Advertisement
JBC

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Fry, A. M.
Right arrow Articles by Nigg, E. A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Fry, A. M.
Right arrow Articles by Nigg, E. A.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

J Biol Chem, Vol. 274, Issue 23, 16304-16310, June 4, 1999


Activity of the Human Centrosomal Kinase, Nek2, Depends on an Unusual Leucine Zipper Dimerization Motif*

Andrew M. FryDagger , Lionel Arnaud, and Erich A. Nigg

From the Department of Molecular Biology, Sciences II, University of Geneva, 30, Quai Ernest-Ansermet, CH-1211 Geneva 4, Switzerland

    ABSTRACT
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

Nek2 is a human cell cycle-regulated kinase that is structurally related to the mitotic regulator, NIMA, of Aspergillus nidulans. Localization studies have shown that Nek2 is a core component of the centrosome, the microtubule organizing center of the cell, and functional approaches suggest a possible role for Nek2 in centrosome separation at the G2/M transition. Here, we have investigated the importance of an unusual leucine zipper coiled-coil motif present in the C-terminal noncatalytic domain of the Nek2 kinase. Glycerol gradient centrifugation indicated that endogenous Nek2 is present in HeLa cells as a salt-resistant 6 S complex, the predicted size of a Nek2 homodimer. Recombinant Nek2 overexpressed in insect cells also formed a 6 S complex, whereas a Nek2 mutant specifically lacking the leucine zipper motif was monomeric. Using yeast two-hybrid interaction analyses and coprecipitation assays, we found that Nek2 can indeed form homodimers both in vivo and in vitro and that this dimerization specifically required the leucine zipper motif. Moreover, deletion of the leucine zipper prevented a trans-autophosphorylation reaction on the C-terminal domain of Nek2 and strongly reduced Nek2 kinase activity on exogenous substrates. Finally, we emphasize that the Nek2 leucine zipper described here differs from classical leucine zippers in that it exhibits a radically different arrangement of hydrophobic and charged amino acids. Thus, this study reveals not only an important mechanism for the regulation of the Nek2 kinase but, furthermore, highlights an unusual organization of a leucine zipper dimerization motif.

    INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

Human Nek2 belongs to a family of serine/threonine protein kinases structurally related to the NIMA mitotic regulator of the filamentous fungus, Aspergillus nidulans. NIMA is the product of a gene that, when mutated, leads to a block of cells in the G2 phase of the cell cycle and, when overexpressed, drives cells into a premature mitosis from any point in the cell cycle (1, 2). However, as physiological substrates of NIMA remain to be identified, the precise mechanism by which NIMA contributes to promote mitosis is unknown. Proteins related to Aspergillus NIMA have been found in a broad variety of species including yeast, trypanosomes, flies, and mammals (reviewed in Ref. 3). In humans, at least six NIMA-related kinases or "Neks" have so far been isolated as full-length or partial sequences (4-7), and it is possible that these may function in different stages of the cell cycle or in different tissues. To date, the closest mammalian relative of NIMA is Nek2 (5). Activity measurements indicate that Nek2 is a cell cycle-regulated kinase with maximal activity in S and G2 phases of the cell cycle (8). Moreover, expression studies reveal that Nek2 is most abundant in meiotic, as well as mitotic, tissues (9-11), strengthening the hypothesis that Nek2, like NIMA, has a function in cell cycle progression.

Recent work has revealed a potential role for Nek2 at the centrosome, the major microtubule-organizing center of the cell (12). Subcellular localization studies indicate that Nek2 is a core component of the centrosome, in that its centrosomal localization is independent of microtubules. Moreover, ectopic expression of active, but not inactive, Nek2 kinase in human tissue culture cells induces a striking splitting of the two centrosomes, raising the possibility that Nek2 might normally function to promote the separation of centrosomes at the G2 to M transition that is necessary for formation of a bipolar mitotic spindle (12). In particular, Nek2 activity might induce the dissolution or degradation of components that are required for cohesion of the two centrosomes during interphase. Intriguingly, a novel component of the centrosome has been identified through interaction with Nek2 that displays several properties of a protein predicted to be involved in centrosome-centrosome cohesion (13). This protein, called C-Nap1, for centrosomal Nek2-associated protein 1, is a high molecular weight protein with extensive coiled-coil domains and most likely functions as a structural component of the centrosome. The C-terminal domain of C-Nap1 can be phosphorylated by Nek2 both in vitro and in vivo, suggesting that C-Nap1 is a bona fide centrosomal substrate of the Nek2 kinase. Finally, in support of a model implicating C-Nap1 in centrosome-centrosome cohesion, C-Nap1was found to be present within interphase centrosomes but absent from mitotic spindle poles (13).

Although the identification of C-Nap1 provides a first step toward understanding what events might be downstream of the Nek2 kinase, virtually nothing is known about upstream events, i.e. how the kinase itself is regulated. Nek2 is maximally active in S and G2, and this level of activity reflects the amount of Nek2 protein present through the different stages of the cell cycle (8). Hence, one mode of regulation is likely to occur at the level of protein abundance by means of either regulated transcription/translation or protein turnover. Equally, Nek2, like other protein kinases, may be regulated through protein-protein complex formation. Cyclin-dependent kinases, for example, are so named because of their absolute dependence upon stoichiometric complex formation with regulatory cyclin subunits. Protein interactions can regulate kinase activity in many ways including the following: (i) allosteric modulation of the kinase domain structure, (ii) blocking the interaction of a kinase inhibitor, (iii) targeting the kinase directly to its substrates, or (iv) targeting the kinase to the correct location in the cell.

As a means to study the regulation of the Nek2 kinase, we set out to look for complexes of Nek2 that may indicate potential regulatory partners. In the course of these studies, we discovered that soluble Nek2 exists in cells as a highly stable homodimer and that homodimerization is dependent upon a leucine zipper coiled-coil motif present in the C-terminal noncatalytic domain of Nek2. We found that dimerization is necessary both for a trans-autophosphorylation reaction and for Nek2 kinase activity on exogenous substrates. Finally, we emphasize that the Nek2 leucine zipper has a strikingly unusual arrangement of amino acids. This highlights the sequence flexibility that is tolerated within this particular class of dimerization motifs.

    EXPERIMENTAL PROCEDURES
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

Cell Culture and Transfections-- Human cells were grown at 37 °C in a 7% CO2 atmosphere in Dulbecco's modified Eagle's medium supplemented with heat-inactivated serum and penicillin/streptomycin (100 IU/ml and 100 µg/ml, respectively). HeLa epithelial cells were supplemented with 5% fetal calf serum and U2OS osteosarcoma cells with 10% fetal calf serum. Sf9 insect cells were grown in TC100 medium (Life Technologies, Inc.) and supplemented with 10% heat-inactivated fetal calf serum and penicillin-streptomycin at 27 °C. For transient transfection studies, U2OS cells were seeded onto HCl-treated glass coverslips at a density of 1 × 105 cells/35-mm dish and transfected with 10 µg of plasmid DNA using calcium phosphate precipitates as described previously (14). Cells were fixed after 24 h and analyzed by indirect immunofluorescence microscopy.

