J Biol Chem, Vol. 274, Issue 22, 15786-15796, May 28, 1999
Effect of Transforming RNA on the Synthesis of a Protein with a
Secretory Signal Sequence in Vitro*
Katsutomo
Hamada
§,
Tsutomu
Kumazaki
, and
Shinobu
Satoh¶
From the
Division of Cell Biology, Research Institute
for Radiation Biology and Medicine, Hiroshima University, 1-2-3 Kasumi, Minami-ku, Hiroshima 734-0037, Japan and the ¶ Institute
for Bio-regulation, Co. Ltd., 1-2 Sumiyoshi-cho, Naka-ku,
Yokohama 231-0013, Japan
 |
ABSTRACT |
U5 small nuclear RNA itself can act as a
clastogenic and transforming agent when transfected into cells. In the
previous work, the 3' half of the U5 small nuclear RNA first stem
structure (designated RNA3S) was capable of driving normal cells into
tumorigenic cells when expressed with a poly(A) tail
(RNA3S+). This transformation critically depended
upon the polypurine sequence GGAGAGGAA in RNA3S+. In this
work, we first examined the pre-
-lactamase and luciferase (model
secretory and nonsecretory proteins) translation with the in
vitro synthesized RNA3S in rabbit reticulocyte lysate. The capped
RNA3S with a poly(A) tail suppressed the translation. In addition, the
polypurine sequence played a crucial role in affecting the secretory
protein synthesis, indicating a primary action of RNA3S+.
Further studies revealed that the oligodeoxynucleotides, corresponding to the polypurine and its antisense sequences, directly contacted 28 S
rRNA in ribosome and 7SL RNA in signal recognition particle, respectively, and differentially affected the nascent chain elongation of secretory protein synthesis. These results suggest that
RNA3S+ blocks a physiological regulatory function played by
signal recognition particle and the ribosome in the secretory protein
synthesis and support the idea that the transformation might result
from a repressed cellular activity.
 |
INTRODUCTION |
Carcinogenesis proceeds through a series of genetic alterations
involving oncogenes and tumor suppressor genes (1-3). It is also
widely believed that carcinogenic initiation is caused by genetic
mutation(s) induced by carcinogens. Initiated cells continue to exhibit
various unusual phenomena leading to malignant neoplasia such as
morphological transformation, immortalization (4), suppression of
intercellular communication (5-7), loss of extracellular matrix
protein (8, 9), and autonomous growth (10). However, the mechanisms
underlying such uncertain alterations associated with all stages in
carcinogenesis are still unknown.
In our previous work based on the cell transformation induced by U5
small nuclear RNA (U5) (11),1
the 3' half of the U5 first stem structure (12) (designated RNA3S) had
an ability to convert normal rat fibroblastic 3Y1 cells to
morphologically transformed cells at a marked frequency when expressed
with a poly(A) tail as an RNA polymerase II-derived noncoding
transcript (RNA3S+) (13). The morphologically transformed
cells went on eventually to produce tumorigenic cells, suggesting that
RNA3S+ is capable of driving the normal cells into the
neoplastic stage. Additionally, RNA3S+ suppressed the
fibronectin protein synthesis in HeLa cells, supporting the idea that
it is indeed a new type of transforming agent. We thus call an
RNA+ having a transforming activity such as
RNA3S+ "transforming RNA." Based on these results, the
transforming RNA might have the ability to perturb a regulatory system
to maintain the normal cellular process. This transformation was
critically dependent upon the polypurine sequence GGAGAGGAA in
RNA3S+. Because the cells expressing the RNA3S without a
poly(A) tail (RNA3S) exhibited only a very low frequency of the
morphological transformation (14), the poly(A) tail is evidently
involved in the enhancement of transformation. It is known that the cap of mRNA binds to an initiation factor, eIF-4E, with several other initiation factors to be anchored to the ribosome (15, 16) and that the
poly(A) tail, in cooperation with the cap, stabilizes mRNA to
enhance its translation (17-20). In fact, RNA3S+ in 3Y1
cells was found to be associated with polysomes (13). In this work, we
examined an effect of RNA3S+ on the rabbit reticulocyte
lysate translation of pre-
-lactamase and luciferase (model secretory
and nonsecretory proteins) mRNAs and found that RNA3S+
suppressed the secretory rather than nonsecretory protein synthesis.
Proteins with a secretory signal sequence are synthesized by polysomes
bound to the endoplasmic reticulum. Signal recognition particle (SRP)
is made up of 7SL or SRP RNA (about 300 nucleotides) and six
polypeptides (21, 22) and functions in targeting most secretory and
membrane proteins to the endoplasmic reticulum membranes (23). 7SL RNA
has the Alu portion comprising approximately 100 nucleotides from the
5' end and 45 nucleotides from the 3' end of the RNA (24). In the
mammalian translation system, secretory protein synthesis is paused
transiently at multiple sites of ribosome-associated nascent
polypeptides (25). With this fact, it has been postulated that a
translational pause may be a convenient switch by which cells could
adapt the secretory protein synthesis to the secretory needs of the
cells (26). We also present evidence that the oligodeoxynucleotides (ODNs), corresponding to the polypurine sequence in RNA3S+
and its antisense sequence, directly contacted 28 S rRNA in ribosome and 7SL RNA in SRP, respectively, and differentially affected secretory
protein synthesis. Finally, we discuss a possible involvement of the
transforming RNA during the process of carcinogenesis.
 |
EXPERIMENTAL PROCEDURES |
Plasmid Construction--
As described previously, the 3' half
of the U5 first stem structure (nucleotides 50-78 of U5) was
designated RNA3S, and its antisense counterpart was designated RNA3A
(14). Synthetic cDNAs, corresponding to these RNAs, were inserted
at the SmaI site of a polylinker region in pGEM3 (Promega)
to give pG3S and pG3A (13). The BamHI-SacI
fragments from the pG constructs were then inserted at the same sites
of the polylinker region in pSP64(poly(A)) (Promega) to create pS3S and
pS3A that express RNA3S or RNA3A with a poly(A) tail
(RNA3S+ or RNA3A+) by SP6 RNA polymerase.
Similarly, pS3SG and pS3SM were constructed to express
RNA3SG+ and RNA3SM+, in which the polypurine
sequence in RNA3S+ was altered to GGGGG- GGGG and
CCUCUCCUU, respectively, by using p3SG and p3SM as described previously
(13). The RNA+ sequences used in this study are shown in
Table I. The cDNA sequence of RNA3S is contained in the
DDBJ/EMBL/GenBankTM with accession number AB021173.
