|
J Biol Chem, Vol. 274, Issue 22, 15847-15856, May 28, 1999
Multiple Enzymatic Activities of the Murein Hydrolase from
Staphylococcal Phage 11
IDENTIFICATION OF A D-ALANYL-GLYCINE
ENDOPEPTIDASE ACTIVITY*
William Wiley
Navarre §,
Hung
Ton-That ,
Kym F.
Faull¶ , and
Olaf
Schneewind **
From the Department of Microbiology & Immunology and the ¶ Department of Psychiatry & Biobehavioral
Sciences, UCLA School of Medicine, Los Angeles, California 90095
 |
ABSTRACT |
Bacteriophage muralytic enzymes degrade the cell
wall envelope of staphylococci to release phage particles from the
bacterial cytoplasm. Murein hydrolases of staphylococcal phages 11,
80 , 187, Twort, and PVL harbor a central domain that displays
sequence homology to known
N-acetylmuramyl-L-alanyl amidases; however, their precise cleavage sites on the staphylococcal peptidoglycan have
thus far not been determined. Here we examined the properties of the
11 enzyme to hydrolyze either the staphylococcal cell wall or
purified cell wall anchor structures attached to surface protein. Our
results show that the 11 enzyme has D-alanyl-glycyl endopeptidase as well as
N-acetylmuramyl-L-alanyl amidase activity. Analysis of a deletion mutant lacking the amidase-homologous sequence, 11( 181-381), revealed that the D-alanyl-glycyl
endopeptidase activity is contained within the N-terminal 180 amino
acid residues of the polypeptide chain. Sequences similar to this
N-terminal domain are found in the murein hydrolases of staphylococcal
phages but not in those of phages that infect other Gram-positive
bacteria such as Listeria or Bacillus.
 |
INTRODUCTION |
The cell wall envelope of Gram-positive bacteria is a
macromolecular, exoskeletal organelle that is assembled and turned over at designated sites (1). The cell wall functions not only to protect
bacteria from osmotic lysis but also serves as a surface organelle that
allows Gram-positive pathogens to interact with their environment, most
notably the infected tissues of the host (2). To understand the mode of
action of antibiotics and to identify new targets of antibacterial
therapy, Staphylococcus aureus has been employed as a model
organism to study the physiology of the cell wall of Gram-positive
bacteria for almost 50 years (3-5). The characterization of muralytic
enzymes has been instrumental in understanding cell wall turnover as
well as determining the structure of peptidoglycan (6).
The peptidoglycan of S. aureus consists of a repeating
disaccharide, N-acetylmuramic
acid-( 1-4)-N-acetylglucosamine
(MurNAc1-GlcNAc) (4, 7). The
D-lactyl moiety of N-acetylmuramic acid is
amide-linked to the short peptide component of peptidoglycan (8-10).
Wall peptides are cross-linked with other peptides attached to
neighboring glycan strands, thereby generating a three-dimensional network that surrounds the staphylococcal cell (11-13). During cell
wall synthesis the peptidoglycan precursor molecule, lipid II
(C55-PP-MurNAc-(L-Ala-D-iGln-L-Lys-(NH2-Gly5)-D-Ala-D-Ala-COOH)-GlcNAc; C55-PP is unde- caprenyl pyrophosphate), is
incorporated into the peptidoglycan network via transglycosylation and
transpeptidation reactions (14-17). Whereas transglycosylation leads
to the polymerization of the glycan strands, the transpeptidation
reaction results in the cross-linking of the peptide backbone of the
cell wall (18). During this reaction, the terminal D-Ala of
the pentapeptide precursor (L-Ala-D-iGln-L-Lys-(NH2-Gly5)-D-Ala-D-Ala-COOH)
is removed and the carboxyl of D-Ala at position four is
linked to the free amino of the pentaglycine cross-bridge within cell
wall peptides of neighboring peptidoglycan strands (19). Fig.
1 shows the structure of the
staphylococcal peptidoglycan and the cleavage sites of muralytic
enzymes.

