|
|
|
|||||||
|
|||||||||
J Biol Chem, Vol. 274, Issue 23, 15978-15981, June 4, 1999
From the Cytokine Research Laboratory, Department of Molecular
Oncology, The University of Texas M. D. Anderson Cancer
Center, Houston, Texas 77030 and the § Human Genome
Sciences, Inc., Rockville, Maryland 20850
By using the amino acid sequence motif of tumor
necrosis factor (TNF), we searched the expressed sequence tag data base
and identified a novel full-length cDNA encoding 285 amino acid
residues and named it THANK. THANK is a type II transmembrane protein
with 15-20% overall amino acid sequence homology to TNF, LT- In 1984, we reported the isolation of two homologous cytokines
that can inhibit the growth specifically of tumor cells (1-7) and
named them TNF- By searching an expressed sequence tag (EST) data base using the amino
acid sequence motif of TNF, we identified a novel member of the TNF
family, named THANK, for TNF homologue that
activates apoptosis, NF- Identification, Cloning, Expression, and Purification of
THANK--
Using high throughput automated DNA sequence analysis of
randomly selected human cDNA clones, a data base containing more than 2 million ESTs obtained from over 750 different cDNA libraries has been generated by Human Genome Sciences, Inc. A specific homology and motif search using the known amino acid sequence motif of TNF
family members against this data base revealed several ESTs having
homology to members of the TNF family. One full-length cDNA clone
(HNEDU15) encoding an intact NH2-terminal signal peptide was isolated from a human neutrophil library and selected for further
investigation. The complete cDNA sequence of both strands of this
clone was determined, and its homology to TNF was confirmed. This gene
product was named THANK. THANK is a 285-amino acid-long type II
transmembrane protein. The transmembrane domain was found to be located
between amino acid residues 47 through 77 (Fig. 1A).
The cDNA encoding the extracellular domain of THANK (amino acids
78-285) was amplified employing the polymerase chain reaction technique using the following primers: 5' BamHI,
GCGGGATCCCAGCCTCCGGGCAGAGC and 3' XbaI,
GCGTCTAGATCACAGCACTTTCAATGC. The amplified fragment was purified,
digested with BamHI and Xbal I, and cloned into a
baculovirus expression vector pA2-GP, derived from pVL94. The cloning,
expression, and confirmation of the identity of the cloned product
were performed using standard techniques (18).
Recombinant THANK was purified from the clarified culture supernatant
of 92-h postinfected Sf9 cells. The protein was stepwise purified by cation and anion exchange chromatography. The purified THANK was analyzed for purity by 12% SDS-PAGE and by Western blot analysis.
Northern Blot Analysis--
Two multiple human tissue Northern
blots containing 2 µg of poly(A)+ RNA per lane of various
tissues (CLONTECH) were probed with
32P-labeled THANK cDNA. RNA from a selected panel of
human cell lines were probed following the same technique.
Production of THANK Antibodies--
Antibodies against THANK
were raised by injecting 0.2 mg of purified recombinant antigen in
Freund's complete adjuvant (Difco) subcutaneously into a rabbit. After
3 weeks, the injection was repeated, and the rabbit was bled every 3rd
week. The specificity of the antiserum was tested by enzyme-linked
immunosorbent assay and Western blot.
Receptor Binding Assay--
TNF receptor binding assay was
performed following a modified procedure described previously from our
laboratory (19). Briefly, 0.5 × 106 cells/well
(triplicate well) in 100 µl of binding medium (RPMI 1640 containing
10% fetal bovine serum) were incubated with 125I-labeled
TNF (2.5 × 105 cpm/well, specific activity 40 mCi/mg)
either alone (total binding) or in the presence of 20 nM
unlabeled TNF (nonspecific binding) or 150 nM unlabeled
THANK in an ice bath for 1 h. Thereafter, cells were washed three
times with ice-cold phosphate-buffered saline containing 0.1% bovine
serum albumin to remove unbound 125I-TNF. The cells were
dried at 80 °C, and the cell-bound radioactivity was determined in a
Electrophoretic Mobility Shift Assay (EMSA)--
NF- Western Blot of THANK--
Purified THANK sample was resolved on
12% SDS-PAGE, electrotransferred to a nitrocellulose membrane, and
probed with polyclonal antibodies (1:6000) raised in rabbits. The blot
was then treated with horseradish peroxidase-conjugated secondary
antibodies and finally detected by chemiluminescence (ECL, Amersham
Pharmacia Biotech).
c-Jun Kinase Assay--
The c-Jun kinase assay was performed by
a modified method as described earlier (22). Briefly, 100-µg
cytoplasmic extracts were treated with anti-JNK1 antibodies,
precipitated the immune complexes with protein A/G-Sepharose beads
(Pierce), and assayed for the enzymatic activity by using glutathione
S-transferase-Jun (amino acids 1-79) as substrate (2 µg)
in the presence of 10 µCi of [32P]ATP. The kinase
reaction was carried out by incubating the above mixture at 30 °C in
kinase assay buffer for 15 min. The reaction was stopped by adding SDS
sample buffer, followed by boiling. Finally, protein was resolved on a
9% acrylamide gel under reduced conditions. The radioactive bands of
the dried gel were visualized and quantitated by PhosphorImager as
mentioned previously. To determine the total amount of JNK1 protein, 30 µg of the cytoplasmic extracts were loaded on 9% acrylamide gels.