Glycerol Gradients and Western Blots-- Cell extracts were prepared from 108 exponentially growing HeLa cells or 107 Sf9 insect cells infected with different Nek2 baculoviruses (48 h postinfection). For this purpose, both floating and adherent cells were harvested, washed once in 1 ml of ice-cold PBS1 + 1 mM phenylmethylsulfonyl fluoride, and resuspended in 0.5 ml of gradient buffer (50 mM Hepes, pH 7.4, 1 mM dithiothreitol, 0.1% Nonidet P-40, 50 or 500 mM NaCl, 5 mM EDTA, 5 mM MnCl2, 1 mM phenylmethylsulfonyl fluoride, 10 µg/ml leupeptin, 10 µg/ml pepstatin A, 50 µg/ml chymostatin, 1/100 aprotinin). Samples were left on ice for 30 min, passed 10 times through a 27-gauge needle, and centrifuged at 10,000 × g for 10 min (4 °C). Protein concentrations were measured using a Bio-Rad protein determination reagent. Cell extracts (1 mg of total protein) were loaded on the top of a 10-ml 15-50% glycerol gradient (containing 20 mM Hepes, pH 7.4, 50 or 500 mM NaCl, 0.2 mM EDTA) and spun at 40,000 rpm, 4 °C for 24 h in a Beckman SW 40 ultracentrifuge rotor. 400-µl fractions were collected from the top of the gradient and analyzed by Western blotting for Nek2 proteins. 100 µg of chymotrypsin (25 kDa), bovine serum albumin (67 kDa, 4.3 S), aldolase (158 kDa, 7.4 S), and catalase (232 kDa, 11.3 S) were centrifuged at the same time on equivalent glycerol gradients to determine the separation of different molecular weight complexes. The position of marker proteins in different fractions was determined by silver staining of SDS-polyacrylamide gel electrophoresis. Western blots were performed by transfer of proteins onto nitrocellulose using a Hoefer SemiDry blotting apparatus. As primary anti-Nek2 antibodies, we used either affinity-purified R40 antibodies (12) or an affinity-purified antipeptide antibody raised against residues 278-299 of human Nek2 by Zymed Laboratories Inc. (South San Francisco, CA). Both antibodies were used at 1.0 µg/ml. Blots were developed by enhanced chemiluminescence (ECL) (Amersham Pharmacia Biotech).

Plasmid and Baculovirus Constructions-- To generate the leucine zipper deletion mutant, pGEM-Nek2Delta LZ, nucleotides 998-1084 of the Nek2 cDNA were removed from pGEM-Nek2 (5) using the CLONTECH site-directed mutagenesis kit. The mutagenic oligonucleotide used was the 40-mer, CCAGCCCTGTATTGAGTGAGTGTGTTCGTGAGAGACTAGC, compromising 20 nucleotides on either side of the region deleted; as a selection primer, an oligonucleotide eliminating the PstI site in the pGEM multicloning site was used. This construct was Myc-tagged by excising Nek2Delta LZ on a NaeI-XbaI fragment from pGEM-Nek2Delta LZ and inserting it into SmaI-XbaI of a pBlueScript vector carrying the Myc epitope tag (15), creating pBS-MycNek2Delta LZ. For eukaryotic expression, the in-frame Myc-Nek2Delta LZ fusion was excised as a SalI(blunted)-XbaI fragment from pBS-MycNek2Delta LZ and subcloned into pRcCMV (Invitrogen Corp.) between the HindIII (blunted) and XbaI sites to create pCMV-MycNek2Delta LZ. For generation of the Myc-tagged version of the Nek2 C-terminal domain alone, an XmnI fragment was excised from pGEM-Nek2 and subcloned into the SmaI site of pBlueScript-Myc to generate pBS-MycNek2-Cterm. The Myc-tagged fusion protein was then excised on a HindIII-XbaI fragment and subcloned into the HindIII-XbaI site of pRcCMV, creating pCMV-MycNek2-Cterm. For yeast two-hybrid assays, fusions of Nek2 to the GAL4 DNA binding domain or GAL4 activation domain were done in the pAS2 and pACT2 plasmids, respectively. Wild-type Nek2 or Nek2Delta LZ was excised on a NaeI-XbaI(blunted) fragment from pGEM-Nek2 or pGEM-Nek2Delta LZ, respectively, and inserted into the SmaI site of pAS2 to create pAS2-Nek2 and pAS2-Nek2Delta LZ. The C-terminal noncatalytic domain of Nek2 was excised on an XmnI fragment and subcloned into the SmaI site of pAS2 to create pAS2-Nek2-Cterm. Subsequently, Nek2 was cut out of pAS2-Nek2 on a NcoI-BamHI fragment and inserted into pACT2 cut with NcoI and BamHI to generate pACT2-Nek2. pAS1-SNF1 and pACT-SNF4 (also called pSE1112 and pSE1111, respectively) were gifts of S. Elledge (Baylor College, Houston, TX). To generate a baculovirus expressing the Nek2Delta LZ mutant, Nek2Delta LZ was excised from pGEM-Nek2Delta LZ on a NaeI-XbaI fragment and subcloned into pVL1392 (Pharmingen Corp.) cut with PstI (blunted) and XbaI, giving pVL1392-Nek2Delta LZ. Recombinant Nek2Delta LZ baculovirus was generated by cotransfection of pVL1392-Nek2Delta LZ and BaculoGold DNA (Pharmingen Corp.) and subsequent amplification of viral DNA.

Yeast Two-hybrid Interaction Assays-- Parent plasmids, pAS2 and pACT2, and the yeast strain, Y190, for two-hybrid interaction assays were kindly provided by S. Elledge (Baylor College, Houston, TX), and interaction analyses by histidine auxotrophy selection and beta -galactosidase filter lift assays were as described in Harper et al. (16). Quantitative measurement of beta -galactosidase activity using the substrate, O-nitrophenyl-beta -D-galactopyranoside, was as described in Durfee et al. (17).

In Vitro Translation, Immunoprecipitation, and Protein Kinase Assays-- Nek2 constructs were translated in vitro using the TnT-coupled transcription/translation kit in the presence of [35S]methionine/cysteine (Expre35S35S, NEN Life Science Products) according to manufacturer's instructions (Promega Corp.). For coprecipitation experiments, reticulocyte lysates were first incubated separately for 60 min and then together for 60 min at 30 °C. Immunoprecipitation of Nek2 proteins and in vitro kinase assays was carried out exactly as described by Fry and Nigg (3). Samples were then processed on 12% SDS-polyacrylamide gels, and the gels were dried and exposed to x-ray film to detect 35S- or 32P-labeled proteins.