View larger version (34K):
[in this window]
[in a new window]
|
Fig. 1.
Muralytic enzymes of staphylococcal
phages. A, diagram of staphylococcal peptidoglycan
(modified after Strominger and Ghuysen (20)) illustrating the sites of
hydrolysis for the 11 murein hydrolase,
N-acetylmuramyl-L-alanine amidase (amidase),
muramidase, glucosaminidase, and lysostaphin. B, schematic
diagram of the murein hydrolases from staphylococcal phage 11
(GenPept accession number 113675 (25)), 80 (accession number 1763243 (64)), Twort (accession number 2764981 (43)), PVL (accession number
3341932 (65)), and 187 (accession number 2764983) (43). Also shown
is a schematic diagram of the deletion construct 11( 181-301),
generated by removal of the central amidase portion of the full-length
11 enzyme. C, sequence alignment of the predicted
N-terminal domains of the enzymes shown in B. Optimal
sequence alignment was carried out via the World Wide Web using the
Multiple Sequence Alignment version 2.1 (66), provided by the Institute
for Biomedical Computing at Washington University, St. Louis, MO.
|
|
Several investigators employed biochemical techniques to isolate and
characterize staphylococcal murein hydrolases, leading to the
identification of N-acetylmuramyl-L-alanine
amidase, N-acetylglucosaminidase, D-Ala-Gly
endopeptidase, as well as Gly-Gly endopeptidase activities (6, 20-23).
The isolation of staphylococcal transposon variants that are defective
in autolysis has permitted the assignment of specific functions to
individual genes as well as sequence comparison between murein
hydrolases from many different bacterial species (24, 25). Murein
hydrolases can be grouped into two separate classes of enzymes. The
first group is the autolysins, for example S. aureus
N-acetylmuramyl-L-alanine amidase (Atl),
N-acetylglucosaminidase (Atl) (24), as well as the presumed
Gly-Gly endopeptidase (LytM) (26). Autolysins are secreted from the
bacterial cytoplasm by N-terminal signal peptides and degrade the cell
wall peptidoglycan at specific sites during physiological growth and/or
during stationary phase. Bacteriophage-encoded murein hydrolases, also
called endolysins, are exported by holins, small polypeptides that are
inserted into the cytoplasmic membrane of the bacterial host (27).
Endolysins function to completely hydrolyze the cell wall peptidoglycan
as a means to release bacteriophage particles from the bacterial cytoplasm.
The gene encoding the murein hydrolase of staphylococcal phage 11
has been sequenced (25). Sequence comparison revealed that this
endolysin has a modular organization consisting of an N-terminal, a
central, and a C-terminal domain. The central domain of the 11
enzyme displays sequence similarity with known
N-acetylmuramyl-L-alanine amidases, whereas the
C-terminal domain is homologous to the cell wall targeting signal of
lysostaphin, a staphylolytic bacteriocin secreted by
Staphylococcus simulans biovar staphylolyticus
(23, 28, 29). Targeting signals are thought to function as binding domains that direct muralytic enzymes to specific receptors on the
bacterial surface (28, 30). The N-terminal domain of 11 murein
hydrolase displays sequence similarity to endolysins of other
aureophages ( 187, 11, 80 , Twort, and PVL); however, a
specific murein hydrolase function has thus far not been assigned to
this domain (Fig. 1C).
Surface proteins of S. aureus are covalently attached to the
peptidoglycan by a mechanism requiring a C-terminal sorting signal and
conserved LPXTG motif (31, 32). After export from the cytoplasm via an N-terminal signal peptide, the sorting signal is
cleaved between the threonine and the glycine of the LPXTG motif. The carboxyl of threonine is linked to the amino group of the
pentaglycine cross-bridge in the staphylococcal cell wall (33, 34). Our
previous work sought to characterize the cell wall anchor structure of
staphylococcal surface proteins after their solubilization with murein
hydrolases (32, 35, 36). When the peptidoglycan is cut with
lysostaphin, a glycyl-glycine endopeptidase (29, 37), purified surface
protein migrates uniformly on SDS-PAGE (32). The solubilized
polypeptides have two or three glycine residues linked to the carboxyl
of threonine (34). In contrast, when solubilized with
N-acetylmuramidase or
N-acetylmuramyl-L-alanine amidase, surface
proteins migrate as a spectrum of fragments on SDS-PAGE with increasing
mass (35). This can be explained as surface protein linked to
peptidoglycan with different amounts of cross-linked cell wall subunits.
We have used purified recombinant 11 murein hydrolase to solubilize
staphylococcal surface proteins from the bacterial cell wall (36). When
analyzed on SDS-PAGE, surface protein migrated as two distinct species,
closely resembling the uniform migration of lysostaphin-released
species but not the heterogeneous pattern observed for
N-acetylmuramidase- or
N-acetylmuramyl-L-alanine amidase-solubilized
surface protein. This was a surprising result, because the 11 murein
hydrolase is known to display sequence homology with known
N-acetylmuramyl-L-alanine amidases.
Characterization of the 11 murein hydrolase-released cell wall
anchor structures of surface proteins revealed the presence of linked
cell wall tetrapeptide
(L-Ala-D-iGln-L-Lys-(surface
protein-Gly5)-D-Ala-COOH) and
disaccharide-tetrapeptide
(MurNAc-(L-Ala-D-iGln-L-Lys-(surface protein-Gly5)-D-Ala-COOH)-GlcNAc) (36). These
observations suggested that the 11 murein hydrolase may cleave the
peptidoglycan at two sites, the amide bond between
N-acetylmuramyl and L-Ala and the peptide bond
between D-Ala and Gly. We show here that the 11 murein
hydrolase displays D-Ala-Gly endopeptidase as well as
N-acetylmuramyl-L-alanine amidase activity.
Furthermore, we demonstrate that the N-terminal domain of 11 murein
hydrolase functions as a D-Ala-Gly endopeptidase.
 |
EXPERIMENTAL PROCEDURES |
Strains and Materials--
Staphylococcal strain OS2 has been
previously described (31) and was used as a host for the recombinant
plasmid pHTT4 encoding the recombinant surface protein
Seb-MH6-Cws (36). Escherichia coli strain
BL21(DE3) (38) was used as a host for the expression of the 6His-tagged
11 and 11( 181-381) enzymes. The coding sequence of the
6His-tagged 11 amidase was contained on plasmid pHTT2 (36). The
truncated mutant protein, 11( 181-381), was generated by the
ligation of DNA fragments encoding the N-terminal 180 amino acids and
C-terminal 100 amino acids of the full-length 11 protein. DNA
encoding the C-terminal domain of the 11 hydrolase was polymerase chain reaction-amplified from pHTT2 DNA using the primers LA-Kpn (28) and 11-Bam6His
(AAGGATCCCTAGTGATGGTGATGGTGATGACTGATTTCTCCCCATAAGTC) (36). DNA encoding
the N-terminal domain was polymerase chain reactionamplified from
pHTT2 DNA using the primers 11-Nde (AACATATGCAAGCAAAATTAACTAAAAAT) (36) and 11-Kpn2 (AAAGGTACCTTCTACTGCTTTAGGTTGTGG). The
resulting polymerase chain reaction products were digested with
BamHI and KpnI or NdeI and
KpnI and subsequently cloned in a three-way ligation into
the NdeI and BamHI sites of the vector pET9a (38)
to generate pWil54. Tryptic soy broth was purchased from Difco.
Mutanolysin and isopropyl-1-thio- -D-galactopyranoside
were purchased from Sigma. All other chemicals were purchased from
Fisher unless otherwise noted.
Isolation of Seb-MH6-Cws from Staphylococcal Cell
Walls--
The purification of Seb-MH6-Cws surface protein
from cell walls of S. aureus OS2 harboring the plasmid pHTT4
was carried out as described previously (35). Briefly, sedimented cells
were washed in 50 mM Tris-HCl, pH 7.5, and were broken with
a Bead-Beater instrument (Biospec Products, Bartlesville, OK). Walls
were sedimented by ultracentrifugation and suspended in 50-70 ml of
wash buffer (100 mM potassium phosphate, pH 7.5, 1% Triton
X-100). The suspension was stirred for 3-12 h at 4 °C, and cell
walls were sedimented by centrifugation for 15 min at 32,500 × g. The walls were washed three times in 100 mM
sodium phosphate, pH 6.0, followed by a single wash with water prior to
digestion with either mutanolysin, 11, or 11( 181-381) enzymes
(see below). Digestion of cell walls with mutanolysin was carried out
in 100 mM sodium phosphate buffer, pH 6.0, as described
previously (35). Digestion of cell walls with 11 or
11( 181-381) was carried out in 50 mM Tris-HCl, pH 7.5, 100 mM NaCl with approximately 1 mg of enzyme per
liter of staphylococcal culture from which the walls were isolated.
Buffers throughout the procedure were supplemented with 1 mM PMSF and 1 µM pepstatin to prevent
proteolysis of the Seb-MH6-Cws protein. Solubilized
Seb-MH6-Cws protein was fast protein liquid chromatography purified by affinity chromatography on nickel resin as described previously (35).
Purification of 6His-tagged 11 and 11( 181-381)
Enzymes--
E. coli BL21(DE3) harboring either pHTT2 and
pLysS (38) or pWil54 were grown overnight in LB medium containing
either chloramphenicol (30 µg/ml) and kanamycin (50 µg/ml) or
chloramphenicol alone, respectively. The culture was diluted 1:50 into
fresh medium and grown with shaking at 37 °C to an
A600 of 0.2 whereupon the expression of T7
polymerase was induced by the addition of
isopropyl-1-thio- -D-galactopyranoside to a final
concentration of 1 mM. Cells were harvested after 4 h
by centrifugation at 8,000 × g. Preliminary
experiments revealed that both full-length and truncated 11 enzymes
were contained in inclusion bodies, and subsequent purification steps
were therefore carried out under denaturing conditions. The E. coli cell sediments were suspended in 50 ml of buffer A (6 M guanidine hydrochloride, 0.1 M
NaH2PO4, 0.01 M Tris-HCl, pH 8.0);
cells were lysed by passage through a French pressure cell at 14,000 pounds/square inch, and insoluble material was removed by
centrifugation at 30,000 × g for 20 min. Enzymes were
fast protein liquid chromatography purified from the supernatant over a
1-ml bed volume column of nickel nitrilotriacetic acid resin (Qiagen).
The column was pre-equilibrated with buffer Q1 (8 M urea,
100 mM NaH2PO4, 0.01 M
Tris-HCl, pH 7.3) and, after loading with sample, was washed with an
additional 10 ml of buffer Q1. The column was washed with 15 ml of 30%
Q1 and 70% Q2 (8 M urea, 100 mM
NaH2PO4, 0.01 M Tris-HCl, pH 4.2).
Protein was eluted from the column in a pH-dependent manner
by a step gradient to 100% Q2 buffer.
The purified enzymes, in approximately 5 ml of Q2 buffer, were folded
by dialysis against 1 liter of dialysis buffer (50% glycerol, 50 mM sodium phosphate, 10 mM MgCl2, 2 mM dithiothreitol, pH 6.8) for 4-6 h at 4 °C without
stirring and again against fresh dialysis buffer overnight with slow
stirring. Insoluble protein was removed by centrifugation, and the
concentration of soluble enzyme was measured by a modified Lowry assay
(Bio-Rad) against a standard of bovine serum albumin. Enzyme
preparations were stored at 20 °C and used directly from stock for
all assays.
Preparation of Staphylococcal Cell Walls--
Crude cell walls
used for Morgan-Elson and DNFB assays (see below) were prepared from a
culture of S. aureus OS2 grown to post-log phase in tryptic
soy broth. Cells were harvested by centrifugation for 15 min at
8,000 × g, suspended in 50 mM Tris-HCl, pH
7.5, and broken with glass beads in a Bead-Beater instrument (5 pulses of 3 min each interspersed with 5 min cooling on ice). Crude cell walls
were sedimented by ultra-centrifugation (100,000 × g
for 30 min) and suspended in 20 ml of a 1% SDS solution and boiled for
30 min. Crude walls were sedimented by centrifugation at 30,000 × g and washed five times with water.
Highly purified staphylococcal peptidoglycan employed for Edman
degradation and mass analysis of 11 and
11( 181-381)-solubilized muropeptides was prepared essentially as
described by de Jonge et al. (39). S. aureus OS2
cells were grown to mid-log phase in tryptic soy broth, and culture was
chilled to 4 °C on ice. Cells were harvested by centrifugation,
suspended in a solution of 4% sodium dodecyl sulfate (SDS), and boiled
for 30 min. Cells were centrifuged for 10 min at 30,000 × g and washed six times with water. The cells were broken
with 0.2-mm glass beads in a Bead-Beater instrument as described above.
Glass beads were removed by centrifugation at 200 × g
for 5 min. Broken cell walls were collected by centrifugation at
30,000 × g for 15 min, and the pellet was suspended in
50 mM Tris-HCl, 10 mM MgCl2, pH
7.5. Walls were treated with -amylase (Sigma, 100 µg/ml), DNase
(Sigma, 10 µg/ml), and RNase A (Qiagen, 50 µg/ml) for 2 h at
37 °C. CaCl2 was added to a final concentration of 10 mM, and protein was removed from the peptidoglycan by the
addition of trypsin (Sigma, 100 µg/ml) and incubating the walls
overnight at 37 °C. Walls were collected by centrifugation, washed
two times with water, once with 8 M LiCl, once with 100 mM EDTA, twice more with water, and finally with acetone.
Walls were suspended in water and stored at 20 °C.
Preparation of C-terminal Anchor Peptides--
Preparation of
C-terminal anchor peptides from Seb-MH6-Cws was carried out
as described previously (35). Purified Seb-MH6-Cws was
methanol/chloroform-precipitated, dried under vacuum in a Speed-Vac
concentrator (Savant), and suspended in 1-3 ml of 70% formic acid.
Five mg of cyanogen bromide was added, and the cleavage reaction was
incubated for 16-18 h at room temperature in the dark. The cleaved
peptides were dried under vacuum, washed twice with water, and
suspended in 1-2 ml of buffer A. Samples were loaded onto a column
packed with 1 ml of nickel nitrilotriacetic acid pre-equilibrated with
10 ml of buffer A. The Column was washed with 10 ml of each buffer A,
buffer B (8 M urea, 100 mM
NaH2PO4, 0.01 M Tris-HCl, pH 8.0),
and buffer C (same as buffer B, but pH 6.3). Peptides were eluted with
2 ml of buffer D (6 M guanidine hydrochloride, 0.5 M acetic acid, pH 4.3) and subjected to rpHPLC on C18
column (2 × 250 mm, C18 Hypersil, Keystone Scientific). Separation was carried out at 40 °C at a flow rate of 0.2 ml/min with a linear gradient starting 10 min after injection from 99% H2O (0.1% trifluoroacetic acid) to 60% H2O
and 40% CH3CN in 35 min followed by a steeper gradient to
99% CH3CN in 5 min. Elution of peptides was monitored at
215 nm, and 1-min fractions were collected.
MALDI-MS--
Dried HPLC fractions containing the peptides of
interest were suspended in CH3CN:water:trifluoroacetic acid
(50:50:0.1), typically 50 µl per 1.5 absorbance units at 215 nm.
MALDI-MS spectra were obtained on a reflectron time-of-flight
instrument (Perspective Biosystems Voyager RP) in the linear mode.
Samples (0.5 µl) were co-spotted with 0.5 µl of matrix
( -cyano-4-hydroxycinnamic acid, 10 mg/ml in
CH3CN:water:trifluoroacetic acid (70:30:0.1)). All samples
were externally calibrated to a standard of bovine insulin.
HPLC Separation of Muropeptides--
For the analysis of
muropeptides removed from surface protein by digestion with the 11
enzyme, anchor peptides were solubilized with mutanolysin and, after
purification, were redigested with the 11 murein hydrolase at a
concentration of 400 µg/ml overnight at 37 °C. Digestion was
terminated by the addition of trifluoroacetic acid to a concentration
of 10%. Samples were placed on ice to precipitate the 11 enzyme,
which was separated from the soluble muropeptides by centrifugation at
15,000 × g for 15 min. Trifluoroacetic acid-soluble
compounds (muropeptides) were desalted over a C18 cartridge (Analtech)
and dried under vacuum. Dried muropeptides were suspended in 200 µl
of water. To the peptides, 200 µl of 0.5 M sodium borate
buffer, pH 9.0, was added followed by the immediate addition of 1-3 mg
of solid sodium borohydride. Reduction of muropeptides was previously
shown to be essential for effective separation by rpHPLC (40). The
reaction was incubated for 30 min at room temperature and quenched by
the addition of 20 µl of 20% phosphoric acid.
The purification and rpHPLC analysis of muropeptides generated by the
digestion of intact peptidoglycan with the 11 and 11( 181-381) enzymes was carried out using highly purified peptidoglycan as a
substrate. Approximately 2 mg of pure staphylococcal peptidoglycan (see
above) was digested with approximately 400-500 µg of enzyme in 1 ml
of 50 mM Tris-HCl, 100 mM NaCl, pH 7.5, for
4 h at 37 °C. Enzyme was precipitated by the addition of
trifluoroacetic acid to 10% and centrifugation after 15 min on ice.
Removal of linked teichoic acids from the soluble muropeptides was
achieved by heating the soluble muropeptides to 60 °C for 14 h.
Muropeptides were desalted over a C18 cartridge and dried. The
muropeptides were resuspended and reduced with sodium borohydride as
described for the anchor muropeptides.
Separation of muropeptides by rpHPLC was carried out using a C18 column
and a method devised for E. coli wall peptides (40) that was
later modified for the separation of S. aureus muropeptides (39). The C18 column employed for the separation of muropeptides from
anchor peptides (2 × 250 mm, C18 Hypersil, Keystone Scientific) contained a slightly different resin than the C18 column employed for
the separation of muropeptides from purified peptidoglycan (2 × 250 mm, C18 Aquasil, Keystone Scientific), resulting in a discrepancy
in the retention times observed between the two experiments. A linear
gradient was started immediately after injection of 5% (v/v) methanol
in 100 mM NaH2PO4 (pH 2.5) to 30%
(v/v) methanol in 100 mM NaH2PO4
(pH 2.8) in 100 min. Azide was not added to the start buffer, and
base-line drift was accounted for by subtracting the chromatogram of a
blank run. Eluted muropeptides were monitored at 206 nm, and positive
fractions were desalted using a C18 cartridge and dried under vacuum
prior to analysis by ESI-MS or Edman degradation.
Chemical Analysis of Solubilized Muropeptides by Modified
Morgan-Elson and DNFB Assays--
Crude staphylococcal cell walls were
resuspended in water (20 mg wet weight/ml) to make a stock solution.
Into each reaction tube, 400 µl of wall stock was mixed with 500 µl
of 100 mM NaH2PO4, pH 7.5 (or pH
6.0 for mutanolysin reaction), and 100 µl of NaCl to give an initial
A600 of 1.1. Lysostaphin (10 µg/ml), 11
enzyme (100 µg/ml), 11( 181-301) (100 µg/ml), or mutanolysin
(50 units/ml) were added, and the crude cell walls were digested
overnight to an A600 <0.1. Insoluble material
was removed by centrifugation for 30 min at 13,000 × g, and soluble material was transferred to another Eppendorf tube.
For the measurement of soluble N-acetylhexosamines by a
modified Morgan-Elson reaction (22), 100 µl of the soluble digestion products were mixed with 100 µl of 2%
K2B4O7 in water. The samples were
boiled for 30 min and allowed to cool to room temperature. p-Dimethylaminobenzaldehyde (Ehrlich's reagent) was
dissolved into a total volume of 9.5 ml of acetic acid, and 0.5 ml of
concentrated HCl was added to give a stock reagent. 1 ml of stock
reagent was diluted per 7 ml of acetic acid to generate the color
reagent. To the boiled muropeptides, 900 µl of color reagent was
added, and the mixture was kept at 37 °C for 20 min. Color was read
spectrophotometrically at 585 nm, and samples were compared with
standards of GlcNAc of known concentration. GlcNAc standards were
boiled in K2B4O7 for 7 min instead
of 30 min to compensate known discrepancies between the extinction
coefficient of free N-acetylhexosamines and those that exist
as disaccharides or are amidically linked to wall peptides.
The liberation of free amino groups was measured by mixing 100 µl of
the soluble wall digestion products with 100 µl of 2% K2B4O7 in water (22). To this, 20 µl of DNFB solution (130 µl of DNFB in 10 ml of ethanol) was added,
and the mixture was heated to 60 °C for 30 min. The reaction was
stopped by the addition of 800 µl of 2 N HCl, and
absorbance was read at 420 nm. All experiments were performed in
triplicate and compared with a standard of L-alanine.
ESI-MS of Muropeptides--
Dried muropeptides were dissolved in
30 µl of water:CH3CN:formic acid (50:50:0.1). A
Perkin-Elmer Sciex API III triple quadrupole mass spectrometer was
tuned and calibrated by flow injection (10 µl/min) of a mixture of
PPG 425, 1000, and 2000 (3.3 × 10 5, 1 × 10 4, and 2 × 10 4 M,
respectively) in water:methanol (1:1) containing 2 mM
ammonium formamide and 0.1% CH3CN. Calibration across the
m/z range 10-2400 was achieved by multiple ion monitoring
of eight PPG solution signals (singly charged ions at m/z
58.99, 326.25, 906.67, 1254.92, 1545.13, 1863.34, and 2010.47 and the
doubly charged ion at m/z 520.4). The ion spray voltage was
operated at 4.5 kV using hydrocarbon-depleted air for the spray
nebulization, and spectra were generated with a curtain gas produced
from the vapors of liquid nitrogen. Samples were introduced into the
ionization source by flow injection. ESI-MS spectra were obtained at
instrument conditions sufficient to resolve the isotopes of the
PPG/NH4+ singly charged ion at
m/z 906 with 40% valley, an orifice voltage of 60, and step
size during data collection of 0.3 Da. Daughter ion spectra were
obtained using degraded mass resolution to improve sensitivity of
detection, and a step size of 1 Da was used for data collection. Under
these conditions, the isotopes of the
PPG/NH4+ singly charged ion at
m/z 906 were not resolved from one another.
 |
RESULTS |
11 Murein Hydrolase Digestion of Cell Wall Anchor Structures
from Staphylococcal Surface Proteins--
Previous characterization of
11 murein hydrolase-released cell wall anchor structures of surface
proteins revealed the presence of linked cell wall tetrapeptide
(L-Ala-D-iGln-L-Lys-(surface protein-Gly5)-D-Ala-COOH) and
disaccharide-tetrapeptide
(MurNAc-(L-Ala-D-iGln-L-Lys-(surface protein-Gly5)-D-Ala-COOH)-GlcNAc) (36). This
observation suggested that the 11 murein hydrolase may cleave the
peptidoglycan at two sites, the amide bond between
N-acetylmuramyl and L-Ala and the peptide bond
between D-Ala and Gly. If so, 11 murein hydrolase digestion of muramidase-released surface protein should yield L-Ala-D-iGln-L-Lys-(surface
protein-Gly5)-D-Ala-COOH. Indeed, the mobility
of the doubly digested surface protein on SDS-PAGE was found to be
identical to surface protein solubilized directly from the
staphylococcal peptidoglycan with the 11 enzyme (Fig. 2C), indicating that the
attached peptidoglycan subunits had been removed.