After electrophoresis, the protein was transferred to nitrocellulose
membranes, blocked with 5% non-fat milk protein, and probed with
rabbit polyclonal antibodies (1:3000) against JNK1. The blots were then
reacted with horseradish peroxidase-conjugated secondary antibodies and finally detected by chemiluminescence (ECL, Amersham Pharmacia Biotech).
Cytotoxicity Assays--
The cytotoxic effects of THANK against
tumor cells were measured by modified tetrazolium salt
(3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide) assay
described earlier (23) and by its ability to activate caspase-3 leading
to cleavage of poly(ADP-ribose) polymerase (PARP) (24). For
cytotoxicity, 5 × 103 cells in 0.1 ml were plated in
triplicate in 96-well plates and exposed to variable concentrations of
either THANK or TNF (for comparison) in 0.1 ml. After 72-h incubation
at 37 °C, cells were examined for viability. To estimate caspase-3
activation by PARP cleavage, cell extracts (50 µg/sample) were
resolved on 7.5% acrylamide gels, electrophoresed, transferred to
nitrocellulose membranes, blocked with 5% non-fat milk protein, probed
with PARP monoclonal antibody (1:3000), and detected by ECL as
indicated above.
Identification, Sequence, and Purification of THANK--
The
predicted amino acid sequence of mature THANK (112-285) is 15, 16, 18, and 19% identical to LIGHT, FasL, TNF, and LT- Tissue and Cell Line Distribution of THANK--
Northern blot
analysis indicated that THANK was expressed in peripheral blood
leukocytes, spleen, thymus, lung, placenta, small intestine, and
pancreas; with highest expression in peripheral blood leukocytes (Fig.
1D). Analysis of the cell line blot
(CLONTECH) revealed very high expression in HL60,
detectable expression in K562, A549, and G361, and no detectable
transcript in HeLa, MOLT4, Raji, and SW480 cell lines. Thus cells and
tissues of the immune system expressed THANK transcripts.
THANK Activates NF-
To ascertain that the observed activation was due to THANK and not a
contaminant, the protein was preincubated with anti-THANK polyclonal
antibodies before treatment with the cells. Fig. 2D shows a
lack of NF- THANK Activates c-Jun NH2-terminal Kinase--
The
activation of JNK is another early event that is initiated by different
members of the TNF family (17, 22). THANK activated JNK activity in a
time- and dose-dependent manner (Fig. 3, A and B). At 10 pM the activity increased by 2.5-fold and at 1 nM it reached 4.4-fold. An additional increase in THANK
concentration slightly decreased activation (Fig. 3A). The
peak activation of JNK was observed at 60 min (3.3-fold increase),
which gradually decreased thereafter (Fig. 3B). These
results suggest that, like TNF, THANK transiently activates JNK in U937
cells. The activation of JNK by THANK was not due to an increase in JNK
protein levels, as immunoblot analysis demonstrated comparable JNK1
expression at all dose and time points (Fig. 3, A and B,
lower panels).
THANK-induced Cytotoxicity and Caspase-3
Activation--
Activations of NF-
Degradation of PARP by caspase-3 is one of the hallmarks of apoptosis
in tumor cells (26). We found that treatment of U937 cells with THANK
for 2 h induced partial cleavage of PARP in U937 cells, whereas
TNF almost completely cleaved PARP under these conditions (Fig.
4B). This suggests that THANK can activate caspase-3, although not so strongly as TNF.
THANK Binds to Receptors Distinct from TNF
Receptors--
Previously we have shown that TNF and LT, which share
homology with each other to the same extent as THANK, bind to the same cell surface receptors (4). Since THANK has significant amino acid
sequence homology with TNF, and like TNF exhibits cytotoxic effects,
and activates NF-
In summary, we describe here the identification of a novel cytokine
expressed by hematopoietic cells that can, like TNF and LT- *
This work was supported by The Clayton Foundation for
Research.The costs of publication of this
article were defrayed in part by the
payment of page charges. The article
must therefore be hereby marked
"advertisement" in
accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
¶
These two authors share the senior authorship.
**
To whom correspondence should be addressed. Tel.: 713-792-3503 (or
6459); Fax: 713-794-1613; E-mail: aggarwal{at}utmdacc.mda.uth.tmc.edu.
The abbreviations used are:
TNF, tumor necrosis
factor;
NF-
COMMUNICATION
Identification and Characterization of a Novel Cytokine, THANK, a
TNF Homologue That Activates
Apoptosis, Nuclear Factor-
B, and c-Jun
NH2-Terminal Kinase*
,§,
, and
ABSTRACT
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS AND DISCUSSION
REFERENCES
,
FasL, and LIGHT, all members of the TNF family. The mRNA for THANK
was expressed at high levels by peripheral blood leukocytes, lymph node, spleen, and thymus and at low levels by small intestine, pancreas, placenta, and lungs. THANK was also prominently expressed in
hematopoietic cell lines. The recombinant purified protein expressed in
the baculovirus system had an approximate molecular size 20 kDa with
amino-terminal sequence of AVQGP. Treatment of human myeloid U937 cells
with purified THANK activated nuclear transcription factor-
B
(NF-B) consisting of p50 and p65. Activation was time- and
dose-dependent, beginning with as little as a 1 pM amount of the cytokines and as early as 15 min.
