|
|
|
|||||||
|
|||||||||
J Biol Chem, Vol. 274, Issue 22, 15883-15891, May 28, 1999
From the The E2F family of heterodimeric transcription
factors plays an important role in the regulation of gene expression at
the G1/S phase transition of the mammalian cell
cycle. Previously, we have demonstrated that cell cycle regulation of
murine dihydrofolate reductase (dhfr) expression requires
E2F-mediated activation of the dhfr promoter in S phase. To
investigate the mechanism by which E2F activates an authentic
E2F-regulated promoter, we precisely replaced the E2F binding site in
the dhfr promoter with a Gal4 binding site. Using Gal4-E2F1
derivatives, we found that E2F1 amino acids 409-437 contain a potent
core transactivation domain. Functional analysis of the E2F1 core
domain demonstrated that replacement of phenylalanine residues 413, 425, and 429 with alanine reduces both transcriptional activation of
the dhfr promoter and protein-protein interactions with
CBP, transcription factor (TF) IIH, and TATA-binding protein (TBP).
However, additional amino acid substitutions for phenylalanine 429 demonstrated a strong correlation between activation of the
dhfr promoter and binding of CBP, but not TFIIH or TBP.
Finally, transactivator bypass experiments indicated that direct
recruitment of CBP is sufficient for activation of the dhfr
promoter. Therefore, we suggest that recruitment of CBP is one
mechanism by which E2F activates the dhfr promoter.
Regulation of eukaryotic gene expression requires
sequence-specific DNA binding transcription factors that contain at
least two essential domains: a DNA binding domain that directs the
protein to its target promoter, and a domain that facilitates
transcriptional regulation by contacting a variety of cellular proteins
(1, 2). Proteins contacted by DNA binding transcription factors include
general transcription factors
(TF)1 such as TFIIA (3),
TFIIB (4), TFIID (5-7), TFIIF (8, 9), and TFIIH (10); coactivators
such as the CREB-binding protein (CBP) (11), GCN5 (12), ADA2 (13, 14),
and components of the SWI/SNF complex (15, 16); and corepressors such
as retinoblastoma (Rb) (17), Sin3 (18, 19), and KRAB-associated protein-1 (KAP-1) (20). These interactions are thought to facilitate transcriptional regulation by directly altering the recruitment and/or
activity of RNA polymerase II transcription complexes, or by modifying
the chromatin structure of a gene (for a recent review, see Ref. 21).
Several studies provide evidence indicating that different gene
promoters require different protein-protein interactions for
activation. For example, recruitment of the TATA-binding protein (TBP)
appears to be important for TATA-containing, but not TATA-less
promoters (22). Additionally, the herpes simplex virus transactivator
VP16 is a more robust activator of TATA-containing promoters than
TATA-less promoters, whereas Sp1 shows no TATA preference, suggesting
functional redundancy of the TATA element and Sp1, but not VP16 (23,
24). In addition, the degree to which a transcription factor
contributes to activation of a promoter can be influenced by the
presence of other bound transactivators, which can provide either
additive or redundant functions. Synergistic activation by two or more
transactivators can be the result of multiple protein contacts that
stimulate distinct stages of transcription (25). For example, the human
immunodeficiency virus Tat transactivator protein stimulates
transcriptional elongation and can synergize with Sp1 (which stimulates
initiation, but not elongation), but not with VP16, p53, or E2F1 (all
of which stimulate elongation) (25). Therefore, the apparent potency of
a particular transactivation domain and the importance of specific
protein-protein interactions may vary considerably in different
promoter contexts.
We wish to understand the mechanisms by which site-specific DNA binding
proteins activate the murine dhfr promoter, which contains
four Sp1 binding sites and an E2F binding site that overlaps the start
site of transcription. Our studies indicate that the Sp1 binding sites
are critical for basal promoter activity, while the E2F binding site is
required for growth-regulated transcription (26-29). In
vivo footprinting analysis of the hamster dhfr promoter demonstrated that protein binding to one strand of the E2F element correlates with the increase in promoter activity in late
G1 and early S phase, suggesting that an E2F family member
activates dhfr transcription in S phase (30). In support of
this hypothesis, we have shown that the E2F site is critical for high
levels of activity from the murine dhfr promoter in S phase
(29). The focus of our current studies is to determine the molecular
mechanisms by which proteins that bind to the E2F site regulate
dhfr transcription.
The E2F family of transactivator proteins mediates both transcriptional
activation and repression through interactions with multiple target
proteins. Eight members of this family have been identified: six E2F
proteins (E2F1 to E2F6) and two DP proteins (DP1 and DP2). The E2F and
DP proteins bind to DNA as a heterodimer to form a functional E2F/DP
complex (for a recent review, see Ref. 31). The transcriptional
repression function of E2F/DP is attributed to the interaction between
E2F family members and the Rb family of transcriptional repressor
pocket proteins. E2F1, E2F2, and E2F3 bind to the Rb protein, E2F4
binds to Rb and the related p107 and p130 proteins, and E2F5 binds to
p130 (for recent reviews, see Refs. 31 and 32). E2F6 (or EMA) does not
bind pocket proteins, but is believed to contain an inherent repressor domain (33, 34). The pocket proteins are thought to repress transcription in G0 and early G1 phase cells by
recruiting histone deacetylases to promoters and by blocking E2F
protein-protein interactions required for activation of transcription
(35-39). However, as cells approach the G1/S phase
boundary, the pocket proteins are phosphorylated and released from the
E2F heterodimer, allowing E2F to function as a transcriptional
activator. The activation functions of E2F/DP are mediated by a potent
C-terminal transactivation domain in the E2F subunits.
We, and others, have previously shown that several of the E2F family
members can activate the dhfr promoter when overexpressed using transient or integrated E2F expression constructs (28, 40, 41).
Additionally, using a formaldehyde cross-linking procedure, we have
recently shown that E2F1, E2F2, E2F3, E2F4, and E2F5 can all bind to
the dhfr promoter in
vivo.2 Furthermore, we
have demonstrated that Gal4 fusion proteins containing the
transactivation domains of E2F1, E2F3, E2F4, and E2F5 activate a
dhfr promoter construct containing a Gal4 binding site in
precise replacement of the E2F binding site
(29).3 The in vivo
binding data, the promoter activation experiments, and the fact that
all of the E2F transactivation domains are very similar, suggests that
all of the E2F family members may be bona fide
activators of the dhfr gene. However, the E2F1
transactivation domain is the best characterized (Fig.
1), and therefore we have used E2F1 in
our current experiments designed to determine the mechanism by which
E2F family members activate the dhfr promoter.