View larger version (26K):
[in this window]
[in a new window]
|
Fig. 2.
RP-HPLC analysis of murein linked to
mutanolysin-released anchor peptides redigested with
11 murein hydrolase. A, diagram of
the hybrid surface protein Seb-MH6-Cws used in these
studies. Labeled arrows indicate the specific cleavage sites
for signal peptidase, cyanogen bromide, and sortase. B,
mutanolysin-solubilized anchor peptides were reduced with sodium
borohydride and digested with the 11 murein hydrolase. Enzyme was
precipitated with 10% trifluoroacetic acid, and the acid-soluble
muropeptides were separated by RP-HPLC. Absorbance was monitored at 206 nm, and fractions corresponding to major absorption peaks (A,
B, and C) were analyzed by ESI-MS (see text).
C, SDS-PAGE of Seb-MH6-Cws after solubilization
from the cell wall with either mutanolysin (Mutano.) or
mutanolysin solubilization followed by a second digest with the
full-length 11 hydrolase (Mutano. + 11).
|
|
To examine the structures of the muropeptides removed from the surface
protein by the 11 enzyme, we employed a strategy previously devised
to analyze the cell wall anchor structures of staphylococcal surface
proteins (35, 36). Seb-MH6-Cws is a fusion between staphylococcal enterotoxin B and the cell wall sorting signal of
protein A (Fig. 2A). At the fusion site between these
domains a methionine followed by six histidines has been inserted.
After solubilization of the staphylococcal cell wall with the
muramidase mutanolysin, Seb-MH6-Cws was purified by
affinity chromatography on nickel resin and cleaved by cyanogen bromide
close to the anchoring point of the polypeptide with the cell wall. The
C-terminal anchor peptides were purified by a second round of affinity
chromatography and were then digested with 11 murein hydrolase. When
separated by rpHPLC, the doubly digested cell wall anchor peptides
generated three major and several minor peaks of absorption at 206 nm
(Fig. 2B). The major peaks (designated A, B, and C) were
desalted, concentrated, and analyzed by ESI-MS.
The sample that eluted at 7.2% methanol (peak A) generated an ion with
m/z 702.4, a measurement that is in close agreement with the
structure of a peptidoglycan cleavage fragment
NH2-L-Ala-D-iGln-L-Lys-(NH2-Gly5)-D-Ala-COOH (calculated ion mass (MH+) 702.74). The sample that eluted
at 9.9% methanol (peak B) yielded two ions with m/z 1182.8 and 979.7, observations that correspond to the peptidoglycan structures
MurNAc-(L-Ala-D-iGln-L-Lys-(NH2-Gly5)-D-Ala-COOH)-( 1-4)-GlcNAc (calculated MH+ 1182.21) and
MurNAc-(L-Ala-D-iGln-L-Lys-(NH2-Gly5)-D-Ala-COOH) (calculated MH+ 979.02), respectively. As can be observed
in the chromatogram, peak B partially overlapped with two other smaller
peaks. Thus, the identification of two separate compound masses is most
likely due to incomplete separation on rpHPLC. The sample that eluted at 12.2% methanol (peak C) generated an ion with m/z
1224.5, a measurement that is in agreement with the structure of
N,O6-diacetylated MurNAc-(L-Ala-D-iGln-L-Lys-(NH2-Gly5)-D-Ala-COOH)-( 1-4)-GlcNAc (calculated MH+ 1225.2).
These ESI-MS data further corroborated our hypothesis that the 11
hydrolase may cut muramidase-released cell wall anchor structures at
two positions, the amide bond between N-acetylmuramyl and
L-Ala and the peptide bond between D-Ala and
Gly. Nevertheless, the ESI-MS data cannot distinguish between
D-Ala-Gly or Gly-Gly endopeptidase activity, as the
compound mass of 702.74 could be explained as peptides with the
structure
NH2-L-Ala-D-iGln-L-Lys-(NH2-Gly5)-D-Ala-COOH, NH2-L-Ala-D-iGln-L-Lys-D-Ala-Gly5-COOH,
or any permutation thereof. To distinguish between these possibilities
we examined the structure of the ion with m/z 702.4 by CID
in an MS/MS experiment (Table I and Fig.
3). We observed a fragmentation product
ion at m/z 286, corresponding to an intact pentaglycine
cross-bridge. We also observed a daughter ion of mass 614, a product of
removal of a single D-alanine from position 4 of the stem
peptide, indicating that the D-Ala at position four of the
wall peptide was not substituted and that the pentaglycyl was linked to
the -amino of lysine. See Table I for a listing of the observed
daughter ions and an interpretation of their structure.
View this table:
[in this window]
[in a new window]
|
Table I
Summary of CID daughter ions of the parent ion with m/z 702 observed in
MS/MS experiment and their proposed structural assignments (Fig. 3)
Many of the ions observed arose from fragmentation of the branched
peptide at multiple sites. Numbers in parentheses indicate the number
of fragmentation events necessary to generate the proposed ions.
|
|

