Advertisement
JBC

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Mukhopadhyay, A.
Right arrow Articles by Aggarwal, B. B.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Mukhopadhyay, A.
Right arrow Articles by Aggarwal, B. B.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

J Biol Chem, Vol. 274, Issue 23, 15978-15981, June 4, 1999

COMMUNICATION
Identification and Characterization of a Novel Cytokine, THANK, a TNF Homologue That Activates Apoptosis, Nuclear Factor-kappa B, and c-Jun NH2-Terminal Kinase*

Asok MukhopadhyayDagger , Jian NiDagger §, Yifan Zhai§, Guo-Liang Yu§parallel , and Bharat B. Aggarwal**

From the Cytokine Research Laboratory, Department of Molecular Oncology, The University of Texas M. D. Anderson Cancer Center, Houston, Texas 77030 and the § Human Genome Sciences, Inc., Rockville, Maryland 20850

    ABSTRACT
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS AND DISCUSSION
REFERENCES

By using the amino acid sequence motif of tumor necrosis factor (TNF), we searched the expressed sequence tag data base and identified a novel full-length cDNA encoding 285 amino acid residues and named it THANK. THANK is a type II transmembrane protein with 15-20% overall amino acid sequence homology to TNF, LT-alpha , FasL, and LIGHT, all members of the TNF family. The mRNA for THANK was expressed at high levels by peripheral blood leukocytes, lymph node, spleen, and thymus and at low levels by small intestine, pancreas, placenta, and lungs. THANK was also prominently expressed in hematopoietic cell lines. The recombinant purified protein expressed in the baculovirus system had an approximate molecular size 20 kDa with amino-terminal sequence of AVQGP. Treatment of human myeloid U937 cells with purified THANK activated nuclear transcription factor-kappa B (NF-kappa B) consisting of p50 and p65. Activation was time- and dose-dependent, beginning with as little as a 1 pM amount of the cytokines and as early as 15 min. Under the same conditions, THANK also activated c-jun NH2-terminal kinase (JNK) in U937 cells. THANK also strongly suppressed the growth of tumor cell lines and activated caspase-3. Although THANK had all the activities and potency of TNF, it did not bind to the TNF receptors. Thus our results indicate that THANK is a novel cytokine that belongs to the TNF family and activates apoptosis, NF-kappa B, and JNK through a distinct receptor.

    INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS AND DISCUSSION
REFERENCES

In 1984, we reported the isolation of two homologous cytokines that can inhibit the growth specifically of tumor cells (1-7) and named them TNF-alpha 1 and TNF-beta (also called lymphotoxin). Since then over 15 members of this family have been identified, including FasL, CD27L, CD30L, CD40L, OX-40L, 4-1BBL, LT-beta , TWEAK, TRAIL, RANKL/TRANCE, LIGHT, VEGI, and APRIL (8-16). At the amino acid sequence level, various members of the TNF family are 20-25% homologous to each other. Most members of this family play an important role in gene activation, proliferation, differentiation, and apoptosis. These ligands interact with the corresponding receptor, also members of the TNF receptor family, and activate the transcription factors NF-kappa B and AP-1 (9, 17), a stress-activated protein kinase (c-jun NH2-terminal protein kinase, JNK), and a cascade of caspases.

By searching an expressed sequence tag (EST) data base using the amino acid sequence motif of TNF, we identified a novel member of the TNF family, named THANK, for TNF homologue that activates apoptosis, NF-kappa B, and JNK. We found that this cytokine was primarily expressed by hematopoietic cells. The recombinant THANK activated NF-kappa B, c-jun NH2-terminal kinase, caspase-3, and displayed antiproliferative effects in U937 cells through binding sites distinct from those for TNF.

    MATERIALS AND METHODS
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS AND DISCUSSION
REFERENCES

Identification, Cloning, Expression, and Purification of THANK-- Using high throughput automated DNA sequence analysis of randomly selected human cDNA clones, a data base containing more than 2 million ESTs obtained from over 750 different cDNA libraries has been generated by Human Genome Sciences, Inc. A specific homology and motif search using the known amino acid sequence motif of TNF family members against this data base revealed several ESTs having homology to members of the TNF family. One full-length cDNA clone (HNEDU15) encoding an intact NH2-terminal signal peptide was isolated from a human neutrophil library and selected for further investigation. The complete cDNA sequence of both strands of this clone was determined, and its homology to TNF was confirmed. This gene product was named THANK. THANK is a 285-amino acid-long type II transmembrane protein. The transmembrane domain was found to be located between amino acid residues 47 through 77 (Fig. 1A).

The cDNA encoding the extracellular domain of THANK (amino acids 78-285) was amplified employing the polymerase chain reaction technique using the following primers: 5' BamHI, GCGGGATCCCAGCCTCCGGGCAGAGC and 3' XbaI, GCGTCTAGATCACAGCACTTTCAATGC. The amplified fragment was purified, digested with BamHI and Xbal I, and cloned into a baculovirus expression vector pA2-GP, derived from pVL94. The cloning, expression, and confirmation of the identity of the cloned product were performed using standard techniques (18).

Recombinant THANK was purified from the clarified culture supernatant of 92-h postinfected Sf9 cells. The protein was stepwise purified by cation and anion exchange chromatography. The purified THANK was analyzed for purity by 12% SDS-PAGE and by Western blot analysis.

Northern Blot Analysis-- Two multiple human tissue Northern blots containing 2 µg of poly(A)+ RNA per lane of various tissues (CLONTECH) were probed with 32P-labeled THANK cDNA. RNA from a selected panel of human cell lines were probed following the same technique.

Production of THANK Antibodies-- Antibodies against THANK were raised by injecting 0.2 mg of purified recombinant antigen in Freund's complete adjuvant (Difco) subcutaneously into a rabbit. After 3 weeks, the injection was repeated, and the rabbit was bled every 3rd week. The specificity of the antiserum was tested by enzyme-linked immunosorbent assay and Western blot.

Receptor Binding Assay-- TNF receptor binding assay was performed following a modified procedure described previously from our laboratory (19). Briefly, 0.5 × 106 cells/well (triplicate well) in 100 µl of binding medium (RPMI 1640 containing 10% fetal bovine serum) were incubated with 125I-labeled TNF (2.5 × 105 cpm/well, specific activity 40 mCi/mg) either alone (total binding) or in the presence of 20 nM unlabeled TNF (nonspecific binding) or 150 nM unlabeled THANK in an ice bath for 1 h. Thereafter, cells were washed three times with ice-cold phosphate-buffered saline containing 0.1% bovine serum albumin to remove unbound 125I-TNF. The cells were dried at 80 °C, and the cell-bound radioactivity was determined in a gamma  counter (Cobra-Auto Gamma, Packard Instrument Co.)