Previous analyses of the E2F1 transactivation domain have employed Gal4
fusion proteins and reporter constructs that have randomly positioned
single or multiple Gal4 binding sites cloned upstream of minimal
promoters whose basal activity is mainly mediated by a TATA box. Due to
the abundance of cellular E2F proteins, the use of Gal4 fusion proteins
is required for the functional analysis of a specific E2F family
member. However, most E2F-regulated promoters, including
dhfr, are TATA-less promoters whose basal activity is
conferred by transcriptional activators such as Sp1 and CCAAT binding
proteins (42). Thus, prior functional analyses of the E2F1
transactivation domain may not accurately reflect the role of
protein-protein interactions in the context of an authentic
E2F-regulated cellular promoter. In support of this hypothesis, we have
shown that, unlike E2F-mediated activation of synthetic promoters,
activation of dhfr transcription is dependent on the
position of the E2F binding site proximal to the transcription start
site (29). Therefore, we have undertaken a functional analysis of E2F1 using an authentic E2F-regulated promoter, and present
evidence that E2F1 recruitment of CBP is critical for activation of
dhfr transcription.
Plasmids--
Standard cloning techniques were used for all
plasmid constructions (43). The inserts for various E2F1 fusion
proteins were made by polymerase chain reaction with the following
primers: primer 1, 5'-CATAGAATAAGTGCGACATCATCATCGG-3'; primer 2, 5'TAGTGGATCCTAGAAGCCCTGTCAGAAATCCAGGGGGGTGAGGTCCCCAAAGTCACAGTCGGCGAGGT-3'; primer 3, 5'-TAGTGGATCCTAGAAGCCCTGTCAGAAATCCAGGGGGGTGAGGTCCCCAGCGTCAC-3'; primer 4, 5'-TAGTGGATCCTAGAAGCCCTGTCAGAAATCCAGGGGGGTGAGGTCCCCATAGTCAC-3'; primer 5, 5'-TAGTGGATCCTAGAAGCCCTGTCAGAAATCCAGGGGGGTGAGGTCCCCTAAGTCAC-3'; primer 6, 5'-TAGTGGATCCTAGAAGCCCTGTCAGAAATCCAGGGGGGTGAGGTCCCCATCGTCAC-3'; primer 7, 5'-TAGTGGATCCTAGAAGCCCTGTCAGAAATCCAGGGGGGTGAGGTCCCCAGCGTCACAGTCGGCGAGGT-3'; primer 8, 5'-CCCGGATCCCTCGACGCCCACTTCG-3'; primer 9, 5'-CCCGGATCCCTCGACTACCACGCCG-3'; primer 10, 5'-CCCGGATCCTCAGAAATCCAGGGGGGT-3'.
For the construction of GST-E2F1 and Gal4-E2F1 expression plasmids, the
appropriate polymerase chain reaction fragment was digested with
BamHI and cloned into the BamHI site of pGEX-4T-1 (Amersham Pharmacia Biotech) or pBXG-1 (gift from Mark Ptashne). Both
the GST and Gal4(1-147) versions of the following E2F1 constructs were
made using the indicated primers and the E2F1 plasmid
pBXG-1/E2F1(409-437) as template (39): E2F1(409-437)F425A, primers 1 and 2; E2F1(409-437)F429A, primers 1 and 3; E2F1(409-437)F429Y,
primers 1 and 4; E2F1(409-437)F429L, primers 1 and 5;
E2F1(409-437)F429D, primers 1 and 6; E2F1(409-437)F425A/F429A, primers 1 and 7. The Gal4 version of E2F1(409-437)Y411A was made using
primers 8 and 10, and the plasmid pCMV-E2F1YA411 as template (44). The
GST and Gal4 versions of E2F1(409-437)F413A were made using primers 9 and 10, and the plasmid pCMVFA413 as template (44). The GST and Gal4
versions of E2F1(409-437)3 Cell Culture and Transfection--
NIH 3T3 cell cultures were
maintained and calcium phosphate transfections were performed as
described previously (29). Briefly, 1 day prior to transfection,
1.25 × 105 cells were seeded into 60-mm diameter
dishes. Each dish of cells was transfected with 5 µg of reporter
construct, 5 µg of Gal4-E2F1 expression construct, and 5 µg of
sonicated salmon sperm DNA (Sigma). For the transfection of Gal4-CBP,
Gal4-TBP, and Gal4-p62, 10-20 µg of Gal4 fusion expression
constructs were used without the addition of salmon sperm DNA. Cells
were incubated in growth medium for 40-48 h before harvesting, and
total cell lysates were assayed for luciferase activity. Each
transfection was repeated at least four times with duplicate samples
and multiple DNA preparations.
Protein Affinity Chromatography--
HeLa cell nuclear extract
was prepared from frozen cells as described previously (49), and was
dialyzed against Affinity Chromatography Buffer (ACB) (10 mM HEPES (pH 7.9), 1 mM EDTA, 1 mM
dithiothreitol, 20% glycerol) containing 0.5 mM
phenylmethylsulfonyl fluoride and 0.1 M NaCl. GST fusion
proteins were prepared and immobilized on Glutathione-Sepharose 4B
(Amersham Pharmacia Biotech) as follows. Overnight cultures of
Escherichia coli strain DHF5 A Core E2F1 Transactivation Domain Can Activate the dhfr
Promoter--
To investigate the activation of dhfr
transcription by E2F1, we have precisely replaced the E2F binding site
in the murine dhfr promoter with a Gal4 binding site to
create a Gal4-responsive dhfr promoter (Fig.
2A). We have previously
demonstrated that, like activation of the dhfr promoter by
endogenous E2F, the activation of DHFRGal4 by a Gal4 fusion protein
containing the E2F1 transactivation domain is dependent on the position
of the Gal4 binding site proximal to the transcription start site,
suggesting that Gal4-E2F1 and endogenous E2F activate the
dhfr promoter through similar mechanisms (29). Using the
DHFRGal4 promoter, and Gal4-E2F1 fusion proteins, we have now
determined the minimal E2F1 transactivation domain and protein-protein
interactions required for transcriptional activation of the
dhfr promoter. Previous studies have implicated mdm2 and Rb
in E2F1-mediated transactivation (46, 51, 52). To determine if
recruitment of mdm2 or Rb is critical for activation of the
dhfr promoter, we cotransfected NIH 3T3 cells with the DHFRGal4 reporter construct and either wild-type Gal4-E2F1 or Gal4-E2F1
expression constructs containing mutations that have been shown to
abolish mdm2 or Rb binding (45, 46). At 2 days post-transfection, cells
were harvested and assayed for luciferase activity. The activation of
DHFRGal4 by the Gal4-E2F1 proteins is shown as percentage of
activation, defining the activity of the wild-type Gal4-E2F1 constructs
as 100% activation (Fig. 2). We found that the wild-type E2F1
transactivation domain robustly activates the DHFRGal4 reporter
construct and that mutations which abolish mdm2 or Rb binding do not
reduce activation. Therefore, recruitment of mdm2 or Rb is not required
for E2F1-mediated activation of the dhfr promoter. This work
is in agreement with the model that Rb functions to keep E2F1 inactive
in G0 phase cells but has no role in the S phase-mediated
activation of promoters by E2F1.
