for several transcription factors. Controls consisted of the
basic pGL3 vector containing the appropriate construct transfected into
qcCEFs, in the presence or absence of Me2SO but without
stimulation by PDBu (PdiBt). The promoter activity for each
construct after stimulation by PDBu is shown as luciferase activity
normalized to -galactosidase activity and to the control values.
Me2SO, which was used to dissolve the PDBu and the
inhibitors, did not cause significant activation, corroborating the
results obtained with the northern blot and immunoblot analysis. The
largest construct p683 (I) conferred a large increase in
luciferase gene activity upon stimulation by PDBu. The construct with
the Elk1 DNA binding elements deleted, p470 (II), showed a
much reduced response to PDBu (only twice the activity of its control).
The two smallest constructs p218 and p66 (III and
IV, respectively) showed virtually no response to PDBu.
B, PD98059 lowered the stimulation of
pGL3/9E3p683 by PDBu to below the level of the control in a
dose-dependent manner. C, dexamethasone also
inhibited activation of transcription of pGL3/9E3p683 by
PDBu in a dose-dependent manner, but even at the highest
doses expression remained above the control. The experiments depicted
in this figure were performed several times, but here we show a
representative experiment because we use primary cells and significant
variations in activation occur from batch to batch of cells. The
bars represent S.E. of three samples/condition in the same
batch of cells. We identified the potentially functional elements known
to be important in regulation of chemokine transcription by the
Transcription Element Search Software (81) assay.
|
|
The results presented above lead us to conclude that the region of the
promoter between
683 and
470 bp contains the dominant elements
important for activation of 9E3/cCAF by PDBu. This region contains two elements that are highly conserved for binding of the Elk1
transcription factor with one starting at
534 bp and the other at
493 bp. Elk1 is an important substrate for ERK2 that we have shown
here is critical for expression of 9E3/cCAF after
stimulation of the cells by PDBu. Therefore, we deleted the Elk1
starting at
534 bp and mutated the one starting at
493 bp to obtain
a construct containing
493 to +32 bp (pmElk1) and performed
transfection studies similar to those described above. The activity of
the two promoters containing the two Elk1 elements (
683 to +32 bp and
542 to +32 bp) was not significantly different. The promoter
containing only the first Elk1 element (
495 to +32 bp) showed a
significant decrease in activity, whereas the mutated promoter (pmElk1)
showed a very low level of activity that was similar to that obtained
with the
470 to +32 bp construct (Fig. 9A). These results suggest
that the two Elk-1 elements are the major regulatory elements for cCAF
expression when cells are stimulated by phorbol esters.

View larger version (36K):
[in this window]
[in a new window]
|
Fig. 9.
Elk1 is the major response
element/transcription factor involved in PDBu stimulation of
9E3/cCAF. A, a construct (pmElk1) was
prepared by deletion of the Elk1 element starting at 534 bp and a
mutation of the one starting at 493 bp. The basal transcription level
of this construct was the same as that of the p470 and was much lower
than that of the normal p683 construct or the controls p542 and p495.
The loss of the Elk-1 elements results in loss of responsiveness to
PDBu and to PD98059 inhibition. B, Elk-1 transcription
factor responds to PDBu (PdiBt) stimulation. Cells were
cotransfected with a reporter construct containing six Gal4 elements in
a series immediately upstream of the luciferase gene (pFR-Luc) and with
the expression vector for a fusion protein (pFA-Gal4dbd-Elk1AD)
containing Gal4dbd and the Elk-1 protein activation domain (Elk-1AD).
In addition to the transfection of pFR-Luc alone (a), two
other controls were used: (i) cells were cotransfected with pFR-Luc and
the expression vector for the Gal4dbd and then stimulated by PDBu
(b), and (ii) cotransfection was done with pFR-Luc and the
expression vector for the fusion protein in the absence of stimulation
by PDBu (c). We observed no activation in either case.