In Vitro Transcription--
Plasmid DNAs were linearized at a
site beyond the SP6 promoter and cDNA insert. A 20-µl reaction
contained 40 mM Tris-HCl, pH 7.5, 6 mM
MgCl2, 2 mM spermidine, 10 mM
dithiothreitol (DTT), 1 unit/µl ribonuclease inhibitor (Takara), 0.5 mM each of ATP, CTP, and GTP, 12 µM of UTP,
50 µCi of [
-32P]UTP (800 Ci/mmol, Amersham Pharmacia
Biotech), 1 µg of plasmid DNA, and 1 unit/µl SP6 RNA polymerase
(Takara) (27). Samples were incubated for 60 min at 37 °C, and the
DNA templates were digested with 2 units RNase-free DNase I
(Takara)/µg DNA at 37 °C for 15 min. RNA was extracted with
phenol/chloroform and precipitated by the addition of 0.1 volume of 3 M- sodium acetate and 2.5 volumes of ethanol. For the
synthesis of a capped RNA transcript, a reaction mixture contained 0.5 mM each of ATP, CTP, and UTP, 0.05 mM GTP, and
0.5 mM m7G(5')ppp(5')G(RNA cap structure
analogue; New England Biolabs). The RNAs synthesized were analyzed by
gel electrophoresis.
In Vitro Translation--
Nonsecretory luciferase (28) and
secretory pre-
-lactamase (29) mRNAs and canine pancreatic
microsomal membranes were obtained from Promega, and nuclease-treated
rabbit reticulocyte lysate systems were from Amersham Pharmacia
Biotech. Standard translation was carried out in 25 µl of reaction
mixture containing 10 µl of lysate, 2 µl of translation mix, 0.1 M potassium acetate, 0.5 mM magnesium acetate,
20 µCi of [35S]methionine (1000 Ci/mmol, Amersham
Pharmacia Biotech), 0.5 µg of luciferase mRNA, and 2 µg of
pre-
-lactamase mRNA at 30 °C (30). Translation products (2-3
µl) were boiled for 3 min in 20 µl of sample buffer (31) (83 mM Tris-HCl, pH 6.8, 10% glycerol, 2.5% SDS, 5%
2-mercaptoethanol, and 0.2% bromphenol blue) and subjected to
electrophoresis in SDS-polyacrylamide gels (stacking gel: 4.5%
acrylamide, 0.12% N,N'-methylenebisacrylamide,
125 mM Tris-HCl, pH 6.8, 0.1% SDS; separating gel: 15%
acrylamide, 0.4% N,N'-methylenebisacrylamide,
375 mM Tris-HCl, pH 8.8, 0.1% SDS) in running buffer (25 mM Tris-HCl, pH 8.3, 192 mM glycine, and 0.1%
SDS). The gels were fluorographed as described previously (13). The
intensities of luciferase (62 kDa) and pre-
-lactamase (31.5 kDa)
bands were quantitated in help of the Desk scan II and software of NIH
image 1.55f.
Synchronized Translation--
Synchronized translation was
carried out in a manner as described previously (25). Because
full-length polypeptide chains of pre-
-lactamase appeared after 5-6
min of synthesis and those of luciferase were detected after 9-10 min
of synthesis when the translation was programmed with 0.08 µg of
pre-
-lactamase mRNA and 0.02 µg of luciferase mRNA/µl of
translation (data not shown), the synchronization time of 3 min below
the minimal time required for completion of the translation was
employed in the following experiments. Translation was initiated for 3 min, at which time further initiation was inhibited by the addition of
RNA cap analogue, m7G(5')ppp(5')G, to a final concentration
of 4 mM (32). The gels were fluorographed. Another
translation uses a tRNA-mediated protein labeling system (Amersham
Pharmacia Biotech) when a very small amount of protein translated is to
be detected. Proteins were electroblotted onto a nitrocellulose
membrane in a buffer (25 mM Tris-HCl, pH 8.3, 192 mM glycine, and 20% methanol) at 100 V for 3 h,
cooling the buffer. The transferred proteins were detected according to
the manufacturer's instructions. The intensities of luciferase and
pre-
-lactamase bands were quantitated as described above.
RNase H Cleavage of RNA--
Synthetic ODNs were obtained from
Funakoshi (Tokyo, Japan). The reticulocyte lysate was incubated with an
ODN in the presence of ribonuclease H (RNase H; Takara) at 37 °C for
60 min. RNA was extracted by the method of Chomczynski and Sacchi (33)
and analyzed in polyacrylamide or agarose gels after heating in a
loading buffer containing 7 M urea at 65 °C for 5 min.
The ODN sequences used for this assay are shown in Table II.
Northern Blot Hybridization--
RNA was electrophoresed on a
5% denaturing polyacrylamide gel containing 7 M urea.
After electroblotting, a nitrocellulose filter was hybridized with a
riboprobe as described previously (13).
Determination of the Rabbit 7SL RNA Sequence--
To determine
the 7SL RNA sequence by using the SMART methods
(CLONTECH), a GpppG cap and a poly(A) were added to
the gel-purified RNA at the 5' end and the 3' end, respectively. First,
1 µg of the gel-purified RNA was incubated with 2 units of poly(A)
polymerase (Takara) in 50 µl of buffer containing 50 mM
Tris-HCl, pH 7.9, 10 mM MgCl2, 2.5 mM MnCl2, 250 mM NaCl, 1 mM DTT, 0.05% bovine serum albumin, and 0.1 mM
ATP for 60 min at 37 °C and precipitated with ethanol after the
phenol/chloroform extraction. The poly(A) RNA was further incubated
with 2 units of guanylyltransferase (Life Technologies, Inc.) in 30 µl of buffer containing 50 mM Tris-HCl, pH 7.9, 1.25 mM MgCl2, 6 mM KCl, 2.5 mM DTT, 0.1% bovine serum albumin, 30 units of RNase
inhibitor (Takara), and 40 µM GTP for 45 min at 37 °C.
The cDNA of capped poly(A) RNA was synthesized by reverse
transcription at 37 °C for 60 min in 10 µl of reaction mixture
containing 100 pM random hexamer, 1 µM
(oligo(dT)30N1N (N = A, G, C, or T;
N1 = A, G, or C)), 1 µM SMARTTM
oligonucleotide, 50 mM Tris-HCl, pH 8.3, 6 mM
MgCl2, 75 mM KCl, 2 mM DTT, 1 mM dNTP, and 20 units of reverse transcriptase (Superscript II; Life Technologies, Inc.). Polymerase chain reaction (PCR) amplification of the resulting single-stranded cDNA was carried out
by using the following primers: 5' primer,
GAGAATTCTACGGCTGCGAGAAGACGACAGAA, and 3' primer, N N1
(dT)30GGAATTCGA at 94 °C for 30 s, 62 °C for 1 min, and 68 °C for 1 min for 21 cycles. After digestion with EcoRI and BamHI, the final products were
gel-purified, cloned into the same sites of pGEM3, and sequenced. The
rabbit 7SL cDNA sequence has been submitted to the
DDBJ/EMBL/GenBankTM with accession number AB021174.