Electrophoretic Mobility Shift Assay (EMSA)-- NF-kappa B activation was analyzed by EMSA as described previously (20, 21). In brief, 6-µg nuclear extracts prepared from THANK-treated cells were incubated with 32P-end-labeled 45-mer double-stranded NF-kappa B oligonucleotide for 15 min at 37 °C and the DNA-protein complex resolved in 7.5% native polyacrylamide gel. The specificity of binding was examined by competition with unlabeled 100-fold excess oligonucleotide. The specificity of binding was also determined by supershift of the DNA-protein complex using specific and irrelevant antibodies. The samples of supershift experiments were resolved on 5.5% native gels. The radioactive bands from dried gels were visualized and quantitated by PhosphorImager (Molecular Dynamics, Sunnyvale, CA) using ImageQuant software.

Western Blot of THANK-- Purified THANK sample was resolved on 12% SDS-PAGE, electrotransferred to a nitrocellulose membrane, and probed with polyclonal antibodies (1:6000) raised in rabbits. The blot was then treated with horseradish peroxidase-conjugated secondary antibodies and finally detected by chemiluminescence (ECL, Amersham Pharmacia Biotech).

c-Jun Kinase Assay-- The c-Jun kinase assay was performed by a modified method as described earlier (22). Briefly, 100-µg cytoplasmic extracts were treated with anti-JNK1 antibodies, precipitated the immune complexes with protein A/G-Sepharose beads (Pierce), and assayed for the enzymatic activity by using glutathione S-transferase-Jun (amino acids 1-79) as substrate (2 µg) in the presence of 10 µCi of [32P]ATP. The kinase reaction was carried out by incubating the above mixture at 30 °C in kinase assay buffer for 15 min. The reaction was stopped by adding SDS sample buffer, followed by boiling. Finally, protein was resolved on a 9% acrylamide gel under reduced conditions. The radioactive bands of the dried gel were visualized and quantitated by PhosphorImager as mentioned previously. To determine the total amount of JNK1 protein, 30 µg of the cytoplasmic extracts were loaded on 9% acrylamide gels. After electrophoresis, the protein was transferred to nitrocellulose membranes, blocked with 5% non-fat milk protein, and probed with rabbit polyclonal antibodies (1:3000) against JNK1. The blots were then reacted with horseradish peroxidase-conjugated secondary antibodies and finally detected by chemiluminescence (ECL, Amersham Pharmacia Biotech).

Cytotoxicity Assays-- The cytotoxic effects of THANK against tumor cells were measured by modified tetrazolium salt (3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide) assay described earlier (23) and by its ability to activate caspase-3 leading to cleavage of poly(ADP-ribose) polymerase (PARP) (24). For cytotoxicity, 5 × 103 cells in 0.1 ml were plated in triplicate in 96-well plates and exposed to variable concentrations of either THANK or TNF (for comparison) in 0.1 ml. After 72-h incubation at 37 °C, cells were examined for viability. To estimate caspase-3 activation by PARP cleavage, cell extracts (50 µg/sample) were resolved on 7.5% acrylamide gels, electrophoresed, transferred to nitrocellulose membranes, blocked with 5% non-fat milk protein, probed with PARP monoclonal antibody (1:3000), and detected by ECL as indicated above.

    RESULTS AND DISCUSSION
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS AND DISCUSSION
REFERENCES

Identification, Sequence, and Purification of THANK-- The predicted amino acid sequence of mature THANK (112-285) is 15, 16, 18, and 19% identical to LIGHT, FasL, TNF, and LT-alpha , respectively (Fig. 1A). The cDNA for this novel cytokine was cloned and expressed in a baculovirus expression system. In CM cellulose cation exchange chromatography, THANK eluted first with 1 M NaCl (fraction A) and then with 1.5 M NaCl (fraction B). Fraction B had an approximate molecular mass of 20 kDa on 12% SDS-PAGE with an amino-terminal sequence starting at AVQGP, whereas fraction A contained an additional peptide of 3 kDa with an amino-terminal sequence LKIFEPP (Fig. 1B). An apparently higher molecular size obtained by SDS-PAGE than that predicted from the number of amino acids suggested a post-translational modification. The amino acid sequence of the mature THANK lacked, however, the potential N-glycosylation site. Polyclonal antibodies prepared against THANK recognized the cytokine on Western blot (Fig. 1C).


View larger version (50K):
[in this window]
[in a new window]
 
Fig. 1.   A, amino acid sequence of THANK and its comparison with mature form of TNF, LT, FasL, and LIGHT. The shaded area indicates homology with LT, TNF, FasL, and LIGHT. B, SDS-PAGE analysis of THANK (fraction B). C, Western blot analysis of THANK (fraction B). D, tissue distribution of THANK mRNA. E, expression of THANK mRNA by various cell lines. PBL, peripheral blood leukocytes.

Tissue and Cell Line Distribution of THANK-- Northern blot analysis indicated that THANK was expressed in peripheral blood leukocytes, spleen, thymus, lung, placenta, small intestine, and pancreas; with highest expression in peripheral blood leukocytes (Fig. 1D). Analysis of the cell line blot (CLONTECH) revealed very high expression in HL60, detectable expression in K562, A549, and G361, and no detectable transcript in HeLa, MOLT4, Raji, and SW480 cell lines. Thus cells and tissues of the immune system expressed THANK transcripts.

THANK Activates NF-kappa B-- One of the earliest events induced by most members of the TNF superfamily is NF-kappa B activation (25). The results depicted in Fig. 2, A and B, indicate that THANK activated NF-kappa B in a dose- and time-dependent manner. Less than 10 pM THANK was enough to activate NF-kappa B in U937 cells, although peak activation was obtained at 1 nM. THANK induced optimum NF-kappa B activation within 60 min at 1 nM; and there was no significant increase thereafter (Fig. 2B). The gel shift band was specific, as its formation could be eliminated with excess unlabeled oligonucleotide. It was supershifted by anti-p50 and anti-p65 antibodies only (Fig. 2C), thus indicating that the nuclear factor was composed of p50 and p65 subunits. No significant difference was found in the ability to activate NF-kappa B between the 20- and 23-kDa forms of THANK, indicating that residues 112 through 134 are optional for the biological activity (data not shown).


