![]()
|
|
||||||||
J Biol Chem, Vol. 274, Issue 23, 16304-16310, June 4, 1999
From the Department of Molecular Biology, Sciences II, University
of Geneva, 30, Quai Ernest-Ansermet,
CH-1211 Geneva 4, Switzerland
Nek2 is a human cell cycle-regulated kinase that
is structurally related to the mitotic regulator, NIMA, of
Aspergillus nidulans. Localization studies have shown that
Nek2 is a core component of the centrosome, the microtubule organizing
center of the cell, and functional approaches suggest a possible role
for Nek2 in centrosome separation at the G2/M transition.
Here, we have investigated the importance of an unusual leucine zipper
coiled-coil motif present in the C-terminal noncatalytic domain of the
Nek2 kinase. Glycerol gradient centrifugation indicated that endogenous
Nek2 is present in HeLa cells as a salt-resistant 6 S complex, the predicted size of a Nek2 homodimer. Recombinant Nek2 overexpressed in
insect cells also formed a 6 S complex, whereas a Nek2 mutant specifically lacking the leucine zipper motif was monomeric. Using yeast two-hybrid interaction analyses and coprecipitation assays, we
found that Nek2 can indeed form homodimers both in vivo and in vitro and that this dimerization specifically required
the leucine zipper motif. Moreover, deletion of the leucine zipper prevented a trans-autophosphorylation reaction on the C-terminal domain
of Nek2 and strongly reduced Nek2 kinase activity on exogenous substrates. Finally, we emphasize that the Nek2 leucine zipper described here differs from classical leucine zippers in that it
exhibits a radically different arrangement of hydrophobic and charged
amino acids. Thus, this study reveals not only an important mechanism
for the regulation of the Nek2 kinase but, furthermore, highlights an
unusual organization of a leucine zipper dimerization motif.
Human Nek2 belongs to a family of serine/threonine protein kinases
structurally related to the NIMA mitotic regulator of the filamentous
fungus, Aspergillus nidulans. NIMA is the product of a gene
that, when mutated, leads to a block of cells in the G2
phase of the cell cycle and, when overexpressed, drives cells into a
premature mitosis from any point in the cell cycle (1, 2). However, as
physiological substrates of NIMA remain to be identified, the precise
mechanism by which NIMA contributes to promote mitosis is unknown.
Proteins related to Aspergillus NIMA have been found in a
broad variety of species including yeast, trypanosomes, flies, and
mammals (reviewed in Ref. 3). In humans, at least six
NIMA-related kinases or "Neks"
have so far been isolated as full-length or partial sequences (4-7),
and it is possible that these may function in different stages of the
cell cycle or in different tissues. To date, the closest mammalian
relative of NIMA is Nek2 (5). Activity measurements indicate that Nek2 is a cell cycle-regulated kinase with maximal activity in S and G2 phases of the cell cycle (8). Moreover, expression
studies reveal that Nek2 is most abundant in meiotic, as well as
mitotic, tissues (9-11), strengthening the hypothesis that Nek2, like
NIMA, has a function in cell cycle progression.
Recent work has revealed a potential role for Nek2 at the centrosome,
the major microtubule-organizing center of the cell (12). Subcellular
localization studies indicate that Nek2 is a core component of the
centrosome, in that its centrosomal localization is independent of
microtubules. Moreover, ectopic expression of active, but not inactive,
Nek2 kinase in human tissue culture cells induces a striking splitting
of the two centrosomes, raising the possibility that Nek2 might
normally function to promote the separation of centrosomes at the
G2 to M transition that is necessary for formation of a
bipolar mitotic spindle (12). In particular, Nek2 activity might induce
the dissolution or degradation of components that are required for
cohesion of the two centrosomes during interphase. Intriguingly, a
novel component of the centrosome has been identified through
interaction with Nek2 that displays several properties of a protein
predicted to be involved in centrosome-centrosome cohesion (13). This
protein, called C-Nap1, for centrosomal Nek2-associated protein
1, is a high molecular weight protein with extensive
coiled-coil domains and most likely functions as a structural component
of the centrosome. The C-terminal domain of C-Nap1 can be
phosphorylated by Nek2 both in vitro and in vivo, suggesting that C-Nap1 is a bona fide centrosomal substrate of the Nek2
kinase. Finally, in support of a model implicating C-Nap1 in
centrosome-centrosome cohesion, C-Nap1was found to be present within interphase centrosomes but absent from mitotic spindle poles
(13).
Although the identification of C-Nap1 provides a first step toward
understanding what events might be downstream of the Nek2 kinase,
virtually nothing is known about upstream events, i.e. how
the kinase itself is regulated. Nek2 is maximally active in S and
G2, and this level of activity reflects the amount of Nek2 protein present through the different stages of the cell cycle (8).
Hence, one mode of regulation is likely to occur at the level of
protein abundance by means of either regulated
transcription/translation or protein turnover. Equally, Nek2, like
other protein kinases, may be regulated through protein-protein complex
formation. Cyclin-dependent kinases, for example, are so
named because of their absolute dependence upon stoichiometric complex
formation with regulatory cyclin subunits. Protein interactions can
regulate kinase activity in many ways including the following: (i)
allosteric modulation of the kinase domain structure, (ii) blocking the
interaction of a kinase inhibitor, (iii) targeting the kinase directly
to its substrates, or (iv) targeting the kinase to the correct location
in the cell.