Previous studies have mapped the E2F1 transactivation domain to amino
acids 380-437 or 399-437, using different minimal TATA box-containing
synthetic promoter constructs with either one or three upstream Gal4
binding sites, respectively (38, 45). To determine the minimal region
of E2F1 required for activation of dhfr, we employed a
series of Gal4-E2F1 fusion proteins containing N-terminal and
C-terminal deletions of the E2F1 transactivation domain (45). NIH 3T3
cells were cotransfected with the DHFRGal4 reporter construct and the
different Gal4-E2F1 expression constructs. A Gal4-E2F1 fusion protein
containing E2F1 amino acids 368-437 shows a 57-fold activation of the
DHFRGal4 reporter construct, and deletion of N-terminal amino acids to
position 399 does not reduce activation (Fig.
3A). This indicates that the
region of E2F1 required for activation of dhfr does not
extend as far N-terminal as the region previously shown to be required
for activation of a minimal promoter containing one upstream Gal4
binding site (38). However, deletion of the next 23 N-terminal amino
acids (399-422) does result in a 7-fold decrease in activation levels.
An analysis of C-terminal deletions demonstrates that deletion of the
last 5, 10, and 15 amino acids of E2F1 results in 2-, 4-, and 13-fold decreases in activation levels, respectively (Fig. 3B).
Therefore, the extreme C terminus of E2F1 is critical for activation of
dhfr transcription. Taken together, these results
demonstrate that E2F1 amino acids 399-437 can confer robust activation
to the dhfr promoter. To more precisely map the N-terminal
boundary of the E2F1 transactivation domain, we utilized an additional
series of N-terminal deletion constructs (39). We found that a
Gal4-E2F1 fusion protein containing E2F1 amino acids 386-437 activated
the DHFRGal4 reporter construct 118-fold, and a Gal4-E2F1 containing amino acids 409-437 retained 38-fold activation (Fig. 3C).
However, further N-terminal deletion to amino acid 415 reduced
activation to a very low level. Therefore, we define amino acids
409-437 as the core transactivation domain of E2F1.
Phenylalanine Residues in the E2F1 Core Transactivation Domain Are
Critical for Activation of the dhfr Promoter and E2F1 Protein-Protein
Interactions--
Our deletion analysis of E2F1 identified a core
domain that spans amino acids 409-437 and potently activates the
dhfr promoter. Previous studies demonstrated that this
domain binds to TBP and TFIIH (39); we show below that this domain is
also sufficient to bind CBP (Fig. 5B). We next wanted to
determine the contributions of TBP, TFIIH, and CBP binding to the
activation of dhfr transcription by E2F1. A larger E2F1
transactivation domain is required for maximal activation of the
dhfr promoter, but is also likely to bind additional
unidentified proteins. Therefore, to simplify our analysis, we chose to
study activation of dhfr transcription mediated by the core
E2F1 transactivation domain. Further N- or C-terminal deletion of this
38-amino acid core region of E2F1 affects the binding of multiple
target proteins (39, 53); therefore, a correlation of specific
protein-protein interactions with transcriptional activation of
dhfr required a more precise mutational analysis. Others
have demonstrated that bulky hydrophobic amino acids in the VP16, p53,
CREB, and Sp1 transactivation domains are critical for protein binding
and transcriptional activation (6, 54-60). Based on amino acid
sequence comparison of these transactivation domains (Fig.
4), we predicted that phenylalanine residues 413, 425, and 429 in the core E2F1 transactivation domain (underlined in Figs. 1 and 4) may be critical for protein
binding and transcriptional activation. In support of this prediction, the transactivation domains of E2F2-5 also contain bulky hydrophobic residues at these aligned positions.
To identify the specific protein-protein interactions required for
E2F1-mediated transcriptional activation of the dhfr
promoter, we replaced phenylalanine residues 413, 425, and 429 in the
core E2F1 transactivation domain with alanine. The effects of these alanine substitutions on transcriptional activation were determined by
cotransfection of NIH 3T3 cells with the DHFRGal4 reporter construct
and Gal4-E2F1 expression constructs. As shown in Fig. 5A, a wild-type E2F1 core
transactivation domain shows a 30-fold activation of the DHFRGal4
reporter construct. Alanine substitution for Tyr-411, an amino acid
residue that is highly conserved in E2F transactivation domains, but
not positionally conserved in other transactivation domains, does not
reduce activation of DHFRGal4. However, alanine substitution for
Phe-413 reduces activation to 36% of wild-type levels, and
substitutions for Phe-425 and Phe-429 reduce activation to 12% and
16% of wild-type levels, respectively. Double and triple alanine
substitutions for residues Phe-413, Phe-425, and Phe-429 completely
abolish activation, demonstrating that these residues are crucial for
the activity of the core E2F1 transactivation domain. By Western blot
analysis, we found the levels of wild-type and mutant Gal4-E2F1 fusion
proteins in transfected NIH 3T3 cells to be equivalent (data not
shown), demonstrating that the decreased activation observed for the
mutant proteins is not a result of decreased expression.
To determine the effects of the alanine substitutions on protein
binding, we compared CBP, TFIIH, and TBP binding by the wild-type and
mutant E2F1 core transactivation domains. The smallest region of E2F1
previously shown to bind CBP, TFIIH, and TBP contained amino acids
380-437 (39, 53); therefore, we used a construct containing amino
acids 386-437 as a positive control. HeLa nuclear extract was applied
to protein affinity columns containing immobilized GST or GST-E2F1
fusion proteins. Bound proteins were eluted, subjected to SDS-PAGE, and
analyzed by Western blot analysis using antibodies directed against
CBP, the p62 subunit of TFIIH, and TBP. As expected, an E2F1
transactivation domain containing amino acids 386-437 binds to all
three proteins (Fig. 5B, lane 3). We
found that the core transactivation domain containing amino acids
409-437 is also sufficient for robust binding of CBP, TFIIH, and TBP
(Fig. 4B, lane 4). Importantly, the
phenylalanine substitutions that reduced activation had dramatic
effects on protein binding (Fig. 5B, lanes
5-9; quantitated in Fig. 5C). TBP binding does
not correlate with the ability of the E2F1 core transactivation domain
to activate the dhfr promoter since alanine substitutions
for Phe-413, Phe-425, and Phe-429 completely abolish TBP binding, but
differentially reduce activation of DHFRGal4. However, binding of CBP
and TFIIH more closely correlate with activation of DHFRGal4. Alanine
substitutions for Phe-425 and Phe-429, which have the most dramatic
effects on transcriptional activation, greatly reduce CBP binding and abolish TFIIH binding. Double and triple alanine substitutions for
residues Phe-413, Phe-425, and Phe-429, which abolish activation of
DHFRGal4, completely abolish binding to all three target proteins analyzed. By Coomassie-stained SDS-PAGE analysis, we found the amount
of GST fusion proteins on the affinity columns to be equivalent (data
not shown), demonstrating that the observed changes in TBP, TFIIH, and
CBP binding are not due to differences in the amount of GST fusion protein.