View larger version (72K):
[in this window]
[in a new window]
 
Fig. 2.   A, dose response of THANK-induced NF-kappa B activation. U937 cells (2 × 106/ml) were treated with different concentrations of THANK for 60 min at 37 °C and then assayed for NF-kappa B by EMSA. B, kinetics of NF-kappa B activation. U937 cells (2 × 106/ml) were treated with 1 nM of THANK for various lengths of time. C, supershift and specificity of NF-kappa B. Nuclear extract of THANK-treated cells (lane 4) was incubated at room temperature for 60 min with anti-p50 (lane 5), anti-p65 (lane 6), mixture of anti-p50 and anti-p65 (lane 7), anti-c-Rel (lane 8), anti-cyclin D1 (lane 9), preimmune serum (lane 10), unlabeled NF-kappa B oligonucleotide (lane 2) and then assayed for NF-kappa B. Lane 1 shows results for free probe, and lanes 3 and 4 show the THANK-untreated and -treated cells, respectively. D, effect of anti-THANK polyclonal antibodies on THANK-induced NF-kappa B activation in U937 cells. THANK was preincubated with anti-THANK antibodies at a dilution of 1:100 or 1:1000 before cells were exposed. E, effect of trypsinization and heat denaturation on the ability of THANK to activate NF-kappa B in U937 cells. THANK was treated with 0.25% trypsin at 37 °C for 60 min and then checked for its ability to activate NF-kappa B (lane 3). The effect of trypsin alone is shown in lane 4. THANK was boiled at 100 °C for 10 min and used for the activation of NF-kappa B (lane 5). Lanes 1 and 2 represent NF-kappa B activation for untreated and THANK-treated U937 cells, respectively.

To ascertain that the observed activation was due to THANK and not a contaminant, the protein was preincubated with anti-THANK polyclonal antibodies before treatment with the cells. Fig. 2D shows a lack of NF-kappa B activation after treatment of THANK with antibodies even at a 1 to 1000 dilution. Antibody against THANK by itself had no effect. To further ascertain that NF-kappa B activation was due to the proteinaceous nature of THANK, the protein was either digested with trypsin or heat-denatured prior to treatment. Both treatments completely abolished NF-kappa B activation in U937 cells, confirming that THANK was responsible for this activation (Fig. 2E). Although THANK was as potent as TNF with respect to both dose and time required for NF-kappa B activation, the overall amplitude of response was less with THANK. In this respect the activity of THANK was comparable with LT-alpha (21).

THANK Activates c-Jun NH2-terminal Kinase-- The activation of JNK is another early event that is initiated by different members of the TNF family (17, 22). THANK activated JNK activity in a time- and dose-dependent manner (Fig. 3, A and B). At 10 pM the activity increased by 2.5-fold and at 1 nM it reached 4.4-fold. An additional increase in THANK concentration slightly decreased activation (Fig. 3A). The peak activation of JNK was observed at 60 min (3.3-fold increase), which gradually decreased thereafter (Fig. 3B). These results suggest that, like TNF, THANK transiently activates JNK in U937 cells. The activation of JNK by THANK was not due to an increase in JNK protein levels, as immunoblot analysis demonstrated comparable JNK1 expression at all dose and time points (Fig. 3, A and B, lower panels).


View larger version (43K):
[in this window]
[in a new window]
 
Fig. 3.   A, dose response of THANK-induced JNK activation. U937 cells (2 × 106/ml) were treated with different concentrations of THANK for 1 h at 37 °C and assayed for JNK activation as described under "Materials and Methods." The lower panel shows equal loading of protein. B, kinetics of THANK-induced activation of JNK. U937 cells (2 × 106/ml) were treated with 1 nM THANK for the indicated time period and assayed for JNK activation. The lower panel shows equal loading of protein. GST, glutathione S-transferase.

THANK-induced Cytotoxicity and Caspase-3 Activation-- Activations of NF-kappa B and JNK are early cellular responses to TNF, which are followed by cytotoxic effects to tumor cells. The effect of different concentrations of THANK on the cytotoxic effects against tumor cell lines was examined and compared with that of TNF. Results in Fig. 4A show that THANK inhibited the growth of human histiocytic lymphoma U937 cells in a dose-dependent manner. Besides U937, THANK also inhibited the growth of prostate cancer (PC-3), colon cancer (HT-29), cervical carcinoma (HeLa), breast carcinoma (MCF-7), and embryonic kidney cells (A293) (data not shown). The growth inhibition curve of THANK was superimposable with that of TNF, indicating comparable potency.


View larger version (30K):
[in this window]
[in a new window]
 
Fig. 4.   A, dose-dependent cytotoxic effects of THANK against U937 cells. 5 × 103 cells/well were incubated in triplicate with various concentrations of THANK or TNF and then examined for cell viability after 72 h. Untreated control is expressed as 100%. B, THANK-induced cleavage of PARP in U937 cells. U937 cells (2 × 106 cells/ml) were treated with 0.1, 1, and 10 nM THANK in the presence of cycloheximide (10 µg/ml) for 2 h at 37 °C. In order to compare the cleavage, TNF was used as a positive control. C, competitive inhibition of labeled TNF binding to U937 cells by unlabeled TNF (20 nM) and THANK (150 nM). U937 cells (0.5 × 106 cells/well) were incubated with 0.25 × 106 cpm of 125I-TNF in an ice bath for 1 h in the presence or absence of the unlabeled competitors. Cell-bound radioactivity was measured in a gamma  counter. Results are expressed as mean ± S.D.

Degradation of PARP by caspase-3 is one of the hallmarks of apoptosis in tumor cells (26). We found that treatment of U937 cells with THANK for 2 h induced partial cleavage of PARP in U937 cells, whereas TNF almost completely cleaved PARP under these conditions (Fig. 4B). This suggests that THANK can activate caspase-3, although not so strongly as TNF.

THANK Binds to Receptors Distinct from TNF Receptors-- Previously we have shown that TNF and LT, which share homology with each other to the same extent as THANK, bind to the same cell surface receptors (4). Since THANK has significant amino acid sequence homology with TNF, and like TNF exhibits cytotoxic effects, and activates NF-kappa B and JNK, we examined its binding to the TNF receptor. The receptor binding results (Fig. 4C) show that 20 nM unlabeled TNF almost completely blocked the binding of 125I-labeled TNF to U937 cells, whereas 150 nM unlabeled THANK did not compete for 125I-TNF binding sites. These results suggest that THANK interacts with U937 cells through a receptor distinct from that for TNF.