As a means to study the regulation of the Nek2 kinase, we set out to
look for complexes of Nek2 that may indicate potential regulatory
partners. In the course of these studies, we discovered that soluble
Nek2 exists in cells as a highly stable homodimer and that
homodimerization is dependent upon a leucine zipper coiled-coil motif
present in the C-terminal noncatalytic domain of Nek2. We found that
dimerization is necessary both for a trans-autophosphorylation reaction
and for Nek2 kinase activity on exogenous substrates. Finally, we
emphasize that the Nek2 leucine zipper has a strikingly unusual
arrangement of amino acids. This highlights the sequence flexibility
that is tolerated within this particular class of dimerization motifs.
Cell Culture and Transfections--
Human cells were grown at
37 °C in a 7% CO2 atmosphere in Dulbecco's modified
Eagle's medium supplemented with heat-inactivated serum and
penicillin/streptomycin (100 IU/ml and 100 µg/ml, respectively). HeLa
epithelial cells were supplemented with 5% fetal calf serum and U2OS
osteosarcoma cells with 10% fetal calf serum. Sf9 insect cells
were grown in TC100 medium (Life Technologies, Inc.) and supplemented
with 10% heat-inactivated fetal calf serum and penicillin-streptomycin at 27 °C. For transient transfection studies, U2OS cells were seeded
onto HCl-treated glass coverslips at a density of 1 × 105 cells/35-mm dish and transfected with 10 µg of
plasmid DNA using calcium phosphate precipitates as described
previously (14). Cells were fixed after 24 h and analyzed by indirect
immunofluorescence microscopy.
Glycerol Gradients and Western Blots--
Cell extracts were
prepared from 108 exponentially growing HeLa cells or
107 Sf9 insect cells infected with different Nek2
baculoviruses (48 h postinfection). For this purpose, both floating and
adherent cells were harvested, washed once in 1 ml of ice-cold
PBS1 + 1 mM
phenylmethylsulfonyl fluoride, and resuspended in 0.5 ml of gradient
buffer (50 mM Hepes, pH 7.4, 1 mM
dithiothreitol, 0.1% Nonidet P-40, 50 or 500 mM NaCl, 5 mM EDTA, 5 mM MnCl2, 1 mM phenylmethylsulfonyl fluoride, 10 µg/ml leupeptin, 10 µg/ml pepstatin A, 50 µg/ml chymostatin, 1/100 aprotinin). Samples
were left on ice for 30 min, passed 10 times through a 27-gauge needle, and centrifuged at 10,000 × g for 10 min (4 °C).
Protein concentrations were measured using a Bio-Rad protein
determination reagent. Cell extracts (1 mg of total protein) were
loaded on the top of a 10-ml 15-50% glycerol gradient (containing 20 mM Hepes, pH 7.4, 50 or 500 mM NaCl, 0.2 mM EDTA) and spun at 40,000 rpm, 4 °C for 24 h in a
Beckman SW 40 ultracentrifuge rotor. 400-µl fractions were collected
from the top of the gradient and analyzed by Western blotting for Nek2
proteins. 100 µg of chymotrypsin (25 kDa), bovine serum albumin (67 kDa, 4.3 S), aldolase (158 kDa, 7.4 S), and catalase (232 kDa, 11.3 S)
were centrifuged at the same time on equivalent glycerol gradients to
determine the separation of different molecular weight complexes. The
position of marker proteins in different fractions was determined by
silver staining of SDS-polyacrylamide gel electrophoresis. Western
blots were performed by transfer of proteins onto nitrocellulose using
a Hoefer SemiDry blotting apparatus. As primary anti-Nek2 antibodies,
we used either affinity-purified R40 antibodies (12) or an
affinity-purified antipeptide antibody raised against residues 278-299
of human Nek2 by Zymed Laboratories Inc. (South San
Francisco, CA). Both antibodies were used at 1.0 µg/ml. Blots were
developed by enhanced chemiluminescence (ECL) (Amersham Pharmacia Biotech).
Plasmid and Baculovirus Constructions--
To generate the
leucine zipper deletion mutant, pGEM-Nek2 Yeast Two-hybrid Interaction Assays--
Parent plasmids, pAS2
and pACT2, and the yeast strain, Y190, for two-hybrid interaction
assays were kindly provided by S. Elledge (Baylor College, Houston,
TX), and interaction analyses by histidine auxotrophy selection and
In Vitro Translation, Immunoprecipitation, and Protein Kinase
Assays--
Nek2 constructs were translated in vitro using
the TnT-coupled transcription/translation kit in the presence of
[35S]methionine/cysteine
(Expre35S35S, NEN Life Science Products)
according to manufacturer's instructions (Promega Corp.). For
coprecipitation experiments, reticulocyte lysates were first incubated
separately for 60 min and then together for 60 min at 30 °C.
Immunoprecipitation of Nek2 proteins and in vitro kinase
assays was carried out exactly as described by Fry and Nigg (3).
Samples were then processed on 12% SDS-polyacrylamide gels, and the
gels were dried and exposed to x-ray film to detect 35S- or
32P-labeled proteins.
Immunofluorescence Microscopy--
For antibody staining of
whole cells, U2OS cells were grown on acid-treated coverslips and fixed
with methanol at Nek2 Complexes in Human and Insect Cells--
To search for
potential Nek2 complexes in cells, extracts were prepared from human
HeLa tissue culture cells and subjected to centrifugation for 24 h
on 15-50% glycerol gradients. Western blotting with anti-Nek2
antibodies revealed that Nek2 exists as a single complex of
approximately 6 S (Fig. 1A,
top panel). This complex was maintained when extracts were
prepared in the presence of 500 mM NaCl, indicating that it
is highly stable and resistant to electrostatic disruption (Fig.
