![]()
|
|
||||||||
J Biol Chem, Vol. 274, Issue 23, 16431-16436, June 4, 1999
From the The nucleosomal chromatin structure within genes
is disrupted upon transcription by RNA polymerase II. To determine
whether this disruption is caused by transcription per se
as opposed to the RNA polymerase source, we engineered the yeast
chromosomal HSP82 gene to be exclusively transcribed by
bacteriophage T7 RNA polymerase in vivo. Interestingly, we
found that a fraction of the T7-generated transcripts were 3' end
processed and polyadenylated at or near the 3' ends of the
hsp82 and the immediately downstream CIN2
genes. Surprisingly, the nucleosomal structure of the T7-transcribed hsp82 gene remained intact, in marked contrast to the
disrupted structure generated by much weaker, basal level transcription of the wild type gene by RNA polymerase II under non-heat shock conditions. Therefore, disruption of chromatin structure by
transcription is dependent on the RNA polymerase source. We propose
that the observed RNA polymerase dependence for transcription-induced
nucleosome disruption may be related either to the differential
recruitment of chromatin remodeling complexes, the rates of histone
octamer translocation and nucleosome reformation during polymerase
traversal, and/or the degree of transient torsional stress generated by
the elongating polymerase.
Eukaryotic genomes are packaged in vivo into
chromatin, whose basic repeating unit, the nucleosome, consists of two
copies each of histones H2A, H2B, H3, and H4 along with core and linker DNA sequences of about 200 bp1 (reviewed in Ref. 1). It
has long been recognized that the chromatin structure of
transcriptionally active class II genes exhibits an increase in DNase I
sensitivity and a disrupted nucleosomal structure (reviewed in Refs. 1
and 2). Even relatively weak transcription by RNA polymerase II leads
to a perturbation in nucleosomal structure (3).
In vitro transcription experiments with nucleosomal
templates reveal that the core RNA polymerase II cannot traverse
through nucleosomes (4), suggesting that in vivo the
association between the core enzyme and accessory proteins may be
important for template traversal. Indeed, the RNA polymerase II
transcription complex can be associated with many accessory proteins,
which include elongation factors (reviewed in Ref. 5), SWI/SNF
chromatin remodeling factors (6), and RNA capping (reviewed in Ref. 7), splicing (reviewed in Refs. 8 and 9), cleavage, and polyadenylation activities (10). Several of these activities appear to be targeted through hyperphosphorylation of the carboxyl-terminal domain of RNA
polymerase II (10-12). In vivo these complexes may be so
large that during transcriptional elongation, instead of moving along a
chromatin template, the template itself may be reeled through fixed
nuclear structures (13, 14). Indeed, the hyperphosphorylated form of
elongating RNA polymerase II is quantitatively recovered in the nuclear
matrix fraction (15). On the other hand, the results of in
vitro experiments reveal that single subunit prokaryotic RNA
polymerases such as bacteriophage T7 can readily transcribe through
nucleosome arrays (16-21). Interestingly, however, recently a protein
complex termed FACT (facilitates chromatin transcription) has been
purified that allows the stalled RNA polymerase II molecules to enter
into productive transcription through short chromatin templates
in vitro (22). In addition, in vitro
transcription through nucleosomal templates by RNA polymerase II can
also be stimulated under certain conditions by the SWI/SNF chromatin
remodeling complex (23). Finally, because the activator domains of
transcription factors associated with class II genes sometimes are
involved in recruiting histone acetylase complexes (24, 25), it is conceivable that local histone acetylation may facilitate RNA polymerase II traversal through nucleosomes in vivo.
Insight into nucleosomal structural alterations during traversal by the
SP6 prokaryotic RNA polymerase and by eukaryotic RNA polymerase III has
come from model in vitro transcription experiments of
Felsenfeld and co-workers (26-29). These polymerases pause near the
nucleosome dyad axis, creating intranucleosomal DNA loops, to which
histone octamer translocations may occur. In other words, the histones
never leave the DNA template but are internally transferred to upstream positions.
To determine if there is modification of the chromatin template
in vivo upon transcriptional elongation that is specific to the RNA polymerase employed, we have compared the chromatin structures generated by transcription of the same sequence in Saccharomyces cerevisiae by two different RNA polymerases. We report here that high level transcription by the T7 RNA polymerase has no detectable effect on modifying chromatin structure, whereas even very weak transcription of the same sequence by RNA polymerase II leads to a
marked disruption in nucleosomal structure. These results suggest that
either proteins associated with the RNA polymerase II transcription
machine, the rates of histone octamer translocation and nucleosome
reformation, and/or transient torsional stress modulate chromatin
structure during template traversal in vivo and that
chromatin structural changes are not simply the consequences of
transcription per se.