Immunofluorescence Microscopy-- For antibody staining of whole cells, U2OS cells were grown on acid-treated coverslips and fixed with methanol at -20 °C for 6 min. Following fixation, coverslips were washed three times with PBS, blocked with 1% bovine serum albumin in PBS for 10 min, and washed again three times with PBS. All subsequent antibody incubations were carried out in PBS containing 3% bovine serum albumin. Myc-tagged proteins were detected using undiluted tissue culture supernatant from the anti-Myc monoclonal antibody 9E10 followed by fluorescein isothiocyanate-conjugated anti-mouse Fab fragment (1:100, Sigma). Centrosome staining was carried out with an anti-gamma -tubulin rabbit polyclonal antibody (1.8 µg/ml IgGs) (12) followed by biotinylated anti-rabbit secondary antibodies (1:50, Amersham Pharmacia Biotech) and Texas Red-conjugated streptavidin (1:200, Amersham Pharmacia Biotech). DNA staining was carried out with Hoechst 33258 (0.2 µg/ml in PBS). Immunofluorescence microscopy was performed using a Zeiss Axioplan II microscope (Thornwood, NY) and a ×63 oil-immersion objective. Photographs were taken using a Quantix 1400 CCD camera (Photometrics, Inc., Tuscon, AZ) and IP-Lab software, and the images were processed using Adobe Photoshop (San Jose, CA).

    RESULTS
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

Nek2 Complexes in Human and Insect Cells-- To search for potential Nek2 complexes in cells, extracts were prepared from human HeLa tissue culture cells and subjected to centrifugation for 24 h on 15-50% glycerol gradients. Western blotting with anti-Nek2 antibodies revealed that Nek2 exists as a single complex of approximately 6 S (Fig. 1A, top panel). This complex was maintained when extracts were prepared in the presence of 500 mM NaCl, indicating that it is highly stable and resistant to electrostatic disruption (Fig. 1A, bottom panel). We then tested whether recombinant Nek2 was also present in such a complex. For this purpose, Nek2 protein was expressed from baculoviruses in insect cells, and the cell extracts were processed by centrifugation through equivalent 15-50% glycerol gradients. Western blotting of the different gradient fractions with anti-Nek2 antibodies revealed that wild-type recombinant Nek2 was also present as a 6 S complex (Fig. 1B, top panel). beta -Casein kinase assays performed on Nek2 immunoprecipitates from across the gradient confirmed the presence of Nek2 kinase activity in the same fractions as the 6 S complex (data not shown). Moreover, the 6 S complex was also observed in extracts of insect cells expressing a catalytically inactive Nek2 mutant, Nek2-K37R (8), indicating that Nek2 activity itself is not required for formation of the 6 S complex (data not shown).


View larger version (27K):
[in this window]
[in a new window]
 
Fig. 1.   Nek2 complexes in insect and human cells. A, glycerol gradient centrifugation of extracts prepared from human HeLa tissue culture cells in the presence of either 50 mM (top panel) or 500 mM (bottom panel) NaCl. B, glycerol gradient centrifugation of extracts prepared from insect cells infected with recombinant baculoviruses encoding wild-type Nek2 (top panel) or Nek2Delta LZ (bottom panel). In both cases, cell extracts were separated by centrifugation through 15-50% glycerol gradients. Fractions were then collected from the top of the gradients and assayed for the presence of Nek2 protein by Western blotting with an anti-Nek2 antibody. The positions of marker proteins in the gradients are indicated underneath (both as molecular mass, kDa; and sedimentation value, S). C, the Nek2 and NIMA protein sequences were analyzed by the COILS program (window 28) (44), which predicts the propensity of a sequence to form coiled-coils on a scale of 0-1 (vertical scale). This is plotted as a function of the linear sequence of amino acids (horizontal scale). Underneath the output for each protein is a schematic view of their domain structure with the catalytic domain in hatched format. Note that in both proteins a coiled-coil domain is present immediately downstream of the catalytic domain, despite no obvious primary sequence conservation in this region. N, N terminus; C, C terminus.

Dimerization of Nek2 Occurs Through a Leucine Zipper Motif-- The demonstration that Nek2, a 48-kDa protein, is present in a 6 S complex, the expected size of a 100-kDa globular protein, suggested the possibility that both cellular and recombinant Nek2 preferentially form dimers. This would also explain why no monomeric Nek2 is seen upon high level overexpression in insect cells. Therefore, we analyzed the primary sequence of Nek2 for the presence of potential dimerization motifs and identified two putative coiled-coil motifs in the C-terminal noncatalytic domain, one immediately downstream of the catalytic domain and the other at the extreme C terminus (Fig. 1C, top panel). Intriguingly, the closest relatives to vertebrate Nek2, namely NIMA (A. nidulans), NIM-1 (Neurospora crassa), and Kin3p/Npk1p (Saccharomyces cerevisiae), all contain a predicted coiled-coil motif immediately downstream of the catalytic domain, despite the lack of primary sequence conservation in this region (shown for NIMA in Fig. 1C, bottom panel; not shown for NIM-1 and Kin3p/Npk1p; see also Ref. 18). This first coiled-coil motif in Nek2 bears a certain resemblance to a leucine zipper in so far as it contains a heptad repeat of leucine residues in position d of the coiled-coil. It is well known that coiled-coil motifs in general act as protein-protein interaction domains and that leucine zippers, in particular, allow both homo- and heterodimerization of proteins. Therefore, to experimentally address the role of this putative leucine zipper motif, we created a deletion mutant, termed Nek2Delta LZ, that entirely lacks the leucine zipper residues 306-334. Using this mutant we adopted three approaches to test whether Nek2 does indeed form dimers and whether this dimerization is dependent upon the leucine zipper motif.

First, we tested whether the leucine zipper was required for formation of the 6 S complex. The Nek2Delta LZ mutant was expressed in insect cells from a recombinant baculovirus, and cell extracts were again subjected to glycerol gradient centrifugation. Western blotting of the gradient fractions with Nek2 antibodies revealed that the 6 S complex now disappeared. Instead, Nek2 reactivity was present in fractions of approximately 4 S, i.e. the size of a monomeric globular protein of 50 kDa (Fig. 1B, bottom panel). Thus, deletion of the leucine zipper prevents recombinant Nek2 from forming the 6 S complex, apparently leaving the mutant protein as a monomer.

Second, we used a yeast two-hybrid interaction assay to directly test the potential for Nek2-Nek2 interaction in vivo. For this purpose, we created double transformants of the yeast strain, Y190, containing different Nek2 constructs fused to either the GAL4 DNA binding domain or the GAL4 activation domain. A positive interaction was indicated by growth on histidine selective medium (Fig. 2A) and a blue color on a beta -galactosidase filter lift assay (data not shown). When mixed with control proteins, SNF1 or SNF4, wild-type Nek2 did not activate the reporters when present either as a DNA binding domain fusion protein or an activation domain fusion protein. However, when Nek2 was placed on the two halves of the interaction system, both reporters were clearly positive, showing that Nek2 was interacting with itself (Fig. 2A). Using the Nek2Delta LZ mutant, we found that deletion of the leucine zipper from one Nek2 molecule completely abolished the interaction with a full-length Nek2 molecule. Conversely, using one full-length Nek2 molecule and one truncated Nek2 molecule containing the C-terminal noncatalytic domain alone (but including the leucine zipper), the interaction was once again restored (Fig. 2A). The relative strength of these interactions was determined by measuring the activity of the beta -galactosidase reporter in the yeast double transformants using the substrate, O-nitrophenyl-beta -D-galactopyranoside (Fig. 2B). The Nek2-Nek2 interaction was almost 20 times stronger than the control interaction between the yeast proteins, SNF1 and SNF4 (19). The interaction was even stronger between full-length Nek2 and the Nek2 C-terminal domain alone, perhaps as a result of reduced steric hindrance. This assay also confirmed that deletion of the leucine zipper completely blocked the interaction, with levels of reporter activity no greater than the negative controls. Equivalent expression of the various Nek2 proteins in all double transformants was controlled by Western blotting of yeast extracts with anti-Nek2 antibodies (data not shown).