Cloning of a Partial 7SL cDNA--
Cloning of a partial
cDNA of rabbit 7SL RNA was carried out by using a 5'-AmpliFINDER
RACE kit (CLONTECH). Single-stranded cDNA was
synthesized by using 0.5 µg of the gel-purified RNA as described
previously (13). PCR amplification of the anchor-ligated cDNA was
performed in 50 µl of reaction mixture containing 10 mM
Tris-HCl, pH 8.3, 50 mM KCl, 1.5 mM
MgCl2, 0.01% gelatin, 50 mM each dNTP, 200 nM each of 7SL-P1 (TGCTCCGTTTCCGACCTGGGCCGGT; the sequence
complementary to nucleotides 184-208 of 7SL RNA) and anchor primers,
and 2 units of Taq polymerase (New England Biolabs). The
mixture was run at 94 °C for 45 s, 60 °C for 45 s, and
72 °C for 2 min for 35 cycles. The first PCR products were used in a
nested PCR reaction with a set of anchor primer and 7SL-P2
(GCGGATCCTCACCCCTCCTTAGGCAACCTGGTG; sequence complementary to
nucleotides 159-183 of 7SL RNA) primers at 94 °C for 45 s, 66 °C for 45 s, and 72 °C for 2 min for 30 cycles. After
digestion with EcoRI and BamHI, the final
products were cloned into the same sites of pGEM3 and sequenced.
5' End Labeling of RNA Molecules--
RNA was end-labeled in 20 µl of reaction mixture containing 50 mM Tris-HCl, pH 8.0, 10 mM MgCl2, 5 mM DTT, 50 µCi of
[
-32P]ATP, and 10 units of T4 polynucleotide kinase
(Takara) at 37 °C for 30 min.
RNase Protection Assay--
Total RNA was extracted from lysate
and hybridized with 105 cpm of riboprobe for 12 h at
45 °C in a 30-µl mixture containing 80% formamide, 40 mM PIPES, pH 6.7, 0.4 M NaCl, and 1 mM EDTA. Samples were then digested with 3 µg of RNase A
and 5 units of RNase T1 in 300 µl of buffer containing 10 mM Tris-HCl, pH 7.5, 0.3 M NaCl, and 5 mM EDTA at 30 °C for 30 min (27, 34). After the
treatment with 200 µg/ml proteinase K and 1% SDS at 37 °C for 20 min, RNA was extracted with phenol/chloroform, ethanol precipitated
with 10 µg of tRNA, and electrophoresed in a 6% sequencing gel.
 |
RESULTS |
RNA3S+ Affects Protein Synthesis in Vitro--
To
examine an effect of RNA3S+ on the translation of
pre-
-lactamase and luciferase mRNAs in rabbit reticulocyte
lysate, we synthesized RNA3S+, RNA3A+
(antisense RNA3S+), and RNAPL+ (transcript from
the pSP64(poly(A)) polylinker region) that had a cap structure at the
5' end and a poly(A) tail at the 3' end. These RNA+
sequences are shown in Table I. The
synthesized RNA+s were added into the standard translation
as described under "Experimental Procedures." A dose-effect test
showed that 0.2 µg of RNA3S+/µl of translation
suppressed most efficiently the overall protein synthesis, reducing the
amounts of luciferase and pre-
-lactamase by about 55 and 65%,
respectively, at 30 min of incubation when compared with those with
RNAPL+ alone (Fig.
1A). Upon translation with
RNA3S+, RNA3A+, and RNAPL+,
RNA3S+ suppressed most significantly the translation (Fig.
1B). Compared with the translation with RNAPL+,
the amounts of luciferase and pre-
-lactamase synthesized with RNA3S+ were reduced by about 60 and 70%, respectively, at
60 min of incubation. RNA3A+ and RNAPL+ also
appeared to suppress the translation when compared with the control. To
see an effect of the cap and poly(A) tail in RNA3S+ on the
translation, we synthesized three types of RNA3S with different
structures: capped RNA3S with a poly(A) tail, uncapped RNA3S with a
poly(A) tail, and uncapped RNA3S without a poly(A) tail. Of these RNAs,
only the capped RNA3S with a poly(A) tail (RNA3S+)
significantly suppressed the translation (Fig. 1C),
demonstrating that RNA3S requires both the cap and poly(A) tail to
exert its function.


View larger version (65K):
[in this window]
[in a new window]
|
Fig. 1.
Translation of
pre- -lactamase and luciferase mRNAs with
in vitro synthesized
RNA3S+. RNA3S+,
RNA3A+, and RNAPL+ were synthesized by using
SP6 RNA polymerase from pS3S, pS3A, and pSP64 linearized with
EcoRI. Aliquots (3 µl) were removed at the indicated times
and analyzed by SDS-PAGE and scanning densitometry as described. The
gel patterns of luciferase and pre- -lactamase synthesized and their
intensities are shown in each experiment. A, dose-effect
test. Mixtures of RNA3S+ and RNAPL+ were added
at the indicated amount into a 20-µl translation. Set 1, 4 µg of RNA3S+; set 2, 2 µg of
RNA3S+ and 2 µg of RNAPL+; set 3,
1 µg of RNA3S+ and 3 µg of RNAPL+;
set 4, 4 µg of RNAPL+. The other translation
products (25-30 kDa) that were not due to luciferase and
pre- -lactamase were due to labeled peptidyl-tRNA resulting from
translation of fragments of globin mRNA (35), because they appeared
in a reaction containing no added mRNA. Additionally, nonspecific
bands (33-62 kDa) might be due to aberrant initiation of luciferase
translation and endogenous methionine-binding lysate proteins (35).