Under the same conditions, THANK also activated c-jun
NH2-terminal kinase (JNK) in U937 cells. THANK also
strongly suppressed the growth of tumor cell lines and activated
caspase-3. Although THANK had all the activities and potency of TNF, it
did not bind to the TNF receptors. Thus our results indicate that THANK
is a novel cytokine that belongs to the TNF family and activates
apoptosis, NF-B, and JNK through a distinct receptor.
INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS AND DISCUSSION
REFERENCES
1 and
TNF-
(also called lymphotoxin). Since then over 15 members of this
family have been identified, including FasL, CD27L, CD30L, CD40L,
OX-40L, 4-1BBL, LT-, TWEAK, TRAIL, RANKL/TRANCE, LIGHT, VEGI, and
APRIL (8-16). At the amino acid sequence level, various members of the
TNF family are 20-25% homologous to each other. Most members of this
family play an important role in gene activation, proliferation,
differentiation, and apoptosis. These ligands interact with the
corresponding receptor, also members of the TNF receptor family, and
activate the transcription factors NF-B and AP-1 (9, 17), a
stress-activated protein kinase (c-jun NH2-terminal protein
kinase, JNK), and a cascade of caspases.
B, and
JNK. We found that this cytokine was primarily expressed by
hematopoietic cells. The recombinant THANK activated NF-B, c-jun
NH2-terminal kinase, caspase-3, and displayed
antiproliferative effects in U937 cells through binding sites distinct
from those for TNF.
MATERIALS AND METHODS
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS AND DISCUSSION
REFERENCES
counter (Cobra-Auto Gamma, Packard Instrument Co.)
B
activation was analyzed by EMSA as described previously (20, 21). In
brief, 6-µg nuclear extracts prepared from THANK-treated cells were
incubated with 32P-end-labeled 45-mer double-stranded
NF-B oligonucleotide for 15 min at 37 °C and the DNA-protein
complex resolved in 7.5% native polyacrylamide gel. The specificity of
binding was examined by competition with unlabeled 100-fold excess
oligonucleotide. The specificity of binding was also determined by
supershift of the DNA-protein complex using specific and irrelevant
antibodies. The samples of supershift experiments were resolved on
5.5% native gels. The radioactive bands from dried gels were
visualized and quantitated by PhosphorImager (Molecular Dynamics,
Sunnyvale, CA) using ImageQuant software.
RESULTS AND DISCUSSION
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS AND DISCUSSION
REFERENCES
, respectively (Fig.
1A). The cDNA for this
novel cytokine was cloned and expressed in a baculovirus expression
system. In CM cellulose cation exchange chromatography, THANK eluted
first with 1 M NaCl (fraction A) and then with 1.5 M NaCl (fraction B). Fraction B had an approximate
molecular mass of 20 kDa on 12% SDS-PAGE with an amino-terminal
sequence starting at AVQGP, whereas fraction A contained an additional
peptide of 3 kDa with an amino-terminal sequence LKIFEPP (Fig.
1B). An apparently higher molecular size obtained by
SDS-PAGE than that predicted from the number of amino acids suggested a
post-translational modification. The amino acid sequence of the mature
THANK lacked, however, the potential N-glycosylation site.
Polyclonal antibodies prepared against THANK recognized the
cytokine on Western blot (Fig. 1C).
View larger version (50K):
[in a new window]
Fig. 1.
A, amino acid sequence of THANK and its
comparison with mature form of TNF, LT, FasL, and LIGHT. The
shaded area indicates homology with LT, TNF, FasL, and
LIGHT. B, SDS-PAGE analysis of THANK (fraction B).
C, Western blot analysis of THANK (fraction B).
D, tissue distribution of THANK mRNA. E,
expression of THANK mRNA by various cell lines. PBL,
peripheral blood leukocytes.
B--
One of the earliest events induced by
most members of the TNF superfamily is NF-B activation (25). The
results depicted in Fig. 2, A
and B, indicate that THANK activated NF-B in a dose- and
time-dependent manner. Less than 10 pM THANK
was enough to activate NF-B in U937 cells, although peak activation
was obtained at 1 nM. THANK induced optimum NF-B
activation within 60 min at 1 nM; and there was no
significant increase thereafter (Fig. 2B). The gel shift
band was specific, as its formation could be eliminated with excess
unlabeled oligonucleotide. It was supershifted by anti-p50 and anti-p65
antibodies only (Fig. 2C), thus indicating that the nuclear
factor was composed of p50 and p65 subunits. No significant difference
was found in the ability to activate NF-B between the 20- and 23-kDa
forms of THANK, indicating that residues 112 through 134 are optional
for the biological activity (data not shown).
View larger version (72K):
[in a new window]
Fig. 2.
A, dose response of THANK-induced
NF- B activation. U937 cells (2 × 106/ml) were
treated with different concentrations of THANK for 60 min at 37 °C
and then assayed for NF-B by EMSA. B, kinetics of NF-B
activation. U937 cells (2 × 106/ml) were treated with
1 nM of THANK for various lengths of time. C,
supershift and specificity of NF-B. Nuclear extract of THANK-treated
cells (lane 4) was incubated at room temperature for 60 min
with anti-p50 (lane 5), anti-p65 (lane 6),
mixture of anti-p50 and anti-p65 (lane 7), anti-c-Rel
(lane 8), anti-cyclin D1 (lane 9), preimmune
serum (lane 10), unlabeled NF-B oligonucleotide
(lane 2) and then assayed for NF-B. Lane 1 shows results for free probe, and lanes 3 and 4 show the THANK-untreated and -treated cells, respectively.