Strains, Plasmids, and Growth Conditions--
S.
cerevisiae W303-1B (MAT Substituting the T7 Promoter for the HSP82
Promoter--
PCR-splicing by overlap extension (35) followed by
two-step gene replacement was used to place the T7 bacteriophage
promoter ( Placing a T7 Terminator Dimer Near the 3' End of the T7hsp82
Gene--
A 344-bp BamHI/HindIII fragment
containing a dimer of the BglII fragments of pET-3 (36), the
T7 RNA polymerase terminator, was excised from plasmid pT72t (obtained
from Alison Bertuch of the University of Rochester) and ligated into
the EcoRI site (+1601) of the HSP82 gene on
YIpHSP82 plasmid (carries a 2.89-kb BglII-ClaI fragment of the HSP82/CIN2 genes) using
BamHI/EcoRI and
HindIII/EcoRI adapters. This plasmid was
linearized at MluI site and transformed to the
T7hsp strain. The initial selection for URA3
expression and counter-selection were done as described earlier (37).
Retention of the terminator dimer in the forward orientation at the
EcoRI site (+1601) was confirmed by diagnostic PCR and
restriction analysis.
Northern Analysis--
RNA was isolated by one of two procedures
as described elsewhere (3, 38). Northern analysis was performed as
reported previously (3). Total RNA samples (8 µg) or
poly(A)+ RNA, isolated using a Stratagene kit (poly(A)
Quick mRNA Purification Kit number 200349) were separated in
triplicate (except for poly(A)+ RNA) on the same 1.25%
agarose-formaldehyde gels. After completing the run, formaldehyde was
removed from the gels by 4 × 10 min washes at 65 °C in
distilled H2O. RNA was then transferred by capillary action
to Zeta-Probe GT blotting membranes (Bio-Rad) with 2× TAE as transfer
buffer. Following transfer, membranes were cut into three sections,
rinsed in 2× TAE for 5 min, and allowed to air-dry. Membranes were
prehybridized (65 °C for probe 1 and actin; 42 °C for probe 2) in
Church-Gilbert buffer (250 mM sodium phosphate buffer, pH
7.2, 1 mM EDTA, and 7% SDS) (39) and then hybridized
separately to [32P]dCTP-labeled DNA probes (Amersham
Pharmacia Biotech Oligolabeling Kit) in the same buffer and at the same
temperature as above. Probe 1 was 753-bp
XmnI-EcoRI fragment from +848 to +1601 of the HSP82 gene, and probe 2 was a 100-mer from +2190 to 2289 of
the same gene (see Fig. 1). To normalize the RNA loading, one filter was hybridized with an actin probe isolated from pGEMACTIN (40), and
the +318 to +1063 coding sequence was PCR-amplified and labeled as
mentioned above. Following hybridization, membranes were washed 3× in
0.2× SSC, 2% SDS plus 20 mM sodium phosphate buffer, pH 7.0, for 15 min at 53 (probe 2) or 65 °C (probe 1 and actin), and
blots were exposed to PhosphorImaging screens at room temperature or to
x-ray film with intensifying screens at DNase I Chromatin Footprinting Assay--
Yeast cells were
converted to spheroplasts using oxalyticase (Enzogenetics) in the
presence of 20 mM sodium azide, and nuclei were isolated
and digested with DNase I as described previously (3). DNA was prepared
as described (41). For naked DNA controls, DNA was isolated from nuclei
or spheroplasts prior to DNase I treatment. EcoRV-digested
DNA samples (10 µg) were separated by electrophoresis on 2% agarose
gels in 1× TPE (90 mM Tris phosphate, 2 mM
EDTA) and transferred to the Zeta-Probe GT membrane (Bio-Rad) by the
capillary method in 0.4 N NaOH, 0.2 M NaCl.
Following transfer, membranes were neutralized with 40 mM
sodium phosphate buffer, pH 7.0, for 10 min and hybridized overnight at
65 °C with a 32P-labeled probe 694-bp
EcoRV-EcoRI fragment from +911 to +1601 of the
HSP82 gene (described above) for indirect end labeling (42).
After hybridization, filters were washed 3× for 20 min at 65 °C
with 0.1× SSC, 2% SDS plus 20 mM sodium phosphate buffer, pH 7.0. Signals were then visualized as described above.