In summary, we describe here the identification of a novel cytokine expressed by hematopoietic cells that can, like TNF and LT-alpha , activate NF-kappa B and JNK and inhibit the growth of a wide variety of tumor cells. Although the structure of THANK also exhibits homology to FasL and LIGHT, the latter have not been reported to activate NF-kappa B. Our preliminary results by using flow cytometry indicate that THANK protein is expressed by promyelomonocytic HL-60 cells (data not shown). Because THANK is expressed by hematopoietic cells, it appears to be similar to LT-alpha and dissimilar from other members of the TNF superfamily. Among all the members of the TNF superfamily, THANK exhibits cytotoxic effects similar to TNF and LT-alpha . Whether THANK exhibits immunomodulatory activities and in vivo antitumor activities is currently under investigation.

    FOOTNOTES

* This work was supported by The Clayton Foundation for Research.The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

Dagger These two authors share the first authorship.

These two authors share the senior authorship.

parallel Present address: Mendel Biotechnology, Inc., 21375 Cabot Blvd., Hayward, CA 94545.

** To whom correspondence should be addressed. Tel.: 713-792-3503 (or 6459); Fax: 713-794-1613; E-mail: aggarwal{at}utmdacc.mda.uth.tmc.edu.

    ABBREVIATIONS

The abbreviations used are: TNF, tumor necrosis factor; NF-kappa B, nuclear transcription factor-kappa B; EMSA, electrophoretic mobility shift assay; AP-1, activator protein 1; JNK, NH2-terminal c-Jun kinase; PARP, poly(ADP-ribose) polymerase; EST, expressed sequence tag; PAGE, polyacrylamide gel electrophoresis.

    REFERENCES
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS AND DISCUSSION
REFERENCES
  1. Aggarwal, B. B., Moffat, B., and Harkins, R. N. (1984) J. Biol. Chem. 259, 686-691[Abstract/Free Full Text]
  2. Gray, P. W., Aggarwal, B. B., Benton, C. V., Bringman, T. S., Henzel, W. J., Jarrett, J. A., Leung, D. W., Moffat, B., Ng, P., Svedersky, L. P., Palladino, M. A., and Nedwin, G. A. (1984) Nature 312, 721-724[CrossRef][Medline] [Order article via Infotrieve]
  3. Pennica, D., Nedwin, G. E., Hayflick, J. F., Seeburg, P. H., Palladino, M. A., Kohr, W. J., Aggarwal, B. B., and Goeddel, D. V. (1984) Nature 312, 724-729[CrossRef][Medline] [Order article via Infotrieve]
  4. Aggarwal, B. B., Eessalu, T. E., and Hass, P. E. (1985) Nature 318, 665-667[CrossRef][Medline] [Order article via Infotrieve]
  5. Aggarwal, B. B., Henzel, W. J., Moffat, B., Kohr, W. J., and Harkins, R. N. (1985) J. Biol. Chem. 260, 2334-2344[Abstract/Free Full Text]
  6. Aggarwal, B. B., Kohr, W. J., Hass, P. E., Moffat, B., Spencer, S. A., Henzel, W. J., Bringman, T. S., Nedwin, G. E., Goeddel, D. V., and Harkins, R. N. (1985) J. Biol. Chem. 260, 2345-2354[Abstract/Free Full Text]
  7. Sugarman, B. J., Aggarwal, B. B., Hass, P. E., Figari, I. S., Palladino, M. A., and Shepard, H. M. (1985) Science 230, 943-945[Abstract/Free Full Text]
  8. Aggarwal, B. B, and Natarajan, K. (1996) Eur. Cytokine Netw. 7, 93-124[Medline] [Order article via Infotrieve]
  9. Smith, C. A., Farrah, T., and Goodwin, R. G. (1994) Cell 76, 959-962[CrossRef][Medline] [Order article via Infotrieve]
  10. Wiley, S. R., Schooley, K., Din, W. S., Huand, C.-P., Sutherland, G. R., Smith, C. A., and Goodwin, R. G. (1995) Immunity 3, 673-682[CrossRef][Medline] [Order article via Infotrieve]
  11. Mauri, D. N., Ebner, R., Montgomery, R. I., Kochel, K. D., Cheung, T. C., Yu, G. L., Ruben, S., Murphy, M., Eisenberg, R. J., Cohen, G. H., Spear, P. G., and Ware, C. F. (1998) Immunity 8, 21-30[CrossRef][Medline] [Order article via Infotrieve]
  12. Hahne, M., Kataoka, T., Schroter, M., Hofmann, K., Irmler, M., Bodmer, J. L., Schneider, P., Bornand, T., Holler, N., French, L. E., Sordat, B., Rimoldi, D., and Tschopp, J. (1998) J. Exp. Med. 188, 1185-1190[Abstract/Free Full Text]
  13. Chicheportiche, Y., Bourdon, P. R., Xu, H., Hsu, Y. M., Scott, H., Hession, C., Garcia, I., and Browning, J. L. (1997) J. Biol. Chem. 272, 32401-32410[Abstract/Free Full Text]
  14. Zhai, Y., Ni, J., Jiang, G.-W., Lu, J., Xing, L., Lincoln, C., Janat, F., Kozak, D., Rojas, J., Aggarwal, B. B., Ruben, S., Li, L., Gentz, R., and Yu, G. (1999) FASEB J. 13, 181-189[Free Full Text]
  15. Anderson, D. M., Maraskovsky, E., Billingsley, W. L., Dougall, W. C., Tometsko, M. E., Roux, E. R., Teepe, M. C., DuBose, R. F., Cosman, D., and Galibert, L. (1997) Nature 390, 175-179[CrossRef][Medline] [Order article via Infotrieve]
  16. Wong, B. R., Rho, J., Arron, J., Robinson, E., Orlinick, J., Chao, M., Kalachikov, S., Cayani, E., Bartlett, F. S., III, Frankel, W. N., Lee, S. Y., and Choi, Y. (1997) J. Biol. Chem. 272, 25190-25194[Abstract/Free Full Text]
  17. Singh, A., Ni, J., and Aggarwal, B. B. (1998) J. Interferon Cytokine Res. 18, 439-450[Medline] [Order article via Infotrieve]
  18. Ni, J., Abrahamson, M., Zhang, M., Fernandez, M., Grubb, A., Su, J., Yu, G.-L., Li, Y.-L., Parmelee, D., Xing, L., Coleman, T., Lima, S., Thotakura, R., Nguyen, N., Hesselberg, M., and Gentz, R. (1997) J. Biol. Chem. 272, 10853-10858[Abstract/Free Full Text]
  19. Higuchi, M., and Aggarwal, B. B. (1992) Anal. Biochem. 204, 53-57[CrossRef][Medline] [Order article via Infotrieve]
  20. Schreiber, E., Matthias, P., Muller, M. M., and Schaffner, W. (1989) Nucleic Acids Res. 17, 6419-6422[Free Full Text]
  21. Chaturvedi, M., LaPushin, R., and Aggarwal, B. B. (1994) J. Biol. Chem. 269, 14575-14583[Abstract/Free Full Text]
  22. Kumar, A., and Aggarwal, B. B. (1999) Methods Enzymol. 300, 339-345[CrossRef][Medline] [Order article via Infotrieve]
  23. Hansen, M. B., Nielsen, S. E., and Berg, K. (1989) J. Immunol. Methods 119, 203-210[CrossRef][Medline] [Order article via Infotrieve]
  24. Haridas, V., Darnay, B., Natarajan, K., Heller, R., and Aggarwal, B. B. (1998) J. Immunol. 160, 3152-3162[Abstract/Free Full Text]
  25. Baeuerle, P., and Baltimore, D. (1996) Cell 87, 13-20[CrossRef][Medline] [Order article via Infotrieve]
  26. Tewari, M., Quan, L. T., O'Rourke, K., Desnoyers, S., Zeng, Z., Beidler, D. R., Poirier, G. G., Salvesen, G. S., and Dixit, V. M. (1995) Cell 81, 801-809[CrossRef][Medline] [Order article via Infotrieve]