Conservative Amino Acid Substitutions for Phenylalanine 429 Show a
Strong Correlation between Recruitment of CBP and Activation of the
dhfr Promoter by E2F1--
Our initial mutational analysis of the core
E2F1 transactivation domain demonstrated the importance of
phenylalanine residues 413, 425, and 429 for both transcriptional
activity of E2F1 and binding of CBP, TFIIH, and TBP. Unfortunately, we
were unable to identify which of these target proteins is required for
activation of the dhfr promoter, since alanine substitutions
for these residues reduced binding to all three proteins. However, we
postulated that if loss of protein binding due to replacement of the
phenylalanine residues with alanine was a result of loss of a critical
bulky hydrophobic side group, then conservative replacement with
residues containing other bulky hydrophobic side groups may restore
transcriptional activation, while restoring only a subset of
protein-protein interactions. Since alanine substitution for Phe-429
had the most dramatic effect on binding of all three proteins tested,
we replaced this residue with tyrosine and leucine to determine if
other aromatic and/or bulky hydrophobic residues could function in
place of phenylalanine in activation and protein binding. We also
replaced Phe-429 with the charged residue aspartate to further test the
requirement for a hydrophobic residue at this position. To determine
the effects of these substitutions on transcriptional activation, we
cotransfected NIH 3T3 cells with the DHFRGal4 reporter construct and
Gal4-E2F1 expression constructs. As expected, the wild-type E2F1 core
transactivation domain shows a 36-fold activation of the DHFRGal4
reporter construct, and the alanine substitution for Phe-429 reduces
activation to 17% of wild-type levels (Fig.
6A). However, replacement of
Phe-429 with tyrosine or leucine either partially or completely
restores activation to 58% and 102% wild-type levels, respectively.
An aspartate residue at position 429 reduces activation to 20%
wild-type levels. The difference in levels of activation observed for
the mutant proteins is not a result of differential expression, since by Western blot analysis, we found the levels of wild-type and mutant
Gal4-E2F1 fusion proteins in transfected NIH 3T3 cells to be equivalent
(data not shown). Taken together, our results demonstrate that tyrosine
and leucine can function in place of Phe-429 of the core E2F1
transactivation domain in the activation of the dhfr
promoter. It is also interesting to note that the transactivation
domains of E2F2 and E2F3 contain a leucine residue at this position
(see Fig. 4).
To determine if replacement of phenylalanine 429 with tyrosine,
leucine, or aspartate altered the binding of target proteins to the
core E2F1 transactivation domain, we compared CBP, TFIIH, and TBP
binding by the wild-type and mutant transactivation domains. HeLa
nuclear extract was applied to protein affinity columns as described
above. Bound proteins were eluted and analyzed by Western blot analysis
using antibodies directed against CBP, the p62 subunit of TFIIH, and
TBP. We found that tyrosine and leucine substitutions for Phe-429 do
alter target protein binding by the core E2F1 transactivation domain.
As shown in Fig. 6B (quantitated in Fig. 6C),
replacement of Phe-429 with tyrosine, leucine, or aspartate greatly
reduces TFIIH and TBP binding to levels indistinguishable from that of F429A (compare lanes 5-7 to lane
4). However, only replacement of Phe-429 with tyrosine and
leucine, both of which can substitute for Phe-429 in activation of
DHFRGal4, result in appreciable binding of CBP when compared with
wild-type (Fig. 6B, compare lanes 4-7 to lane 3). F429A and F429D, which do not
activate DHFRGal4, bind only very low amounts of CBP. By
Coomassie-stained SDS-PAGE analysis, we found the amount of GST fusion
proteins on the affinity columns to be equivalent (data not shown),
demonstrating that the observed changes in TBP, TFIIH, and CBP binding
are not due to differences in the amount of GST fusion protein. Taken
together, our results show a strong correlation between activation of
DHFRGal4 and binding of the core E2F1 transactivation domain to CBP,
but not TFIIH or TBP. Therefore, we suggest that CBP recruitment is
critical for activation of the dhfr promoter.
Transactivator Bypass Experiments Indicate That Recruitment of CBP
Is Sufficient for Activation of the dhfr Promoter--
We have
defined a core E2F1 transactivation domain containing only 38 amino
acids and have shown a strong correlation between activation of the
dhfr promoter and binding of CBP, but not TFIIH or TBP. We
next wished to determine if the direct recruitment of either CBP,
TFIIH, or TBP could bypass the requirement for the E2F1 transactivation
domain at the dhfr promoter. Therefore, we analyzed the
ability of Gal4-CBP, Gal4-p62 (TFIIH), and Gal4-TBP fusion proteins to
activate the DHFRGal4 reporter construct in NIH 3T3 cells (11, 61).
Since TFIIH is a multisubunit protein complex, we chose to fuse the
Gal4 DNA binding domain to the p62 subunit which has previously been
shown to directly contact the E2F1 transactivation domain (39). As
shown in Fig. 7, Gal4-p62 and Gal4-TBP
show only a 2.1- and 1.2-fold activation of DHFRGal4, respectively. The
inability of these fusion proteins to activate transcription in a
transactivator bypass experiment suggests that recruitment of TFIIH and
TBP are not rate-limiting steps in the activation of the
dhfr promoter. However, a Gal4-CBP fusion protein shows an
8.5-fold activation of DHFRGal4, suggesting that recruitment of CBP is
rate-limiting in the activation of dhfr. Therefore, we
suggest that recruitment of CBP is one mechanism by which E2F1 activates dhfr transcription.
We have previously demonstrated that the murine dhfr
promoter is activated by an E2F family member in S phase (29). We have also shown that E2F1 can bind to the dhfr promoter in
vivo2 and that E2F1 is a robust activator of
dhfr transcription (29, 62). Therefore, we have chosen E2F1
as the representative E2F family member in our experiments designed to
define and characterize the region of E2F proteins and protein-protein
interactions required for activation of dhfr transcription.