Cotransfection of the cells with pFR-Luc and pFA-Gal4dbd-Elk1AD and
stimulation with PDBu resulted in a 6-fold increase over the control
(d). This latter stimulation can be inhibited to the
background level by 25 µM PD98059 (e), the
same dose used in other p683 studies. As a positive control, MEK-1, the
kinase that activates ERK2 was cotransfected with pFA-Gal4dbd-Elk1AD
and pFR-Luc. Overexpression of MEK-1 in the absence of stimulation by
PDBu resulted in a 3-fold increase in activity of the reporter gene
when compared with the control (f). C, gel shift
analysis using nuclear extracts from primary cells overexpressing Elk1
from pCMV-Elk1 (60). Nuclear extracts from cells treated with PDBu and
incubated with the radiolabeled oligonucleotide containing the sequence
of the Elk1 binding element present in the 9E3 gene resulted
in three band shifts (lane 1); competition with excess
unlabeled oligonucleotide (lane 2) and incubation with
radiolabeled mutated oligonucleotide (lane 3) show
specificity of binding. Shifted bands are indicated with
arrowheads. In lane 4 the extract was incubated
with an antibody directed to a peptide containing phosphoserine 383, which is phosphorylated only when Elk1 is activated. Binding of this
antibody produced the supershift indicated by a double
arrowhead. When the nuclear extracts from cells treated with PDBu
in the presence of the inhibitor PD98059 were incubated with the
radiolabeled oligonucleotide and the same Elk1 antibody, a supershift
did not occur (lane 5). Each experiment depicted here was
performed at least three times in three different batches of primary
cells. The bars represent S.E. of the three samples
analyzed/condition.
|
|
To complement the mutagenesis studies, we tested whether the Elk1
transcription factor is activated in response to PDBu. For these
experiments, we used a PathDetect reporter system developed by
Stratagene and applied it to our system (Fig. 9B). Cells
were cotransfected with the pFR-Luc construct, which contains the Gal4 DNA binding sequence upstream of the luciferase gene, and with the
pFA-Gal4dbd-Elk1AD construct (pFA-dbd-Elk1), which is an expression vector for a fusion protein containing the Gal4 DNA binding domain (Gal4dbd) and the Elk1 activation domain (Elk1AD). The Gal4dbd part of
this fusion protein binds to the Gal4 element on pFR-Luc, and the
Elk1AD portion of the fusion protein is capable of activating the
luciferase gene. As a negative control we used an expression vector for
the Gal4 DNA binding domain alone (pFC-dbd), and as a positive control
we used an expression vector for MEK1 (pFC-MEK1). Our results show that
when pFC-Gal4dbd was cotransfected with the reporter construct
(pFR-Luc) and subsequently treated with PDBu, there was a very small
activation of the luciferase gene, which was not significantly
different from the control (Fig. 9B, b); the same
was observed if cotransfection was performed with pFA-Gal4dbd-Elk1AD in
the absence of stimulation by PDBu (Fig. 9B, c).
However, when this phorbol ester was used to stimulate the cells
cotransfected with the pFA-Gal4dbd-Elk1AD, we observed a 4-fold
increase in activation (Fig. 9B, d), which was
eliminated by PD98059 (Fig. 9B, e), the inhibitor
for MEK1. Cotransfection of a MEK1 expression vector with the reporter
construct and the expression vector for the fusion protein
Gal4dbd-Elk1AD but in the absence of PDBu stimulation caused
significant activation of the reporter gene (Fig. 9B,
f). Therefore, overexpression of MEK1 activated its
substrate ERK2 followed by activation of the ELK1 transcription factor.
The results show that PDBu can stimulate activation of the Elk1
transcription factor leading to gene expression.
To determine if Elk1 activated by PDBu binds specifically to its
element in these primary fibroblasts, we performed EMSA and supershifts
using antibodies specific for activated Elk1. Our normal primary cells
express very low levels of the Elk1 transcription factor making it
difficult to obtain strong shift and supershift bands. Therefore, we
overexpressed Elk1 using pCMV-Elk1 (60), treated the cells with PDBu,
and incubated the nuclear extracts with a radiolabeled 27-mer
oligonucleotide containing a sequence identical to that of the Elk1
elements present in our promoter. As observed by others (60, 61), EMSA
showed multiple shifted bands (Fig. 9C,
arrowheads). These shifted bands were competed out with cold
oligonucleotide (Fig. 9C, lane 2) and disappeared when incubated with the mutated radiolabeled oligonucleotide (Fig. 9C, lane 3). Incubation with a specific antibody
to activated Elk1, which is phosphorylated on serine 383 (60), resulted
in a supershift of two of the Elk1 bands to a common band (Fig.