Engineering T7 RNA Polymerase-mediated Transcription of the Yeast
Chromosomal HSP82 Gene--
Fig. 1
illustrates our experimental strategy to address whether disruption of
nucleosome structure caused by transcription in vivo
exhibits any specificity for the RNA polymerase source. We inactivated
the yeast HSP82 gene promoter for transcription by RNA
polymerase II by creating base changes in heat shock element 1 (designated HSE1) and the TATA box (30). By using PCR techniques, we
substituted 23 bp of the HSP82 start site sequences with
promoter sequences recognized by T7 RNA polymerase (36). This construct was then integrated into the chromosomal locus, replacing the wild type
gene, to create haploid strain T7hsp82 (Fig. 1A).
We also created another strain that in addition possesses a tandem T7
RNA polymerase terminator dimer introduced at a downstream EcoRI site, termed T7hsp82TD (Fig.
1A). These strains contain a galactose-inducible T7 RNA
polymerase expression vector, encoding an enzyme with an engineered
nuclear targeting sequence (31), either as a high copy number plasmid
(GAL:T7) (Fig. 1B) or as a single copy integrated at
LEU2. As a carbon source control, we also transformed the
parent T7hsp82 strains with a blank expression vector. All
these strains were verified by extensive analyses of genomic Southern
patterns, diagnostic PCR assays, and genetic marker constitutions (data
not shown).
Robust Transcription of the Yeast Chromosomal T7hsp82(±TD) Genes
by T7 RNA Polymerase and Efficient Termination for T7hsp82TD--
To
judge the level of T7 RNA polymerase-mediated T7hsp82 gene
transcripts, we performed a Northern analysis and used as a standard
RNA from wild type non-heat shocked yeast. Although the level of basal
transcription from the wild type gene is only 5% that of the
heat-induced maximum (43), even this level of transcription is known to
markedly disrupt nucleosomal structure (see below; Ref. 3). In
addition, at the same time we also evaluated the efficiency of
transcription termination in the strain bearing the terminator dimer by
using a downstream probe (probe 2, see Fig. 1A for map
position). As shown by the Northern analysis in Fig.
2A, in the absence of
expression of T7 RNA polymerase, basal transcription of the wild type
gene is abolished by the promoter mutations introduced into the
T7hsp82 allele (compare lanes 1 and
2). Notably, after induction of T7 RNA polymerase, a
steady-state transcript level 42-fold greater than that of the wild
type standard is observed (Fig. 2A, compare lanes
1 and 3). In the presence of the terminator, no
detectable transcripts are observed with this downstream probe,
indicating that termination is more than 99% efficient (Fig. 2A,
lane 5). To demonstrate directly the presence of the corresponding
shorter transcripts in the strain bearing the terminator, we used a
probe that cross-hybridizes to the 2.46-kb HSC82 cognate
gene transcript, termed probe 1 (see Fig. 1A for map
position), which detects the T7-terminated 1.76-kb novel
hsp82 transcript (Fig. 2B, lane 5); the intensity
of this hybridization signal indicates robust transcription of this
allele. In summary, T7 RNA polymerase actively and faithfully
transcribes these engineered hsp82 alleles.
Processing of T7 Transcripts--
Although T7 RNA polymerase is
very processive (36), the transcripts arising from the terminator minus
strain are fairly short and apparently are processed
post-transcriptionally at several downstream sites because their size
is equal to and greater than those of the wild type allele (Figs.
2A and 3, compare lanes 1 and 3).
Because other studies have shown that yeast class II gene transcript
cleavage and polyadenylation can occur post-transcriptionally in
vitro in cell-free extracts (44, 45) or in purified systems free
of RNA polymerase II (46, 47), we investigated the possibility that
such events may also occur in vivo for these T7-generated transcripts. We affinity fractionated total RNA on oligo(dT) and found
2.3- and 3.3-kb-long T7hsp82 transcripts that were indeed poly(A)+ (Fig. 3, lane
4). Furthermore, it is particularly striking that RNA species
>2.3 kb but <3.3 kb seen as a smear in the input did not fractionate
with poly(A)+ material (Fig. 3, compare lanes 3 and 4). Apparently, the processing signals at the ends of
the hsp82 and immediately downstream CIN2 genes
are used independently of RNA polymerase II transcription. Furthermore,
we verified that the longer sequences possessed both hsp82
and CIN2 gene sequences using a downstream probe (data not shown). Although these results contrast with previous reports in which
class II gene transcripts generated by either RNA polymerase I or III
were found not to be 3'-polyadenylated in mammalian cells (48, 49), our
estimates suggest that such post-transcriptional processing in yeast is
not very efficient and may only represent a few percent of the total
transcript population (data not shown); furthermore, we can not rule
out a trans, post-transcriptional role for RNA polymerase II
in such processing as has been demonstrated recently by in
vitro experiments (50).