The E2F1 transactivation domain binds a variety of cellular proteins
including mdm2, Rb, CBP, TFIIH, and TBP (17, 38, 39, 46, 53). Many of
these protein-protein interactions have been shown to correlate with activation of synthetic TATA-containing promoters (38, 39, 46, 53);
however, we found only CBP binding to correlate with activation of the
dhfr promoter. Using deletion analysis, we have shown a
region of E2F1 containing amino acids 399-437 to be sufficient for
maximal activation of the dhfr promoter, and identified a smaller core domain of E2F1 spanning amino acids 409-437 that retains
robust activation and binding of CBP, TFIIH, and TBP. Further analysis
using amino acid substitutions indicated that two phenylalanine
residues in the core domain (Phe-425 and Phe-429) are highly critical
for both transcriptional activation of dhfr and binding of
CBP, TFIIH, and TBP. However, further amino acid substitutions for
Phe-429 eliminated the correlation between activation and binding of
TFIIH and TBP. In contrast, our results showed a striking correlation
between the ability of the core E2F1 transactivation domain to activate
the dhfr promoter and to bind CBP. Furthermore, in a
transactivator bypass experiment, we demonstrated that direct recruitment of CBP results in activation of the dhfr
promoter. Therefore, we suggest that recruitment of CBP is one
mechanism by which E2F1 activates the dhfr promoter.
Our results strongly suggest that recruitment of mdm2, Rb, TFIIH, and
TBP are not required for activation of the dhfr promoter by
E2F1. For example, Gal4-E2F1 fusion proteins that no longer bind to
mdm2 or Rb retain the ability to activate the dhfr promoter (Fig. 2). Additionally, Gal4-E2F1 fusion proteins that no longer bind
to TFIIH or TBP retain the ability to activate the dhfr
promoter (Figs. 5 and 6), and neither Gal4-TBP nor Gal4-p62 activated
the dhfr promoter in a transactivator bypass experiment,
suggesting that recruitment of TFIIH and TBP are not rate-limiting
steps in activation of dhfr transcription. It is not
surprising that E2F1 is not required to recruit TBP, since the
dhfr promoter contains four binding sites for Sp1, which has
been shown to bind other subunits of TFIID and to substitute for a TATA
box as the primary transcription initiation positioning element (6,
63-66). Our results are also in complete agreement with previous
studies demonstrating that recruitment of TBP, a component of the
general transcription factor TFIID, is not rate-limiting for TATA-less
promoters (22). In addition, we have found that several transactivation
domains which bind TBP, including a C-terminally truncated VP16
transactivation domain, are not able to activate dhfr
transcription (29).
Although our studies suggest that CBP recruitment is one essential
function of E2F1, we also note that additional proteins may be required
for maximal activation of dhfr transcription. For example,
the core transactivation domain does not activate the dhfr
promoter to the same level as does a longer E2F1 transactivation domain, even though both constructs bind similar amounts of CBP (Fig.
5). In addition, alanine replacement of Phe-413 decreased activation by
3-fold, but had no apparent effect on CBP binding by the core E2F1
transactivation domain. These results could be due to the in
vitro conditions chosen to examine binding of E2F1 to CBP or could
be due to a requirement for other unidentified activities. Regardless,
our results strongly suggest that recruitment of CBP is critical for
activation of the dhfr promoter.
CBP is a member of a family of global transcriptional coactivators that
is involved in the regulation of many DNA binding transcriptional
activators (for recent reviews, see Refs. 67-69). Previous studies
suggest several mechanisms by which CBP may activate transcription. For
example, CBP can directly interact with RNA polymerase II, TFIIB, and
TBP, suggesting a role in recruitment of the basal transcription
machinery (70, 71). In addition, CBP has been shown to contain histone
acetyltransferase activity and to associate with proteins that also
have similar activities, including p300/CBP-associated factor (72, 73).
Acetylation of the N-terminal tails of histones has long been
correlated with transcriptional activation (for a recent review, see
Ref. 74), and our preliminary data suggests that the dhfr
promoter may be regulated by changes in histone acetylation. First, we
find that the histone deacetylase inhibitor trichostatin A induces
transcription from the endogenous dhfr promoter in quiescent
NIH 3T3 cells.3 Furthermore, using a chromatin
immunoprecipitation assay with antibodies directed against acetylated
histones, we find an increase in the abundance of acetylated histone H3
at the endogenous dhfr promoter in mid to late
G1 phase of the cell cycle, just prior to activation of
transcription.2 These experiments indicate that a
transition from deacetylated to acetylated histones correlates with
activation of the dhfr promoter. Therefore, we propose that
E2F1-mediated activation of the dhfr promoter involves the
histone acetylation activity of CBP. However, CBP has also been shown
to acetylate other proteins, including the general transcription
factors TFIIE In summary, we propose a model (shown in Fig.
8) in which transcription of the
dhfr promoter is repressed in G0 phase due to
the association of E2F with a pocket protein (such as Rb), which masks
the E2F transactivation domain, blocks recruitment of CBP, and recruits
histone deacetylase (HDAC) activity. In support of this model, it has
been shown that Rb, p107, and p130 all share the ability to repress E2F
activity through recruitment of HDAC1 (35, 37, 76). Upon
phosphorylation and release of the pocket proteins in late
G1 phase of the cell cycle, E2F recruits CBP, which
acetylates histone H3. The structural changes in the nucleosome that
result as a consequence of acetylation of H3 then contribute to the
activation of dhfr transcription, possibly by increasing the
access of RNA polymerase and the basal machinery to the promoter. Although our studies have been performed using transiently transfected plasmids, we feel that our results are likely to be relevant to the
endogenous dhfr promoter. First, we have shown that cell
cycle regulation is maintained with transiently transfected
dhfr reporter plasmid (28, 29). Second, previous studies
have demonstrated that transfected plasmids interact with histones to
form nucleosome-like structures and that recruitment of histone
deacetylases or histone acetylases can modulate transcription from such
plasmids (37, 77-81). However, we also realize that a more complete
understanding of dhfr regulation may come from an analysis
of a chromosomally located promoter. Therefore, studies are in progress
to compare cell cycle stage-specific changes in acetylation using
integrated and episomal dhfr promoter constructs.
We are very grateful to Erik
Flemington, Tony Kouzarides, Errol Friedberg, Jean-Marc Egly, John
Chrivia, Hua Xiao, and Nancy Thompson for providing plasmids and
antibodies. We thank Julie Wells for generous communication of
unpublished data, and Steve Triezenberg and Vladimir Svetlov for
valuable discussions and assistance. We thank the rest of the Farnham
laboratory for all of their helpful suggestions and critical reading of
this manuscript.