Marker, prestained SDS-PAGE standards (Bio-Rad). Gel
patterns (left side) and intensities (right
side). B, translations with RNA3S+,
RNA3A+, and RNAPL+. 4 µg of each
RNA+ were added into a 20-µl translation. Intensities of
luciferase and pre- -lactamase bands in the control were not shown
because of apparently higher intensities. Gel patterns (left
side) and intensities (right side). C,
translations with three types of RNA3S with different structures. Capped RNA3S with a poly(A)
tail, uncapped RNA3S with a poly(A) tail, and uncapped RNA3S without a
poly(A) tail were synthesized by using pS3S and SP6 RNA polymerase. 4 µg of each RNA3S were added into a 20-µl translation. PA
indicates poly(A) tail. Gel pattern (left side) and
intensities (right side) are shown. D,
translations with RNA3S+, RNA3SG+, and
RNA3SM+. 5 µg of each RNA+ were added into a
25-µl translation. Gel patterns (left side) and
intensities (right side) are shown. These translation
experiments were repeated with similar results.
|
|
In the previous study, RNA3SG+, in which the polypurine
sequence was changed from GGAGAGGAA to GGGGGGGGG, exhibited the
transforming potential similar to that of RNA3S+ (13). On
the other hand, RNA3SM+, which has the CCUCUCCUU in place
of the polypurine sequence in RNA3S+, lost the potential
completely. We also examined the effects of RNA3SG+ and
RNA3SM+ (Table I) on the translation. As shown in Fig.
1D, RNA3SG+ also suppressed the
pre-
-lactamase synthesis, whereas RNA3SM+ did not
suppress it. We noted that RNA3S+ and RNA3SG+
preferred to affect the secretory rather than nonsecretory protein synthesis, depending upon their polypurine sequences.
The Polypurine Sequence Contacts 28 S rRNA in Ribosome, whereas Its
Antisense Sequence Contacts 7SL RNA in SRP--
From the above data,
the polypurine sequence might contact directly an integral RNA in
polysomes. We thus prepared the ODN, 3S-9nt (GGAGAGGAA), and searched
the lysate for such an RNA. An ODN-directed RNase H cleavage assay has
been useful for identifying the RNA sequences that are accessible for
base pairing with DNA molecules. Total RNA was recovered from the
lysate treated with 3S-9nt in the presence of RNase H and analyzed in
gels. As shown in Fig. 2A,
3S-9nt mediated the cleavage of 28 S rRNA in a
dose-dependent manner, generating some cleavage products.
This suggests that 3S-9nt is specific to the cleavage. 4 µg of
3S-9nt/10 µl of lysate were required to degrade all the target RNAs.
Neither 3S-9nt alone nor RNaseH alone affected 28 S rRNA. A similar
assay was performed by using 3A-9nt (TTCCTCTCC) that was the antisense
3S-9nt ODN. In a nondenaturing gel analysis (Fig. 2B),
3A-9nt appeared to mediate the cleavage of an RNA species (designated
RNAX in Fig. 2B) located between 18 S rRNA and
5.8 S rRNA, generating a new band RNA (RNAx in Fig.
2B). From the separating gel pattern of cytoplasmic RNA as
reported previously (36), it is suggested that RNAX might be 7SL RNA
and thus RNAx the cleavage product of 7SL RNA. We determined the
sequence of RNAX in a manner as described under "Experimental
Procedures." Both a cap and a poly(A) tail were added to the
gel-purified RNAX. After reverse transcription of the modified RNAX
followed by PCR amplification of the resulting cDNAs, products were
cloned into a plasmid and sequenced. As shown in Fig. 2C,
RNAX was identified as 7SL RNA, exhibiting a 98.3% homology with the
human 7SL DNA sequence. To confirm that RNAx is a cleavage product of
7SL RNA, we carried out a Northern blot hybridization. We constructed
several plasmids containing the partial 7SL cDNA fragments by using
the reverse transcription products of the gel-purified RNAx. One of
those plasmids, pG7SL7 contained the cDNA fragment corresponding to
nucleotides 110-183 of 7SL RNA but not the Alu sequence. Thus, pG7SL7
produces an antisense partial 7SL cRNA specific to 7SL RNA. Again, the
cleavage products were analyzed in a denaturing gel (Fig.
2D). RNAX from the 3A-9nt-treated lysate appeared as a
broader and lower intensive band (lanes 7-9 and
11 in Fig. 2D). RNAx appeared in the
nondenaturing gel was just visible in the denaturing gels. In Northern
blot analysis (Fig. 2E), both RNAX and RNAx (lanes 7-9 and
11 in Fig. 2E) indeed hybridized with the
antisense 7SL7 cRNA. In addition, 3A-9nt was found to mediate the
cleavage of 7SL RNA dose-dependently. Neither 3A-9nt alone
nor RNaseH alone affected 7SL RNA. These results suggest that 3S-9nt
and 3A-9nt contact specifically 28 S rRNA in the ribosome and 7SL RNA
in SRP, respectively, which are known to be engaged in secretory
protein synthesis (38).

View larger version (44K):
[in this window]
[in a new window]
|
Fig. 2.
RNase H cleavage assays. A,
agarose gel analysis. 10 µl of lysate were incubated with ODN at the
indicated amount in the presence of 20 units of RNaseH at 37 °C for
60 min. Total RNA from each sample was electrophoresed on a 1.2%
agarose gel. Gels were stained with ethidium bromide and visualized.
Lane 1, control; lane 2, RNaseH alone;
lanes 3-5, 4, 2, and 1 µg of 3S-9nt, respectively;
lane 6, 4 µg of 3S-9nt alone; lanes 7-9, 4, 2, and 1 µg of 3A-9nt, respectively; lane 10, 4 µg of
3A-9nt alone. B, nondenaturing polyacrylamide gel analysis.
10 µl of lysate were treated with 4 µg of either 3S-9nt or 3A-9nt
in the presence of 20 units of RNase H at 37 °C for 60 min. Total
RNA was electrophoresed on a 6% nondenaturing gel. Lane 1, control; lane 2,
3S-9nt; lane 3, 3A-9nt. RNAX and RNAx indicate an RNA
species targeted by 3A-9nt and a new band RNA generated by the ODN,
respectively. C, the cDNA sequence of RNAX. The RNAX
cDNA sequence was determined as described under "Experimental
Procedures." All the four clones tested were derived from 7SL RNA.
The sequence of the EcoRI-BamHI fragment in
pGRNAX-12 (row 1) was aligned with the human 7SL DNA
(row 2) (37). The rabbit sequence analyzed differed from
human sequence at the five positions. The nucleotide present in the
rabbit RNA at these positions is as follows; C19,
C53, C88, T293, and
C299. D, denaturing polyacrylamide gel analysis.