9C, lane 4, double arrowhead). Because
Elk1 can bind to its element even when it is not activated (61) to
verify that the supershifted band represents activated Elk1, we treated
the same batch of primary cells with PDBu in the presence of the
inhibitor PD98059. As described above, PD98059 is a specific inhibitor
of MEK1 that directly activates ERK2, which phosphorylates/activates
Elk1. Therefore, the Elk1 transcription factor bound to the
oligonucleotide should not be phosphorylated on Ser-383 and should not
be recognized by the antibody specific to this Ser. When the nuclear
extracts from these cells were incubated with the antibody against
activated Elk1, there was no supershift (Fig. 9C, lane
5). Thus, EMSA confirms that Elk-1 binds specifically to its
element in the 9E3 gene promoter and that this transcription
factor is activated by PDBu. The results of transcription activation
taken together with those on signal transduction show that PDBu
stimulates MEK1/ERK2, which results in the activation of the Elk1
transcription factor and stimulation of 9E3/cCAF.
Because it has been previously shown that phorbol esters activate the
NF
B and AP-1 transcription factors (62-64) although it is not the
case in our transfection experiment (Figs. 8A and 9A), we tested the possibility that the PDRII
B and the
AP-1 binding elements were somehow inactivated by alterations of our
constructs during the PCR reaction. Sequence analysis showed that they
contain no mutations. Further testing of the PDRII
B was obtained by
treating the cells transfected with the
218 to +32 bp construct with
LPS, which is known to activate the CINC chemokine gene
through NF
B (45). Treatment of this region of the 9E3
gene promoter with LPS activated the reporter system (Fig.
10A), showing that PDRII
B is functional in the 9E3/cCAF promoter but does not respond
to PDBu. Testing of the functionality of the AP-1 binding element was
performed by cotransfecting the fibroblasts with the p683 construct and
the expression vectors containing the c-Fos and c-Jun cDNAs. The
latter vectors, when expressed, should form an active AP-1
transcription factor complex (60-65). To determine if the expressed
AP-1 transcription factor was functional in our normal fibroblasts, the
cis-PathDetect system (Stratagene) for the AP-1 binding element was
used. This system contains seven AP-1 elements in series in a
Cis-reporter backbone containing the luciferase reporter gene
(pAP-1-Luc). The Cis-reporter by itself caused virtually no activation
of the luciferase gene (Fig. 10B, a), whereas in
the presence of PDBu (PdiBt) stimulation alone (Fig.
10B, b), c-Fos + c-Jun (Fig. 10B,
c), or c-Fos + c-Jun + PdiBt (Fig. 10B,
d) there was a 3-4-fold increase in activation. MEK kinase
was used as a positive control to verify that the Cis-reporter system
was working correctly (Fig. 10B, e). Thus, the
AP-1 transcription factor complex made from the expression vectors is
functional in our cells. However, when cells were cotransfected with
p683 and the expression vectors for the AP-1 complex, we found that c-Fos and c-Jun individually or in combination do not stimulate expression of the reporter gene above that of the control (Fig. 10C, c, e, and g). When
these cells were simultaneously stimulated with PDBu, there was an
increase in the expression of the reporter to slightly lower levels
(Fig. 10C, d, f, and h)
than those of the positive control (cells transfected with the p683
alone and treated with PDBu) (Fig. 10C, b). These
results show that overexpression of a functional c-Fos·c-Jun complex
(that can bind to AP-1 response elements and activate transcription)
does not activate the reporter gene in the context of our promoter. To
further establish the lack of involvement of AP-1 in
9E3/cCAF expression, we used site-directed mutagenesis to
mutate the AP-1 binding element in the context of the p683 promoter
(pmAP-1). In comparison to the native p683, the p683 with the mutated
AP-1 element showed a small decrease in luciferase activity upon
stimulation with PDBu, demonstrating that AP-1 in not significantly
involved in the activation of 9E3/cCAF by this tumor
promoter.

View larger version (39K):
[in this window]
[in a new window]
|
Fig. 10.
Activity of the
PDRII B (NF B-like) and
the AP-1 binding elements in response to PDBu stimulation.