View larger version (48K):
[in this window]
[in a new window]
 
Fig. 2.   Nek2 homodimerization in a yeast two-hybrid interaction assay. A, yeast Y190 double transformants were tested for a positive interaction between the GAL4 DNA binding domain fusion protein (indicated first) and the GAL4 activation domain fusion protein (indicated second). The right panel shows nutrient selection for the histidine reporter gene indicative of a positive interaction, whereas the respective partners in each sector are indicated schematically in the left panel. B, quantitative assay for beta -galactosidase activity using the substrate O-nitrophenyl-beta -D-galactopyranoside (ONPG). Units of activity are relative to the SNF1-SNF4 interaction and given an arbitrary value of 1.0. Results are the mean of three independent experiments. C-term, C-terminal.

Third, an in vitro coprecipitation approach was used. A Myc-tagged version of the Nek2 C-terminal domain containing the leucine zipper was transcribed and translated in vitro either alone or in combination with untagged wild-type Nek2 or untagged Nek2Delta LZ (Fig. 3, lanes 1-3). The anti-Myc monoclonal antibody, 9E10, was then used to immunoprecipitate the Myc-tagged Nek2 C-terminal domain from these mixes (Fig. 3, lanes 4-6). The untagged full-length Nek2 molecule was coprecipitated (Fig. 3, lane 5), indicating that the full-length molecule could interact with the Nek2 C-terminal domain. However, the untagged Nek2Delta LZ was not coprecipitated (Fig. 3, lane 6), confirming that this interaction required the presence of the leucine zipper. Hence, multiple approaches concur to demonstrate that the recombinant Nek2 kinase can specifically dimerize through its leucine zipper motif.


View larger version (48K):
[in this window]
[in a new window]
 
Fig. 3.   In vitro dimerization of Nek2 in a coprecipitation assay. A Myc-tagged version of the Nek2 C-terminal domain (Cterm) was translated alone in vitro (lanes 1 and 4) or together with untagged versions of wild-type Nek2 (lanes 2 and 5) or Nek2Delta LZ (lanes 3 and 6) in the presence of [35S]methionine. A portion of each sample was run out on a 12% polyacrylamide gel and exposed to autoradiography either before (lanes 1-3) or after (lanes 4-6) immunoprecipitation with the 9E10 anti-Myc antibody. Molecular masses (kDa) are indicated on the left, and the positions of the Nek2 proteins on the right. IP, immunoprecipitate; IVT, in vitro translation.

Dimerization Allows Nek2 Trans-autophosphorylation-- We have previously noted that the Nek2 kinase is capable of autophosphorylation and that this occurs predominantly on serine residues (8, 20). Having shown that the C-terminal domain of Nek2 could coprecipitate with full-length active Nek2, we tested whether this also led to phosphorylation of the C-terminal domain by the full-length kinase. Proteins were prepared by separate in vitro translation reactions (Fig. 4, lanes 1-4) and mixed prior to immunoprecipitation with anti-Myc antibodies (Fig. 4, lanes 5-8). In this experiment, all Nek2 constructs were Myc-tagged, and hence immunoprecipitation with the anti-Myc antibody led to the isolation of all in vitro translated proteins irrespective of whether or not there was an interaction between them. In vitro kinase assays were then performed on immunoprecipitates containing mixtures of wild-type or mutant Nek2 proteins (Fig. 4, lanes 9-12). We found that the Nek2 C-terminal domain construct became strongly phosphorylated when mixed with the full-length, wild-type Nek2 but not the catalytically inactive Nek2 mutant, Nek2-K37R (Fig. 4, compare lanes 10 and 11). Autophosphorylation and gel retardation of the full-length Nek2 protein was also seen with the active, but not inactive, molecule. The Nek2Delta LZ mutant, which does not interact with the Nek2 C-terminal domain, caused only very minor phosphorylation of the C-terminal domain (Fig. 4, lane 12). In addition, there was an almost negligible level of autophosphorylation of the Nek2Delta LZ protein itself. These results indicate that Nek2 protein can trans-autophosphorylate on its own C-terminal domain and that this only works efficiently in the presence of an intact leucine zipper dimerization motif.


View larger version (55K):
[in this window]
[in a new window]
 
Fig. 4.   The leucine zipper motif allows Nek2 trans-autophosphorylation. Myc-tagged Nek2 proteins were translated in vitro separately in the presence of [35S]methionine (lanes 1-4) before mixing as indicated and immunoprecipitating with the anti-Myc antibody, 9E10 (lanes 5-12). The immunoprecipitates were then incubated in Nek2 kinase buffer containing [32P]ATP for 30 min at 30 °C. Samples were run out on a 12% polyacrylamide gel and exposed to x-ray film. The 35S radioactive signal alone in lanes 5-8 (IP 35 S) was obtained by storing the dried gel for 4 months to allow decay of 32P, whereas the 32P radioactivity alone (IP-Kinase 32P) was obtained by placing an extra piece of film between the freshly dried gel and the x-ray film to screen out the 35S signal. The position of the Myc-Nek2 C-terminal domain (myc:Nek2-Cterm) is indicted on the right. IVT, in vitro translation.

Nek2 Kinase Activity Depends on the Leucine Zipper-- We next asked whether the dimerization motif was required for either the localization of Nek2 to the centrosome or the kinase activity of Nek2 against known exogenous substrates such as beta -casein (8). To test its subcellular localization, a Myc epitope-tagged version of the Nek2Delta LZ mutant was subcloned into a eukaryotic expression vector and transiently transfected into human U2OS osteosarcoma cells. Colocalization of anti-Myc antibodies in transfected cells with antibodies against the known centrosomal protein gamma -tubulin clearly indicated that this construct could still associate with the centrosome (Fig. 5A). Hence, the leucine zipper motif is not by itself necessary for the localization of Nek2 to the centrosome. Furthermore, this result strongly argues that deletion of the leucine zipper does not cause major unfolding of the Nek2 kinase.


View larger version (62K):
[in this window]
[in a new window]
 
Fig. 5.   Nek2Delta LZ localizes to the centrosome but has reduced kinase activity. A, human U2OS osteosarcoma cells were transiently transfected with the pCMV-Myc-Nek2Delta LZ plasmid and fixed after 24 h in cold methanol. Cells were then double-stained with the Myc 9E10 monoclonal antibody to identify transfected protein (a) and a polyclonal gamma -tubulin antibody to reveal the centrosomes (b). Colocalization of the mutant Nek2 protein with centrosomes is indicated by an arrowhead. Scale bar, 10 µm. B, Myc-tagged Nek2 proteins, wild-type Nek2 (Nek2wt, lanes 2 and 5), catalytically inactive Nek2 (K37R, lanes 1 and 4), and the Nek2 leucine zipper deletion mutant (Delta LZ, lanes 3 and 6) were translated in vitro in the presence of [35S]methionine, and aliquots were run out on a 12% polyacrylamide gel and exposed to autoradiography (lanes 1-3). The remainder of each sample was immunoprecipitated with the 9E10 anti-Myc antibody, and in vitro beta -casein kinase assays with [32P]ATP were carried out. Reaction products were resolved on a 12% polyacrylamide gel and analyzed by autoradiography (lanes 4-6). Molecular masses (kDa) are indicated on the left, and the positions of beta -casein and Nek2 proteins are indicated on the right. Note that the radioactivity in lanes 4-6 is a mixture of the 35S and 32P signals.