1A, bottom panel). We then tested whether
recombinant Nek2 was also present in such a complex. For this purpose,
Nek2 protein was expressed from baculoviruses in insect cells, and the
cell extracts were processed by centrifugation through equivalent
15-50% glycerol gradients. Western blotting of the different gradient
fractions with anti-Nek2 antibodies revealed that wild-type recombinant
Nek2 was also present as a 6 S complex (Fig. 1B, top
panel). Dimerization of Nek2 Occurs Through a Leucine Zipper
Motif--
The demonstration that Nek2, a 48-kDa protein, is present
in a 6 S complex, the expected size of a 100-kDa globular protein, suggested the possibility that both cellular and recombinant Nek2 preferentially form dimers. This would also explain why no monomeric Nek2 is seen upon high level overexpression in insect cells. Therefore, we analyzed the primary sequence of Nek2 for the presence of potential dimerization motifs and identified two putative coiled-coil motifs in
the C-terminal noncatalytic domain, one immediately downstream of the
catalytic domain and the other at the extreme C terminus (Fig.
1C, top panel). Intriguingly, the closest
relatives to vertebrate Nek2, namely NIMA (A. nidulans),
NIM-1 (Neurospora crassa), and Kin3p/Npk1p
(Saccharomyces cerevisiae), all contain a predicted coiled-coil motif immediately downstream of the catalytic domain, despite the lack of primary sequence conservation in this region (shown
for NIMA in Fig. 1C, bottom panel; not shown for
NIM-1 and Kin3p/Npk1p; see also Ref. 18). This first coiled-coil motif in Nek2 bears a certain resemblance to a leucine zipper in so far as it
contains a heptad repeat of leucine residues in position d
of the coiled-coil. It is well known that coiled-coil motifs in general
act as protein-protein interaction domains and that leucine zippers, in
particular, allow both homo- and heterodimerization of proteins.
Therefore, to experimentally address the role of this putative leucine
zipper motif, we created a deletion mutant, termed Nek2
First, we tested whether the leucine zipper was required for formation
of the 6 S complex. The Nek2
Second, we used a yeast two-hybrid interaction assay to directly test
the potential for Nek2-Nek2 interaction in vivo. For this
purpose, we created double transformants of the yeast strain, Y190,
containing different Nek2 constructs fused to either the GAL4 DNA
binding domain or the GAL4 activation domain. A positive interaction
was indicated by growth on histidine selective medium (Fig.
2A) and a blue color on a
Third, an in vitro coprecipitation approach was used. A
Myc-tagged version of the Nek2 C-terminal domain containing the leucine zipper was transcribed and translated in vitro either alone
or in combination with untagged wild-type Nek2 or untagged Nek2 Dimerization Allows Nek2 Trans-autophosphorylation--
We have
previously noted that the Nek2 kinase is capable of autophosphorylation
and that this occurs predominantly on serine residues (8, 20). Having
shown that the C-terminal domain of Nek2 could coprecipitate with
full-length active Nek2, we tested whether this also led to
phosphorylation of the C-terminal domain by the full-length kinase.
Proteins were prepared by separate in vitro translation
reactions (Fig. 4, lanes 1-4)
and mixed prior to immunoprecipitation with anti-Myc antibodies (Fig.
4, lanes 5-8). In this experiment, all Nek2 constructs were
Myc-tagged, and hence immunoprecipitation with the anti-Myc antibody
led to the isolation of all in vitro translated proteins
irrespective of whether or not there was an interaction between them.
In vitro kinase assays were then performed on
immunoprecipitates containing mixtures of wild-type or mutant Nek2
proteins (Fig. 4, lanes 9-12). We found that the
Nek2 C-terminal domain construct became strongly phosphorylated when
mixed with the full-length, wild-type Nek2 but not the catalytically
inactive Nek2 mutant, Nek2-K37R (Fig. 4, compare lanes 10 and 11). Autophosphorylation and gel retardation of the
full-length Nek2 protein was also seen with the active, but not
inactive, molecule. The Nek2 Nek2 Kinase Activity Depends on the Leucine Zipper--
We next
asked whether the dimerization motif was required for either the
localization of Nek2 to the centrosome or the kinase activity of Nek2
against known exogenous substrates such as
To determine whether the leucine zipper was required for Nek2 kinase
activity, The Nek2 Leucine Zipper Contains a Highly Unusual Arrangement of
Amino Acids--
Traditional leucine zippers, such as those present in
the bZIP transcription factors c-Myc, c-Jun, and GCN4, contain
hydrophobic residues at both of the spatially adjacent positions
a and d. This allows the creation of a
hydrophobic core (a, d, a', d') upon dimerization (21, 22).
Contrary to this arrangement, however, Nek2 lacks hydrophobic residues
at position a. Instead, the hydrophobic d
position is flanked on one side at position a by acidic
glutamate residues and on the other at position g by basic
arginine and lysine residues. This presents a highly unusual
arrangement whereby the single hydrophobic arm is flanked by two
oppositely charged hydrophilic arms (Fig.
6A). To our knowledge, no
other leucine zippers have yet been found with such a striking arrangement of charged and hydrophobic residues.
Although we have no direct physical evidence for coiled-coil formation,
modeling of this unusual leucine zipper reveals that homodimerization
between parallel coiled-coils is energetically feasible with both
hydrophobic and electrostatic interactions contributing to dimer
formation (Fig. 6B). The leucine residues all point into the
central core of the zipper as would be expected, whereas the glutamate
residues at position a of one monomer contact the basic
residues of position g of the other monomer and vice versa.