A, stimulation of the pGL3/9E3p218 and
pGL3/9E3p66 by LPS. LPS stimulated transcription from the
p218 promoter because this promoter contains the PDRII B DNA binding
element. p66 contains only the TATA box therefore, stimulation was
insignificant. B, testing the functionality of the c-Fos and
c-Jun expression systems in normal fibroblasts. For these studies a
promoter containing 7 AP-1 binding elements in a series in front of the
luciferase reporter gene (cis-PathDetect system from Stratagene) was
used. Overexpression of c-Fos and c-Jun in the absence (c)
or presence (d) of PDBu (PdiBt), caused a
4-5-fold increase in transcription of the reporter system. The
functionality of the cis-PathDetect system was shown by cotransfection
of the cells with an expression vector for MEK kinase, which functions
as the positive control for the system (e). C,
the activity of the AP-1 binding element in the 9E3 promoter
was studied by transfection of the cells with p683 and the expression
vectors for c-Fos, c-Jun, or both. c-Fos and c-Jun individually or in
combination do not stimulate expression of the reporter gene above that
of the control (c). When these cells were simultaneously
stimulated by PDBu there was an increase in expression of the reporter
to slightly lower levels (d, f, and h)
than those of the positive control (b). D, to
further determine the lack of involvement of AP-1 in
9E3/cCAF expression, the AP-1 binding element was mutated
within the context of the p683 promoter (pmAP-1) by site-directed
mutagenesis using Quickchange (Stratagene), and the mutation was
verified by restriction enzyme digestion and sequencing. Our results
show only an insignificant reduction in activation of the reporter
system when the AP-1 binding element was mutated, demonstrating that in
primary normal fibroblasts activation of 9E3/cCAF by PDBu
does not involve AP-1. Each experiment was performed at least twice
with two different batches of cells. The bars represent S.E.
of three samples/condition.
|
|
 |
DISCUSSION |
Although it is clear that chemokines play important roles in
tumorigenesis, very little is known about the way tumor-promoting agents activate chemokine genes. We have used the 9E3 gene
and its product cCAF as a model to study the activation of chemokines in primary fibroblasts by one class of tumor promoters, the phorbol esters. We show the following: (i) 9E3/cCAF stimulation by
PDBu is only moderately inhibited by down-regulation of C1
domain-containing PKCs or by inhibition of this enzyme with the
specific inhibitor calphostin C and that stimulation can also be
achieved by 4
-PDBu, the isomer of PDBu that does not activate PKC;
(ii) general tyrosine kinase inhibitors, although more effective than
PKC inhibitors, also did not completely abolish the activation of
9E3/cCAF by PDBu; (iii) dexamethasone is much more effective
than PKC or the tyrosine kinase inhibitor in inhibiting the activation
of this chemokine by PDBu; (iv) complete inhibition of
9E3/cCAF was not accomplished until the three types of
inhibitors were applied simultaneously; (v) inhibition of MEK1/ERK2 by
PD98059 also completely eliminated 9E3/cCAF expression; (vi)
Elk1 binding elements and the Elk1 transcription factor are crucial for
activation of this chemokine gene by PDBu, whereas the AP-1 and the
PDRII
B binding elements, although potentially fully functional, are
not responsive to the activation of the 9E3/cCAF by
PDBu.
Our studies show that all three of these signaling pathways, C1 domain
PKCs, tyrosine kinases, and those mediated by dexamethasone, converge
to MEK1/ERK2. The activation of ERK2 via multiple signaling pathways is
consistent with the recent demonstration that full activation of ERKs,
in particular in fibroblasts, may require the cooperation of various
signaling pathways (66, 67). Furthermore, ERK1 and ERK2 are central
transducers of extracellular signals from hormones, growth factors, and
cytokines (55, 63) and are known to be points of convergence of signals
emanating from tyrosine kinase-coupled receptors (68) and
G-protein-coupled receptors (69). The results presented here further
these studies and show that ERK2 can also be a point of convergence of
several signaling pathways generated independently of cell surface receptors.
The inhibition of PDBu stimulation of 9E3/cCAF by
dexamethasone is intriguing, because this glucocorticoid is
primarily known for its inhibition of the NF
B transcription factor,
and yet our results show that PDRII
B is not involved in the
stimulation of our chemokine gene by PDBu. Similar studies have shown
that 12-O-tetradecanoylphorbol-13-acetate cannot activate
CINC (a closely related chemokine gene in rats) through
NF
B, although this gene can be activated by LPS through this
transcription factor (45). We also show here that the PDRII
B element
in the 9E3 promoter responded to LPS. Taken together, these
results suggest that PDBu does not stimulate 9E3/cCAF in normal fibroblasts via the PDRII
B and that dexamethasone is not acting through the inhibition of this transcription factor.