To determine whether the leucine zipper was required for Nek2 kinase activity, beta -casein kinase assays were carried out using equal amounts of in vitro translated Nek2 proteins (Fig. 5B, lanes 1-3). Strikingly, we found that the activity of the Nek2Delta LZ mutant was significantly reduced (at least 5-fold) as compared with the wild-type kinase (Fig. 5B, compare lanes 5 and 6). The mutant, Nek2-K37R, containing a substitution in the nucleotide-binding motif was inactive in this assay, as expected (Fig. 5B, lane 4). Autophosphorylation of the wild-type Nek2 protein led to both 32P labeling and a reduction in its electrophoretic mobility (Fig. 5B, lane 5). However, the Nek2Delta LZ mutant was not detectably labeled with 32P and did not show any significant change in mobility, confirming our earlier results that this mutant is unable to autophosphorylate. This striking reduction in kinase activity in the Nek2Delta LZ mutant was confirmed by comparing the activity of baculovirus-expressed recombinant proteins (data not shown). However, as deletion of the leucine zipper prevents both autophosphorylation and phosphorylation of exogenous substrates, we cannot distinguish at the present time whether full activity is strictly dependent upon dimerization or autophosphorylation (or both).

The Nek2 Leucine Zipper Contains a Highly Unusual Arrangement of Amino Acids-- Traditional leucine zippers, such as those present in the bZIP transcription factors c-Myc, c-Jun, and GCN4, contain hydrophobic residues at both of the spatially adjacent positions a and d. This allows the creation of a hydrophobic core (a, d, a', d') upon dimerization (21, 22). Contrary to this arrangement, however, Nek2 lacks hydrophobic residues at position a. Instead, the hydrophobic d position is flanked on one side at position a by acidic glutamate residues and on the other at position g by basic arginine and lysine residues. This presents a highly unusual arrangement whereby the single hydrophobic arm is flanked by two oppositely charged hydrophilic arms (Fig. 6A). To our knowledge, no other leucine zippers have yet been found with such a striking arrangement of charged and hydrophobic residues.


View larger version (19K):
[in this window]
[in a new window]
 
Fig. 6.   Dimerization occurs through an unusual leucine zipper motif. A, helical wheel representation of amino acids 306-340 of the Nek2 protein showing the regular heptad repeat of leucine residues at position d flanked by a basic arm of residues at position g and by an acidic glutamate arm of residues at position a. B, a hypothetical wire diagram model of a Nek2 leucine zipper dimer as calculated using the ICM program (47) and viewed with RasMol (48). The model is based on the coordinates of the two-stranded coiled-coil region of the yeast GCN4 transcriptional activator (deposited in the Protein Data Bank under accession number 2ZTA). The Nek2 model was generated by replacing the GCN4 coiled-coil side chains by the corresponding side chains of Nek2. The correspondence relationship is based on the coiled-coil register as determined by the COILS2 program (22, 46). Subsequent to the side chain replacement, sterical clashes were removed by the ICM program (47). The individual alpha -helices are right-handed and run parallel, and the coil of the helices is left-handed. Leucine residues in position d of each monomer are indicated in yellow, whereas the acidic glutamate residues in position a of one monomer are in red, and the basic lysine or arginine residues in position g of the other monomer are in blue. The symmetrical pair of glutamate and basic residues on the back side of the molecule are omitted for clarity. C, a schematic model illustrating the interaction of two full-length Nek2 molecules is shown. Dimerization is shown to occur between parallel leucine zippers (LZ) such that it allows the C-terminal domain (C-term) of one molecule to be phosphorylated by the catalytic domain (CAT) of the second molecule. P, phosphate.

Although we have no direct physical evidence for coiled-coil formation, modeling of this unusual leucine zipper reveals that homodimerization between parallel coiled-coils is energetically feasible with both hydrophobic and electrostatic interactions contributing to dimer formation (Fig. 6B). The leucine residues all point into the central core of the zipper as would be expected, whereas the glutamate residues at position a of one monomer contact the basic residues of position g of the other monomer and vice versa. Antiparallel coiled-coils are electrostatically unfavorable as like charged side chains would be brought into close juxtaposition. Comparison of models also indicates that a dimer of coiled-coils is more energetically favorable than a trimer (data not shown), and the presence of polar residues at positions a and g should tend anyway to favor dimers, where they are still partly solvated, rather than trimers or tetramers, where they are more hidden in the hydrophobic core (22).

    DISCUSSION
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

In this study, we have examined the role of an unusual leucine zipper motif present in the C-terminal noncatalytic domain of the human serine/threonine kinase, Nek2. We found that in human tissue culture cells endogenous Nek2 is present as a 6 S complex, the predicted size of a Nek2 dimer. Nek2 also forms a 6 S complex in insect cells following high level overexpression, suggesting that no other proteins are required to form this complex. Deletion of the leucine zipper motif from the recombinant protein leads to a smaller complex, the size of a Nek2 monomer, implying that both endogenous and recombinant wild-type Nek2 form homodimers. In further support of Nek2 homodimerization, yeast two-hybrid and coprecipitation assays demonstrated that recombinant Nek2 can interact strongly with itself, that this interaction occurs through the C-terminal noncatalytic domain, and that it is strictly dependent upon the presence of the leucine zipper. Taken together, these data provide persuasive evidence that the preferred state of soluble Nek2 protein in cells is a dimer (Fig. 6C). Furthermore, we found that the leucine zipper allows recombinant Nek2 to trans-autophosphorylate on its C-terminal domain and achieve full activity on exogenous substrates such as beta -casein.

We have previously shown that Nek2 associates with the centrosome, the major microtubule organizing center of the cell (12). However, like other centrosomal proteins studied to date (e.g. Refs. 23 and 24), the bulk of cellular Nek2 (up to 90%) is noncentrosomal. Indeed, it is now thought that the centrosome is a highly dynamic structure with a frequent exchange of many proteins between a centrosomal and noncentrosomal pool. The 6 S Nek2 complex analyzed in this study was obtained from the soluble fraction of cell extracts, and we assume, but cannot presently prove, that the fraction of Nek2 present at the centrosome at the time of extraction represents a similar oligomeric state. In contrast to Nek2, the centrosomal protein gamma -tubulin has been shown to exist in a large 25 S complex, known as the gamma -tubulin ring complex or gamma -TuRC, both at the centrosome and in the cytoplasm (23, 25, 26). Homodimerization is not necessary for recombinant Nek2 to associate with the centrosome, because deletion of the leucine zipper did not prevent centrosomal localization. We previously showed that Nek2 interacts with the core centrosomal protein C-Nap1 and that this interaction does not require the Nek2 leucine zipper (13). Whether the interaction with C-Nap1 is sufficient for the localization of Nek2 to the centrosome is not known.