Antiparallel coiled-coils are electrostatically unfavorable as like
charged side chains would be brought into close juxtaposition. Comparison of models also indicates that a dimer of coiled-coils is
more energetically favorable than a trimer (data not shown), and the
presence of polar residues at positions a and g
should tend anyway to favor dimers, where they are still partly
solvated, rather than trimers or tetramers, where they are more
hidden in the hydrophobic core (22).
In this study, we have examined the role of an unusual leucine
zipper motif present in the C-terminal noncatalytic domain of the human
serine/threonine kinase, Nek2. We found that in human tissue culture
cells endogenous Nek2 is present as a 6 S complex, the predicted size
of a Nek2 dimer. Nek2 also forms a 6 S complex in insect cells
following high level overexpression, suggesting that no other proteins
are required to form this complex. Deletion of the leucine zipper motif
from the recombinant protein leads to a smaller complex, the size of a
Nek2 monomer, implying that both endogenous and recombinant wild-type
Nek2 form homodimers. In further support of Nek2 homodimerization,
yeast two-hybrid and coprecipitation assays demonstrated that
recombinant Nek2 can interact strongly with itself, that this
interaction occurs through the C-terminal noncatalytic domain, and that
it is strictly dependent upon the presence of the leucine zipper. Taken
together, these data provide persuasive evidence that the preferred
state of soluble Nek2 protein in cells is a dimer (Fig. 6C).
Furthermore, we found that the leucine zipper allows recombinant Nek2
to trans-autophosphorylate on its C-terminal domain and achieve full
activity on exogenous substrates such as We have previously shown that Nek2 associates with the centrosome, the
major microtubule organizing center of the cell (12). However, like
other centrosomal proteins studied to date (e.g. Refs. 23
and 24), the bulk of cellular Nek2 (up to 90%) is noncentrosomal.
Indeed, it is now thought that the centrosome is a highly dynamic
structure with a frequent exchange of many proteins between a
centrosomal and noncentrosomal pool. The 6 S Nek2 complex analyzed in
this study was obtained from the soluble fraction of cell extracts, and
we assume, but cannot presently prove, that the fraction of Nek2
present at the centrosome at the time of extraction represents a
similar oligomeric state. In contrast to Nek2, the centrosomal protein
Importantly, deletion of the Nek2 leucine zipper led to a significant
loss of Nek2 activity against exogenous substrates. Moreover, the
leucine zipper deletion mutant was less efficient in stimulating
centrosome splitting, a phenotype dependent on Nek2 kinase activity,
when transfected into U2OS
cells.2 Recombinant and
cellular NIMA were also reported to exist as oligomers, perhaps
involving a complex of four catalytic subunits, although the effect of
oligomerization on NIMA activity was not addressed (27). Whether the
equivalent coiled-coil of NIMA contributes to oligomerization is also
not clear. However, this domain was necessary for the G2
block imposed by dominant negative mutants expressed in both
Aspergillus and human cells (28, 29). This suggests that in
these experiments the coiled-coil domain of the overexpressed protein
was acting as a competitive inhibitor of normal physiological
interactors of NIMA. Indeed, NIMA, through its coiled-coil domain, has
been shown to bind the peptidyl-prolyl isomerase Pin1 that is essential
for correct mitotic regulation (30). Thus, the dominant negative
mutants might act through sequestration of endogenous NIMA-like kinases
and/or other proteins.
The role of dimerization in the activation of receptor tyrosine kinases
has long been established. However, only recently has dimerization been
recognized as an important mechanism for the regulation of many
serine/threonine kinases as well. The demonstration that dimerization
modulates the activity of recombinant Nek2 falls in line with recent
results on, for instance, the c-raf-1 proto-oncogene (31,
32) and the mitogen-activated protein kinase extracellular signal-regulated kinase 2 (33). Leucine zippers, in particular, have
now been described in several serine/threonine kinases, including type
I and II cGMP-dependent protein kinases (34, 35), the mixed
lineage kinase family (36, 37), TOUSLED kinase of
Arabidopsis (38), the protein kinase C-related protein
kinase N (34), DNA-dependent kinase catalytic subunit (an
enzyme with a catalytic domain related to phosphatidylinositol
3-kinases) (39), and ZIP kinase (41). Homodimerization through the
leucine zipper has been shown to result in activation at least in the
case of TOUSLED and ZIP kinase, whereas the DNA-dependent
protein kinase catalytic subunit can be activated through leucine
zipper-dependent heterodimerization with the DNA-binding
protein C1D (40).
As Nek2 dimerization also leads to a trans-autophosphorylation
reaction, the question remains open as to whether it is the dimerization per se or the autophosphorylation reaction that
is necessary to achieve full activation of the kinase. Mapping and subsequent mutation of the autophosphorylation site(s) will be necessary to answer this question. Likewise, it is inherently difficult
to determine whether the absence of a trans-autophosphorylation reaction in the leucine zipper deletion mutant is the result of a
failure to dimerize or a reduced kinase activity toward the C-terminal
domain. Unraveling these dependences will probably require a detailed
understanding of Nek2 structure. What we clearly can conclude at this
stage, though, is that removal of the leucine zipper motif prevents
dimerization, interferes with a trans-autophosphorylation reaction, and
reduces kinase activity toward exogenous substrates.