*
This work was supported in part by National Institutes of
Health Grants CA45240 and CA07175 and a grant from the National Cancer
Institute of Canada with funds from the Canadian Cancer Society.The costs of publication of this
article were defrayed in part by the
payment of page charges. The article
must therefore be hereby marked
"advertisement" in
accordance with 18 U.S.C. Section
1734 solely to indicate this fact.
§
Supported in part by National Institutes of Health Predoctoral
Fellowship CA09135.
**
To whom correspondence should be addressed: McArdle Laboratory for
Cancer Research, 1400 University Ave., University of Wisconsin Medical
School, Madison, WI 53706-1599. Tel.: 608-262-2071; Fax: 608-262-2824;
E-mail: farnham{at}oncology.wisc.edu.
2
J. Wells and P. J. Farnham, unpublished data.
3
C. J. Fry and P. J. Farnham,
unpublished data.
The abbreviations used are:
TF, transcription
factor;
CBP, CREB-binding protein;
CREB, cAMP response element-binding
protein;
TBP, TATA-binding protein;
GST, glutathione
S-transferase;
DHFR, dihydrofolate reductase;
Rb, retinoblastoma;
ACB, Affinity Chromatography Buffer;
HDAC, histone
deacetylase.
Activation of the Murine Dihydrofolate Reductase Promoter by
E2F1
A REQUIREMENT FOR CBP RECRUITMENT*
§,
,,,**
McArdle Laboratory for Cancer Research,
University of Wisconsin Medical School, Madison, Wisconsin 53706 and
the ¶ Banting and Best Department of Medical Research, University
of Toronto, Toronto, Ontario M5G 1L6, Canada
ABSTRACT
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES
INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES
View larger version (19K):
[in a new window]
Fig. 1.
The E2F1 transactivation domain binds several
cellular proteins. Schematic of the human E2F1 protein depicting
previously characterized functional domains (17, 38, 39, 46, 53). The
transactivation domain is magnified to indicate the binding domains for
mdm2, Rb, the p62 subunit of TFIIH, CBP, and the two independent
binding domains for the TBP. Underlined amino acid residues
were mutated in this study.
MATERIALS AND METHODS
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES
F contain the triple alanine substitution
F413A/F425A/F429A and were made using primers 1 and 7 with the E2F1
plasmid pBXG-1/E2F1(409-437)F413A as template. All other Gal4 and GST
fusion protein expression plasmids used in these studies have been
described previously and are referenced accordingly in the text.
Gal4-E2F1Rb and Gal4-E2F1mdm2 have been described previously as
Gal4-E2F1(368-437)(d418-422) and Gal4-E2F1(380-437)DF1 (45, 46). To
construct Gal4-p62, a human p62 BamHI/SalI
fragment from pAS1/p62 (gift from Errol Friedberg) was cloned into
BamHI/SalI-digested pSG424 (47). The DHFRGal4
reporter construct contains dhfr promoter sequence from
356 to +20, with the E2F binding element precisely replaced with a
Gal4 binding element, cloned upstream of the luciferase cDNA
in the vector pAAlucA (29). The pG5TI and pMaeE2F reporter constructs have been described previously (27, 48).
transformed with GST or
GST-E2F1 expression plasmids were diluted 1:10 in 1 liter of fresh
Luria Broth + ampicillin (50 µg/ml) and grown at 30 °C to an
A600 between 0.5 and 1.0 before adding
isopropyl-1-thio-
-D-galactopyranoside to a final
concentration of 0.4 mM. After 2-3 h of additional growth
at 30 °C, cells were pelleted by centrifugation for 5 min at 5,000 rpm in a Beckman model J2-21 centrifuge (JA-17 rotor). Cell pellets
were resuspended in 10 ml Buffer A (20 mM Tris-HCl (pH
7.4), 0.2 mM EDTA, 1 mM dithiothreitol, 1 M NaCl, 1 mM phenylmethylsulfonyl fluoride, 1×
complete protease inhibitor (Roche Molecular Biochemicals), and lysed
by mild sonication. Cellular debris was removed by centrifugation for
20 min at 11,500 rpm. Glycerol was added to the supernatant (to 10%
final concentration), which was then frozen in liquid nitrogen and
stored at 80 °C. E. coli GST lysates (precleared by
centrifugation) were incubated with prewashed Glutathione-Sepharose 4B
(Amersham Pharmacia Biotech) for 2 h at 4 °C. The Glutathione 4B was then washed three times with 10 volumes of ACB containing 0.1 M NaCl, and stored at 4 °C as a 50% slurry in ACB
containing 0.1 mM NaCl and bovine serum albumin (1 mg/ml).
For the affinity chromatography experiments, 60 µl of GST-protein
affinity columns (4 µg of GST fusion protein/µl of
Glutathione-Sepharose 4B) were prewashed with eight column volumes of
ACB containing 1 M NaCl and equilibrated with eight column
volumes of ACB containing 0.1 M NaCl. 1 mg of HeLa nuclear
extract was applied to the columns, which were then washed with 10 column volumes of ACB containing 0.1 M NaCl, and eluted
with four column volumes of ACB containing 1% SDS. Eluates were
analyzed by Western blot analysis with anti-p62 mAb3c9 (50), anti-CBP
sc-583 (Santa Cruz), and anti-TBP 1TBP18 (gift from Nancy Thompson)
antibodies. Autoradiograms were scanned and the signals were
quantitated using ImageQuant version 4.2a (Moleular Dynamics). Each
binding experiment was repeated at least four times.
RESULTS
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES
View larger version (18K):
[in a new window]
Fig. 2.
mdm2 and Rb binding are not critical for
activation of the dhfr promoter. A,
schematic of the DHFRGal4 reporter construct containing a Gal4 binding
site in precise replacement of the E2F1 binding site in the
dhfr promoter. Activation of the DHFRGal4 reporter construct
in NIH 3T3 cells by Gal4-E2F1 fusion proteins containing mutations that
have been shown to abolish mdm2 binding (B) and Rb binding
(C) was compared with the activation by the corresponding
wild-type Gal4-E2F1 fusion proteins. mdm2 contains E2F1 amino acids
380-437 with D390A and F391A substitutions. Rb contains E2F1 amino
acids 368-437 with a deletion of amino acids 418-422. The reporter
construct (5 µg) and Gal4 fusion expression plasmids (5 µg) were
transfected into 1.25 × 105 cells, which were then
incubated in growth medium for 48 h, harvested, and analyzed for
luciferase activity. -Fold activation was calculated by dividing the
luciferase levels conferred to DHFRGal4 by the specified Gal4-E2F1
fusion protein by the luciferase levels conferred by the Gal4 DNA
binding domain alone. The -fold activation by the wild-type E2F1
constructs (shown by the number above the
bar) was set to 100%. Activation by the mutant Gal4-E2F1
fusion proteins is reported as a percentage of the activation conferred
by the corresponding wild-type fusion protein. Bars
represent standard errors of the means.