View larger version (18K):
[in this window]
[in a new window]
|
Fig. 3.
CID-MS/MS analysis of the compound in peak
A. A, the compound of m/z 702 (peak
A, Fig. 2) was subjected to CID in an MS/MS experiment (see
"Experimental Procedures" for a detailed description).
B, diagram of a peptidoglycan subunit of mass 701 with
fragmentation ions indicated.
|
|
We would also expect that Edman degradation of the sample in peak A and
peak B should yield five consecutive cycles of phenylthiohydantoin glycine if the 11 enzyme displayed D-Ala-Gly
endopeptidase activity. This was tested, and the concentration of
phenylthiohydantoin glycine obtained after Edman degradation remained
similar during five consecutive cleavage cycles. Equimolar amounts of
phenylthiohydantoin alanine and glycine were released in cycle 1 of the
peak A sample, whereas no such release of alanine was observed for
material that eluted in peak B (Table
II). This observation is consistent with the presence of an N-terminal alanine in the peak A but not in the peak
B sample.
View this table:
[in this window]
[in a new window]
|
Table II
Edman degradation and ESI-MS of muropeptides removed from
mutanolysin-solubilized surface protein with the 11 enzyme
(compounds in peak A and B from Fig. 2)
Compounds eluted after HPLC chromatography as shown in Fig. 2 were
desalted and analyzed by ESI-MS or subjected to protein sequence
analysis. No amino acids other than glycine and alanine were detected
in significant amounts during the sequencing reaction. Numbers in
parentheses indicate the concentration of cleaved phenylthiohydantoin
residues in picomoles.
|
|
The ESI-MS, CID-MS/MS, and Edman degradation data indicate that peak A
contained a branched peptide with the structure
NH2-L-Ala-D-iGln-L-Lys-(NH2-Gly5)-D-Ala-COOH andwith two N termini (Ala and Gly), whereas peak B contained a
branched peptide with the structure
MurNAc-(L-Ala-D-iGln-L-Lys-(NH2-Gly5)-D-Ala-COOH)-( 1-4)-GlcNAc and only one N terminus (Gly). These data suggest that the 11 murein
hydrolase cut muramidase-released anchor peptides at two sites, the
D-Ala-Gly peptide bond and the
N-acetylmuramyl-L-Ala amide bond. Cleavage at
the latter site appeared to be less effective as more than half of all
cleavage products still contained linked disaccharide. This observation
is similar to the direct solubilization of surface protein with 11
murein hydrolase, which yielded equal amounts of anchor peptides with
linked tetrapeptide
(NH2-L-Ala-D-iGln-L-Lys-(surface protein-Gly5)-D-Ala-COOH) and disaccharide
tetrapeptide
MurNAc(L-Ala-D-iGln-L-Lys-(surface protein-Gly5)-D-Ala-COOH)-( 1- 4)-GlcNAc.
Purification and Characterization of the 11( 181-301)
Enzyme--
To test whether the N-terminal domain of 11 hydrolase
contained D-Ala-Gly endopeptidase or any other muralytic
activity, we generated a recombinant enzyme, 11( 181-301), in
which the 201 amino acid residues spanning the amidase domain were
removed (Fig. 1A). Like the full-length 11 hydrolase, the
11( 181-301) enzyme was purified via a C-terminal six histidyl
tag by affinity chromatography on nickel-Sepharose (see "Experimental
Procedures"). As measured with both crude and purified cell walls,
the 11( 181-301) enzyme degraded the staphylococcal peptidoglycan
similar to full-length 11 hydrolase (Fig.
4).