The Nek2 leucine zipper lies within a putative coiled-coil that is
conserved in secondary structure, although not primary sequence, among
a subfamily of NIMA-related kinases that include human Nek2,
Aspergillus NIMA, Neurospora NIM-1, and
Saccharomyces Kin3p/Npk1p (3). However, whereas both NIM-1
and Kin3p/Npk1 have heptad repeats of leucines, only Nek2 has a
perfectly maintained arrangement of basic and acidic residues flanking
the leucine position. The classical leucine zippers of bZIP
transcription factors conform to the consensus of a heptad repeat
(abcdefg)n of hydrophobic residues in a 4-3 pattern in which
leucines are conserved at position d (21). This allows
formation of a parallel, two-stranded coiled-coil of We thank Kay Hofmann (MEMOREC, Cologne,
Germany) for expert help with computer modeling, Steve Elledge (Baylor
College, Houston, TX) for providing strains and plasmids for yeast
interaction assays, and Nicolas Roggli (University of Geneva,
Switzerland) for artwork. We also thank all members of the laboratory
for useful discussion.
*
The costs of publication of this
article were defrayed in part by the
payment of page charges. The article
must therefore be hereby marked
"advertisement" in
accordance with 18 U.S.C. Section
1734 solely to indicate this fact.
2
A. M. Fry and E. A. Nigg, unpublished results.
The abbreviation used is:
PBS, phosphate-buffered saline.
Activity of the Human Centrosomal Kinase, Nek2, Depends on an
Unusual Leucine Zipper Dimerization Motif*
,
![]()
ABSTRACT
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES
![]()
INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES
![]()
EXPERIMENTAL PROCEDURES
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES
LZ, nucleotides 998-1084
of the Nek2 cDNA were removed from pGEM-Nek2 (5) using the
CLONTECH site-directed mutagenesis kit. The
mutagenic oligonucleotide used was the 40-mer,
CCAGCCCTGTATTGAGTGAGTGTGTTCGTGAGAGACTAGC, compromising 20 nucleotides on either side of the region deleted; as a selection
primer, an oligonucleotide eliminating the PstI site in the
pGEM multicloning site was used. This construct was Myc-tagged by
excising Nek2
LZ on a NaeI-XbaI fragment from
pGEM-Nek2
LZ and inserting it into SmaI-XbaI of
a pBlueScript vector carrying the Myc epitope tag (15), creating
pBS-MycNek2
LZ. For eukaryotic expression, the in-frame Myc-Nek2
LZ
fusion was excised as a SalI(blunted)-XbaI fragment from pBS-MycNek2
LZ and subcloned into pRcCMV (Invitrogen Corp.) between the HindIII (blunted) and XbaI
sites to create pCMV-MycNek2
LZ. For generation of the Myc-tagged
version of the Nek2 C-terminal domain alone, an XmnI
fragment was excised from pGEM-Nek2 and subcloned into the
SmaI site of pBlueScript-Myc to generate pBS-MycNek2-Cterm.
The Myc-tagged fusion protein was then excised on a
HindIII-XbaI fragment and subcloned into the HindIII-XbaI site of pRcCMV, creating
pCMV-MycNek2-Cterm. For yeast two-hybrid assays, fusions of Nek2 to the
GAL4 DNA binding domain or GAL4 activation domain were done in the pAS2
and pACT2 plasmids, respectively. Wild-type Nek2 or Nek2
LZ was
excised on a NaeI-XbaI(blunted) fragment from
pGEM-Nek2 or pGEM-Nek2
LZ, respectively, and inserted into the
SmaI site of pAS2 to create pAS2-Nek2 and pAS2-Nek2
LZ.
The C-terminal noncatalytic domain of Nek2 was excised on an
XmnI fragment and subcloned into the SmaI site of
pAS2 to create pAS2-Nek2-Cterm. Subsequently, Nek2 was cut out of
pAS2-Nek2 on a NcoI-BamHI fragment and inserted into pACT2 cut with NcoI and BamHI to generate
pACT2-Nek2. pAS1-SNF1 and pACT-SNF4 (also called pSE1112 and pSE1111,
respectively) were gifts of S. Elledge (Baylor College, Houston, TX).
To generate a baculovirus expressing the Nek2
LZ mutant, Nek2
LZ
was excised from pGEM-Nek2
LZ on a NaeI-XbaI
fragment and subcloned into pVL1392 (Pharmingen Corp.) cut with
PstI (blunted) and XbaI, giving
pVL1392-Nek2
LZ. Recombinant Nek2
LZ baculovirus was generated by
cotransfection of pVL1392-Nek2
LZ and BaculoGold DNA (Pharmingen
Corp.) and subsequent amplification of viral DNA.
-galactosidase filter lift assays were as described in Harper
et al. (16). Quantitative measurement of
-galactosidase
activity using the substrate,
O-nitrophenyl-
-D-galactopyranoside, was as
described in Durfee et al. (17).
20 °C for 6 min. Following fixation, coverslips
were washed three times with PBS, blocked with 1% bovine serum albumin
in PBS for 10 min, and washed again three times with PBS. All
subsequent antibody incubations were carried out in PBS containing 3%
bovine serum albumin. Myc-tagged proteins were detected using undiluted
tissue culture supernatant from the anti-Myc monoclonal antibody 9E10 followed by fluorescein isothiocyanate-conjugated anti-mouse Fab fragment (1:100, Sigma). Centrosome staining was carried out with an
anti-
-tubulin rabbit polyclonal antibody (1.8 µg/ml IgGs) (12)
followed by biotinylated anti-rabbit secondary antibodies (1:50,
Amersham Pharmacia Biotech) and Texas Red-conjugated streptavidin (1:200, Amersham Pharmacia Biotech). DNA staining was carried out with
Hoechst 33258 (0.2 µg/ml in PBS). Immunofluorescence microscopy was
performed using a Zeiss Axioplan II microscope (Thornwood, NY) and a
×63 oil-immersion objective. Photographs were taken using a Quantix
1400 CCD camera (Photometrics, Inc., Tuscon, AZ) and IP-Lab software,
and the images were processed using Adobe Photoshop (San Jose, CA).