D, effect of anti-THANK polyclonal antibodies on
THANK-induced NF-B activation in U937 cells. THANK was preincubated
with anti-THANK antibodies at a dilution of 1:100 or 1:1000 before
cells were exposed. E, effect of trypsinization and heat
denaturation on the ability of THANK to activate NF-B in U937 cells.
THANK was treated with 0.25% trypsin at 37 °C for 60 min and then
checked for its ability to activate NF-B (lane 3). The
effect of trypsin alone is shown in lane 4. THANK was boiled
at 100 °C for 10 min and used for the activation of NF-B
(lane 5). Lanes 1 and 2 represent
NF-B activation for untreated and THANK-treated U937 cells,
respectively.
B activation after treatment of THANK with antibodies
even at a 1 to 1000 dilution. Antibody against THANK by itself had no
effect. To further ascertain that NF-B activation was due to the
proteinaceous nature of THANK, the protein was either digested with
trypsin or heat-denatured prior to treatment. Both treatments
completely abolished NF-B activation in U937 cells, confirming that
THANK was responsible for this activation (Fig. 2E).
Although THANK was as potent as TNF with respect to both dose and time
required for NF-B activation, the overall amplitude of response was
less with THANK. In this respect the activity of THANK was comparable
with LT- (21).
View larger version (43K):
[in a new window]
Fig. 3.
A, dose response of THANK-induced JNK
activation. U937 cells (2 × 106/ml) were treated with
different concentrations of THANK for 1 h at 37 °C and assayed
for JNK activation as described under "Materials and Methods." The
lower panel shows equal loading of protein. B,
kinetics of THANK-induced activation of JNK. U937 cells (2 × 106/ml) were treated with 1 nM THANK for the
indicated time period and assayed for JNK activation. The lower
panel shows equal loading of protein. GST, glutathione
S-transferase.
B and JNK are early cellular
responses to TNF, which are followed by cytotoxic effects to tumor
cells. The effect of different concentrations of THANK on the cytotoxic effects against tumor cell lines was examined and compared with that of
TNF. Results in Fig. 4A show
that THANK inhibited the growth of human histiocytic lymphoma U937
cells in a dose-dependent manner. Besides U937, THANK also
inhibited the growth of prostate cancer (PC-3), colon cancer (HT-29),
cervical carcinoma (HeLa), breast carcinoma (MCF-7), and embryonic
kidney cells (A293) (data not shown). The growth inhibition curve of
THANK was superimposable with that of TNF, indicating comparable
potency.
View larger version (30K):
[in a new window]
Fig. 4.
A, dose-dependent cytotoxic
effects of THANK against U937 cells. 5 × 103
cells/well were incubated in triplicate with various concentrations of
THANK or TNF and then examined for cell viability after 72 h.
Untreated control is expressed as 100%. B, THANK-induced
cleavage of PARP in U937 cells. U937 cells (2 × 106
cells/ml) were treated with 0.1, 1, and 10 nM THANK in the
presence of cycloheximide (10 µg/ml) for 2 h at 37 °C. In
order to compare the cleavage, TNF was used as a positive control.
C, competitive inhibition of labeled TNF binding to U937
cells by unlabeled TNF (20 nM) and THANK (150 nM). U937 cells (0.5 × 106 cells/well)
were incubated with 0.25 × 106 cpm of
125I-TNF in an ice bath for 1 h in the presence or
absence of the unlabeled competitors. Cell-bound radioactivity was
measured in a counter. Results are expressed as mean ± S.D.
B and JNK, we examined its binding to the TNF
receptor. The receptor binding results (Fig. 4C) show that
20 nM unlabeled TNF almost completely blocked the binding of 125I-labeled TNF to U937 cells, whereas 150 nM unlabeled THANK did not compete for 125I-TNF
binding sites. These results suggest that THANK interacts with U937
cells through a receptor distinct from that for TNF.
,
activate NF-B and JNK and inhibit the growth of a wide variety of
tumor cells. Although the structure of THANK also exhibits homology to
FasL and LIGHT, the latter have not been reported to activate NF-B.
Our preliminary results by using flow cytometry indicate that THANK
protein is expressed by promyelomonocytic HL-60 cells (data not shown).
Because THANK is expressed by hematopoietic cells, it appears to be
similar to LT- and dissimilar from other members of the TNF
superfamily. Among all the members of the TNF superfamily, THANK
exhibits cytotoxic effects similar to TNF and LT-. Whether THANK
exhibits immunomodulatory activities and in vivo antitumor
activities is currently under investigation.
FOOTNOTES
These two authors share the first authorship.
Present address: Mendel Biotechnology, Inc., 21375 Cabot
Blvd., Hayward, CA 94545.
ABBREVIATIONS
B, nuclear transcription factor-B;
EMSA, electrophoretic mobility shift assay;
AP-1, activator protein 1;
JNK, NH2-terminal c-Jun kinase;
PARP, poly(ADP-ribose)
polymerase;
EST, expressed sequence tag;
PAGE, polyacrylamide gel
electrophoresis.
REFERENCES
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS AND DISCUSSION
REFERENCES
Copyright © 1999 by The American Society for Biochemistry and Molecular Biology, Inc.
CiteULike 
Complore 
Connotea 
Del.icio.us 
Digg 
Reddit 
Technorati What's this?