View larger version (20K):
[in a new window]
Fig. 3.
Amino acids 409-437 of E2F1 contain the core
domain required for activation of the dhfr
promoter. Activation of the DHFRGal4 reporter construct by
the indicated Gal4-E2F1 fusion proteins was examined in transiently
transfected NIH 3T3 cells, as described in the legend to Fig. 2. Fusion
proteins containing N-terminal (A and C) and
C-terminal (B) truncations of the E2F1 protein identify
regions of the transactivation domain required for activation of the
dhfr promoter. -Fold activation of DHFRGal4 by the wild-type
Gal4-E2F1 fusion proteins is given above the bar,
while activation by other Gal4-E2F1 fusion proteins is reported as a
percentage of the wild-type activation. Bars represent
standard errors of the means.
View larger version (31K):
[in a new window]
Fig. 4.
Bulky hydrophobic amino acids may be critical
for E2F1 protein-protein interactions required for transcriptional
activation. Comparison of the primary sequences of various
transactivation domains including E2F. This alignment is based on
visual inspection of positionally conserved bulky hydrophobic amino
acids (indicated in boxes) in E2F, p53, and CREB
transactivation domains compared with the alignment of VP16 and Sp1, as
reported by Cress and Triezenberg (54). Amino acid residues previously
shown to be critical for protein-protein interactions and/or
transactivation by VP16, Sp1, p53, and CREB are underlined.
E2F1 amino acids 409-430 are depicted, and underlined
residues were mutated in these studies.
View larger version (26K):
[in a new window]
Fig. 5.
Phenylalanine residues in the core E2F1
transactivation domain are critical for both transcriptional activation
and protein binding. A, activation of the DHFRGal4
reporter construct by Gal4 fusion proteins containing the core E2F1
transactivation domain with the indicated alanine substitutions was
examined in transiently transfected NIH 3T3 cells, as described in the
legend to Fig. 2. -Fold activation of DHFRGal4 by the wild-type
Gal4-E2F1 fusion protein is given above the bar,
while activation by other Gal4-E2F1 fusion proteins is reported as a
percentage of the wild-type activation. Bars represent
standard errors of the means. B, HeLa nuclear extract was
chromatographed over the indicated series of GST-E2F1 affinity columns.
The columns were washed with low salt buffer and then eluted with
buffer containing 1% SDS. The eluates were analyzed by Western blot
analysis with antibodies directed against CBP, the p62 subunit of
TFIIH, and TBP. The columns contained either GST alone (lane
2), GST-E2F1(386-437) (lane 3), or
GST-E2F1(409-437) with the indicated amino acid substitutions
(lanes 4-9). Lane 1 contains 5% of the input HeLa nuclear extract. Lanes
2-9 contain 40% (p62 and TBP) and 8% (CBP) of the
indicated SDS eluates. Each binding experiment was performed at least
four separate times. C, Western blot autoradiograms were
scanned and the signals were quantitated using ImageQuant version 4.2a
(Molecular Dynamics) to determine the relative levels of protein
binding. The amount of each protein bound by the wild-type core E2F1
transactivation domain (amino acids 409-437) was set to 100%. Levels
of protein bound by E2F1(386-437) and the mutant E2F1 transactivation
domains is reported as a percentage of the protein bound by the
wild-type core transactivation domain.
View larger version (29K):
[in a new window]
Fig. 6.
CBP binding correlates with activation of the
dhfr promoter by the core E2F1 transactivation
domain. A, activation of the DHFRGal4 reporter
construct by Gal4-E2F1 fusion proteins containing the indicated Phe-429
substitutions was examined in transiently transfected NIH 3T3 cells, as
described in the legend to Fig. 2. -Fold activation of DHFRGal4 by the
wild-type Gal4-E2F1 fusion protein is given above the
bar, while activation by the mutated Gal4-E2F1 fusion
proteins is reported as a percentage of the wild-type activation.
Bars represent standard errors of the means. B,
CBP, TFIIH, and TBP binding by core E2F1 transactivation domains
containing the indicated Phe-429 substitutions was measured as
described in the legend to Fig. 4. The columns contained either GST
alone (lane 2), GST-E2F1(409-437)
(lane 3), or GST-E2F1(409-437) with the
indicated Phe-429 substitutions (lanes 4-7).
Lane 1 contains 5% of the input HeLa nuclear
extract. Lanes 2-7 contain 40% (p62 and TBP)
and 8% (CBP) of the indicated SDS eluates. Each binding experiment was
performed at least four separate times. C, protein binding
by the wild-type and Phe-429 substituted core E2F1 transactivation
domains was quantitated as described in the legend to Fig. 4. The
amount of each protein bound by the wild-type core E2F1 transactivation
domain was set to 100%. Levels of protein bound by Phe-429 substituted
E2F1 transactivation domains is reported as a percent of the protein
bound by the wild-type core transactivation domain.
View larger version (40K):
[in a new window]
Fig. 7.
CBP activates the dhfr
promoter in an E2F1 transactivator bypass experiment.
Activation of the DHFRGal4 reporter construct by Gal4 fusion proteins
containing the p62 subunit of TFIIH, CBP, and TBP was examined in
transiently transfected NIH 3T3 cells, as described in the legend to
Fig. 2. -Fold activation was calculated by dividing the luciferase
levels conferred to DHFRGal4 by the specified Gal4 fusion protein by
the luciferase levels conferred by the Gal4 DNA binding domain alone.
Bars represent standard errors of the means.
DISCUSSION
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES
and TFIIF (75). Therefore, it remains possible that
E2F1 recruitment of CBP may be to achieve acetylation of another
component of the transcriptional machinery.
View larger version (22K):
[in a new window]
Fig. 8.
A model for E2F1-mediated activation of the
dhfr promoter in S phase. Figure is a schematic
depicting the murine dhfr promoter in G0 and
G1/S phase of the cell cycle; the arrow
represents the transcription start site. Transcription from the
dhfr promoter is low in G0 phase because: 1) Rb
binds to and masks the E2F transactivation domain and 2) Rb recruits
HDAC1 which deacetylates histones, maintaining a chromatin structure
that hinders access of RNA polymerase II and the basal transcription
machinery. Rb is phosphorylated and released from E2F in late
G1 and early S phase, allowing for recruitment of CBP and
associated factors (CBP*). CBP* then acetylates histones, resulting in
a change of chromatin structure (depicted by differential
shading of nucleosomes) and stimulation of dhfr
transcription. We note that E2F may also recruit additional
unidentified proteins (represented by protein X)
that are required for maximal activation of the dhfr
promoter.