![]()
RESULTS
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES
-Casein kinase assays performed on Nek2
immunoprecipitates from across the gradient confirmed the presence of
Nek2 kinase activity in the same fractions as the 6 S complex (data not
shown). Moreover, the 6 S complex was also observed in extracts of
insect cells expressing a catalytically inactive Nek2 mutant, Nek2-K37R
(8), indicating that Nek2 activity itself is not required for formation
of the 6 S complex (data not shown).

View larger version (27K):
[in a new window]
Fig. 1.
Nek2 complexes in insect and human
cells. A, glycerol gradient centrifugation of extracts
prepared from human HeLa tissue culture cells in the presence of either
50 mM (top panel) or 500 mM
(bottom panel) NaCl. B, glycerol gradient
centrifugation of extracts prepared from insect cells infected with
recombinant baculoviruses encoding wild-type Nek2 (top
panel) or Nek2
LZ (bottom panel). In both cases, cell
extracts were separated by centrifugation through 15-50% glycerol
gradients. Fractions were then collected from the top of the gradients
and assayed for the presence of Nek2 protein by Western blotting with
an anti-Nek2 antibody. The positions of marker proteins in the
gradients are indicated underneath (both as molecular mass,
kDa; and sedimentation value, S). C, the Nek2 and NIMA
protein sequences were analyzed by the COILS program (window
28) (44), which predicts the propensity of a sequence to form
coiled-coils on a scale of 0-1 (vertical scale). This is
plotted as a function of the linear sequence of amino acids
(horizontal scale). Underneath the output for each protein
is a schematic view of their domain structure with the catalytic domain
in hatched format. Note that in both proteins a coiled-coil domain is
present immediately downstream of the catalytic domain, despite no
obvious primary sequence conservation in this region. N, N
terminus; C, C terminus.
LZ, that
entirely lacks the leucine zipper residues 306-334. Using this mutant
we adopted three approaches to test whether Nek2 does indeed form
dimers and whether this dimerization is dependent upon the leucine
zipper motif.
LZ mutant was expressed in insect cells
from a recombinant baculovirus, and cell extracts were again subjected
to glycerol gradient centrifugation. Western blotting of the gradient
fractions with Nek2 antibodies revealed that the 6 S complex now
disappeared. Instead, Nek2 reactivity was present in fractions of
approximately 4 S, i.e. the size of a monomeric globular
protein of 50 kDa (Fig. 1B, bottom panel). Thus,
deletion of the leucine zipper prevents recombinant Nek2 from forming
the 6 S complex, apparently leaving the mutant protein as a monomer.
-galactosidase filter lift assay (data not shown). When mixed with
control proteins, SNF1 or SNF4, wild-type Nek2 did not activate the
reporters when present either as a DNA binding domain fusion protein or
an activation domain fusion protein. However, when Nek2 was placed on
the two halves of the interaction system, both reporters were clearly
positive, showing that Nek2 was interacting with itself (Fig.
2A). Using the Nek2
LZ mutant, we found that deletion of
the leucine zipper from one Nek2 molecule completely abolished the
interaction with a full-length Nek2 molecule. Conversely, using one
full-length Nek2 molecule and one truncated Nek2 molecule containing
the C-terminal noncatalytic domain alone (but including the leucine
zipper), the interaction was once again restored (Fig. 2A).
The relative strength of these interactions was determined by measuring
the activity of the
-galactosidase reporter in the yeast double
transformants using the substrate,
O-nitrophenyl-
-D-galactopyranoside (Fig. 2B). The Nek2-Nek2 interaction was almost 20 times stronger
than the control interaction between the yeast proteins, SNF1 and SNF4 (19). The interaction was even stronger between full-length Nek2 and
the Nek2 C-terminal domain alone, perhaps as a result of reduced steric
hindrance. This assay also confirmed that deletion of the leucine
zipper completely blocked the interaction, with levels of reporter
activity no greater than the negative controls. Equivalent expression
of the various Nek2 proteins in all double transformants was controlled
by Western blotting of yeast extracts with anti-Nek2 antibodies (data
not shown).

View larger version (48K):
[in a new window]
Fig. 2.
Nek2 homodimerization in a yeast two-hybrid
interaction assay. A, yeast Y190 double transformants
were tested for a positive interaction between the GAL4 DNA binding
domain fusion protein (indicated first) and the GAL4 activation domain
fusion protein (indicated second). The right panel shows
nutrient selection for the histidine reporter gene indicative of a
positive interaction, whereas the respective partners in each sector
are indicated schematically in the left panel. B,
quantitative assay for
-galactosidase activity using the substrate
O-nitrophenyl-
-D-galactopyranoside
(ONPG). Units of activity are relative to the SNF1-SNF4
interaction and given an arbitrary value of 1.0. Results are the mean
of three independent experiments. C-term, C-terminal.
LZ (Fig. 3, lanes 1-3). The
anti-Myc monoclonal antibody, 9E10, was then used to immunoprecipitate
the Myc-tagged Nek2 C-terminal domain from these mixes (Fig. 3,
lanes 4-6). The untagged full-length Nek2 molecule was
coprecipitated (Fig. 3, lane 5), indicating that the
full-length molecule could interact with the Nek2 C-terminal domain.
However, the untagged Nek2
LZ was not coprecipitated (Fig. 3,
lane 6), confirming that this interaction required the
presence of the leucine zipper. Hence, multiple approaches concur to
demonstrate that the recombinant Nek2 kinase can specifically dimerize
through its leucine zipper motif.

View larger version (48K):
[in a new window]
Fig. 3.