Copyright © 1999 by The American Society for Biochemistry and Molecular Biology, Inc.
Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
J. Leukoc. Biol.Home page
G. Hardenberg, L. Fernandez, J. Hendriks, K. Chebli, C. Jacquet, M. Sitbon, M. Hahne, and J. P. Medema
APRIL facilitates viral-induced erythroleukemia but is dispensable for T cell immunity and lymphomagenesis
J. Leukoc. Biol., August 1, 2008; 84(2): 380 - 388.
[Abstract] [Full Text] [PDF]


Home page
Ann Rheum DisHome page
D T La, C E Collins, H-T Yang, T-S Migone, and W Stohl
B lymphocyte stimulator expression in patients with rheumatoid arthritis treated with tumour necrosis factor {alpha} antagonists: differential effects between good and poor clinical responders
Ann Rheum Dis, August 1, 2008; 67(8): 1132 - 1138.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
W. Stohl, N. Jacob, W. J. Quinn III, M. P. Cancro, H. Gao, C. Putterman, X. Gao, L. Pricop, and M. N. Koss
Global T Cell Dysregulation in Non-Autoimmune-Prone Mice Promotes Rapid Development of BAFF-Independent, Systemic Lupus Erythematosus-Like Autoimmunity
J. Immunol., July 1, 2008; 181(1): 833 - 841.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
G. Badr, G. Borhis, E. A. Lefevre, N. Chaoul, F. Deshayes, V. Dessirier, G. Lapree, A. Tsapis, and Y. Richard
BAFF enhances chemotaxis of primary human B cells: a particular synergy between BAFF and CXCL13 on memory B cells
Blood, March 1, 2008; 111(5): 2744 - 2754.
[Abstract] [Full Text] [PDF]


Home page
Molecular Cancer TherapeuticsHome page
M. C. Ryan, M. Hering, D. Peckham, C. F. McDonagh, L. Brown, K. M. Kim, D. L. Meyer, R. F. Zabinski, I. S. Grewal, and P. J. Carter
Antibody targeting of B-cell maturation antigen on malignant plasma cells
Mol. Cancer Ther., November 1, 2007; 6(11): 3009 - 3018.
[Abstract] [Full Text] [PDF]


Home page
Rheumatology (Oxford)Home page
S. Morimoto, S. Nakano, T. Watanabe, Y. Tamayama, A. Mitsuo, Y. Nakiri, J. Suzuki, K. Nozawa, H. Amano, Y. Tokano, et al.
Expression of B-cell activating factor of the tumour necrosis factor family (BAFF) in T cells in active systemic lupus erythematosus: the role of BAFF in T cell-dependent B cell pathogenic autoantibody production
Rheumatology, July 1, 2007; 46(7): 1083 - 1086.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
R. Nimmanapalli, M.-A. Lyu, M. Du, M. J. Keating, M. G. Rosenblum, and V. Gandhi
The growth factor fusion construct containing B-lymphocyte stimulator (BLyS) and the toxin rGel induces apoptosis specifically in BAFF-R-positive CLL cells
Blood, March 15, 2007; 109(6): 2557 - 2564.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
C. O. Jacob, L. Pricop, C. Putterman, M. N. Koss, Y. Liu, M. Kollaros, S. A. Bixler, C. M. Ambrose, M. L. Scott, and W. Stohl
Paucity of Clinical Disease despite Serological Autoimmunity and Kidney Pathology in Lupus-Prone New Zealand Mixed 2328 Mice Deficient in BAFF
J. Immunol., August 15, 2006; 177(4): 2671 - 2680.
[Abstract] [Full Text] [PDF]


Home page
Int ImmunolHome page
K. Yoshimoto, Y. Takahashi, M. Ogasawara, Y. Setoyama, K. Suzuki, K. Tsuzaka, T. Abe, and T. Takeuchi
Aberrant expression of BAFF in T cells of systemic lupus erythematosus, which is recapitulated by a human T cell line, Loucy
Int. Immunol., July 1, 2006; 18(7): 1189 - 1196.
[Abstract] [Full Text] [PDF]


Home page
Toxicol SciHome page
W. G. Halpern, P. Lappin, T. Zanardi, W. Cai, M. Corcoran, J. Zhong, and K. P. Baker
Chronic Administration of Belimumab, a BLyS Antagonist, Decreases Tissue and Peripheral Blood B-Lymphocyte Populations in Cynomolgus Monkeys: Pharmacokinetic, Pharmacodynamic, and Toxicologic Effects
Toxicol. Sci., June 1, 2006; 91(2): 586 - 599.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
J. P. Miller, J. E. Stadanlick, and M. P. Cancro
Space, Selection, and Surveillance: Setting Boundaries with BLyS.
J. Immunol., June 1, 2006; 176(11): 6405 - 6410.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
L. Fu, Y.-C. Lin-Lee, L. V. Pham, A. Tamayo, L. Yoshimura, and R. J. Ford
Constitutive NF-{kappa}B and NFAT activation leads to stimulation of the BLyS survival pathway in aggressive B-cell lymphomas
Blood, June 1, 2006; 107(11): 4540 - 4548.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
D. Bischof, S. F. Elsawa, G. Mantchev, J. Yoon, G. E. Michels, A. Nilson, S. L. Sutor, J. L. Platt, S. M. Ansell, G. von Bulow, et al.
Selective activation of TACI by syndecan-2
Blood, April 15, 2006; 107(8): 3235 - 3242.
[Abstract] [Full Text] [PDF]