Chromatin Structural Analyses--
To investigate
transcription-induced changes in the chromatin structure of
hsp82 alleles, we used the indirect end-labeling technique
to map nuclease cutting sites at low resolution (±20 bp) toward the 3'
end of the hsp82 gene as well as further downstream into the
CIN2 gene and beyond (42). Previous studies have shown that
in the case of both basal and heat shock-induced transcription exhibited by the wild type gene, the chromatin structure within the
transcription unit exhibits a half-nucleosomal DNase I cleavage periodicity of about 80-bp increments, which we have termed a "split
nucleosomal structure" (3). However, only a whole nucleosome DNase I
cleavage periodicity is exhibited in the same region in genes
possessing promoter mutations that abolish basal transcription (3). As
shown in Fig. 4B for two
independent experiments (Exp. 1, lanes 2 and
3, and Exp. 2, lanes 4 and
5), either in the absence or presence of T7 RNA
polymerase-mediated high level transcription of T7hsp82,
three translationally positioned nucleosomes at the 3' end of the
hsp82 gene can be detected, which are bounded by two whole
nucleosome-spaced DNase I cutting sites and a hypersensitive site at
the gene end (open circles and arrows). However,
in agreement with our previous studies (3, 51), in wild type
non-heat-shocked yeast the chromatin structure in the corresponding
region is disrupted and exhibits a half-nucleosomal DNase I cleavage
periodicity (Fig. 4A, lane 1, closed circles). We
also investigated the chromatin structure in T7hsp82TD and
found that, either in the absence or presence of T7 RNA
polymerase-mediated high level transcription, no detectable disruption
of nucleosomal structure in the relevant regions could be detected in
two independent experiments (Fig. 4C, Exp. 1, lanes 6 and 7, and Exp. 2, lanes
8 and 9). Introduction of the terminator dimer
sequence, however, leads to the irregular positioning of one nucleosome
immediately downstream (Fig. 4C, lanes 6-9,
overlapping open circles). Nevertheless, we conclude that
chromatin structural alterations exhibit an unexpected dependence on
the RNA polymerase used for
transcription.2
The yeast chromosomal hsp82 gene offers a unique
opportunity to examine with high sensitivity nucleosomal structural
changes in response to traversal by RNA polymerases. Previous studies have established that translationally positioned whole nucleosomes at
the 3' gene end become split into "half-nucleosomal structures" upon traversal by RNA polymerase II (3). Such structural changes are
probably quite common in other gene systems (discussed in Ref. 3), but
their detection is difficult because the required footprinting
experiments demand that upon RNA polymerase traversal the resident
nucleosomes do not relocate to semi-random translational positions.
Furthermore, nucleosome structural changes in response to transcription
of class I or III genes have not been fully characterized, because not
all of these repetitive gene copies are transcriptionally active and
rapidly switching their transcription on and off has not been possible.
We have observed that transcription by RNA polymerase II, but not by T7
RNA polymerase, disrupts the chromatin structure within the chromosomal
yeast hsp82 gene. Thus, the act of transcription per
se does not lead to nucleosome alterations, and there appears to
be something special about the RNA polymerase II complex. We discuss
below possible mechanisms that may account for these observations.
Proteins associated with the RNA polymerase II elongation complex, such
as elongation factors (5), RNA processing components (8-12), chromatin
remodeling machines (6, 23, 52), or FACT (22), may be responsible for
generating disrupted nucleosomal structures. In this regard it is
interesting that chromatin remodeling complexes have been recently
shown to introduce reversible but persistent changes in nucleosome
conformation without displacing the histones that lead to heightened
DNase I sensitivity in vitro during the association with the
chromatin remodeling complexes (53-55). In addition, because
transcriptionally active class II genes appear to bear nucleosomes
containing highly acetylated histones (24, 25), it is conceivable that
local histone acetylation may be connected in part to nucleosomal
structural changes mediated through RNA polymerase II targeting mechanisms.