Dexamethasone can also inhibit cytokine gene expression by binding to
and activating the glucocorticoid receptor (70), which, in turn, can
bind to the AP-1 (c-Fos·c-Jun) complex and prevent it from binding to
DNA and activating gene expression (71). Although it has been shown
previously that the AP-1 site for the 9E3 gene promoter can
function in Rous sarcoma virus-transformed cells (58, 59), we show here
that the AP-1 element of the 9E3 promoter is not responsive
to the stimulation of this gene by PDBu. Overexpression in normal
fibroblasts of a functional c-Fos·c-Jun complex that can bind to AP-1
response elements and activate transcription does not activate the
reporter gene in the context of the 9E3 promoter AP-1
binding element. Furthermore, mutation of the AP-1 binding element
within the context of the 9E3/cCAF promoter did not result
in significant reduction of activity of the reporter system. These
results taken together demonstrate that AP-1 is not importantly
involved in the stimulation of 9E3/cCAF by PDBu. Therefore,
it is possible that the AP-1 binding element is inaccessible for
activation of this chemokine gene in normal fibroblasts. Interestingly,
we have identified a consensus binding sequence for the Oct-1 repressor
near the AP-1 binding element. Oct-1 is a member of the POU domain
family and has been shown to repress the expression of several genes
(72-75). Therefore, it is possible that this repressor in normal cells
inhibits the ability of the activated c-Fos·c-Jun complex to bind to
its element and/or to activate gene expression, whereas in transformed
cells this repression is lifted. Work is in
progress2 to analyze the role
of this repressor in the tightly regulated expression of
9E3/cCAF in normal cells to compare with the constitutive expression observed in transformed fibroblasts.
In addition to its role in the inhibition of NF
B and AP-1,
dexamethasone also inhibits the phosphorylation of the Raf1 kinase (76,
77). Raf1 is known to act upstream from MEK1 and ERK2 in the MAP kinase
cascade (77, 78) and, therefore, can be importantly involved in ERK2
activation. Our ongoing work in deciphering the signal transduction
pathways of stimulation of 9E3/cCAF has shown that Raf1
activation is required for 9E3/cCAF expression stimulated by
phorbol esters,3 suggesting
that dexamethasone acts on Raf1 to inhibit MEK1/ERK2 activity and
9E3/cCAF expression.
ERK2 is known to activate gene expression via a variety of
transcription factors including Elk1 (79-81). Our data show that 80-90% of the activation of 9E3/cCAF by PDBu occurs in the
543 to
470 bp region of the 9E3 promoter (Figs.
8A and 9A), which contains two Elk1 responsive
elements; deletion and mutation of the two Elk1 elements present in
this region of the promoter eliminated this effect. Using a Gal4-Elk1
fusion protein, we also show that PDBu stimulation leads to the
activation of the Elk1 transcription factor and subsequent activation
of the reporter system (Fig. 9B). EMSA with nuclear extracts
of cells overexpressing Elk1 shows that in vitro the
oligonucleotide sequence representing the Elk1 binding elements in the
promoter of 9E3/cCAF was specifically bound by nuclear
protein(s). The shift band can be retarded by an antibody specific to
Ser-383 phosphorylated/activated Elk1, demonstrating that after
treatment with PDBu the factor that binds to the elements is activated
Elk1 (Fig. 9C). The interesting supershift of two bands to
the same heavier band by the antibody to activated Elk1 is the subject
of ongoing work in our laboratory.3 Using transcription
activation reporter systems, site-directed mutagenesis, heterologous
expression systems, and EMSA, we have shown that the major
transcriptional activation pathway for 9E3/cCAF expression
upon stimulation by PDBu occurs via ERK2/Elk1.
The remaining 10-20% of activation of 9E3/cCAF by PDBu
occurs almost exclusively in the
470 to
218 bp section of the
promoter (Figs. 8A and 9A). This region does not
contain a consensus sequence for the Elk1 element, but it does contain
a closely related Ets sequence, which could be responsible for this
smaller activation. It has been shown that several Ets domain binding
factors are targets for the ERK proteins (80), making it possible that
ERK2 activates one of the Ets-binding proteins, which in turn could be
responsible for the small level of activation we observed with this
shorter promoter.