Home page
JCOHome page
A. J. Novak, D. M. Grote, S. C. Ziesmer, M. P. Kline, M. K. Manske, S. Slager, T. E. Witzig, T. Shanafelt, T. G. Call, N. E. Kay, et al.
Elevated Serum B-Lymphocyte Stimulator Levels in Patients With Familial Lymphoproliferative Disorders
J. Clin. Oncol., February 20, 2006; 24(6): 983 - 987.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Pathol.Home page
Y. Vugmeyster, D. Seshasayee, W. Chang, A. Storn, K. Howell, S. Sa, T. Nelson, F. Martin, I. Grewal, E. Gilkerson, et al.
A Soluble BAFF Antagonist, BR3-Fc, Decreases Peripheral Blood B Cells and Lymphoid Tissue Marginal Zone and Follicular B Cells in Cynomolgus Monkeys
Am. J. Pathol., February 1, 2006; 168(2): 476 - 489.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
Y. Zheng, S. Gallucci, J. P. Gaughan, J. A. Gross, and M. Monestier
A Role for B Cell-Activating Factor of the TNF Family in Chemically Induced Autoimmunity
J. Immunol., November 1, 2005; 175(9): 6163 - 6168.
[Abstract] [Full Text] [PDF]


Home page
Ann Rheum DisHome page
M Schaller, W Stohl, S M Tan, V M Benoit, D M Hilbert, and H J Ditzel
Raised levels of anti-glucose-6-phosphate isomerase IgG in serum and synovial fluid from patients with inflammatory arthritis
Ann Rheum Dis, May 1, 2005; 64(5): 743 - 749.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
D. Gatto, C. Ruedl, B. Odermatt, and M. F. Bachmann
Rapid Response of Marginal Zone B Cells to Viral Particles
J. Immunol., October 1, 2004; 173(7): 4308 - 4316.
[Abstract] [Full Text] [PDF]


Home page
Ann Rheum DisHome page
W Stohl, S Metyas, S-M Tan, G S Cheema, B Oamar, V Roschke, Y Wu, K P Baker, and D M Hilbert
Inverse association between circulating APRIL levels and serological and clinical disease activity in patients with systemic lupus erythematosus
Ann Rheum Dis, September 1, 2004; 63(9): 1096 - 1103.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
S. Shulga-Morskaya, M. Dobles, M. E. Walsh, L. G. Ng, F. MacKay, S. P. Rao, S. L. Kalled, and M. L. Scott
B Cell-Activating Factor Belonging to the TNF Family Acts through Separate Receptors to Support B Cell Survival and T Cell-Independent Antibody Formation
J. Immunol., August 15, 2004; 173(4): 2331 - 2341.
[Abstract] [Full Text] [PDF]


Home page
J BiochemHome page
G. Chen, S. Peng, M. Zou, H. Xu, D. Xu, and J. Wang
Construction and Function of Two Cys146-Mutants with High Activity, Derived from Recombinant Human Soluble B Lymphocyte Stimulator
J. Biochem., July 1, 2004; 136(1): 73 - 79.
[Abstract] [Full Text] [PDF]


Home page
LupusHome page
W Stohl
A therapeutic role for BLyS antagonists
Lupus, May 1, 2004; 13(5): 317 - 322.
[Abstract] [PDF]


Home page
BloodHome page
J. Moreaux, E. Legouffe, E. Jourdan, P. Quittet, T. Reme, C. Lugagne, P. Moine, J.-F. Rossi, B. Klein, and K. Tarte
BAFF and APRIL protect myeloma cells from apoptosis induced by interleukin 6 deprivation and dexamethasone
Blood, April 15, 2004; 103(8): 3148 - 3157.
[Abstract] [Full Text] [PDF]


Home page
Int ImmunolHome page
B. Huard, L. Arlettaz, C. Ambrose, V. Kindler, D. Mauri, E. Roosnek, J. Tschopp, P. Schneider, and L. E. French
BAFF production by antigen-presenting cells provides T cell co-stimulation
Int. Immunol., March 1, 2004; 16(3): 467 - 475.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
E. Varfolomeev, F. Kischkel, F. Martin, D. Seshasayee, H. Wang, D. Lawrence, C. Olsson, L. Tom, S. Erickson, D. French, et al.
APRIL-Deficient Mice Have Normal Immune System Development
Mol. Cell. Biol., February 1, 2004; 24(3): 997 - 1006.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
C. Kern, J.-F. Cornuel, C. Billard, R. Tang, D. Rouillard, V. Stenou, T. Defrance, F. Ajchenbaum-Cymbalista, P.-Y. Simonin, S. Feldblum, et al.
Involvement of BAFF and APRIL in the resistance to apoptosis of B-CLL through an autocrine pathway
Blood, January 15, 2004; 103(2): 679 - 688.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
A. J. Novak, J. R. Darce, B. K. Arendt, B. Harder, K. Henderson, W. Kindsvogel, J. A. Gross, P. R. Greipp, and D. F. Jelinek
Expression of BCMA, TACI, and BAFF-R in multiple myeloma: a mechanism for growth and survival
Blood, January 15, 2004; 103(2): 689 - 694.
[Abstract] [Full Text] [PDF]


Home page
Int ImmunolHome page
K. Schneider, S. Kothlow, P. Schneider, A. Tardivel, T. Gobel, B. Kaspers, and P. Staeheli
Chicken BAFF--a highly conserved cytokine that mediates B cell survival
Int. Immunol., January 1, 2004; 16(1): 139 - 148.
[Abstract] [Full Text] [PDF]


Home page
Ann Rheum DisHome page
F Melchers
Actions of BAFF in B cell maturation and its effects on the development of autoimmune disease
Ann Rheum Dis, November 1, 2003; 62(90002): ii25 - 27.
[Abstract] [Full Text] [PDF]


Home page
JEMHome page
Z. SM. Rahman, S. P. Rao, S. L. Kalled, and T. Manser
Normal Induction but Attenuated Progression of Germinal Center Responses in BAFF and BAFF-R Signaling-Deficient Mice
J. Exp. Med., October 20, 2003; 198(8): 1157 - 1169.
[Abstract] [Full Text] [PDF]