This article has been cited by other articles:
|
|
 |
|
  G. Hardenberg, L. Fernandez, J. Hendriks, K. Chebli, C. Jacquet, M. Sitbon, M. Hahne, and J. P. Medema APRIL facilitates viral-induced erythroleukemia but is dispensable for T cell immunity and lymphomagenesis J. Leukoc. Biol., August 1, 2008; 84(2): 380 - 388. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 D T La, C E Collins, H-T Yang, T-S Migone, and W Stohl B lymphocyte stimulator expression in patients with rheumatoid arthritis treated with tumour necrosis factor {alpha} antagonists: differential effects between good and poor clinical responders Ann Rheum Dis, August 1, 2008; 67(8): 1132 - 1138. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 W. Stohl, N. Jacob, W. J. Quinn III, M. P. Cancro, H. Gao, C. Putterman, X. Gao, L. Pricop, and M. N. Koss Global T Cell Dysregulation in Non-Autoimmune-Prone Mice Promotes Rapid Development of BAFF-Independent, Systemic Lupus Erythematosus-Like Autoimmunity J. Immunol., July 1, 2008; 181(1): 833 - 841. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 G. Badr, G. Borhis, E. A. Lefevre, N. Chaoul, F. Deshayes, V. Dessirier, G. Lapree, A. Tsapis, and Y. Richard BAFF enhances chemotaxis of primary human B cells: a particular synergy between BAFF and CXCL13 on memory B cells Blood, March 1, 2008; 111(5): 2744 - 2754. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. C. Ryan, M. Hering, D. Peckham, C. F. McDonagh, L. Brown, K. M. Kim, D. L. Meyer, R. F. Zabinski, I. S. Grewal, and P. J. Carter Antibody targeting of B-cell maturation antigen on malignant plasma cells Mol. Cancer Ther., November 1, 2007; 6(11): 3009 - 3018. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 S. Morimoto, S. Nakano, T. Watanabe, Y. Tamayama, A. Mitsuo, Y. Nakiri, J. Suzuki, K. Nozawa, H. Amano, Y. Tokano, et al. Expression of B-cell activating factor of the tumour necrosis factor family (BAFF) in T cells in active systemic lupus erythematosus: the role of BAFF in T cell-dependent B cell pathogenic autoantibody production Rheumatology, July 1, 2007; 46(7): 1083 - 1086. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
R. Nimmanapalli, M.-A. Lyu, M. Du, M. J. Keating, M. G. Rosenblum, and V. Gandhi The growth factor fusion construct containing B-lymphocyte stimulator (BLyS) and the toxin rGel induces apoptosis specifically in BAFF-R-positive CLL cells Blood, March 15, 2007; 109(6): 2557 - 2564. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
C. O. Jacob, L. Pricop, C. Putterman, M. N. Koss, Y. Liu, M. Kollaros, S. A. Bixler, C. M. Ambrose, M. L. Scott, and W. Stohl Paucity of Clinical Disease despite Serological Autoimmunity and Kidney Pathology in Lupus-Prone New Zealand Mixed 2328 Mice Deficient in BAFF J. Immunol., August 15, 2006; 177(4): 2671 - 2680. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 K. Yoshimoto, Y. Takahashi, M. Ogasawara, Y. Setoyama, K. Suzuki, K. Tsuzaka, T. Abe, and T. Takeuchi Aberrant expression of BAFF in T cells of systemic lupus erythematosus, which is recapitulated by a human T cell line, Loucy Int. Immunol., July 1, 2006; 18(7): 1189 - 1196. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 W. G. Halpern, P. Lappin, T. Zanardi, W. Cai, M. Corcoran, J. Zhong, and K. P. Baker Chronic Administration of Belimumab, a BLyS Antagonist, Decreases Tissue and Peripheral Blood B-Lymphocyte Populations in Cynomolgus Monkeys: Pharmacokinetic, Pharmacodynamic, and Toxicologic Effects Toxicol. Sci., June 1, 2006; 91(2): 586 - 599. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. P. Miller, J. E. Stadanlick, and M. P. Cancro Space, Selection, and Surveillance: Setting Boundaries with BLyS. J. Immunol., June 1, 2006; 176(11): 6405 - 6410. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
L. Fu, Y.-C. Lin-Lee, L. V. Pham, A. Tamayo, L. Yoshimura, and R. J. Ford Constitutive NF-{kappa}B and NFAT activation leads to stimulation of the BLyS survival pathway in aggressive B-cell lymphomas Blood, June 1, 2006; 107(11): 4540 - 4548. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
D. Bischof, S. F. Elsawa, G. Mantchev, J. Yoon, G. E. Michels, A. Nilson, S. L. Sutor, J. L. Platt, S. M. Ansell, G. von Bulow, et al. Selective activation of TACI by syndecan-2 Blood, April 15, 2006; 107(8): 3235 - 3242. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 A. J. Novak, D. M. Grote, S. C. Ziesmer, M. P. Kline, M. K. Manske, S. Slager, T. E. Witzig, T. Shanafelt, T. G. Call, N. E. Kay, et al. Elevated Serum B-Lymphocyte Stimulator Levels in Patients With Familial Lymphoproliferative Disorders J. Clin. Oncol., February 20, 2006; 24(6): 983 - 987. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 Y. Vugmeyster, D. Seshasayee, W. Chang, A. Storn, K. Howell, S. Sa, T. Nelson, F. Martin, I. Grewal, E. Gilkerson, et al. A Soluble BAFF Antagonist, BR3-Fc, Decreases Peripheral Blood B Cells and Lymphoid Tissue Marginal Zone and Follicular B Cells in Cynomolgus Monkeys Am. J. Pathol., February 1, 2006; 168(2): 476 - 489. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