View larger version (15K):
[in this window]
[in a new window]
|
Fig. 4.
Digestion of crude staphylococcal cell walls
with the 11( 181-301)
enzyme. Crude staphylococcal cell walls were prepared by lysing
staphylococci with glass beads and sedimenting the walls by
centrifugation. The wall pellet was boiled in 2% SDS in water for 20 min and washed several times with water alone to remove excess
detergent. The crude walls were resuspended to a final absorbance of
0.7 (600 nm) in the lysis buffer and distributed to tubes containing
either EDTA ( , 5 mM), p-hydroxymercuribenzoic
acid ( , 1 mM), a mixture of pepstatin (2.5 µM) and PMSF (2 mM, ), or water (no
inhibitor, /no enzyme, ). Reactions were started by the addition
of purified enzyme (except in the no enzyme tubes), and aliquots were
taken at various time points, and lysis of walls was measured as a
decrease in absorbance at 600 nm. The experiment was performed in
triplicate using the identical cell wall/lysis buffer preparation, and
results were averaged. Absorbances at all data points are displayed as
an average of the three experiments, and the results did not vary
between the experiments by more than 3%.
|
|
Alignment of the N-terminal domains from the phage enzymes (Fig.
1C) revealed the presence of several regions of homology between all four polypeptides, including 18 invariant residues. Of
particular note is the presence of one conserved cysteine and three
conserved aspartic acids, potentially catalytic residues that leave
open the possibility that D-Ala-Gly endopeptidase cleavage occurs by a mechanism similar to cysteine or aspartate proteases. To
address this possibility we tested the staphylolytic activity of the
11( 181-301) enzyme in the presence of protease inhibitors, and
we found that the activity could be completely abolished in the
presence of 1 mM p-hydroxymercuribenzoic acid,
an organic mercurial known to form stable complexes with thiol moieties
(cysteine) (Fig. 4) (41). The purified enzyme was partially inhibited
in the presence of 5 mM EDTA; however, a mixture of
pepstatin and PMSF, inhibitors of aspartate and serine proteases, had
no effect on the cell wall hydrolysis activity of the
11( 181-301) enzyme. These data suggest that the conserved
cysteine residue is required for the D-Ala-Gly
endopeptidase activity of the N-terminal portion of 11 murein hydrolase.
Many muralytic enzymes possess glycan hydrolase activity as indicated
by the release of reducing N-acetylhexosamines (22). We
analyzed the 11 and 11( 181-301) enzymes for such an activity against crude staphylococcal cell walls using a modified Morgan-Elson procedure. As indicated in Table III,
neither the 11 nor 11( 181-301) enzyme released significant
hexosamine from staphylococcal cell walls. As a control, mutanolysin,
an N-acetylmuramidase, released reducing hexosamines,
whereas lysostaphin, a glycyl-glycine endopeptidase, did not. We
measured the activity of murein hydrolases to release free amino groups
from the staphylococcal cell wall with the Sanger reagent (DNFB), a
chromogenic compound reactive with free amino groups. 11 murein
hydrolase as well as the 11( 181-301) enzyme released significant
amounts of free amino acid from the staphylococcal cell wall. As a
control, mutanolysin liberated only small amounts, whereas lysostaphin
released large amounts of free amino groups. These data indicate that
11 murein hydrolase as well as the 11( 181-301) enzyme display
endopeptidase but no glycan hydrolase activity on the staphylococcal
cell wall.
View this table:
[in this window]
[in a new window]
|
Table III
Liberation of amino groups and hexosamines from digested staphylococcal
peptidoglycan
Crude cell walls were digested with the enzymes as indicated. Soluble
aliquots were removed and measured for the presence of free amino
groups or hexosamines (see text). Data represent an average of three
independent experiments. The standard deviation of these measurements
is indicated as ±.
|
|
To reveal the identity of amino groups liberated by digestion with the
11 enzymes, highly purified staphylococcal peptidoglycan was
digested, and the resulting muropeptides were subjected to Edman
degradation. The 11 hydrolase-digested sample contained similar
amounts of phenylthiohydantoin alanine and glycine during the first
cycle, whereas the next four cycles yielded predominantly glycine. In
contrast, the 11( 181-301) enzyme-digested sample contained
mostly phenylthiohydantoin glycine during five consecutive cleavage
cycles (Table IV).
View this table:
[in this window]
[in a new window]
|
Table IV
Edman degradation of muropeptides generated by the digestion of
purified staphylococcal peptidoglycan
Edman degradation of muropeptides generated from 11 and 11
( 181-301) digestion of purified staphylococcal cell walls (pmol
released per cycle indicated in parentheses). Glycine and alanine were
the only phenylthiohydantoin amino acids observed in significant
amounts during sequencing.
|
|
Purification of Peptidoglycan Cleavage Products of the 11
Enzymes--
To analyze the digestion products of the 11 or
11( 181-301) enzymes by rpHPLC, digested staphylococcal
peptidoglycan was further degraded with mutanolysin to cleave the
glycan strands and liberate muropeptide monomers. After reduction of
muropeptides with sodium borohydride, the sample was subjected to
rpHPLC using the same procedure employed for the separation of
muropeptides removed from the staphylococcal surface protein. The 11
hydrolase-digested sample yielded one major peak that eluted at 5.6%
methanol (Fig. 5A). Analysis
of this sample by ESI-MS revealed a compound with m/z 702.3, corresponding to the mass of a singly charged muropeptide of the
structure
NH2-L-Ala-D-iGln-L-Lys-(NH2-Gly5)-D-Ala-COOH (predicted mass 702.7). rpHPLC analysis of the 11( 181-301)
enzyme-digested sample also generated one major peak that eluted at
8.0% methanol (Fig. 5B). ESI-MS of the eluted sample
revealed a single ion of m/z 1182.6. This measurement is in
agreement with the predicted m/z of a singly charged
muropeptide of the structure
MurNAc-(L-Ala-D-iGln-L-Lys-(NH2-Gly5)-D-Ala-COOH)-( 1-4)-GlcNAc (calculated ion mass 1182.2). Taken together the data indicate that the
11 murein hydrolase has N-acetylmuramyl-L-Ala
amidase as well as D-Ala-Gly endopeptidase activity,
whereas the 11( 181-301) enzyme displays only
D-Ala-Gly endopeptidase activity.

View larger version (18K):
[in this window]
[in a new window]
|
Fig. 5.
Comparison of muropeptides generated by
digestion of purified staphylococcal peptidoglycan with the
full-length 11 and
11( 181-301) enzymes by
rpHPLC. A, staphylococcal peptidoglycan was solubilized
with the 11 murein hydrolase, and glycan strands were degraded by
subsequent digestion of the solubilized muropeptides with mutanolysin
(see "Experimental Procedures"). Digestion products were reduced
with sodium borohydride and analyzed by rpHPLC on a C18 column using a
protocol developed for the separation of staphylococcal muropeptides
(39). Products eluting with the indicated absorption peak were desalted
and analyzed by ESI-MS. The observed m/z of the ion signal
and the proposed structure is shown. B, analysis of products
generated by the solubilization of staphylococcal peptidoglycan with
purified 11( 181-301) enzyme.
|
|
Solubilization of Surface Protein with the 11( 181-301)
Enzyme--
If the 11( 181-301) enzyme functions as a
D-Ala-Gly endopeptidase, digestion of the staphylococcal
cell wall with this enzyme should solubilize surface proteins linked to
multiple muropeptide subunits that are attached along a single glycan
strand. This was tested and 11( 181-301)-solubilized
Seb-MH6-Cws was purified and subjected to SDS-PAGE. In
contrast to surface protein released with the full-length 11 enzyme,
the 11( 181-301)-solubilized species migrated as a spectrum of
fragments on SDS-PAGE, similar to mutanolysin and amidase-released
surface protein. Redigestion of the 11( 181-301) solubilized
surface protein with mutanolysin caused Seb-MH6-Cws to
migrate uniformly on SDS-PAGE, suggesting that the heterogeneity in
mass is caused by linked murein subunits that are tethered along
glycan strands (Fig. 6).