Importantly, deletion of the Nek2 leucine zipper led to a significant loss of Nek2 activity against exogenous substrates. Moreover, the leucine zipper deletion mutant was less efficient in stimulating centrosome splitting, a phenotype dependent on Nek2 kinase activity, when transfected into U2OS cells.2 Recombinant and cellular NIMA were also reported to exist as oligomers, perhaps involving a complex of four catalytic subunits, although the effect of oligomerization on NIMA activity was not addressed (27). Whether the equivalent coiled-coil of NIMA contributes to oligomerization is also not clear. However, this domain was necessary for the G2 block imposed by dominant negative mutants expressed in both Aspergillus and human cells (28, 29). This suggests that in these experiments the coiled-coil domain of the overexpressed protein was acting as a competitive inhibitor of normal physiological interactors of NIMA. Indeed, NIMA, through its coiled-coil domain, has been shown to bind the peptidyl-prolyl isomerase Pin1 that is essential for correct mitotic regulation (30). Thus, the dominant negative mutants might act through sequestration of endogenous NIMA-like kinases and/or other proteins.

The role of dimerization in the activation of receptor tyrosine kinases has long been established. However, only recently has dimerization been recognized as an important mechanism for the regulation of many serine/threonine kinases as well. The demonstration that dimerization modulates the activity of recombinant Nek2 falls in line with recent results on, for instance, the c-raf-1 proto-oncogene (31, 32) and the mitogen-activated protein kinase extracellular signal-regulated kinase 2 (33). Leucine zippers, in particular, have now been described in several serine/threonine kinases, including type I and II cGMP-dependent protein kinases (34, 35), the mixed lineage kinase family (36, 37), TOUSLED kinase of Arabidopsis (38), the protein kinase C-related protein kinase N (34), DNA-dependent kinase catalytic subunit (an enzyme with a catalytic domain related to phosphatidylinositol 3-kinases) (39), and ZIP kinase (41). Homodimerization through the leucine zipper has been shown to result in activation at least in the case of TOUSLED and ZIP kinase, whereas the DNA-dependent protein kinase catalytic subunit can be activated through leucine zipper-dependent heterodimerization with the DNA-binding protein C1D (40).

As Nek2 dimerization also leads to a trans-autophosphorylation reaction, the question remains open as to whether it is the dimerization per se or the autophosphorylation reaction that is necessary to achieve full activation of the kinase. Mapping and subsequent mutation of the autophosphorylation site(s) will be necessary to answer this question. Likewise, it is inherently difficult to determine whether the absence of a trans-autophosphorylation reaction in the leucine zipper deletion mutant is the result of a failure to dimerize or a reduced kinase activity toward the C-terminal domain. Unraveling these dependences will probably require a detailed understanding of Nek2 structure. What we clearly can conclude at this stage, though, is that removal of the leucine zipper motif prevents dimerization, interferes with a trans-autophosphorylation reaction, and reduces kinase activity toward exogenous substrates.

The Nek2 leucine zipper lies within a putative coiled-coil that is conserved in secondary structure, although not primary sequence, among a subfamily of NIMA-related kinases that include human Nek2, Aspergillus NIMA, Neurospora NIM-1, and Saccharomyces Kin3p/Npk1p (3). However, whereas both NIM-1 and Kin3p/Npk1 have heptad repeats of leucines, only Nek2 has a perfectly maintained arrangement of basic and acidic residues flanking the leucine position. The classical leucine zippers of bZIP transcription factors conform to the consensus of a heptad repeat (abcdefg)n of hydrophobic residues in a 4-3 pattern in which leucines are conserved at position d (21). This allows formation of a parallel, two-stranded coiled-coil of alpha -helices. The a position is usually occupied by beta -branched hydrophobic amino acids (i.e. valine or isoleucine), but occasional polar or charged residues are tolerated (as seen, for example, in c-Fos or c-Myc). The amino acids at positions e and g are typically charged to allow both intra- or interhelical electrostatic interactions, with e and g of one monomer interacting with g' and e', respectively, of the second monomer in parallel coiled-coils (42). Crystal structures of leucine zipper dimers have revealed that this contributes to stabilization or destabilization of the zipper and thus a degree of specificity for dimerization between different leucine zipper proteins (43-45). Clearly, the most obvious deviation from this framework in the Nek2 leucine zipper is that the a position possesses no hydrophobic residues at all, but instead contains a perfect repeat of negatively charged residues consisting entirely of glutamic acids. It is unlikely that there could be much interaction between the e and g positions of the respective Nek2 monomers as both are overall basic. Yet, there is complete conservation of the leucines in position d, and all the acidic and basic residues in positions a and g, respectively, in human and mouse Nek2 (9-11) as well as in Xenopus Nek2,2 implying that this unusual sequence arrangement is critical to the performance of the Nek2 leucine zipper. Moreover, the observation that the Nek2 dimer was resistant to 500 mM NaCl demonstrates the stability of this structure and highlights the strength of the electrostatic interactions involved in dimerization. High resolution structural analyses will be needed in the future to determine the precise conformation of this interaction.

    ACKNOWLEDGEMENTS

We thank Kay Hofmann (MEMOREC, Cologne, Germany) for expert help with computer modeling, Steve Elledge (Baylor College, Houston, TX) for providing strains and plasmids for yeast interaction assays, and Nicolas Roggli (University of Geneva, Switzerland) for artwork. We also thank all members of the laboratory for useful discussion.

    FOOTNOTES

* The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

Dagger To whom correspondence should be addressed: Dept. of Biochemistry, Adrian Bldg., University of Leicester, University Rd., Leicester LE1 7RH, UK. Tel.: 44 116 252 5024; Fax: 44 116 252 3369; E-mail: amf5{at}le.ac.uk.

2 A. M. Fry and E. A. Nigg, unpublished results.

    ABBREVIATIONS

The abbreviation used is: PBS, phosphate-buffered saline.