In vitro dimerization of Nek2 in a
coprecipitation assay. A Myc-tagged version of the Nek2 C-terminal
domain (Cterm) was translated alone in vitro
(lanes 1 and 4) or together with untagged
versions of wild-type Nek2 (lanes 2 and 5) or
Nek2
LZ (lanes 3 and 6) in the presence of
[35S]methionine. A portion of each sample was run out on
a 12% polyacrylamide gel and exposed to autoradiography either before
(lanes 1-3) or after (lanes 4-6)
immunoprecipitation with the 9E10 anti-Myc antibody. Molecular masses
(kDa) are indicated on the left, and the positions of the
Nek2 proteins on the right. IP,
immunoprecipitate; IVT, in vitro
translation.
LZ mutant, which does not interact with
the Nek2 C-terminal domain, caused only very minor phosphorylation of
the C-terminal domain (Fig. 4, lane 12). In addition, there
was an almost negligible level of autophosphorylation of the Nek2
LZ
protein itself. These results indicate that Nek2 protein can
trans-autophosphorylate on its own C-terminal domain and that this only
works efficiently in the presence of an intact leucine zipper
dimerization motif.

View larger version (55K):
[in a new window]
Fig. 4.
The leucine zipper motif allows Nek2
trans-autophosphorylation. Myc-tagged Nek2 proteins were
translated in vitro separately in the presence of
[35S]methionine (lanes 1-4) before mixing as
indicated and immunoprecipitating with the anti-Myc antibody, 9E10
(lanes 5-12). The immunoprecipitates were then incubated in
Nek2 kinase buffer containing [32P]ATP for 30 min at
30 °C. Samples were run out on a 12% polyacrylamide gel and exposed
to x-ray film. The 35S radioactive signal alone in
lanes 5-8 (IP 35 S) was obtained by storing the
dried gel for 4 months to allow decay of 32P, whereas the
32P radioactivity alone (IP-Kinase
32P) was obtained by placing an extra piece of film
between the freshly dried gel and the x-ray film to screen out the
35S signal. The position of the Myc-Nek2 C-terminal domain
(myc:Nek2-Cterm) is indicted on the right.
IVT, in vitro translation.
-casein (8). To test its
subcellular localization, a Myc epitope-tagged version of the Nek2
LZ
mutant was subcloned into a eukaryotic expression vector and
transiently transfected into human U2OS osteosarcoma cells.
Colocalization of anti-Myc antibodies in transfected cells with
antibodies against the known centrosomal protein
-tubulin clearly
indicated that this construct could still associate with the centrosome
(Fig. 5A). Hence, the leucine
zipper motif is not by itself necessary for the localization of Nek2 to
the centrosome. Furthermore, this result strongly argues that deletion
of the leucine zipper does not cause major unfolding of the Nek2
kinase.

View larger version (62K):
[in a new window]
Fig. 5.
Nek2
LZ localizes to
the centrosome but has reduced kinase activity. A,
human U2OS osteosarcoma cells were transiently transfected with the
pCMV-Myc-Nek2
LZ plasmid and fixed after 24 h in cold methanol.
Cells were then double-stained with the Myc 9E10 monoclonal antibody to
identify transfected protein (a) and a polyclonal
-tubulin antibody to reveal the centrosomes (b).
Colocalization of the mutant Nek2 protein with centrosomes is indicated
by an arrowhead. Scale bar, 10 µm.
B, Myc-tagged Nek2 proteins, wild-type Nek2
(Nek2wt, lanes 2 and 5), catalytically
inactive Nek2 (K37R, lanes 1 and 4),
and the Nek2 leucine zipper deletion mutant (
LZ,
lanes 3 and 6) were translated in
vitro in the presence of [35S]methionine, and
aliquots were run out on a 12% polyacrylamide gel and exposed to
autoradiography (lanes 1-3). The remainder of each sample
was immunoprecipitated with the 9E10 anti-Myc antibody, and in
vitro
-casein kinase assays with [32P]ATP were
carried out. Reaction products were resolved on a 12% polyacrylamide
gel and analyzed by autoradiography (lanes 4-6). Molecular
masses (kDa) are indicated on the left, and the positions of
-casein and Nek2 proteins are indicated on the right.
Note that the radioactivity in lanes 4-6 is a mixture of
the 35S and 32P signals.
-casein kinase assays were carried out using equal amounts
of in vitro translated Nek2 proteins (Fig. 5B,
lanes 1-3). Strikingly, we found that the activity of the
Nek2
LZ mutant was significantly reduced (at least 5-fold) as
compared with the wild-type kinase (Fig. 5B, compare
lanes 5 and 6). The mutant, Nek2-K37R, containing
a substitution in the nucleotide-binding motif was inactive in this
assay, as expected (Fig. 5B, lane 4). Autophosphorylation of the wild-type Nek2 protein led to both 32P labeling and a reduction in its
electrophoretic mobility (Fig. 5B, lane 5).
However, the Nek2
LZ mutant was not detectably labeled with
32P and did not show any significant change in mobility,
confirming our earlier results that this mutant is unable to
autophosphorylate. This striking reduction in kinase activity in the
Nek2
LZ mutant was confirmed by comparing the activity of
baculovirus-expressed recombinant proteins (data not shown). However,
as deletion of the leucine zipper prevents both autophosphorylation and
phosphorylation of exogenous substrates, we cannot distinguish at the
present time whether full activity is strictly dependent upon
dimerization or autophosphorylation (or both).

View larger version (19K):
[in a new window]
Fig. 6.