View larger version (23K):
[in this window]
[in a new window]
|
Fig. 6.
Characterization of
11 ( 181-301)-solubilized
anchor peptides by MALDI-MS. Seb-MH6-Cws was
solubilized from the staphylococcal cell wall with the
11( 181-301) enzyme, and C-terminal anchor peptides were prepared
by treatment of the full-length protein with cyanogen bromide, affinity
purification, and rpHPLC (see "Experimental Procedures"). HPLC
fractions containing anchor peptides were analyzed by MALDI-MS. Ions
indicated by * are apparently the result of partial amidase removal of
peptide substituents from subunits along the linear glycan strand to
which the anchor peptide is attached. Ions indicated in
parentheses are approximate values due to a high degree of
overlap with nearby ion signals (see text). Inset,
Coomassie-stained 12% SDS-PAGE of Seb-MH6-Cws solubilized
from staphylococcal peptidoglycan with mutanolysin or the
11( 181-301) enzyme. 11( 181-301)-solubilized
Seb-MH6-Cws was redigested with mutanolysin, and surface
protein products migrated uniformly on SDS-PAGE, indicating their
linkage to murein subunits that are tethered along disaccharide
(MurNac-GlcNac) moieties. Approximately 5-fold less protein was loaded
in the double-digested sample (mutano. + 11( 181-301))
to compensate for the overloading that occurred when the many species
of various molecular weights were converted into a single species. The
arrow designated ( ) indicates the migration of the
11( 181-301) enzyme on SDS-PAGE.
|
|
To examine the structure of these surface proteins further, the
C-terminal anchor peptides of 11( 181-301) solubilized
Seb-MH6-Cws were obtained by cyanogen bromide cleavage and
affinity purification. MALDI-MS revealed the presence of a
heterogeneous population of ions spaced at regular intervals (Fig. 6).
The ion signal at m/z 2757 likely corresponds to anchor
peptide linked to a single wall tetrapeptide of the structure
MurNAc-(L-Ala-D-iGln-L-Lys(NH2-H6AQALPET-Gly5)-D-Ala)-( 1-4)-GlcNAc that is acetylated at the O-6 position of the muramic acid (calculated ion mass 2756.82). Ion groups centered at m/z 3919, 5152, and 6314 can be explained as anchor peptides linked to two, three, four, or five peptidoglycan subunits. A summary of the ions observed in
each of these groups is given in Table V.
The ion signals became more broadly dispersed with increasing mass and
frequently diminished in intensity. These phenomena are likely due to
the fact that the linked peptidoglycan subunits exist as either
tetrapeptide (1162.16 Da) or pentapeptide subunits (1233.24 Da) that
may or may not be acetylated at the O-6 position of
N-acetylmuramic acid (42.03 Da). Thus, each additional
linked peptidoglycan subunit increases the number of possible compounds
by a factor of 4. Surface protein linked to three peptidoglycan
subunits could theoretically exist as any one of 16 possible mass
combinations, whereas a protein linked to four peptidoglycan subunits
yields 25 different compounds. Hence a majority of the mass signals at
m/z greater than 7000 overlapped and were difficult to
interpret. Nonetheless, we were able to observe ion groups to an
m/z of approximately 18,000, corresponding to anchor
peptides linked to as many as 15 subunits (data not shown).
View this table:
[in this window]
[in a new window]
|
Table V
Summary of ions observed by MALDI-MS of 11( 181-381)-solubilized
anchor peptides
Numbers indicate the m/z of observed ions (the predicted
m/z of each ion is given in parentheses). Where indicated,
certain compounds were not detected (ND).
|
|
The ion with m/z 2235 corresponds to anchor peptide linked
to a wall subunit of the structure
NH2-L-Ala-D-iGln-L-Lys-(NH2-H6AQALPET-Gly5)-D-Ala-COOH, i.e. a single peptidoglycan subunit lacking the
MurNAc-GlcNAc disaccharide (calculated MH+ 2235). Ion
groups centered at m/z 3238, 4439, 5631, and 6384 can be
explained as anchor peptides attached to two, three, four, or five wall
subunits where one of the subunits lacks the peptide substituent (a
loss of 683.72 Da). Apparently, each of these cell wall structures was
generated by N-acetylmuramyl-L-Ala amidase hydrolysis of one of the murein subunits. We speculate that these compounds are generated by the endogenous autolysin amidase activity in
crudely prepared staphylococcal cell walls from which the
Seb-MH6-Cws protein was purified (42). Ions representing
anchor peptides linked to multiple cell wall pentapeptides were not
readily observed (usually the anchor peptides were linked to either a
single or no pentapeptides). The reasons for this are most likely due
to the fact that the staphylococcal peptidoglycan is highly
cross-linked by transpeptidation with the majority of subunits existing
as tetrapeptides.
 |
DISCUSSION |
In this paper we analyzed the enzymatic properties of 11 murein
hydrolase using both staphylococcal peptidoglycan as well as
solubilized surface protein as substrates. We conclude that the enzyme
is bifunctional, having both an
N-acetylmuramyl-L-alanyl amidase and a
D-alanyl-glycine endopeptidase activity. By engineering a
deletion that removed the central amidase domain of this enzyme, we
determined that the endopeptidase activity is contained within the
first 180 residues of the polypeptide chain. To our knowledge this is
the first report of such an activity associated with the aureophage
endolysins. The presence of a muralytic activity in the N-terminal
portion of the enzyme is in agreement with a recent report for the
related muralytic enzyme of staphylococcal phage Twort (43). Like the
11 enzyme, the Twort murein hydrolase was characterized as an
amidase based on the ability of the full-length enzyme to liberate DNFB
reactive L-alanine from digested peptidoglycan (43).
Because the N-terminal domain of the Twort enzyme is similar to that of
the 11 hydrolase, we think it is likely that the Twort enzyme as
well as other aureophages also display D-alanyl-glycine endopeptidase activity.
Recently it has been reported that the - and -lytic proteases
secreted by Achromobacter lyticus are capable of cleaving staphylococcal peptidoglycan at the pentaglycine cross-bridge (44-46).
Both lytic proteases appear to hydrolyze not only the Gly-Gly bond but
also D-Ala-Gly and Ala-Ala bonds, suggesting that these
enzymes display a more relaxed substrate specificity than the 11
enzyme. The -lytic protease also possesses amidase activity
indicating that it may be functionally similar to the 11 hydrolase,
although the gene for this enzyme has not yet been cloned (45). The
-lytic protease is a metalloenzyme that bears no primary sequence
homology to the 11 enzyme (44, 46). Crude enzymatic preparations
capable of cleaving the staphylococcal wall peptide-cross-bridge
junction were also isolated over 30 years ago from Streptomyces
albus G (47) and Myxobacter AL-1 (10) culture
filtrates. The Myxobacter enzyme was reported to have an
additional, less efficient amidase activity, which may indicate that it
is also functionally similar to the 11 hydrolase (10).
Staphylococcal peptidoglycan is highly cross-linked (8, 11, 39, 48),
and disruption of the cross-bridges appears to be a highly efficient
means by which to rapidly hydrolyze the cell wall. It is likely not a
coincidence that enzymes whose function is to destroy the murein
sacculus, for example lysostaphin and phage hydrolases, have chosen the
staphylococcal cross-bridge as their target.
All aureophages described to date belong to the order of tailed phages
(caudovirales) and are further subclassified into three families as
follows: the Myoviridae, the Siphoviridae, or the Podoviridae. Whereas 187, 11, and 80 belong to the
Siphoviridae family, Twort belongs to the
Myoviridae (49). That each of these phages encodes proteins
homologous to the D-Ala-Gly endopeptidase of 11 suggests
that this activity will be found in several distantly related
aureophages. Genes encoding phage hydrolases have been cloned and
sequenced from many different tailed phages that infect a variety of
Gram-positive bacteria including Listeria sp. (50), Streptococcus pneumoniae (51-53), and Bacillus
cereus (54). A comparison of the muralytic enzymes from
Gram-positive bacteria and their phages has indicated that these
enzymes are modular, containing separate catalytic and cell wall
binding domains (targeting domains) (51, 54, 55). It has been proposed
that the evolution of these enzymes has likely occurred through the
swapping of these domains and that phage lytic enzymes have co-evolved
with host autolysins (52, 56, 57). A majority of the muralytic enzymes cloned from the Gram-positive phages are amidases and bear significant homology to the central amidase portion of the 11 enzyme. Exceptions include the lytic enzymes of phages A118 (Ply118) and A500 (Ply500) of
Listeria monocytogenes, which possess an
L-alanyl-D-glutamate peptidase activity (50),
and the Cpl glycosidase of the pneumococcal phage Cp-1 (51). Due to the
near ubiquitous presence of MurNAc-L-alanine linkages in
bacterial peptidoglycan, amidases frequently display activity against
cell walls from a wide variety of bacterial species. In contrast, we
suspect that the D-alanyl-glycine endopeptidase activity of
the 11 enzyme may be specific toward only a small subset of the
known types of peptidoglycan. Although D-alanyl-glycyl bonds have also been found in the peptidoglycan of strains within the
genus Micrococcus (58), Thermus (59), and
Deinococcus (60), sequences homologous to the N-terminal
domain of the 11 hydrolase have thus far only been identified in
enzymes isolated from staphylococci or their phages.
The C-terminal domain of the 11 hydrolase bears significant homology
to the wall targeting domain of lysostaphin and InlB, a protein found
on the surface of L. monocytogenes (61). Targeting domains
have been shown to help control both the specificity and the level of
activity of muralytic enzymes (28). Thus far, at least two other types
of targeting domains have been characterized in autolysins of