10 µl of lysate were incubated with ODN at the indicated amount in
the presence of 20 units of RNaseH at 37 °C for 60 min. Total RNA
was electrophoresed on a 5% denaturing gels containing 7 M
urea. Lane 1, control; lane 2, RNaseH alone;
lanes 3-5, 4, 2, and 1 µg of 3S-9nt, respectively;
lane 6, 4 µg of 3S-9nt alone; lanes 7-9 and
11, 4, 2, 1, and 6 µg of 3A-9nt, respectively; lane
10, 4 µg of 3A-9nt alone. RNAX and RNAx
indicate the same RNAs as shown in B. E, Northern
blot analysis. RNAs shown in D were electroblotted onto the
nitrocellulose filter. The filter was hybridized with an antisense 7SL7
cRNA probe at 106 cpm/ml. The intensities of RNAx bands
were quantitated and found to decrease with the increased amount of
3A-9nt (data not shown). RNAX and RNAx were the
same RNAs as shown in D.
|
|
3A-9nt Contacts the Alu Portion in 7SL RNA--
The three distinct
activities of SRP (signal recognition, elongation arrest, and
translocation promotion) reside in separate domains (39). We thus
determined the site of 7SL RNA in contact with 3A-9nt. First, the
gel-eluted RNAx was, without an alkaline phosphatase treatment,
incubated with [
-32P]ATP in the presence of
polynucleotide kinase and analyzed in a sequencing gel. As shown in
Fig. 3A, RNAx accepted the
radioactive phosphate, suggesting that RNAx lost the 5' site of 7SL
RNA. The smear pattern (indicated by arrows) suggests that
RNAx might be a mixture of the partial 7SL RNAs resulting from the
RNaseH digestion and still have a structure. It was estimated to be
more than at least 230 nucleotides in length. Out of the plasmids
containing partial 7SL DNA fragments as described above, pG7SL2 that
contains the cDNA fragment corresponding to nucleotides 44-183 of
7SL RNA was used to prepare a riboprobe in the following RNase
protection assay. Fig. 3B shows the sequencing gel of 7SL2
DNA and its sequence. The antisense 7SL2 cRNA was hybridized with total
RNA from the 3A-9nt-treated lysate. After the digestion with RNase A
and RNase T1, samples were analyzed in a sequencing gel
(Fig. 3C). As expected, the contact site of 7SL RNA
displayed a nibbling pattern, demonstrating the ODN-directed RNaseH
digestion. Because 7SL2 RNA is 139 nucleotides in length, the site was
found to be GAGG at 5-8 nucleotides from the 5' end of 7SL2 RNA when
compared with a DNA sequencing shown in parallel. This site corresponds
to nucleotides 48-51 of 7SL RNA. The result indicates that 3A-9nt
contacts the Alu portion in 7SL RNA that is assigned to the elongation
arrest activity of SRP (41).

View larger version (58K):
[in this window]
[in a new window]
|
Fig. 3.
Determination of the site of 7SL RNA in
contact with 3A-9nt. A, size of RNAx. Approximately 0.1 µg of the gel-purified RNAx was end-labeled and electrophoresed in a
6% sequencing gel. Marker (lane M), 32P-labeled
MspI digest of pBR322. B, sequencing gel of the
7SL2 cDNA and its sequence. The cloned 7SL2 DNA was sequenced in
both orientations, linearizing pG7SL2 with either HindIII or
PvuII. The sequencing gel is displayed in the sense
direction, and the 7SL2 RNA sequence derived from the cDNA sequence
is shown in the proposed secondary structure (40). C,
mapping of the 5' end of the RNase-protected fragment. Total RNA was
recovered from 10 µl of lysate treated with 4 µg of ODN in the
presence of 20 units of RNaseH. The antisense 7SL2 cRNA probe was
prepared by using SP6 RNA polymerase and pG7SL2 digested with
EcoRI and should be thus 185 nucleotides in length
(lane 1). Lane 2, 10 µg of yeast tRNA;
lanes 3 and 6, control RNA; lane 4,
3S-9nt-treated RNA; lanes 5 and 7, 3A-9nt-treated
RNA. Marker (lane M), 32P-labeled
MspI digest of pBR322. Sizes of the DNA fragments are
indicated in nucleotides. A DNA sequencing is shown in parallel to
determine the cleavage sites of 7SL RNA. The nibbling pattern is also
shown for a shorter exposure in the lower side.
|
|
3S-9nt and 3A-9nt Affect Secretory Protein Synthesis--
To
confirm that 3S-9nt and 3A-9nt affect only secretory protein synthesis,
we performed the synchronized translation with 3S-9nt or 3A-9nt. In
this experiment, we used a tRNA-mediated protein labeling system to
detect proteins synthesized because the ability of 3S-9nt to affect the
pre-
-lactamase synthesis was very large. After the reaction was
synchronized by allowing initiation for 3 min, the RNA cap analogue was
added to block further initiation. As shown in Fig.
4, the pre-
-lactamase polypeptide chains were observed after 5-6 min of synthesis in the control translation. The chains appeared after 8-10 min of synthesis in the
translation with 3S-9nt, although they were clearly detected even after
5 min of synthesis in the translation with 3A-9nt. The amount of
pre-
-lactamase synthesized with 3S-9nt was reduced by more than 70%
after 10 min of incubation, whereas that with 3A-9nt was increased to
about 120-150% at each time of incubation. On the other hand,
luciferase polypeptide chains appeared after 10 min of synthesis in all
the three translations. In addition, both ODNs did not change the
amount of luciferase synthesized. These results indicate that 3S-9nt
markedly suppresses the secretory protein synthesis,
whereas 3A-9nt modestly enhances it. It is also
evident that the delay observed with 3S-9nt is not due to suppression
of overall protein synthesis.

View larger version (52K):
[in this window]
[in a new window]
|
Fig. 4.
Synchronized translation. Translation
was carried out by using a tRNA-mediated protein labeling system in a
30-µl reaction containing 2.4 µg of pre- -lactamase mRNA, 0.6 µg of luciferase mRNA, and 12 µg of either 3S-9nt or 3A-9nt. At
the indicated times, aliquots (2 µl) were analyzed by SDS-PAGE
(left side) and scanning densitometry (right
side). The translation was repeated with similar results.
|
|
The Effect on the Secretory Protein Synthesis Occurs at the Level
of Nascent Chain Elongation--
To see whether the ODNs affect either
initiation or elongation of translation, microsomal membranes were
supplemented into the translation. Membranes that contain the SRP
receptors relieve the SRP-mediated elongation arrest and process
pre-secretory protein to mature protein (42, 43). 0.08 equivalents of
membranes/µl of translation continued to process pre-
-lactamase to
-lactamase without losing their activity for at least 60 min of
incubation, representing 88-90% of processing efficiency (data not
shown). As shown in Fig. 5,
pre-
-lactamase polypeptide chains appeared after 6 min of synthesis
in all the translations. Obviously, membranes accelerated the
pre-
-lactamase synthesis with 3S-9nt. This result indicates that the
ODNs differentially affect the secretory protein synthesis at the level
of elongation but not initiation.