When taken together, our results lead to a potential model for
activation of 9E3/cCAF by phorbol esters in primary normal fibroblasts. Complete inhibition of PDBu stimulation of
9E3/cCAF by PD98059 (downstream inhibitor of the MAP kinase
cascade) indicates that all three signaling pathways go through
MEK1/ERK2, whereas dexamethasone (upstream inhibitor of the MAP kinase
cascade) inhibits only about 80% of the stimulation, suggesting that
one of the less active pathways (PKC or tyrosine kinase activated) is
not inhibited by dexamethasone. Thus, the major pathway by which PDBu stimulates 9E3/cCAF and one of the two minor pathways must
merge together before the point of dexamethasone inhibition, and the third pathway involved must merge in the cascade after the point of
dexamethasone inhibition. Dexamethasone is known to interfere with Raf1
(76, 77), which is the kinase that acts upon MEK1 in the MAP kinase
signaling cascade, hence the minor pathway independent of dexamethasone
inhibition could merge either at the point of MEK1 or immediately
before it. Our observation that both dexamethasone and PD98059
completely inhibit 9E3/cCAF stimulation by 4
-PDBu (which
does not activate PKC), whereas dexamethasone only partially inhibits
stimulation by PDBu, suggests that the dexamethasone-independent pathway is the pathway involving PKC. Alternatively, PKC can stimulate Raf1 activation in a way that cannot be inhibited by dexamethasone.
In summary, we show for the first time that phorbol esters can activate
a chemokine gene via multiple pathways that involve simultaneously a
dexamethasone-sensitive pathway and to a much lesser extent tyrosine
kinases and C1 domain-containing PKCs. These pathways all culminate in
ERK2 activation and in dominant stimulation of a major regulatory
region of the gene that contains two Elk1 consensus binding sites.
Furthermore, our functional studies show that stimulation of this gene
by phorbol esters leads to activation of the Elk1 and that this
transcription factor binds to its elements in the 9E3/cCAF
promoter. We conclude that the predominant signaling pathway for the
activation of 9E3/cCAF by PDBu goes through the MAP kinase
cascade enzymes MEK1/ERK2 and involves activation of the transcription
factor Elk1. The existence of multiple pathways to activate chemokine
genes is important because these are immediate early response genes
that are expressed in response to stresses such as tumors and injuries.
Agonists that use several pathways are more versatile in turning on
genes potentially allowing for a more reliable response.
 |
ACKNOWLEDGEMENTS |
We thank F. Sladek for helpful discussions
and technical advice. We are indebted to R. Tjan for the expression
vector for c-Fos and c-Jun, D. Strauss and S. Gill for use of equipment
in their laboratories, and A. C. Green and K. Bozhilov for
technical assistance with computer graphics used to prepare the figures.
 |
FOOTNOTES |
*
This work was supported by National Institutes of Health
Grant GM48436 (to M. M.-G.)The costs of publication of this
article were defrayed in part by the
payment of page charges. The article must therefore be hereby marked
"advertisement" in
accordance with 18 U.S.C. Section
1734 solely to indicate this fact.
To whom correspondence should be addressed: Dept. of Biology,
University of California, Riverside, CA 92521. Tel.: 909-787-2585; Fax:
909-787-4509; E-mail: mmgreen{at}ucrac1.ucr.edu.
2
Q.-J. Li and M. Martins-Green, manuscript in preparation.
3
Q.-J. Li and M. Martins-Green, unpublished data.
 |
ABBREVIATIONS |
The abbreviations used are:
cCAF, chicken
chemotactic and angiogenic factor;
PKC, protein kinase C;
PDBu, phorbol
12,13-dibutyrate;
MAP, mitogen-activated protein;
ERK, extracellular
signal-regulated kinase;
CEF, chicken embryo fibroblasts;
qc, quiescent
confluent;
PCR, polymerase chain reaction;
bp, base pairs;
EMSA, electrophoretic mobility shift assay;
MEK, mitogen-activated protein
kinase/extracellular signal-regulated kinase kinase;
dbd, DNA binding
domain;
AD, activation domain;
LPS, lipopolysaccharide, Luc,
luciferase;
AP1, activating protein 1.
 |
REFERENCES |
-
Horuk, R.
(1996)
in
Chemoattractant Ligands and Their Receptors (Horuk, R., ed), CRC Press, New York
-
Martins-Green, M.,
and Hanafusa, H.
(1997)
Cytokine Growth Factor Rev.
8,
221-232[CrossRef][Medline]
[Order article via Infotrieve]
-
Feng, Y.,
Broder, C. C.,
Kennedy, P. E.,
and Berger, E. A.