Gram-positive bacteria. The first type to be identified was found in a
set of bacterial and phage-encoded pneumococcal hydrolases that
recognize specific choline moieties in the teichoic acid polymer
associated with the envelope of S. pneumoniae (62, 63). The
other examples are the C-terminal repeat domains recently discovered on
the multifunctional staphylococcal autolysin, Atl. In contrast to the
other two binding domains, which likely bind a receptor found all over
the surface of the target cell, the Atl targeting domains have been
shown to direct reporter proteins specifically to the sites of cell
division (30).
 |
ACKNOWLEDGEMENTS |
We thank members of our laboratory for
critical review of this manuscript.
 |
FOOTNOTES |
*
This work was supported in part by United States Public
Health Service Grants AI 33985 and AI 38897.The costs of publication of this
article were defrayed in part by the
payment of page charges. The article
must therefore be hereby marked
"advertisement" in accordance with 18 U.S.C. Section
1734 solely to indicate this fact.
§
Supported by a Cellular and Molecular Biology Training Grant at
UCLA. Present address: Skirball Institute, Dept. of Microbiology and
Kaplan Cancer Center, New York University School of Medicine, 540 First
Ave., New York, NY 10016.
Supported by a grant from the Keck foundation.
**
To whom correspondence should be addressed: Dept. of Microbiology & Immunology, UCLA School of Medicine, 10833 Le Conte Ave., Los Angeles,
CA 90095. Tel.: 310-206-0997; Fax: 310-267-0173; E-mail:
olafs{at}ucla.edu.
 |
ABBREVIATIONS |
The abbreviations used are:
MurNAc, N-acetylmuramic acid;
CH3CN, acetonitrile;
CID, collisionally induced dissociation;
Cws, cell wall sorting signal;
DNFB, dinitrofluorobenzene;
ESI-MS, electrospray ionization-mass
spectrometry;
MALDI-MS, matrix-assisted laser desorption ionization
mass spectrometry;
MS/MS, tandem mass spectrometry;
PAGE, polyacrylamide gel electrophoresis;
PMSF, phenylmethylsulfonyl
fluoride;
rpHPLC, reversed phase high performance liquid
chromatography, Seb, staphylococcal enterotoxin B;
Atl, autolysins;
D-iGln, D-isoglutaminyl;
PPG, polypropylene
glycol GlcNAc, N-acetylhexosamine.
 |
REFERENCES |
-
Ghuysen, J. M., and Hakenbeck, R.
(eds)
(1994)
Bacterial Cell Wall, Elsevier Science Publishers B.V., Amsterdam
-
Navarre, W. W.,
and Schneewind, O.
(1999)
Microbiol. Molec. Biol. Rev.
63,
174-229[Abstract/Free Full Text]
-
Dawson, I. M.
(1949)
in
The Nature of the Bacterial Surface (Miles, A. A., and Pirie, N. W., eds), pp. 119-121, Blackwell Scientific, Oxford
-
Ghuysen, J. M.,
and Strominger, J. L.
(1963)
Biochemistry
2,
1110-1119
-
Tipper, D. J.,
Ghuysen, J. M.,
and Strominger, J. L.
(1965)
Biochemistry
4,
468-473[CrossRef]
-
Ghuysen, J. M.
(1968)
Bacteriol. Rev.
32,
425-464[Free Full Text]
-
Ghuysen, J. M.,
and Strominger, J. L.
(1963)
Biochemistry
2,
1119-1125
-
Ghuysen, J. M.,
Tipper, D. J.,
Birge, C. H.,
and Strominger, J. L.
(1965)
Biochemistry
4,
2245-2254[CrossRef]
-
Munoz, E.,
Ghuysen, J.-M.,
Leyh-Bouille, M.,
Petit, J. F.,
Heymann, H.,
Bricas, E.,
and Lefrancier, P.
(1966)
Biochemistry
5,
3748-3764[CrossRef]
-
Tipper, D. J.,
Strominger, J. L.,
and Ensign, J. C.
(1967)
Biochemistry
6,
906-920[CrossRef][Medline]
[Order article via Infotrieve]
-
Tipper, D. J.,
and Berman, M. F.
(1969)
Biochemistry
8,
2183-2191[CrossRef][Medline]
[Order article via Infotrieve]
-
Tipper, D. J.,
and Strominger, J. L.
(1968)
J. Biol. Chem.
243,
3169-3179[Abstract/Free Full Text]
-
Tipper, D. J.
(1969)
Biochemistry
8,
2192-2202[CrossRef][Medline]
[Order article via Infotrieve]
-
Higashi, Y.,
Siewert, G.,
and Strominger, J. L.
(1970)
J. Biol. Chem.
245,
3683-3690[Abstract/Free Full Text]
-
Higashi, Y.,
Strominger, J. L.,
and Sweeley, C. C.
(1967)
Proc. Natl. Acad. Sci. U. S. A.
57,
1878-1884[Free Full Text]
-
Higashi, Y.,
Strominger, J. L.,
and Sweeley, C. C.
(1970)
J. Biol. Chem.
245,
3697-3702[Abstract/Free Full Text]
-
Ghuysen, J. M.
(1991)
Annu. Rev. Microbiol.
45,
37-67[CrossRef][Medline]
[Order article via Infotrieve]
-
Nakagawa, J.,
Tamaki, S.,
Tomioka, S.,
and Matsuhashi, M.
(1984)
J. Biol. Chem.
259,
13937-13946[Abstract/Free Full Text]
-
Tipper, D. J.,
and Strominger, J. L.
(1965)
Proc. Natl. Acad. Sci. U. S. A.
54,
1133-1141[Free Full Text]
-
Strominger, J. L.,
and Ghuysen, J. M.
(1967)
Science
156,
213-221[Free Full Text]
-
Shockman, G. D.,
and Höltje, J.-V.
(1994)
in
Bacterial Cell Wall (Ghuysen, J.-M., and Hakenbeck, R., eds), pp. 131-166, Elsevier Science Publishers B.V., Amsterdam
-
Ghuysen, J.-M.,
Tipper, D. J.,
and Strominger, J.
(1966)
Methods Enzymol.
8,
685-699
-
Schindler, C. A.,
and Schuhardt, V. T.
(1964)
Proc. Natl. Acad. Sci. U. S. A.
51,
414-421[Free Full Text]
-
Oshida, T.,
Sugai, M.,
Komatsuzawa, H.,
Hong, Y. M.,
Suginaka, H.,
and Tomasz, A.
(1995)
Proc. Natl. Acad. Sci. U. S. A.
92,
285-289[Abstract/Free Full Text]
-
Wang, X.,
Wilkinson, B. J.,
and Jayaswal, R. K.
(1991)
Gene (Amst.)
102,
105-109[CrossRef][Medline]
[Order article via Infotrieve]
-
Ramadurai, L.,
and Jayaswal, R. K.
(1997)
J. Bacteriol.
179,
3625-3631[Abstract/Free Full Text]
-
Young, R.
(1992)
Microbiol. Rev.
56,
430-481[Abstract/Free Full Text]
-
Baba, T.,
and Schneewind, O.
(1996)
EMBO J.
15,
4789-4797[Medline]
[Order article via Infotrieve]
-
Browder, H. P.,
Zygmunt, W. A.,
Young, J. R.,
and Tavoramina, P. A.
(1965)
Biochem. Biophys. Res. Commun.
19,
383-389[CrossRef][Medline]
[Order article via Infotrieve]
-
Baba, T.,
and Schneewind, O.
(1998)
EMBO J.
17,
4639-4646[CrossRef][Medline]
[Order article via Infotrieve]
-
Schneewind, O.,
Model, P.,
and Fischetti, V. A.
(1992)
Cell
70,
267-281[CrossRef][Medline]
[Order article via Infotrieve]
-
Schneewind, O.,
Mihaylova-Petkov, D.,
and Model, P.
(1993)
EMBO J.
12,
4803-4811[Medline]
[Order article via Infotrieve]
-
Navarre, W. W.,
and Schneewind, O.
(1994)
Mol. Microbiol.
14,
115-121[Medline]
[Order article via Infotrieve]
-
Schneewind, O.,
Fowler, A.,
and Faull, K. F.
(1995)
Science
268,
103-106[Abstract/Free Full Text]
-
Navarre, W. W.,
Ton-That, H.,
Faull, K. F.,
and Schneewind, O.
(1998)
J. Biol. Chem.
273,
29135-29142[Abstract/Free Full Text]
-
Ton-That, H.,
Faull, K. F.,
and Schneewind, O.
(1997)
J. Biol. Chem.
272,
22285-22292[Abstract/Free Full Text]
-
Sloan, G. L.,
Smith, E. C.,
and Lancaster, J. H.
(1977)
Biochem. J.
167,
293-296[Medline]
[Order article via Infotrieve]
-
Studier, F. W.
(1991)
J. Mol. Biol.
219,
37-44[CrossRef][Medline]
[Order article via Infotrieve]
-
de Jonge, B. L.,
Chang, Y. S.,
Gage, D.,
and Tomasz, A.
(1992)
J. Biol. Chem.
267,
11248-11254[Abstract/Free Full Text]
-
Glauner, B.
(1988)
Anal. Biochem.
172,
451-464[CrossRef][Medline]
[Order article via Infotrieve]
-
Creighton, T. E.
(1993)
Proteins: Structures and Molecular Properties, 2nd Ed., W. H. Freeman & Co., New York
-
Tipper, D. J.
(1969)
J. Bacteriol.
97,
837-847[Abstract/Free Full Text]
-
Loessner, M. J.,
Gaeng, S.,
Wendlinger, G.,
Maier, S. K.,
and Scherer, S.
(1998)
FEMS Microbiol. Lett.
162,
265-274[CrossRef][Medline]
[Order article via Infotrieve]
-
Li, S.,
Norioka, S.,
and Sakiyama, F.
(1998)
J. Biochem. (Tokyo)
124,
332-339[Abstract/Free Full Text]
-
Li, S.,
Norioka, S.,
and Sakiyama, F.
(1997)
J. Biochem. (Tokyo)
122,
772-778[Abstract/Free Full Text]
-
Li, S.,
Norioka, S.,
and Sakiyama, F.
(1990)
J. Bacteriol.
172,
6506-6511[Abstract/Free Full Text]
-
Ghuysen, J. M.,
Dierickx, L.,
Leyh-Bouille, M.,
Strominger, J. L.,
Bricas, E.,
and Nicot, C.
(1965)
Biochemistry
4,
2237-2244[CrossRef]
-
Petit, J. F.,
Munoz, E.,
and Ghuysen, J. M.
(1966)
Biochemistry
5,
2764-2776[CrossRef][Medline]
[Order article via Infotrieve]
-
Ackermann, H.-W.,
and DuBow, M. S.
(1987)
Viruses of Prokaryotes, Vol. 2, CRC Press, Inc., Boca Raton, FL
-
Loessner, M. J.,
Wendlinger, G.,
and Scherer, S.
(1995)
Mol. Microbiol.
16,
1231-1241[Medline]
[Order article via Infotrieve]
-
García, E.,
García, J. L.,
García, P.,
Arrarás, A.,
Sánchez-Puelles, J. M.,
and López, R.
(1988)
Proc. Natl. Acad. Sci. U. S. A.
85,
914-918[Abstract/Free Full Text]
-
Díaz, E.,
López, R.,
and García, J. L.
(1991)
J. Biol. Chem.
266,
5464-5471[Abstract/Free Full Text]
-
Díaz, E.,
López, R.,
and García, J. L.
(1992)
J. Bacteriol.
174,
5516-5525[Abstract/Free Full Text]
-
Loessner, M. J.,
Maier, S. K.,
Daubek-Puza, H.,
Wendlinger, G.,
and Scherer, S.
(1997)
J. Bacteriol.
179,
2845-2851[Abstract/Free Full Text]
-
García, J. L.,
Díaz, E.,
Romero, A.,
and Garcia, P.
(1994)
J. Bacteriol.
176,
4066-4072[Abstract/Free Full Text]
-
Díaz, E.,
López, R.,
and García, J. L.
(1990)
Proc. Natl. Acad. Sci. U. S. A.
87,
8125-8129[Abstract/Free Full Text]
-
Romero, A.,
López, R.,
and García, P.
(1990)
J. Bacteriol.
172,
5064-5070[Abstract/Free Full Text]
-
Schleifer, K. H.,
and Kandler, O.
(1972)
Bacteriol. Rev.
36,
407-477[Free Full Text]
-
Quintela, J. C.,
Pittenauer, E.,
Allmaier, G.,
Aran, V.,
and de Pedro, M. A.
(1995)
J. Bacteriol.
177,
4947-4962[Abstract/Free Full Text]
-
Quintela, J. C.,
Garcia-del Portillo, F.,
Pittenauer, E.,
Allmaier, G.,
and de Pedro, M. A.
(1999)
J. Bacteriol.
181,
334-337[Abstract/Free Full Text]
-
Braun, L.,
Dramsi, S.,
Dehoux, P.,
Bierne, H.,
Lindahl, G.,
and Cossart, P.
(1997)
Mol. Microbiol.
25,
285-294[CrossRef][Medline]
[Order article via Infotrieve]
-
Sánchez-Puelles, J. M.,
Sanz, J. M.,
García, J. L.,
and García, E.
(1990)
Gene (Amst.)
89,
69-75[CrossRef][Medline]
[Order article via Infotrieve]
-
Höltje, J.-V.,
and Tomasz, A.
(1975)
J. Biol. Chem.
250,
6072-6076[Abstract/Free Full Text]
-
Bon, J.,
Mani, N.,
and Jayaswal, R. K.
(1997)
Can. J. Microbiol.
43,
612-616[Medline]
[Order article via Infotrieve]
-
Kaneko, J.,
Kimura, T.,
Narita, S.,
Tomita, T.,
and Kamio, Y.
(1998)
Gene (Amst.)
215,
57-67[CrossRef][Medline]
[Order article via Infotrieve]
-
Gupta, S. K.,
Kececioglu, J. D.,
and Schaffer, A. A.
(1995)
J. Comput. Biol.
2,
459-472[Medline]
[Order article via Infotrieve]
Copyright © 1999 by The American Society for Biochemistry and Molecular Biology, Inc.