Home page
JEMHome page
L. Gorelik, K. Gilbride, M. Dobles, S. L. Kalled, D. Zandman, and M. L. Scott
Normal B Cell Homeostasis Requires B Cell Activation Factor Production by Radiation-resistant Cells
J. Exp. Med., September 15, 2003; 198(6): 937 - 945.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
M. Pelletier, J. S. Thompson, F. Qian, S. A. Bixler, D. Gong, T. Cachero, K. Gilbride, E. Day, M. Zafari, C. Benjamin, et al.
Comparison of Soluble Decoy IgG Fusion Proteins of BAFF-R and BCMA as Antagonists for BAFF
J. Biol. Chem., August 29, 2003; 278(35): 33127 - 33133.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
K. A. Vora, L. C. Wang, S. P. Rao, Z.-Y. Liu, G. R. Majeau, A. H. Cutler, P. S. Hochman, M. L. Scott, and S. L. Kalled
Cutting Edge: Germinal Centers Formed in the Absence of B Cell-Activating Factor Belonging to the TNF Family Exhibit Impaired Maturation and Function
J. Immunol., July 15, 2003; 171(2): 547 - 551.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
M. Wu, L.-G. Xu, Z. Zhai, and H.-B. Shu
SINK Is a p65-interacting Negative Regulator of NF-{kappa}B-dependent Transcription
J. Biol. Chem., July 11, 2003; 278(29): 27072 - 27079.
[Abstract] [Full Text] [PDF]


Home page
J. Leukoc. Biol.Home page
T. A. Phillips, J. Ni, and J. S. Hunt
Cell-specific expression of B lymphocyte (APRIL, BLyS)- and Th2 (CD30L/CD153)-promoting tumor necrosis factor superfamily ligands in human placentas
J. Leukoc. Biol., July 1, 2003; 74(1): 81 - 87.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
A. Craxton, D. Magaletti, E. J. Ryan, and E. A. Clark
Macrophage- and dendritic cell--dependent regulation of human B-cell proliferation requires the TNF family ligand BAFF
Blood, June 1, 2003; 101(11): 4464 - 4471.
[Abstract] [Full Text] [PDF]


Home page
JNMHome page
T. A. Riccobene, R. C. Miceli, C. Lincoln, Y. Knight, J. Meadows, M. G. Stabin, and C. Sung
Rapid and Specific Targeting of 125I-Labeled B Lymphocyte Stimulator to Lymphoid Tissues and B Cell Tumors in Mice
J. Nucl. Med., March 1, 2003; 44(3): 422 - 433.
[Abstract] [Full Text] [PDF]


Home page
JNMHome page
D. J. Buchsbaum and A. F. LoBuglio
Targeting of 125I-Labeled B Lymphocyte Stimulator
J. Nucl. Med., March 1, 2003; 44(3): 434 - 436.
[Full Text] [PDF]


Home page
JEMHome page
C. S. Schmidt, J. Liu, T. Zhang, H. Y. Song, G. Sandusky, K. Mintze, R. J. Benschop, A. Glasebrook, D. D. Yang, and S. Na
Enhanced B Cell Expansion, Survival, and Humoral Responses by Targeting Death Receptor 6
J. Exp. Med., January 6, 2003; 197(1): 51 - 62.
[Abstract] [Full Text] [PDF]


Home page
ASH Education BookHome page
M. J. Keating, N. Chiorazzi, B. Messmer, R. N. Damle, S. L. Allen, K. R. Rai, M. Ferrarini, and T. J. Kipps
Biology and Treatment of Chronic Lymphocytic Leukemia
Hematology, January 1, 2003; 2003(1): 153 - 175.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
L.-G. Xu and H.-B. Shu
TNFR-Associated Factor-3 Is Associated With BAFF-R and Negatively Regulates BAFF-R-Mediated NF-{kappa}B Activation and IL-10 Production
J. Immunol., December 15, 2002; 169(12): 6883 - 6889.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
V. Roschke, S. Sosnovtseva, C. D. Ward, J. S. Hong, R. Smith, V. Albert, W. Stohl, K. P. Baker, S. Ullrich, B. Nardelli, et al.
BLyS and APRIL Form Biologically Active Heterotrimers That Are Expressed in Patients with Systemic Immune-Based Rheumatic Diseases
J. Immunol., October 15, 2002; 169(8): 4314 - 4321.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
A. J. Novak, R. J. Bram, N. E. Kay, and D. F. Jelinek
Aberrant expression of B-lymphocyte stimulator by B chronic lymphocytic leukemia cells: a mechanism for survival
Blood, September 26, 2002; 100(8): 2973 - 2979.
[Abstract] [Full Text] [PDF]


Home page
J. Leukoc. Biol.Home page
L.-G. Xu, M. Wu, J. Hu, Z. Zhai, and H.-B. Shu
Identification of downstream genes up-regulated by the tumor necrosis factor family member TALL-1
J. Leukoc. Biol., August 1, 2002; 72(2): 410 - 416.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
B. Huard, P. Schneider, D. Mauri, J. Tschopp, and L. E. French
T Cell Costimulation by the TNF Ligand BAFF
J. Immunol., December 1, 2001; 167(11): 6225 - 6231.
[Abstract] [Full Text] [PDF]


Home page
Int ImmunolHome page
I. I. Kuzin, J. E. Snyder, G. D. Ugine, D. Wu, S. Lee, T. Bushnell Jr, R. A. Insel, F. M. Young, and A. Bottaro
Tetracyclines inhibit activated B cell function
Int. Immunol., July 1, 2001; 13(7): 921 - 931.
[Abstract] [Full Text] [PDF]


Home page
JEMHome page
S. Ishikawa, T. Sato, M. Abe, S. Nagai, N. Onai, H. Yoneyama, Y.-y. Zhang, T. Suzuki, S.-i. Hashimoto, T. Shirai, et al.
Aberrant High Expression of B Lymphocyte Chemokine (BLC/CXCL13) by C11b+CD11c+ Dendritic Cells in Murine Lupus and Preferential Chemotaxis of B1 Cells Towards BLC
J. Exp. Med., June 18, 2001; 193(12): 1393 - 1402.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
S. Xu and K.-P. Lam
B-Cell Maturation Protein, Which Binds the Tumor Necrosis Factor Family Members BAFF and APRIL, Is Dispensable for Humoral Immune Responses
Mol. Cell. Biol., June 15, 2001; 21(12): 4067 - 4074.
[Abstract] [Full Text]