Dimerization occurs through an unusual
leucine zipper motif. A, helical wheel representation
of amino acids 306-340 of the Nek2 protein showing the regular heptad
repeat of leucine residues at position d flanked by a basic
arm of residues at position g and by an acidic glutamate arm
of residues at position a. B, a hypothetical wire
diagram model of a Nek2 leucine zipper dimer as calculated using the
ICM program (47) and viewed with RasMol (48). The model is based on the
coordinates of the two-stranded coiled-coil region of the yeast GCN4
transcriptional activator (deposited in the Protein Data Bank under
accession number 2ZTA). The Nek2 model was generated by replacing the
GCN4 coiled-coil side chains by the corresponding side chains of Nek2.
The correspondence relationship is based on the coiled-coil register as
determined by the COILS2 program (22, 46). Subsequent to the side chain
replacement, sterical clashes were removed by the ICM program (47). The
individual
-helices are right-handed and run parallel, and the coil
of the helices is left-handed. Leucine residues in position
d of each monomer are indicated in yellow,
whereas the acidic glutamate residues in position a of one
monomer are in red, and the basic lysine or arginine
residues in position g of the other monomer are in
blue. The symmetrical pair of glutamate and basic residues
on the back side of the molecule are omitted for clarity. C,
a schematic model illustrating the interaction of two full-length Nek2
molecules is shown. Dimerization is shown to occur between parallel
leucine zippers (LZ) such that it allows the C-terminal
domain (C-term) of one molecule to be phosphorylated by the
catalytic domain (CAT) of the second molecule. P,
phosphate.
![]()
DISCUSSION
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES
-casein.
-tubulin has been shown to exist in a large 25 S complex, known as
the
-tubulin ring complex or
-TuRC, both at the centrosome and in
the cytoplasm (23, 25, 26). Homodimerization is not necessary for
recombinant Nek2 to associate with the centrosome, because deletion of
the leucine zipper did not prevent centrosomal localization. We
previously showed that Nek2 interacts with the core centrosomal protein
C-Nap1 and that this interaction does not require the Nek2 leucine
zipper (13). Whether the interaction with C-Nap1 is sufficient for the
localization of Nek2 to the centrosome is not known.
-helices. The
a position is usually occupied by
-branched hydrophobic
amino acids (i.e. valine or isoleucine), but occasional
polar or charged residues are tolerated (as seen, for example, in c-Fos
or c-Myc). The amino acids at positions e and g
are typically charged to allow both intra- or interhelical
electrostatic interactions, with e and g of one
monomer interacting with g' and e', respectively,
of the second monomer in parallel coiled-coils (42). Crystal structures
of leucine zipper dimers have revealed that this contributes to
stabilization or destabilization of the zipper and thus a degree of
specificity for dimerization between different leucine zipper proteins
(43-45). Clearly, the most obvious deviation from this framework in
the Nek2 leucine zipper is that the a position possesses no
hydrophobic residues at all, but instead contains a perfect repeat of
negatively charged residues consisting entirely of glutamic acids. It
is unlikely that there could be much interaction between the
e and g positions of the respective Nek2 monomers
as both are overall basic. Yet, there is complete conservation of the
leucines in position d, and all the acidic and basic
residues in positions a and g, respectively, in
human and mouse Nek2 (9-11) as well as in Xenopus
Nek2,2 implying that this
unusual sequence arrangement is critical to the performance of the Nek2
leucine zipper. Moreover, the observation that the Nek2 dimer was
resistant to 500 mM NaCl demonstrates the stability of this
structure and highlights the strength of the electrostatic interactions
involved in dimerization. High resolution structural analyses will be
needed in the future to determine the precise conformation of this interaction.
![]()
ACKNOWLEDGEMENTS
![]()
FOOTNOTES
To whom correspondence should be addressed: Dept. of Biochemistry,
Adrian Bldg., University of Leicester, University Rd., Leicester LE1
7RH, UK. Tel.: 44 116 252 5024; Fax: 44 116 252 3369; E-mail:
amf5{at}le.ac.uk.
![]()
ABBREVIATIONS
![]()
REFERENCES
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES
Copyright © 1999 by The American Society for Biochemistry and Molecular Biology, Inc.
![]()
CiteULike
Complore
Connotea
Del.icio.us
Digg
Reddit
Technorati What's this?
This article has been cited by other articles:
![]() |
W. Wu, J. E. Baxter, S. L. Wattam, D. G. Hayward, M. Fardilha, A. Knebel, E. M. Ford, E. F. da Cruz e Silva, and A. M. Fry Alternative Splicing Controls Nuclear Translocation of the Cell Cycle-regulated Nek2 Kinase J. Biol. Chem., September 7, 2007; 282(36): 26431 - 26440. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. Rellos, F. J. Ivins, J. E. Baxter, A. Pike, T. J. Nott, D.-M. Parkinson, S. Das, S. Howell, O. Fedorov, Q. Y. Shen, et al. Structure and Regulation of the Human Nek2 Centrosomal Kinase J. Biol. Chem., March 2, 2007; 282(9): 6833 - 6842. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. M. Quarmby and M. R. Mahjoub Caught Nek-ing: cilia and centrioles J. Cell Sci., November 15, 2005; 118(22): 5161 - 5169. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. S. Hames, R. E. Crookes, K. R. Straatman, A. Merdes, M. J. Hayes, A. J. Faragher, and A. M. Fry Dynamic Recruitment of Nek2 Kinase to the Centrosome Involves Microtubules, PCM-1, and Localized Proteasomal Degradation Mol. Biol. Cell, April 1, 2005; 16(4): 1711 - 1724. [Abstract] [Full Text] [PDF] |
||||
![]() |
|