Y. Zheng, S. Gallucci, J. P. Gaughan, J. A. Gross, and M. Monestier A Role for B Cell-Activating Factor of the TNF Family in Chemically Induced Autoimmunity J. Immunol., November 1, 2005; 175(9): 6163 - 6168. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M Schaller, W Stohl, S M Tan, V M Benoit, D M Hilbert, and H J Ditzel Raised levels of anti-glucose-6-phosphate isomerase IgG in serum and synovial fluid from patients with inflammatory arthritis Ann Rheum Dis, May 1, 2005; 64(5): 743 - 749. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
D. Gatto, C. Ruedl, B. Odermatt, and M. F. Bachmann Rapid Response of Marginal Zone B Cells to Viral Particles J. Immunol., October 1, 2004; 173(7): 4308 - 4316. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
W Stohl, S Metyas, S-M Tan, G S Cheema, B Oamar, V Roschke, Y Wu, K P Baker, and D M Hilbert Inverse association between circulating APRIL levels and serological and clinical disease activity in patients with systemic lupus erythematosus Ann Rheum Dis, September 1, 2004; 63(9): 1096 - 1103. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. Shulga-Morskaya, M. Dobles, M. E. Walsh, L. G. Ng, F. MacKay, S. P. Rao, S. L. Kalled, and M. L. Scott B Cell-Activating Factor Belonging to the TNF Family Acts through Separate Receptors to Support B Cell Survival and T Cell-Independent Antibody Formation J. Immunol., August 15, 2004; 173(4): 2331 - 2341. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 G. Chen, S. Peng, M. Zou, H. Xu, D. Xu, and J. Wang Construction and Function of Two Cys146-Mutants with High Activity, Derived from Recombinant Human Soluble B Lymphocyte Stimulator J. Biochem., July 1, 2004; 136(1): 73 - 79. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 W Stohl A therapeutic role for BLyS antagonists Lupus, May 1, 2004; 13(5): 317 - 322. [Abstract] [PDF]
|
|
|
|
|
|
J. Moreaux, E. Legouffe, E. Jourdan, P. Quittet, T. Reme, C. Lugagne, P. Moine, J.-F. Rossi, B. Klein, and K. Tarte BAFF and APRIL protect myeloma cells from apoptosis induced by interleukin 6 deprivation and dexamethasone Blood, April 15, 2004; 103(8): 3148 - 3157. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
B. Huard, L. Arlettaz, C. Ambrose, V. Kindler, D. Mauri, E. Roosnek, J. Tschopp, P. Schneider, and L. E. French BAFF production by antigen-presenting cells provides T cell co-stimulation Int. Immunol., March 1, 2004; 16(3): 467 - 475. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 E. Varfolomeev, F. Kischkel, F. Martin, D. Seshasayee, H. Wang, D. Lawrence, C. Olsson, L. Tom, S. Erickson, D. French, et al. APRIL-Deficient Mice Have Normal Immune System Development Mol. Cell. Biol., February 1, 2004; 24(3): 997 - 1006. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
C. Kern, J.-F. Cornuel, C. Billard, R. Tang, D. Rouillard, V. Stenou, T. Defrance, F. Ajchenbaum-Cymbalista, P.-Y. Simonin, S. Feldblum, et al. Involvement of BAFF and APRIL in the resistance to apoptosis of B-CLL through an autocrine pathway Blood, January 15, 2004; 103(2): 679 - 688. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. J. Novak, J. R. Darce, B. K. Arendt, B. Harder, K. Henderson, W. Kindsvogel, J. A. Gross, P. R. Greipp, and D. F. Jelinek Expression of BCMA, TACI, and BAFF-R in multiple myeloma: a mechanism for growth and survival Blood, January 15, 2004; 103(2): 689 - 694. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
K. Schneider, S. Kothlow, P. Schneider, A. Tardivel, T. Gobel, B. Kaspers, and P. Staeheli Chicken BAFF--a highly conserved cytokine that mediates B cell survival Int. Immunol., January 1, 2004; 16(1): 139 - 148. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
F Melchers Actions of BAFF in B cell maturation and its effects on the development of autoimmune disease Ann Rheum Dis, November 1, 2003; 62(90002): ii25 - 27. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 Z. SM. Rahman, S. P. Rao, S. L. Kalled, and T. Manser Normal Induction but Attenuated Progression of Germinal Center Responses in BAFF and BAFF-R Signaling-Deficient Mice J. Exp. Med., October 20, 2003; 198(8): 1157 - 1169. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
L. Gorelik, K. Gilbride, M. Dobles, S. L. Kalled, D. Zandman, and M. L. Scott Normal B Cell Homeostasis Requires B Cell Activation Factor Production by Radiation-resistant Cells J. Exp. Med., September 15, 2003; 198(6): 937 - 945. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. Pelletier, J. S. Thompson, F. Qian, S. A. Bixler, D. Gong, T. Cachero, K. Gilbride, E. Day, M. Zafari, C. Benjamin, et al. Comparison of Soluble Decoy IgG Fusion Proteins of BAFF-R and BCMA as Antagonists for BAFF J. Biol. Chem., August 29, 2003; 278(35): 33127 - 33133. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