The differential chromatin structures generated by the RNA polymerase
source may be related to the rates of nucleosome repair or reformation
after histone octamer translocation during RNA polymerase traversal
(26-29). On naked DNA substrates the T7 RNA polymerase elongation rate
is much faster than that of RNA polymerase II, which is probably also
the case on nucleosomal substrates (see Introduction). Previous studies
employing in vitro transcription of a nucleosomal substrate
with RNA polymerase III, an enzyme of approximately the same size as
RNA polymerase II, have revealed marked pausing (29). Similar pausing
by RNA polymerase II may retard the kinetics of nucleosome reformation
and lead to the detection of nucleosome transfer intermediates scored
here as split nucleosomes. By contrast, the more rapid traversal by the T7 enzyme may allow more time between successive transcription cycles
to allow for nucleosome repair.
Another possibility, which is not mutually exclusive of the above
models, is that transcription by RNA polymerase II may generate far
more transient torsional stress in the chromatin DNA template as
compared with that generated by T7 RNA polymerase, and this stress may
be responsible for disrupting nucleosomal structure even at a distance.
As described in the Introduction, elongating RNA polymerase II is
associated with many accessory proteins and may be anchored to
insoluble nuclear structures. In this case during transcription the
chromatin would be reeled through, and every 10-bp step of traversal
would generate one positive supercoil downstream and one negative
supercoil upstream of the anchored polymerase complex, whose relaxation
by the DNA topoisomerases may kinetically lag (2, 56). Furthermore, it
is known in S. cerevisiae that nuclear anchoring of circular
templates outside of transcription units greatly increases localized
torsional stress, presumably introduced by nearby RNA polymerase II
transcription (57, 58). By contrast, the smaller single subunit T7 RNA
polymerase may rotate nearly freely around the template during
traversal because of low hydrodynamic drag, thereby not generating
substantial twin domains of DNA supercoiling, as has been shown in
Escherichia coli for transcription-translation complexes
encoding non-membrane-bound proteins (59). We have previously
demonstrated that positive supercoiling disrupts nucleosomal structure
and generates DNase I sensitivity (41). Current modeling of nucleosomal
alterations caused by positive supercoiling features H3-H4 tetramers
wrapping a right-handed superhelix with the displacement of H2A-H2B
dimers (60, 61).
In conclusion, we have detected an unexpected polymerase-specific
disruption in nucleosomal structure, and we have discussed possible
mechanisms to account for differential structural alterations, some of
which are experimentally testable. A crucial unanswered question,
however, remains. Is the observed disruption in nucleosome structure a
requirement for RNA polymerase II traversal or is it simply a
by-product of the process?
We thank Chien-ping Liang of this laboratory
for thoughtful comments on this work.
*
This investigation was supported by Grants GM29935 and
GM22201 (to W. T. G.) from the National Institutes of Health and
Robert A. Welch Foundation Grant I-823.The costs of publication of this article were defrayed in part by the
payment of page charges. The article
must therefore be hereby marked
"advertisement" in accordance with 18 U.S.C. Section
1734 solely to indicate this fact.
§
Both authors contributed equally to this work.
**
To whom correspondence should be addressed: Dept. of Molecular
Biology and Oncology, University of Texas Southwestern Medical Center,
Hammon Biomedical Research Bldg., 5323 Harry Hines Blvd., Dallas, TX
75235-9140. Tel.: 14-648-1924; Fax: 214-648-1909; E-mail: garrard{at}utsw.swmed.edu.
2
In rich medium (YPGal), we obtained identical
results for the T7hsp82TD strain expressing an integrated
copy of the T7 RNA polymerase gene. However, in YPD medium the
T7hsp82 strain exhibits slight splitting of one nucleosome
in the absence of T7 RNA polymerase expression, which we attributed to
leaky RNA polymerase II transcription based on Northern analyses. In
the same strain such splitting is mildly enhanced in YPGal medium upon
expression of the integrated copy of T7 RNA polymerase, which we
attributed to increased leaky RNA polymerase II transcription triggered
by a stress response.
The abbreviations used are:
bp, base pair(s);
PCR, polymerase chain reaction;
kb, kilobase pair.