CiteULike Complore Connotea Del.icio.us Digg Reddit Technorati What's this?
This article has been cited by other articles:

|
 |

|
 |
 
M. Horgan, G. O'Flynn, J. Garry, J. Cooney, A. Coffey, G. F. Fitzgerald, R. P. Ross, and O. McAuliffe
Phage Lysin LysK Can Be Truncated to Its CHAP Domain and Retain Lytic Activity against Live Antibiotic-Resistant Staphylococci
Appl. Envir. Microbiol.,
February 1, 2009;
75(3):
872 - 874.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. R. Gargis, H. E. Heath, L. S. Heath, P. A. LeBlanc, R. S. Simmonds, B. D. Abbott, R. Timkovich, and G. L. Sloan
Use of 4-Sulfophenyl Isothiocyanate Labeling and Mass Spectrometry To Determine the Site of Action of the Streptococcolytic Peptidoglycan Hydrolase Zoocin A
Appl. Envir. Microbiol.,
January 1, 2009;
75(1):
72 - 77.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. W. Maresso and O. Schneewind
Sortase as a Target of Anti-Infective Therapy
Pharmacol. Rev.,
March 1, 2008;
60(1):
128 - 141.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
P. Sass and G. Bierbaum
Lytic Activity of Recombinant Bacteriophage {phi}11 and {phi}12 Endolysins on Whole Cells and Biofilms of Staphylococcus aureus
Appl. Envir. Microbiol.,
January 1, 2007;
73(1):
347 - 352.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. R. Baker, C. Liu, S. Dong, and D. G. Pritchard
Endopeptidase and glycosidase activities of the bacteriophage b30 lysin.
Appl. Envir. Microbiol.,
October 1, 2006;
72(10):
6825 - 6828.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. Grundling, D. M. Missiakas, and O. Schneewind
Staphylococcus aureus Mutants with Increased Lysostaphin Resistance.
J. Bacteriol.,
September 1, 2006;
188(17):
6286 - 6297.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
D. Nelson, R. Schuch, P. Chahales, S. Zhu, and V. A. Fischetti
PlyC: A multimeric bacteriophage lysin
PNAS,
July 11, 2006;
103(28):
10765 - 10770.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. Grundling and O. Schneewind
Cross-Linked Peptidoglycan Mediates Lysostaphin Binding to the Cell Wall Envelope of Staphylococcus aureus.
J. Bacteriol.,
April 1, 2006;
188(7):
2463 - 2472.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. Borysowski, B. Weber-Dabrowska, and A. Gorski
Bacteriophage endolysins as a novel class of antibacterial agents.
Experimental Biology and Medicine,
April 1, 2006;
231(4):
366 - 377.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
L. A. Marraffini, A. C. DeDent, and O. Schneewind
Sortases and the Art of Anchoring Proteins to the Envelopes of Gram-Positive Bacteria
Microbiol. Mol. Biol. Rev.,
March 1, 2006;
70(1):
192 - 221.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. O'Flaherty, A. Coffey, W. Meaney, G. F. Fitzgerald, and R. P. Ross
The Recombinant Phage Lysin LysK Has a Broad Spectrum of Lytic Activity against Clinically Relevant Staphylococci, Including Methicillin-Resistant Staphylococcus aureus
J. Bacteriol.,
October 15, 2005;
187(20):
7161 - 7164.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. Takac, A. Witte, and U. Blasi
Functional analysis of the lysis genes of Staphylococcus aureus phage P68 in Escherichia coli
Microbiology,
July 1, 2005;
151(7):
2331 - 2342.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
L. A. Marraffini and O. Schneewind
Anchor Structure of Staphylococcal Surface Proteins: V. ANCHOR STRUCTURE OF THE SORTASE B SUBSTRATE IsdC
J. Biol. Chem.,
April 22, 2005;
280(16):
16263 - 16271.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
Q. Cheng, D. Nelson, S. Zhu, and V. A. Fischetti
Removal of Group B Streptococci Colonizing the Vagina and Oropharynx of Mice with a Bacteriophage Lytic Enzyme
Antimicrob. Agents Chemother.,
January 1, 2005;
49(1):
111 - 117.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
R. Pechous, N. Ledala, B. J. Wilkinson, and R. K. Jayaswal
Regulation of the Expression of Cell Wall Stress Stimulon Member Gene msrA1 in Methicillin-Susceptible or -Resistant Staphylococcus aureus
Antimicrob. Agents Chemother.,
August 1, 2004;
48(8):
3057 - 3063.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
D. G. Pritchard, S. Dong, J. R. Baker, and J. A. Engler
The bifunctional peptidoglycan lysin of Streptococcus agalactiae bacteriophage B30
Microbiology,
July 1, 2004;
150(7):
2079 - 2087.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. M. Perry, H. Ton-That, S. K. Mazmanian, and O. Schneewind
Anchoring of Surface Proteins to the Cell Wall of Staphylococcus aureus. III. LIPID II IS AN IN VIVO PEPTIDOGLYCAN SUBSTRATE FOR SORTASE-CATALYZED SURFACE PROTEIN ANCHORING
J. Biol. Chem.,
May 3, 2002;
277(18):
16241 - 16248.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
U. Ilangovan, H. Ton-That, J. Iwahara, O. Schneewind, and R. T. Clubb
Structure of sortase, the transpeptidase that anchors proteins to the cell wall of Staphylococcusaureus
PNAS,
May 22, 2001;
98(11):
6056 - 6061.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. Gründling, D. L. Smith, U. Bläsi, and R. Young
Dimerization between the Holin and Holin Inhibitor of Phage lambda
J. Bacteriol.,
November 1, 2000;
182(21):
6075 - 6081.
[Abstract]
[Full Text]
|
 |
|

|
 |

|
 |
 
H. Ton-That, S. K. Mazmanian, K. F. Faull, and O. Schneewind
Anchoring of Surface Proteins to the Cell Wall of Staphylococcus aureus. SORTASE CATALYZED IN VITRO TRANSPEPTIDATION REACTION USING LPXTG PEPTIDE AND NH2-GLY3 SUBSTRATES
J. Biol. Chem.,
March 24, 2000;
275(13):
9876 - 9881.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. Beukes, G. Bierbaum, H.-G. Sahl, and J. W. Hastings
Purification and Partial Characterization of a Murein Hydrolase, Millericin B, Produced by Streptococcus milleri NMSCC 061
Appl. Envir. Microbiol.,
January 1, 2000;
66(1):
23 - 28.
[Abstract]
[Full Text]
|
 |
|

|
 |

|
 |
 
H. Ton-That, G. Liu, S. K. Mazmanian, K. F. Faull, and O. Schneewind
Purification and characterization of sortase, the transpeptidase that cleaves surface proteins of Staphylococcus aureus at the LPXTG motif
PNAS,
October 26, 1999;
96(22):
12424 - 12429.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
H. Ton-That and O. Schneewind
Anchor Structure of Staphylococcal Surface Proteins. IV. INHIBITORS OF THE CELL WALL SORTING REACTION
J. Biol. Chem.,
August 20, 1999;
274(34):
24316 - 24320.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. K. Mazmanian, G. Liu, H. Ton-That, and O. Schneewind
Staphylococcus aureus Sortase, an Enzyme that Anchors Surface Proteins to the Cell Wall
Science,
July 30, 1999;
285(5428):
760 - 763.
[Abstract]
[Full Text]
|
 |
|
Copyright © 1999 by the American Society for Biochemistry and Molecular Biology.
|
Advertisement
Advertisement
|