ACKNOWLEDGEMENTS
FOOTNOTES
Supported in part by a scholarship from the Fonds pour la
Formation des Chercheurs et l'Aide à la Recherche.
ABBREVIATIONS
REFERENCES
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES
Copyright © 1999 by The American Society for Biochemistry and Molecular Biology, Inc.
CiteULike 
Complore 
Connotea 
Del.icio.us 
Digg 
Reddit 
Technorati What's this?
This article has been cited by other articles:
|
|
 |
|
  X. Xu, M. Bieda, V. X. Jin, A. Rabinovich, M. J. Oberley, R. Green, and P. J. Farnham A comprehensive ChIP chip analysis of E2F1, E2F4, and E2F6 in normal and tumor cells reveals interchangeable roles of E2F family members Genome Res., November 1, 2007; 17(11): 1550 - 1561. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J. N. Davis, K. J. Wojno, S. Daignault, M. D. Hofer, R. Kuefer, M. A. Rubin, and M. L. Day Elevated E2F1 Inhibits Transcription of the Androgen Receptor in Metastatic Hormone-Resistant Prostate Cancer Cancer Res., December 15, 2006; 66(24): 11897 - 11906. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 H. Gao, J. Xiao, Q. Sun, H. Lin, Y. Bai, L. Yang, B. Yang, H. Wang, and Z. Wang A Single Decoy Oligodeoxynucleotides Targeting Multiple Oncoproteins Produces Strong Anticancer Effects Mol. Pharmacol., November 1, 2006; 70(5): 1621 - 1629. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. Bieda, X. Xu, M. A. Singer, R. Green, and P. J. Farnham Unbiased location analysis of E2F1-binding sites suggests a widespread role for E2F1 in the human genome Genome Res., May 1, 2006; 16(5): 595 - 605. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 N. Berteaux, S. Lottin, D. Monte, S. Pinte, B. Quatannens, J. Coll, H. Hondermarck, J.-J. Curgy, T. Dugimont, and E. Adriaenssens H19 mRNA-like Noncoding RNA Promotes Breast Cancer Cell Proliferation through Positive Control by E2F1 J. Biol. Chem., August 19, 2005; 280(33): 29625 - 29636. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. Nemethova, M. Smutny, and E. Wintersberger Transactivation of E2F-Regulated Genes by Polyomavirus Large T Antigen: Evidence for a Two-Step Mechanism Mol. Cell. Biol., December 15, 2004; 24(24): 10986 - 10994. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 K. M. Regula, M. J. Rzeszutek, D. Baetz, C. Seneviratne, and L. A. Kirshenbaum Therapeutic opportunities for cell cycle re-entry and cardiac regeneration Cardiovasc Res, December 1, 2004; 64(3): 395 - 401. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. Taubert, C. Gorrini, S. R. Frank, T. Parisi, M. Fuchs, H.-M. Chan, D. M. Livingston, and B. Amati E2F-Dependent Histone Acetylation and Recruitment of the Tip60 Acetyltransferase Complex to Chromatin in Late G1 Mol. Cell. Biol., May 15, 2004; 24(10): 4546 - 4556. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. J. Oberley, D. R. Inman, and P. J. Farnham E2F6 Negatively Regulates BRCA1 in Human Cancer Cells without Methylation of Histone H3 on Lysine 9 J. Biol. Chem., October 24, 2003; 278(43): 42466 - 42476. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
P. H. Giangrande, T. C. Hallstrom, C. Tunyaplin, K. Calame, and J. R. Nevins Identification of E-Box Factor TFE3 as a Functional Partner for the E2F3 Transcription Factor Mol. Cell. Biol., June 1, 2003; 23(11): 3707 - 3720. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
V. Salsi, G. Caretti, M. Wasner, W. Reinhard, U. Haugwitz, K. Engeland, and R. Mantovani Interactions between p300 and Multiple NF-Y Trimers Govern Cyclin B2 Promoter Function J. Biol. Chem., February 21, 2003; 278(9): 6642 - 6650. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 C. Lee, J. H. Chang, H. S. Lee, and Y. Cho Structural basis for the recognition of the E2F transactivation domain by the retinoblastoma tumor suppressor Genes & Dev., December 15, 2002; 16(24): 3199 - 3212. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. R. Eberhardy and P. J. Farnham Myc Recruits P-TEFb to Mediate the Final Step in the Transcriptional Activation of the cad Promoter J. Biol. Chem., October 11, 2002; 277(42): 40156 - 40162. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. R. Eberhardy and P. J. Farnham c-Myc Mediates Activation of the cad Promoter via a Post-RNA Polymerase II Recruitment Mechanism J. Biol. Chem., December 14, 2001; 276(51): 48562 - 48571. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 D. Huang, M. Jokela, J. Tuusa, S. Skog, K. Poikonen, and J. E. Syvaoja E2F mediates induction of the Sp1-controlled promoter of the human DNA polymerase {{epsilon}} B-subunit gene POLE2 Nucleic Acids Res., July 1, 2001; 29(13): 2810 - 2821. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
Y.-C. Chang, S. Illenye, and N. H. Heintz Cooperation of E2F-p130 and Sp1-pRb Complexes in Repression of the Chinese Hamster dhfr Gene Mol. Cell. Biol., February 15, 2001; 21(4): 1121 - 1131. [Abstract] [Full Text]
|
|
|
|
|
|
B. A. Slomiany, K. L. D'Arigo, M. M. Kelly, and D. T. Kurtz C/EBPalpha Inhibits Cell Growth via Direct Repression of E2F-DP-Mediated Transcription Mol. Cell. Biol., August 15, 2000; 20(16): 5986 - 5997. [Abstract] [Full Text]
|
|
|
|
|
|
S. R. Eberhardy, C. A. D'Cunha, and P. J. Farnham Direct Examination of Histone Acetylation on Myc Target Genes Using Chromatin Immunoprecipitation J. Biol. Chem., October 20, 2000; 275(43): 33798 - 33805. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. G. Hwang, D. Lee, J. Kim, T. Seo, and J. Choe Human Papillomavirus Type 16 E7 Binds to E2F1 and Activates E2F1-driven Transcription in a Retinoblastoma Protein-independent Manner J. Biol. Chem., January 18, 2002; 277(4): 2923 - 2930. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| All ASBMB Journals | Molecular and Cellular Proteomics |
| Journal of Lipid Research | ASBMB Today |