View larger version (28K):
[in this window]
[in a new window]
|
Fig. 5.
Synchronized translation with membranes.
Translation was carried out in a 30-µl reaction containing 2.4 equivalents of membranes, 2.4 µg of pre- -lactamase mRNA, 0.6 µg of luciferase mRNA, and 12 µg of either 3S-9nt or 3A-9nt. At
the indicated times, aliquots (2 µl) were analyzed by SDS-PAGE
(left side) and scanning densitometry (right
side). mm, microsome membranes. The translation was
repeated with similar results.
|
|
The Suppression of Secretory Protein Synthesis Is Due to the Direct
Contact between 28 S rRNA and ODN--
From the results described
above, it is suggested that the suppressed pre-
-lactamase synthesis
is due to the direct contact between 28 S rRNA and 3S-9nt. To further
study this, we prepared the following altered polypurine ODNs:
3SM1-9nt, 3SM2-9nt, 2A-9nt, 2AM-9nt, and GA-9nt (Table
II). By using these ODNs , we carried out
the RNase H cleavage and in vitro translation assays. In the former assay, 3SM2-9nt and 2AM-9nt apparently mediated the cleavage of
28 S rRNA, representing the cleavage products similar to those with
3S-9nt (Fig. 6A). 3SM1-9nt and
2A-9nt appeared to mediate the cleavage of a very small amount of 28 S
rRNA. However, the cleavage pattern with GA-9nt was quite different
from that with 3S-9nt. This finding indicates that the cleavage
requires a common sequence GGAG in the ODNs. Thus, 3SM1-9nt, 2A-9nt,
and GA-9nt still lack a nucleotide important for the cleavage. In the
latter assay, 3SM2-9nt and 2AM-9nt suppressed the pre-
-lactamase
synthesis, whereas 3SM1-9nt, 2A-9nt, and GA-9nt did not affect the
synthesis (Fig. 6B). Combined with these results, it is
suggested that the suppression of secretory protein synthesis results
from the direct contact between 28 S rRNA and the GGAG in the ODNs. For
the transforming RNA3SG+, we also examined the ability of
G-9nt in these assays. As shown in Fig. 6, however, G-9nt mediated
destruction of 28 S rRNA and suppressed almost completely overall
protein synthesis, suggesting that G-9nt is inappropriate to see the
ability of RNA3SG+ in these assays.

View larger version (50K):
[in this window]
[in a new window]
|
Fig. 6.
Relationship between the 28 S rRNA cleavage
and the suppression of pre- -lactamase
synthesis. A, RNase H cleavage of 28S rRNA with various
altered polypurine ODNs. 10 µl of lysate were incubated with 4 µg
of ODN but with 2 µg of 3S-9nt in the presence of 20 units of RNaseH.
Lane 1, control; lane 2, 3S-9nt; lane
3, 3SM1-9nt; lane 4, 3SM2-9nt; lane 5,
2A-9nt; lane 6, 2AM-9nt; lane 7, GA-9nt;
lane 8, G-9nt. B, translations with the altered
ODNs. Translation was synchronized in a 15-µl reaction with 6 µg of
ODN. At the indicated times, aliquots (3 µl) were analyzed by
SDS-PAGE (left side) and scanning densitometry (right
side). With the experimental results performed repeatedly, the
intensities of luciferase and pre- -lactamase bands with 2A-9nt,
2AM-9nt, and GA-9nt were adjusted to those with the other ODNs.
|
|
 |
DISCUSSION |
In this work, we examined the translation of pre-
-lactamase and
luciferase mRNAs with RNA3S+ and found that
RNA3S+, requiring the cap and poly(A) tail, significantly
suppressed the translation. Because the uncapped RNA3S without a
poly(A) tail had no effect on the translation, it is evident that the effect of RNA3S+ is not due to the action of a protein
bound to the RNA. Also, it is suggested that the suppression of overall
protein synthesis with RNA3A+ or RNAPL+,
observed when compared with the control translation, is due to the
association of these RNAs with ribosomes and thus nonspecific. Therefore, these findings parallel the data that the transforming activity of RNA3S was markedly enhanced when expressed with a poly(A)
tail (13, 14). In addition, RNA3S+ and RNA3SG+
suppressed the secretory rather than nonsecretory protein synthesis, whereas RNA3SM+ did not affect the translation. This
indicates that the polypurine sequences play a crucial role in
suppressing the secretory protein synthesis and also parallels the fact
that the transforming activity critically depended upon the sequences.
With these results, it is strongly suggested that the suppression of
secretory protein synthesis is a primary action of the transforming RNA.
In the synchronized translation, 3S-9nt suppressed the
pre-
-lactamase synthesis, whereas 3A-9nt enhanced it. Because these effects were abolished by the supplementation of membranes, it is
evident that the ODNs do not inactivate the ability of
pre-
-lactamase mRNA to be translated. Similarly, the ODNs,
because they did not change the processing efficiency of membranes, do
not block the ability of membranes. We concluded that these effects
occurred at the level of elongation. Therefore, this suppression
appears to be consistent with the observation in the canine SRP-rabbit reticulocyte lysate system that was designed to demonstrate a transient
elongation arrest activity of SRP (25).
It appeared that RNA3S+ also suppressed the luciferase
synthesis in the amount of protein synthesized. Recently, it has been reported that the peptidyl transferase center localized at the central
circle of domain V of the 23 S-like rRNAs in bacteria is the most
important functional site for protein synthesis (44). We examined
whether RNA3S could affect cis-actively the
pre-
-lactamase synthesis. The sequence of RNA3S was introduced into
the 5'- or 3'-untranslated region of pre-
-lactamase mRNA. The
translations of these modified mRNAs were the same as that of the
original mRNA (data not shown). Thus, RNA3S+ is able to
affect only trans-actively the secretory protein synthesis by acting presumably at the site of 28 S rRNA different from the peptidyl transferase center. It seems likely that the site may not only
structurally but functionally link to the peptidyl transferase center.
Because the amount of RNA3S+ added into the translation is
thought to be in excess, it is likely that a large proportion of
ribosomes are associated with the RNA. This may influence
nonspecifically the overall protein synthesis in vitro.
However, we do not yet know whether such a situation also takes place
in cells and plays an important role in transformation.