    REFERENCES
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES
  1. Morris, N. R. (1976) Genet. Res. Camb. 26, 237-254
  2. Osmani, S. A., Pu, R. T., and Morris, N. R. (1988) Cell 53, 237-244[CrossRef][Medline] [Order article via Infotrieve]
  3. Fry, A. M., and Nigg, E. A. (1997) Methods Enzymol. 283, 270-282[Medline] [Order article via Infotrieve]
  4. Schultz, S. J., and Nigg, E. A. (1993) Cell Growth Differ. 4, 821-830[Abstract]
  5. Schultz, S. J., Fry, A. M., Sütterlin, C., Ried, T., and Nigg, E. A. (1994) Cell Growth Differ. 5, 625-635[Abstract]
  6. Levedakou, E. N., He, M., Baptist, E. W., Craven, R. J., Cance, W. G., Welcsh, P. L., Simmons, A., Naylor, S. L., Leach, R. J., Lewis, T. B., Bowcock, A., and Liu, E. T. (1994) Oncogene 9, 1977-1988[Medline] [Order article via Infotrieve]
  7. Lu, K. P., and Hunter, T. (1995) in Progress in Cell Cycle Research (Meijer, L., Guidet, S., and Tung, H. Y. L., eds), Vol. 1, pp. 187-205, Plenum Press, New York
  8. Fry, A. M., Schultz, S. J., Bartek, J., and Nigg, E. A. (1995) J. Biol. Chem. 270, 12899-12905[Abstract/Free Full Text]
  9. Rhee, K., and Wolgemuth, D. J. (1997) Development 124, 2167-2177[Abstract]
  10. Tanaka, K., Parvinen, M., and Nigg, E. A. (1997) Exp. Cell Res. 237, 264-274[CrossRef][Medline] [Order article via Infotrieve]
  11. Arama, E., Yanai, A., Kilfin, G., Bernstein, A., and Motro, B. (1998) Oncogene 16, 1813-1823[CrossRef][Medline] [Order article via Infotrieve]
  12. Fry, A. M., Meraldi, P., and Nigg, E. A. (1998) EMBO J. 17, 470-481[CrossRef][Medline] [Order article via Infotrieve]
  13. Fry, A. M., Mayor, T., Meraldi, P., Stierhof, Y.-D., Tanaka, K., and Nigg, E. A. (1998) J. Cell Biol. 141, 1563-1574[Abstract/Free Full Text]
  14. Krek, W., and Nigg, E. A. (1991) EMBO J. 10, 3331-3341[Medline] [Order article via Infotrieve]
  15. Schmidt-Zachmann, M. S., and Nigg, E. A. (1993) J. Cell Sci. 105, 799-806[Abstract]
  16. Harper, J. W., Adami, G. R., Wei, N., Keyomarsi, K., and Elledge, S. J. (1993) Cell 75, 805-816[CrossRef][Medline] [Order article via Infotrieve]
  17. Durfee, T., Becherer, K., Chen, P.-L., Yeh, S.-H., Yang, Y., Kilburn, A. E., Lee, W.-H., and Elledge, S. J. (1993) Genes Dev. 7, 555-569[Abstract/Free Full Text]
  18. Osmani, S. A., and Ye, X. S. (1996) Biochem. J. 317, 633-641
  19. Fields, S., and Song, O. (1989) Nature 340, 245-246[CrossRef][Medline] [Order article via Infotrieve]
  20. Gallant, P., Fry, A. M., and Nigg, E. A. (1995) J. Cell Sci. Suppl. 19, 21-28[Abstract]
  21. Alber, T. (1992) Curr. Opin. Genet. Dev. 2, 205-210[CrossRef][Medline] [Order article via Infotrieve]
  22. Lupas, A. (1996) Methods Enzymol. 266, 513-525[Medline] [Order article via Infotrieve]
  23. Moudjou, M., Bordes, N., Paintrand, M., and Bornens, M. (1996) J. Cell Sci. 109, 875-887[Abstract]
  24. Paoletti, A., Moudjou, M., Paintrand, M., Salisbury, J. L., and Bornens, M. (1996) J. Cell Sci. 109, 3089-3102[Abstract]
  25. Moritz, M., Braunfeld, M. B., Sedat, J. W., Alberts, B., and Agard, D. A. (1995) Nature 378, 638-640[CrossRef][Medline] [Order article via Infotrieve]
  26. Zheng, Y., Wong, M. L., Alberts, B., and Mitchison, T. (1995) Nature 378, 578-583[CrossRef][Medline] [Order article via Infotrieve]
  27. Lu, K. P., Osmani, S. A., and Means, A. R. (1993) J. Biol. Chem. 268, 8769-8776[Abstract/Free Full Text]
  28. Lu, K. P., and Means, A. R. (1994) EMBO J. 13, 2103-2113[Medline] [Order article via Infotrieve]
  29. Lu, K. P., and Hunter, T. (1995b) Cell 81, 413-424[CrossRef][Medline] [Order article via Infotrieve]
  30. Lu, K. P., Hanes, S. D., and Hunter, T. (1996) Nature 380, 544-547[CrossRef][Medline] [Order article via Infotrieve]
  31. Farrar, M. A., Alberola-Ila, J., and Perlmutter, R. M. (1996) Nature 383, 178-181[CrossRef][Medline] [Order article via Infotrieve]
  32. Luo, Z., Tzivion, G., Belshaw, P. J., Vavvas, D., Marshall, M., and Avruch, J. (1996) Nature 383, 181-185[CrossRef][Medline] [Order article via Infotrieve]
  33. Khokhlatchev, A. V., Canagarajah, B., Wilsbacher, J., Robinson, M., Atkinson, M., Goldsmith, E., and Cobb, M. H. (1998) Cell 93, 605-615[CrossRef][Medline] [Order article via Infotrieve]
  34. Wernet, W., Flockerzi, V., and Hofmann, F. (1989) FEBS Lett. 251, 191-196[CrossRef][Medline] [Order article via Infotrieve]
  35. Gamm, D. M., Francis, S. H., Angelotti, T. P., Corbin, J. D., and Uhler, M. D. (1995) J. Biol. Chem. 270, 27380-27388[Abstract/Free Full Text]
  36. Holzman, L. B., Merritt, S. E., and Fan, G. (1994) J. Biol. Chem. 269, 30808-30817[Abstract/Free Full Text]
  37. Dorow, D. S., Devereux, L., Dietzsch, E., and De Kretser, T. (1993) Eur. J. Biochem. 213, 701-710[Medline] [Order article via Infotrieve]
  38. Roe, J. L., Durfee, T., Zupan, J. R., Repetti, P. P., McLean, G., and Zambryski, P. C. (1997) J. Biol. Chem. 272, 5838-5845[Abstract/Free Full Text]
  39. Mukai, H., and Ono, Y. (1994) Biochem. Biophys. Res. Commun. 199, 897-904[CrossRef][Medline] [Order article via Infotrieve]
  40. Yavuzer, U., Smith, G. C. M., Bliss, T., Werner, D., and Jackson, S. P. (1998) Genes Dev. 12, 2188-2199[Abstract/Free Full Text]
  41. Kawai, T., Matsumoto, M., Takeda, K., Sanjo, H., and Akira, S. (1998) Mol. Cell. Biol. 18, 1642-1651[Abstract/Free Full Text]
  42. Gentz, R., Rauscher, F. J., Abate, C., and Curran, T. (1989) Science 243, 1695-1699[Abstract/Free Full Text]
  43. O'Shea, E. K., Klemm, J. D., Kim, P. S., and Alber, T. (1991) Science 254, 539-544[Abstract/Free Full Text]
  44. Ferré-D'Amaré, A. R., Prendergast, G. C., Ziff, E. B., and Burley, S. K. (1993) Nature 363, 38-45[CrossRef][Medline] [Order article via Infotrieve]
  45. Glover, J. N. M., and Harrison, S. C. (1995) Nature 373, 257-261[CrossRef][Medline] [Order article via Infotrieve]
  46. Lupas, A., Van Dyke, M., and Stock, J. (1991) Science 252, 1162-1164[Free Full Text]
  47. Cardozo, T., Totrov, M., and Abagyan, R. (1995) Proteins 23, 403-414[CrossRef][Medline] [Order article via Infotrieve]
  48. Sayle, R. A., and Milner-White, E. J. (1995) Trends Biochem. Sci. 20, 374[CrossRef][Medline] [Order article via Infotrieve]