K. A. Vora, L. C. Wang, S. P. Rao, Z.-Y. Liu, G. R. Majeau, A. H. Cutler, P. S. Hochman, M. L. Scott, and S. L. Kalled Cutting Edge: Germinal Centers Formed in the Absence of B Cell-Activating Factor Belonging to the TNF Family Exhibit Impaired Maturation and Function J. Immunol., July 15, 2003; 171(2): 547 - 551. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. Wu, L.-G. Xu, Z. Zhai, and H.-B. Shu SINK Is a p65-interacting Negative Regulator of NF-{kappa}B-dependent Transcription J. Biol. Chem., July 11, 2003; 278(29): 27072 - 27079. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
T. A. Phillips, J. Ni, and J. S. Hunt Cell-specific expression of B lymphocyte (APRIL, BLyS)- and Th2 (CD30L/CD153)-promoting tumor necrosis factor superfamily ligands in human placentas J. Leukoc. Biol., July 1, 2003; 74(1): 81 - 87. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. Craxton, D. Magaletti, E. J. Ryan, and E. A. Clark Macrophage- and dendritic cell--dependent regulation of human B-cell proliferation requires the TNF family ligand BAFF Blood, June 1, 2003; 101(11): 4464 - 4471. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 T. A. Riccobene, R. C. Miceli, C. Lincoln, Y. Knight, J. Meadows, M. G. Stabin, and C. Sung Rapid and Specific Targeting of 125I-Labeled B Lymphocyte Stimulator to Lymphoid Tissues and B Cell Tumors in Mice J. Nucl. Med., March 1, 2003; 44(3): 422 - 433. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
D. J. Buchsbaum and A. F. LoBuglio Targeting of 125I-Labeled B Lymphocyte Stimulator J. Nucl. Med., March 1, 2003; 44(3): 434 - 436. [Full Text] [PDF]
|
|
|
|
|
|
C. S. Schmidt, J. Liu, T. Zhang, H. Y. Song, G. Sandusky, K. Mintze, R. J. Benschop, A. Glasebrook, D. D. Yang, and S. Na Enhanced B Cell Expansion, Survival, and Humoral Responses by Targeting Death Receptor 6 J. Exp. Med., January 6, 2003; 197(1): 51 - 62. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. J. Keating, N. Chiorazzi, B. Messmer, R. N. Damle, S. L. Allen, K. R. Rai, M. Ferrarini, and T. J. Kipps Biology and Treatment of Chronic Lymphocytic Leukemia Hematology, January 1, 2003; 2003(1): 153 - 175. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
L.-G. Xu and H.-B. Shu TNFR-Associated Factor-3 Is Associated With BAFF-R and Negatively Regulates BAFF-R-Mediated NF-{kappa}B Activation and IL-10 Production J. Immunol., December 15, 2002; 169(12): 6883 - 6889. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
V. Roschke, S. Sosnovtseva, C. D. Ward, J. S. Hong, R. Smith, V. Albert, W. Stohl, K. P. Baker, S. Ullrich, B. Nardelli, et al. BLyS and APRIL Form Biologically Active Heterotrimers That Are Expressed in Patients with Systemic Immune-Based Rheumatic Diseases J. Immunol., October 15, 2002; 169(8): 4314 - 4321. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. J. Novak, R. J. Bram, N. E. Kay, and D. F. Jelinek Aberrant expression of B-lymphocyte stimulator by B chronic lymphocytic leukemia cells: a mechanism for survival Blood, September 26, 2002; 100(8): 2973 - 2979. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
L.-G. Xu, M. Wu, J. Hu, Z. Zhai, and H.-B. Shu Identification of downstream genes up-regulated by the tumor necrosis factor family member TALL-1 J. Leukoc. Biol., August 1, 2002; 72(2): 410 - 416. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
B. Huard, P. Schneider, D. Mauri, J. Tschopp, and L. E. French T Cell Costimulation by the TNF Ligand BAFF J. Immunol., December 1, 2001; 167(11): 6225 - 6231. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
I. I. Kuzin, J. E. Snyder, G. D. Ugine, D. Wu, S. Lee, T. Bushnell Jr, R. A. Insel, F. M. Young, and A. Bottaro Tetracyclines inhibit activated B cell function Int. Immunol., July 1, 2001; 13(7): 921 - 931. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. Ishikawa, T. Sato, M. Abe, S. Nagai, N. Onai, H. Yoneyama, Y.-y. Zhang, T. Suzuki, S.-i. Hashimoto, T. Shirai, et al. Aberrant High Expression of B Lymphocyte Chemokine (BLC/CXCL13) by C11b+CD11c+ Dendritic Cells in Murine Lupus and Preferential Chemotaxis of B1 Cells Towards BLC J. Exp. Med., June 18, 2001; 193(12): 1393 - 1402. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. Xu and K.-P. Lam B-Cell Maturation Protein, Which Binds the Tumor Necrosis Factor Family Members BAFF and APRIL, Is Dispensable for Humoral Immune Responses Mol. Cell. Biol., June 15, 2001; 21(12): 4067 - 4074. [Abstract] [Full Text]
|
|
|
|
 |
|
 T. J. Parry, T. A. Riccobene, S. J. Strawn, R. Williams, R. Daoud, J. Carrell, S. Sosnovtseva, R. C. Miceli, C. M. Poortman, L. Sekut, et al. Pharmacokinetics and Immunological Effects of Exogenously Administered Recombinant Human B Lymphocyte Stimulator (BLyS) in Mice J. Pharmacol. Exp. Ther., April 13, 2001; 296(2): 396 - 404. [Abstract] [Full Text]