Concerning the site (nucleotides 48-51) of 7SL RNA contacting 3A-9nt,
this site forms a stem structure with the 3'-terminal region
(nucleotides 295-298) of the RNA in the proposed secondary structure
(40). We also noticed that any amount of 3A-9nt could not cleave all of
7SL RNAs in lysate, suggesting that the cleavage might correlate with
the activity of SRP. In a chemical modification analysis (45), the
A49 in nucleotides 48-51 of 7SL RNA is a sensitive
nucleotide in membrane-bound SRP, while it is protected in both
polysome bound SRP and soluble SRP during the SRP cycle. Taken
together, it is suggested that the stem structure might be changed
during the SRP cycle. The question is how the ODNs affect the
pre-
-lactamase synthesis at the level of elongation. 3A-9nt
contacted the GAGG of 7SL RNA, and the GGAG of 3S-9nt contacted 28 S
rRNA, suggesting a possible contact sequence CUCC of the RNA. At these
sites, 28 S rRNA and 7SL RNA potentially form three base pairs. With
the basic orientation of 7SL RNA in SRP in a microscopic analysis (46)
and a three-legged model in which the tRNA-like 5' domain of 7SL RNA is
in direct contact with tRNA binding sites of ribosome (47), these
possible base pairings may have a physiological regulatory function for
the secretory protein synthesis.
In mammalian cells, most secretory and membrane proteins are
synthesized through the SRP-mediated translocation system (26, 48, 49).
If a transforming RNA that is an RNA polymerase
II-dependent noncoding transcript containing a unique
polypurine sequence with a poly(A) tail is persistently expressed, the
normal cellular process would continue to be perturbed because
secretory protein synthesis could be suppressed. Such a transforming
RNA could be generated by a genetic mutation in an initial event of
carcinogenesis. Under such a repressed cellular activity, cells may
change themselves so as to adapt to the environment for the main
purpose of surviving. Based on the studies of liver carcinogenesis
(50), it is assumed that tumors develop by cellular adaptation to
perturbations in the environment (51). By analogy with studies in
bacteria, in which Escherichia coli kept in the stationary
phase under selective conditions mutate to gain a selective advantage
(52-54), it is assumed that multiple genetic changes in carcinogenesis
are adaptive mutations (55-59). This adaptive mutation theory seems
currently most attractive to understanding the transformation
mechanisms with a transforming RNA.
 |
ACKNOWLEDGEMENTS |
We are grateful to Dr. James Trosko for
critical comments on the manuscript and the late Dr. Ichie Satoh for
financial support.
 |
FOOTNOTES |
*
This work was supported in part by a grant-in-aid for
scientific research (08878125) from the Ministry of Education, Science, and Culture, Japan.The costs of publication of this
article were defrayed in part by the
payment of page charges. The article
must therefore be hereby marked
"advertisement" in
accordance with 18 U.S.C. Section
1734 solely to indicate this fact.
The nucleotide sequence(s) reported in this paper has been submitted to the GenBankTM/EMBL Data Bank with accession number(s) AB021174.
§
To whom correspondence should be addressed. Tel.: 82-257-5880; Fax:
82-257-5880.
 |
ABBREVIATIONS |
The abbreviations used are:
U5, U5 small nuclear
RNA;
SRP, signal recognition particle;
ODN, oligodeoxynucleotide;
DTT, dithiothreitol;
PIPES, piperazine-1,4-bis-2-ethanesulfonic acid;
PCR, polymerase chain reaction;
PAGE, polyacrylamide gel
electrophoresis.
 |
REFERENCES |
-
Weinberg, R. A.
(1989)
Cancer Res.
49,
3713-3721[Free Full Text]
-
Fearon, E. R.,
and Vogelstein, B.
(1990)
Cell
61,
759-767[CrossRef][Medline]
[Order article via Infotrieve]
-
Bishop, J. M.
(1991)
Cell
64,
235-248[CrossRef][Medline]
[Order article via Infotrieve]
-
Newbold, R. F.,
Overell, R. W.,
and Connell, J. R.
(1982)
Nature.
299,
633-635[CrossRef][Medline]
[Order article via Infotrieve]
-
Heldin, C.-H.,
and Westermark, B.
(1984)
Cell
37,
9-20[CrossRef][Medline]
[Order article via Infotrieve]
-
Isfort, R. J.,
Cody, D. B.,
Kerckaert, G. A.,
and LeBoeuf, R. A.
(1994)
Carcinogenesis
15,
1203-1209[Abstract/Free Full Text]
-
Trosko, J. E.,
and Ruch, R.
(1998)
Frontiers Bioscience
3,
208-236
-
Hynes, R. O.
(1976)
Biochim. Biophys. Acta
458,
73-107[Medline]
[Order article via Infotrieve]
-
Vaheri, A.,
and Mosher, D. F.
(1978)
Biochim. Biophys. Acta
516,
1-25[Medline]
[Order article via Infotrieve]
-
Foulds, L.
(1969)
Neoplastic Development, Vol. 1, pp. 49-89, Academic Press, London
-
Hamada, K.,
Kumazaki, T.,
Mizuno, K.,
and Yokoro, K.
(1989)
Mol. Cell. Biol.
9,
4345-4356[Abstract/Free Full Text]
-
Branlant, C.,
Krol, A.,
Lazar, E.,
Haendler, B.,
Jacob, M.,
Galego-Dias, L.,
and Pousada, C.
(1983)
Nucleic Acids Res.
11,
8359-8367[Abstract/Free Full Text]
-
Hamada, K.
(1997)
Mol. Carcinogen.
20,
175-188[CrossRef][Medline]
[Order article via Infotrieve]
-
Hamada, K.,
and Mizuno, K.
(1992)
Mutat. Res.
267,
97-104[CrossRef][Medline]
[Order article via Infotrieve]
-
Mader, S.,
Lee, H.,
Pause, A.,
and Sonenberg, N.
(1995)
Mol. Cell. Biol.
15,
4990-4997[Abstract]
-
Lamphear, B. J.,
Kirchweger, R.,
Skern, T.,
and Rhoads, R.
(1995)
J. Biol. Chem.
270,
21975-21983[Abstract/Free Full Text]
-
Jackson, R. J.,
and Standart, N.
(1990)
Cell
62,
15-24[CrossRef][Medline]
[Order article via Infotrieve]
-
Gallie, D. R.
(1991)
Genes Dev.
5,
2108-2116[Abstract/Free Full Text]
-
Tarun, S. Z., Jr.,
and Sachs, A. B.
(1995)
Genes Dev.
9,
2997-3007[Abstract/Free Full Text]
-
Tarun, S. Z., Jr.,
and Sachs, A. B.