Copyright © 1999 by The American Society for Biochemistry and Molecular Biology, Inc.
Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
J. Cell Sci.Home page
J. Chang, R. H. Baloh, and J. Milbrandt
The NIMA-family kinase Nek3 regulates microtubule acetylation in neurons
J. Cell Sci., July 1, 2009; 122(13): 2274 - 2282.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
W. Wu, J. E. Baxter, S. L. Wattam, D. G. Hayward, M. Fardilha, A. Knebel, E. M. Ford, E. F. da Cruz e Silva, and A. M. Fry
Alternative Splicing Controls Nuclear Translocation of the Cell Cycle-regulated Nek2 Kinase
J. Biol. Chem., September 7, 2007; 282(36): 26431 - 26440.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
P. Rellos, F. J. Ivins, J. E. Baxter, A. Pike, T. J. Nott, D.-M. Parkinson, S. Das, S. Howell, O. Fedorov, Q. Y. Shen, et al.
Structure and Regulation of the Human Nek2 Centrosomal Kinase
J. Biol. Chem., March 2, 2007; 282(9): 6833 - 6842.
[Abstract] [Full Text] [PDF]


Home page
J. Cell Sci.Home page
L. M. Quarmby and M. R. Mahjoub
Caught Nek-ing: cilia and centrioles
J. Cell Sci., November 15, 2005; 118(22): 5161 - 5169.
[Abstract] [Full Text] [PDF]


Home page
Mol. Biol. CellHome page
R. S. Hames, R. E. Crookes, K. R. Straatman, A. Merdes, M. J. Hayes, A. J. Faragher, and A. M. Fry
Dynamic Recruitment of Nek2 Kinase to the Centrosome Involves Microtubules, PCM-1, and Localized Proteasomal Degradation
Mol. Biol. Cell, April 1, 2005; 16(4): 1711 - 1724.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
J. Rapley, J. E. Baxter, J. Blot, S. L. Wattam, M. Casenghi, P. Meraldi, E. A. Nigg, and A. M. Fry
Coordinate Regulation of the Mother Centriole Component Nlp by Nek2 and Plk1 Protein Kinases
Mol. Cell. Biol., February 15, 2005; 25(4): 1309 - 1324.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
D. G. Hayward, R. B. Clarke, A. J. Faragher, M. R. Pillai, I. M. Hagan, and A. M. Fry
The Centrosomal Kinase Nek2 Displays Elevated Levels of Protein Expression in Human Breast Cancer
Cancer Res., October 15, 2004; 64(20): 7370 - 7376.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
K. Noguchi, H. Fukazawa, Y. Murakami, and Y. Uehara
Nucleolar Nek11 Is a Novel Target of Nek2A in G1/S-arrested Cells
J. Biol. Chem., July 30, 2004; 279(31): 32716 - 32727.
[Abstract] [Full Text] [PDF]


Home page
J. Cell Sci.Home page
R. M. Guzzo, S. Sevinc, M. Salih, and B. S. Tuana
A novel isoform of sarcolemmal membrane-associated protein (SLMAP) is a component of the microtubule organizing centre
J. Cell Sci., May 1, 2004; 117(11): 2271 - 2281.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
C. Belham, J. Roig, J. A. Caldwell, Y. Aoyama, B. E. Kemp, M. Comb, and J. Avruch
A Mitotic Cascade of NIMA Family Kinases: Nercc1/Nek9 ACTIVATES THE Nek6 AND Nek7 KINASES
J. Biol. Chem., September 12, 2003; 278(37): 34897 - 34909.
[Abstract] [Full Text] [PDF]


Home page
Mol. Biol. CellHome page
A. J. Faragher and A. M. Fry
Nek2A kinase stimulates centrosome disjunction and is required for formation of bipolar mitotic spindles
Mol. Biol. Cell, July 1, 2003; 14(7): 2876 - 2889.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
P. M. Holland, A. Milne, K. Garka, R. S. Johnson, C. Willis, J. E. Sims, C. T. Rauch, T. A. Bird, and G. D. Virca
Purification, Cloning, and Characterization of Nek8, a Novel NIMA-related Kinase, and Its Candidate Substrate Bicd2
J. Biol. Chem., May 3, 2002; 277(18): 16229 - 16240.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
Y. Zhou, F. G. Gwadry, W. C. Reinhold, L. D. Miller, L. H. Smith, U. Scherf, E. T. Liu, K. W. Kohn, Y. Pommier, and J. N. Weinstein
Transcriptional Regulation of Mitotic Genes by Camptothecin-induced DNA Damage: Microarray Analysis of Dose- and Time-dependent Effects
Cancer Res., March 1, 2002; 62(6): 1688 - 1695.
[Abstract] [Full Text] [PDF]


Home page
J. Cell Sci.Home page
R. Graf
DdNek2, the first non-vertebrate homologue of human Nek2, is involved in the formation of microtubule-organizing centers
J. Cell Sci., January 5, 2002; 115(9): 1919 - 1929.
[Abstract] [Full Text] [PDF]


Home page
J. Cell Sci.Home page
A. Fry, P Descombes, C Twomey, R Bacchieri, and E. Nigg
The NIMA-related kinase X-Nek2B is required for efficient assembly of the zygotic centrosome in Xenopus laevis
J. Cell Sci., January 6, 2000; 113(11): 1973 - 1984.
[Abstract] [PDF]


Home page
J. Biol. Chem.Home page
P. O. Vacratsis and K. A. Gallo
Zipper-mediated Oligomerization of the Mixed Lineage Kinase SPRK/MLK-3 Is Not Required for Its Activation by the GTPase cdc 42 but Is Necessary for Its Activation of the JNK Pathway. MONOMERIC SPRK L410P DOES NOT CATALYZE THE ACTIVATING PHOSPHORYLATION OF Thr258 OF MURINE MITOGEN-ACTIVATED PROTEIN KINASE KINASE 4
J. Biol. Chem., September 1, 2000; 275(36): 27893 - 27900.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
M. Chiravuri, H. Lee, S. L. Mathieu, and B. T. Huber
Homodimerization via a Leucine Zipper Motif Is Required for Enzymatic Activity of Quiescent Cell Proline Dipeptidase
J. Biol. Chem., August 25, 2000; 275(35): 26994 - 26999.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
Y.-M. Wu, C.-L. Huang, H.-J. Kung, and C.-Y. F. Huang
Proteolytic Activation of Etk/Bmx Tyrosine Kinase by Caspases
J. Biol. Chem., May 18, 2001; 276(21): 17672 - 17678.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
A. Charest, K. Lane, K. McMahon, and D. E. Housman
Association of a Novel PDZ Domain-containing Peripheral Golgi Protein with the Q-SNARE (Q-soluble N-Ethylmaleimide-sensitive Fusion Protein (NSF) Attachment Protein Receptor) Protein Syntaxin 6
J. Biol. Chem., July 27, 2001; 276(31): 29456 - 29465.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Fry, A. M.
Right arrow Articles by Nigg, E. A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Fry, A. M.
Right arrow Articles by Nigg, E. A.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 All ASBMB Journals   Molecular and Cellular Proteomics 
 Journal of Lipid Research   ASBMB Today 
Copyright © 1999 by the American Society for Biochemistry and Molecular Biology.
Advertisement
spacer
Advertisement
Advertisement