Home page
J. Pharmacol. Exp. Ther.Home page
T. J. Parry, T. A. Riccobene, S. J. Strawn, R. Williams, R. Daoud, J. Carrell, S. Sosnovtseva, R. C. Miceli, C. M. Poortman, L. Sekut, et al.
Pharmacokinetics and Immunological Effects of Exogenously Administered Recombinant Human B Lymphocyte Stimulator (BLyS) in Mice
J. Pharmacol. Exp. Ther., April 13, 2001; 296(2): 396 - 404.
[Abstract] [Full Text]


Home page
J. Immunol.Home page
J. Zhang, V. Roschke, K. P. Baker, Z. Wang, G. S. Alarcon, B. J. Fessler, H. Bastian, R. P. Kimberly, and T. Zhou
Cutting Edge: A Role for B Lymphocyte Stimulator in Systemic Lupus Erythematosus
J. Immunol., January 1, 2001; 166(1): 6 - 10.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
B. Nardelli, O. Belvedere, V. Roschke, P. A. Moore, H. S. Olsen, T. S. Migone, S. Sosnovtseva, J. A. Carrell, P. Feng, J. G. Giri, et al.
Synthesis and release of B-lymphocyte stimulator from myeloid cells
Blood, January 1, 2001; 97(1): 198 - 204.
[Abstract] [Full Text] [PDF]


Home page
JEMHome page
C. F. Ware
APRIL and BAFF Connect Autoimmunity and Cancer
J. Exp. Med., December 4, 2000; 192(11): F35 - F38.
[Full Text] [PDF]


Home page
JEMHome page
M. Batten, J. Groom, T. G. Cachero, F. Qian, P. Schneider, J. Tschopp, J. L. Browning, and F. Mackay
BAFF Mediates Survival of Peripheral Immature B Lymphocytes
J. Exp. Med., November 20, 2000; 192(10): 1453 - 1466.
[Abstract] [Full Text] [PDF]


Home page
JEMHome page
R. K.G. Do, E. Hatada, H. Lee, M. R. Tourigny, D. Hilbert, and S. Chen-Kiang
Attenuation of Apoptosis Underlies B Lymphocyte Stimulator Enhancement of Humoral Immune Response
J. Exp. Med., September 25, 2000; 192(7): 953 - 964.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
H.-B. Shu and H. Johnson
B cell maturation protein is a receptor for the tumor necrosis factor family member TALL-1
PNAS, July 19, 2000; (2000) 160213497.
[Abstract] [Full Text]


Home page
JEMHome page
J. S. Thompson, P. Schneider, S. L. Kalled, L. Wang, E. A. Lefevre, T. G. Cachero, F. MacKay, S. A. Bixler, M. Zafari, Z.-Y. Liu, et al.
BAFF Binds to the Tumor Necrosis Factor Receptor-like Molecule B Cell Maturation Antigen and Is Important for Maintaining the Peripheral B Cell Population
J. Exp. Med., July 3, 2000; 192(1): 129 - 136.
[Abstract] [Full Text] [PDF]


Home page
JEMHome page
X.-Z. Xia, J. Treanor, G. Senaldi, S. D. Khare, T. Boone, M. Kelley, L. E. Theill, A. Colombero, I. Solovyev, F. Lee, et al.
TACI Is a TRAF-interacting Receptor for TALL-1, a Tumor Necrosis Factor Family Member Involved in B Cell Regulation
J. Exp. Med., July 3, 2000; 192(1): 137 - 144.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
M. T. Eby, A. Jasmin, A. Kumar, K. Sharma, and P. M. Chaudhary
TAJ, a Novel Member of the Tumor Necrosis Factor Receptor Family, Activates the c-Jun N-terminal Kinase Pathway and Mediates Caspase-independent Cell Death
J. Biol. Chem., May 12, 2000; 275(20): 15336 - 15342.
[Abstract] [Full Text] [PDF]


Home page
JEMHome page
F. Mackay, S. A. Woodcock, P. Lawton, C. Ambrose, M. Baetscher, P. Schneider, J. Tschopp, and J. L. Browning
Mice Transgenic for BAFF Develop Lymphocytic Disorders Along with Autoimmune Manifestations
J. Exp. Med., December 6, 1999; 190(11): 1697 - 1710.
[Abstract] [Full Text] [PDF]


Home page
ScienceHome page
B. Schiemann, J. L. Gommerman, K. Vora, T. G. Cachero, S. Shulga-Morskaya, M. Dobles, E. Frew, and M. L. Scott
An Essential Role for BAFF in the Normal Development of B Cells Through a BCMA-Independent Pathway
Science, September 14, 2001; 293(5537): 2111 - 2114.
[Abstract] [Full Text] [PDF]


Home page
ScienceHome page
J. S. Thompson, S. A. Bixler, F. Qian, K. Vora, M. L. Scott, T. G. Cachero, C. Hession, P. Schneider, I. D. Sizing, C. Mullen, et al.
BAFF-R, a Newly Identified TNF Receptor That Specifically Interacts with BAFF
Science, September 14, 2001; 293(5537): 2108 - 2111.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
M.-C. Chen, T.-L. Hsu, T.-Y. Luh, and S.-L. Hsieh
Overexpression of Bcl-2 Enhances LIGHT- and Interferon-gamma -mediated Apoptosis in Hep3BT2 Cells
J. Biol. Chem., December 1, 2000; 275(49): 38794 - 38801.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
Y. Wu, D. Bressette, J. A. Carrell, T. Kaufman, P. Feng, K. Taylor, Y. Gan, Y. H. Cho, A. D. Garcia, E. Gollatz, et al.
Tumor Necrosis Factor (TNF) Receptor Superfamily Member TACI Is a High Affinity Receptor for TNF Family Members APRIL and BLyS
J. Biol. Chem., November 3, 2000; 275(45): 35478 - 35485.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
S. D. Khare, I. Sarosi, X.-Z. Xia, S. McCabe, K. Miner, I. Solovyev, N. Hawkins, M. Kelley, D. Chang, G. Van, et al.
Severe B cell hyperplasia and autoimmune disease in TALL-1 transgenic mice
PNAS, March 28, 2000; 97(7): 3370 - 3375.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
H.-B. Shu and H. Johnson
B cell maturation protein is a receptor for the tumor necrosis factor family member TALL-1
PNAS, August 1, 2000; 97(16): 9156 - 9161.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Mukhopadhyay, A.
Right arrow Articles by Aggarwal, B. B.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Mukhopadhyay, A.
Right arrow Articles by Aggarwal, B. B.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 All ASBMB Journals   Molecular and Cellular Proteomics 
 Journal of Lipid Research   ASBMB Today 
Copyright © 1999 by the American Society for Biochemistry and Molecular Biology.
Advertisement
spacer
Advertisement
Advertisement