(1996)
EMBO J.
15,
7168-7177[Medline]
[Order article via Infotrieve]
-
Walter, P.,
and Blobel, G.
(1980)
Proc. Natl. Acad. Sci. U. S. A.
77,
7112-7116[Abstract/Free Full Text]
-
Walter, P.,
and Blobel, G.
(1982)
Nature
299,
691-698[CrossRef][Medline]
[Order article via Infotrieve]
-
Walter, P.,
and Lingappa, V. R.
(1986)
Annu. Rev. Cell Biol.
2,
499-516[CrossRef]
-
Ullu, E.,
and Tschudi, C.
(1984)
Nature.
312,
171-172[Medline]
[Order article via Infotrieve]
-
Wolin, S. L.,
and Walter, P.
(1989)
J. Cell Biol.
109,
2617-2622[Abstract/Free Full Text]
-
Walter, P.,
and Johnson, A. E.
(1994)
Annu. Rev. Cell Biol.
10,
87-119[CrossRef]
-
Melton, D. A.,
Krieg, P. A.,
Rebagliati, M. R.,
Maniatis, T.,
Zinn, K.,
and Green, M. R.
(1984)
Nucleic Acids Res.
12,
7035-7056[Abstract/Free Full Text]
-
Wood, K. V.,
deWet, J. R.,
Dewji, N.,
and DeLuca, M.
(1984)
Biochem. Biophys. Res. Commun.
124,
592-596[CrossRef][Medline]
[Order article via Infotrieve]
-
Muller, M.,
Ibrahimi, I.,
Chang, C. N.,
Walter, P.,
and Blobel, G.
(1982)
J. Biol. Chem.
257,
11860-11863[Abstract/Free Full Text]
-
Pelham, H. R.,
and Jackson, R. J.
(1976)
Eur. J. Biochem.
67,
247-256[Medline]
[Order article via Infotrieve]
-
Laemmli, U, K.
(1970)
Nature
227,
680-685[CrossRef][Medline]
[Order article via Infotrieve]
-
Rothman, J. E.,
and Lodish, H. F.
(1977)
Nature
269,
775-780[CrossRef][Medline]
[Order article via Infotrieve]
-
Chomczynski, P.,
and Sacchi, N.
(1987)
Anal. Biochem.
162,
156-159[Medline]
[Order article via Infotrieve]
-
Sambrook, J.,
Fritsch, E. F.,
and Maniatis, T.
(1989)
Molecular Cloning: A Laboratory Manual, 2nd Ed., pp. 207-209, Cold Spring Harbor Laboratory, Cold Spring Harbor, NY
-
Jackson, R. J.,
and Hunt, T.
(1983)
Methods Enzymol.
96,
50-74[Medline]
[Order article via Infotrieve]
-
Ullu, E.,
Murphy, S.,
and Melli, M.
(1982)
Cell
29,
195-202[CrossRef][Medline]
[Order article via Infotrieve]
-
Ullu, E.,
and Weiner, A. M.
(1984)
EMBO J.
3,
3303-3310[Medline]
[Order article via Infotrieve]
-
Siegel, V.,
and Walter, P.
(1985)
J. Cell Biol.
100,
1913-1921[Abstract/Free Full Text]
-
Siegel, V.,
and Walter, P.
(1988)
Cell
52,
39-49[CrossRef][Medline]
[Order article via Infotrieve]
-
Zwieb, C.
(1985)
Nucleic Acids Res.
13,
6105-6124[Abstract/Free Full Text]
-
Siegel, V.,
and Walter, P.
(1986)
Nature
320,
81-84[CrossRef][Medline]
[Order article via Infotrieve]
-
Gilmore, R.,
Walter, P.,
and Blobel, G.
(1982)
J. Cell Biol.
95,
470-477[Abstract/Free Full Text]
-
Meyer, D. I.,
Krause, E.,
and Dobberstein, B.
(1982)
Nature
297,
647-650[CrossRef][Medline]
[Order article via Infotrieve]
-
Noller, H. E.
(1991)
Annu. Rev. Biochem.
60,
191-227[Medline]
[Order article via Infotrieve]
-
Andreazzoli, M.,
and Gerbi, S. A.
(1991)
EMBO J.
10,
767-777[Medline]
[Order article via Infotrieve]
-
Andrews, D. W.,
Walter, P.,
and Ottensmeyer, F. P.
(1987)
EMBO J.
6,
3471-3477[Medline]
[Order article via Infotrieve]
-
Zwieb, C.
(1989)
Prog. Nucleic Acids Res. Mol. Biol.
37,
207-234[Medline]
[Order article via Infotrieve]
-
Schlenstedt, G.,
Gudmundsson, G. H.,
Boman, H. G.,
and Zimmermann, R.
(1990)
J. Biol. Chem.
265,
13960-13968[Abstract/Free Full Text]
-
Wiech, H.,
Klappa, P.,
and Zimmermann, R.
(1991)
FEBS Lett.
285,
182-188[CrossRef][Medline]
[Order article via Infotrieve]
-
Farber, E.,
and Sarma, D. S. R.
(1987)
Lab. Invest.
56,
4-22[Medline]
[Order article via Infotrieve]
-
Farber, E.,
and Rubin, H.
(1991)
Cancer Res.
51,
2751-2761[Free Full Text]
-
Shapiro, J. A.
(1984)
Mol. Gen. Genet.
194,
79-90[CrossRef][Medline]
[Order article via Infotrieve]
-
Cairns, J.,
Overbaugh, J.,
and Miller, S.
(1988)
Nature
335,
142-145[CrossRef][Medline]
[Order article via Infotrieve]
-
Hall, B. G.
(1990)
Genetics
126,
5-16[Abstract]
-
Strauss, B. S.
(1992)
Cancer Res.
52,
249-253[Free Full Text]
-
Hall, B. G.
(1995)
Proc. Natl. Acad. Sci. U. S. A.
92,
5669-5673[Abstract/Free Full Text]
-
Schwab, E. D.,
and Pienta, K. J.
(1996)
Med. Hypotheses
47,
235-241[CrossRef][Medline]
[Order article via Infotrieve]
-
Bridges, B. A.
(1997)
Bioessays
19,
347-352[CrossRef][Medline]
[Order article via Infotrieve]
-
Cairns, J.
(1998)
Genetics
148,
1433-1440[Free Full Text]
Copyright © 1999 by The American Society for Biochemistry and Molecular Biology, Inc.

CiteULike
Complore
Connotea
Del.icio.us
Digg
Reddit
Technorati What's this?