(1996)
Science
272,
872-877[Abstract]
-
Richmond, A.,
and Shattuck, R. L.
(1996)
in
Chemoattractant Ligands and Their Receptors (Horuk, R., ed), pp. 87-124, CRC Press, New York
-
Howard, O. M. Z.,
Ben-Baruch, A.,
and Oppenheim, J. J.
(1996)
Trends Biotechnol.
14,
46-51[CrossRef][Medline]
[Order article via Infotrieve]
-
Kligman, A. M.,
and Kligman, L. H.
(1994)
Cancer Lett.
87,
171-178[CrossRef][Medline]
[Order article via Infotrieve]
-
Jenkins, T. D.,
Nakagawa, H.,
and Rustgi, A. K.
(1997)
J. Biol. Chem.
272,
24433-24442[Abstract/Free Full Text]
-
Iversen, O. H.
(1995)
Crit. Rev. Oncog.
6,
357-405[Medline]
[Order article via Infotrieve]
-
Xian, W.,
Kiguchi, K.,
Imamoto, A.,
Rupp, T.,
Zilberstein, A.,
and DiGiovanni, J.
(1995)
Cell Growth Differ.
6,
1447-1455[Abstract]
-
Lacey, M.,
Alpert, S.,
and Hanahan, D.
(1986)
Nature
322,
609-612[CrossRef][Medline]
[Order article via Infotrieve]
-
Sieweke, M. H.,
Stoker, A. W.,
and Bissell, M. J.
(1989)
Cancer Res.
49,
6419-6424[Abstract/Free Full Text]
-
DiGiovanni, J.,
Bhatt, T. S.,
and Walker, S. E.
(1993)
Carcinogenesis
14,
319-321[Abstract/Free Full Text]
-
Martins-Green, M.,
Boudreau, N. M.,
and Bissell, J.
(1994)
Cancer Res.
54,
4334-4341[Abstract/Free Full Text]
-
Sieweke, M. H.,
and Bissell, M. J.
(1994)
Crit. Rev. Oncog.
5,
297-311[Medline]
[Order article via Infotrieve]
-
Cannon, R. E.,
Spalding, J. W.,
Trempus, C. S.,
Szczesniak, C. J.,
Virgil, K. M.,
Humble, M. C.,
and Tennant, R. W.
(1997)
Mol. Carcinogen.
20,
108-114[CrossRef][Medline]
[Order article via Infotrieve]
-
Bissell, M. J.,
Hatie, C.,
and Calvin, M.
(1979)
Proc. Natl. Acad. Sci. U. S. A.
76,
348-352[Abstract/Free Full Text]
-
Sugano, S.,
Stoeckle, M. Y.,
and Hanafusa, H.
(1987)
Cell
49,
321-328[CrossRef][Medline]
[Order article via Infotrieve]
-
Bedard, P-A.,
Alcorta, D.,
Simmons, D. L.,
Luk, K-C.,
and Erikson, R. L.
(1987)
Proc. Natl. Acad. Sci., U. S. A.
84,
6715-6719[Abstract/Free Full Text]
-
Martins-Green, M.,
and Bissell, M. J.
(1990)
J. Cell Biol.
110,
581-595[Abstract/Free Full Text]
-
Barker, K.,
and Hanafusa, H.
(1990)
Mol. Cell. Biol.
10,
3813-3817[Abstract/Free Full Text]
-
Martins-Green, M.,
Aotaki-Keen, A.,
Hjelmeland, L.,
and Bissell, M. J.
(1992)
J. Cell Sci.
101,
701-707[Abstract/Free Full Text]
-
Martins-Green, M.,
and Feugate, J. E.
(1998)
Cytokine
8,
522-535
-
Martins-Green, M.,
and Kelly, T.
(1998)
Cytokine
8,
819-829
-
Nishizuka, Y.
(1995)
FASEB J.
9,
484-496[Abstract]
-
Newton, A. C.
(1995)
Current Biol.
5,
973-976[CrossRef][Medline]
[Order article via Infotrieve]
-
Jaken, S.
(1995)
Curr. Opin. Cell Biol.
8,
168-173
-
Hall, C.,
Monfries, C.,
Smith, P.,
Lim, H. H.,
Kozma, R.,
Ahmed, S.,
Vanniasingham, V.,
Leung, T.,
and Lim, L.
(1990)
J. Mol. Biol.
211,
11-16