|
|
|
|
|
|
J. Zhang, V. Roschke, K. P. Baker, Z. Wang, G. S. Alarcon, B. J. Fessler, H. Bastian, R. P. Kimberly, and T. Zhou Cutting Edge: A Role for B Lymphocyte Stimulator in Systemic Lupus Erythematosus J. Immunol., January 1, 2001; 166(1): 6 - 10. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
B. Nardelli, O. Belvedere, V. Roschke, P. A. Moore, H. S. Olsen, T. S. Migone, S. Sosnovtseva, J. A. Carrell, P. Feng, J. G. Giri, et al. Synthesis and release of B-lymphocyte stimulator from myeloid cells Blood, January 1, 2001; 97(1): 198 - 204. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
C. F. Ware APRIL and BAFF Connect Autoimmunity and Cancer J. Exp. Med., December 4, 2000; 192(11): F35 - F38. [Full Text] [PDF]
|
|
|
|
|
|
M. Batten, J. Groom, T. G. Cachero, F. Qian, P. Schneider, J. Tschopp, J. L. Browning, and F. Mackay BAFF Mediates Survival of Peripheral Immature B Lymphocytes J. Exp. Med., November 20, 2000; 192(10): 1453 - 1466. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
R. K.G. Do, E. Hatada, H. Lee, M. R. Tourigny, D. Hilbert, and S. Chen-Kiang Attenuation of Apoptosis Underlies B Lymphocyte Stimulator Enhancement of Humoral Immune Response J. Exp. Med., September 25, 2000; 192(7): 953 - 964. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 H.-B. Shu and H. Johnson B cell maturation protein is a receptor for the tumor necrosis factor family member TALL-1 PNAS, July 19, 2000; (2000) 160213497. [Abstract] [Full Text]
|
|
|
|
|
|
J. S. Thompson, P. Schneider, S. L. Kalled, L. Wang, E. A. Lefevre, T. G. Cachero, F. MacKay, S. A. Bixler, M. Zafari, Z.-Y. Liu, et al. BAFF Binds to the Tumor Necrosis Factor Receptor-like Molecule B Cell Maturation Antigen and Is Important for Maintaining the Peripheral B Cell Population J. Exp. Med., July 3, 2000; 192(1): 129 - 136. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
X.-Z. Xia, J. Treanor, G. Senaldi, S. D. Khare, T. Boone, M. Kelley, L. E. Theill, A. Colombero, I. Solovyev, F. Lee, et al. TACI Is a TRAF-interacting Receptor for TALL-1, a Tumor Necrosis Factor Family Member Involved in B Cell Regulation J. Exp. Med., July 3, 2000; 192(1): 137 - 144. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. T. Eby, A. Jasmin, A. Kumar, K. Sharma, and P. M. Chaudhary TAJ, a Novel Member of the Tumor Necrosis Factor Receptor Family, Activates the c-Jun N-terminal Kinase Pathway and Mediates Caspase-independent Cell Death J. Biol. Chem., May 12, 2000; 275(20): 15336 - 15342. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
F. Mackay, S. A. Woodcock, P. Lawton, C. Ambrose, M. Baetscher, P. Schneider, J. Tschopp, and J. L. Browning Mice Transgenic for BAFF Develop Lymphocytic Disorders Along with Autoimmune Manifestations J. Exp. Med., December 6, 1999; 190(11): 1697 - 1710. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 B. Schiemann, J. L. Gommerman, K. Vora, T. G. Cachero, S. Shulga-Morskaya, M. Dobles, E. Frew, and M. L. Scott An Essential Role for BAFF in the Normal Development of B Cells Through a BCMA-Independent Pathway Science, September 14, 2001; 293(5537): 2111 - 2114. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. S. Thompson, S. A. Bixler, F. Qian, K. Vora, M. L. Scott, T. G. Cachero, C. Hession, P. Schneider, I. D. Sizing, C. Mullen, et al. BAFF-R, a Newly Identified TNF Receptor That Specifically Interacts with BAFF Science, September 14, 2001; 293(5537): 2108 - 2111. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M.-C. Chen, T.-L. Hsu, T.-Y. Luh, and S.-L. Hsieh Overexpression of Bcl-2 Enhances LIGHT- and Interferon-gamma -mediated Apoptosis in Hep3BT2 Cells J. Biol. Chem., December 1, 2000; 275(49): 38794 - 38801. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
Y. Wu, D. Bressette, J. A. Carrell, T. Kaufman, P. Feng, K. Taylor, Y. Gan, Y. H. Cho, A. D. Garcia, E. Gollatz, et al. Tumor Necrosis Factor (TNF) Receptor Superfamily Member TACI Is a High Affinity Receptor for TNF Family Members APRIL and BLyS J. Biol. Chem., November 3, 2000; 275(45): 35478 - 35485. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. D. Khare, I. Sarosi, X.-Z. Xia, S. McCabe, K. Miner, I. Solovyev, N. Hawkins, M. Kelley, D. Chang, G. Van, et al. Severe B cell hyperplasia and autoimmune disease in TALL-1 transgenic mice PNAS, March 28, 2000; 97(7): 3370 - 3375. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
H.-B. Shu and H. Johnson B cell maturation protein is a receptor for the tumor necrosis factor family member TALL-1 PNAS, August 1, 2000; 97(16): 9156 - 9161. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| All ASBMB Journals | Molecular and Cellular Proteomics |
| Journal of Lipid Research | ASBMB Today |