RNA Polymerase-specific Nucleosome Disruption by
Transcription in Vivo*
§,
, and
**
Department of Molecular Biology
and Oncology, University of Texas Southwestern Medical Center,
Dallas, Texas 75235-9140, the ¶ Laboratory of Molecular
Embryology, NICHD, National Institutes of Health,
Bethesda, Maryland 20892, and the
Department of Biology,
Sookmyung Women's University, Chungpa-dong, Yongsan-Ku,
Seoul, 140-742 Korea
![]()
ABSTRACT
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES
![]()
INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES
![]()
EXPERIMENTAL PROCEDURES
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES
ade2-1 ura3-1 his3-11, 15 leu2-3,
112 trp1-1 can1-100) served as the parent strain for construction of isogenic mutant strains. The HSP82 promoter was replaced
by the bacteriophage T7 promoter and mutations in the TATA box and HSE1
(T2P2; Ref. 30) to obtain the T7hsp82 strain. The
T7hsp82 strain was further manipulated by placing a T7
terminator dimer within the coding region of HSP82 gene to
generate T7hsp82+TD (see below and Fig. 1 for details).
These strains were transformed either with the 2-µm yeast plasmid
YEp401NLEU+, designated GAL:T7, or the
integrating construct YIp401NLEU+ as indicated
in the figure legends (Ref. 31; kindly provided by Christopher Greer,
University of California, Irvine), which carry the T7 polymerase gene
under control of the inducible GAL1 promoter. The empty
plasmid (URA3+) without the T7 polymerase gene
served as a control. The plasmid YIp5 (New England Biolabs) carrying
the URA3 marker was used for HSP82 gene
integration and gene replacement. Wild type cells were grown in yeast
extract/peptone medium (YEP) containing 2% glucose (32). Yeast
transformations were done by the lithium acetate method (33, 34). The
strains T7hsp82 and T7hsp82TD carrying either an
empty or GAL:T7 plasmid or integrant were grown in selective medium
lacking leucine or uracil (32). All the strains were grown at 30 °C
to A600 = 0.8 (wild type) or 1.2 (T7hsp82±TD). From 10 ml overnight stationary cultures
grown in selective medium containing 2% raffinose, 5 ml was inoculated
into 1 liter of selective medium containing 2% raffinose, 3%
galactose and grown in 2-liter flasks with shaking at 250 rpm for
15 h.
18 to +5) (36) and the T2P2 mutations (30) in place of wild type promoter of the HSP82 gene. The nucleotide sequences
(5' to 3') of forward and reverse primer pairs used in two independent PCR reactions with a plasmid template bearing the T2P2 mutations (30)
for splicing by overlap extension purposes were as follows: GGAATAAAGCTTAATCGG (
281 to
263 of HSP82) and
CCCTATAGTGAGTCGTATTAAGCGGGAAGAAATGAGG (+3 to
17 lower strand T7
promoter sequences fused to
18 to
34 HSP82 sequences);
CGACTCACTATAGGGAGACCTGATAGAAAATAGAGTCC (
12 to +5 upper strand T7
promoter sequences fused to +6 to +26 sequences of HSP82)
and CCAAAACTTTTTGCTCTGGC (+265 to +284 sequences of HSP82). The T2P2T7HSP82 PCR fragment (
281 to
+284) was first cloned into the yeast integration vector YIp5. Then it
was cleaved at a unique BglII site (+239) and transformed
into the wild type strain for homologous recombination. After initial
selection for URA3 expression, those cells that subsequently
had lost URA3 by undergoing recombination between duplicated
adjacent sequences were isolated by the counter selection technique
(37). Retention of the T2P2T7 HSP82 PCR fragment at its
genetic locus was confirmed by Southern analysis.
70 °C. Phosphor screens
were scanned with a Molecular Dynamics PhosphorImager, and the signals
were quantitated using ImageQuant software or imaged using Adobe
Photoshop 3.0.
![]()
RESULTS
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

View larger version (10K):
[in a new window]
Fig. 1.
Engineering the yeast chromosomal
HSP82 gene for transcription mediated by bacteriophage
T7 RNA polymerase. A, the symbols × in the
upstream region correspond to base changes in HSE1 and the TATA box,
termed P2 and T2, respectively (30). The sites of insertion of the T7
promoter and terminator dimer are shown, as well as restriction
endonuclease cutting sites for KpnI (K),
EcoRV (V), EcoRI (E),
Mlu1 (M), and ClaI (C). The
map positions of probes 1 and 2 are also indicated. B, a
high copy number expression plasmid for T7 RNA polymerase.

View larger version (28K):
[in a new window]
Fig. 2.
Northern analysis shows that engineered
hsp82 alleles are actively and faithfully transcribed
exclusively by T7 RNA polymerase. Total RNA was isolated from
non-heat-shocked wild type (WT) cells grown in medium with
glucose as the carbon source or from strains bearing
T7hsp82 ± the terminator dimer (Term)
alleles grown in medium with galactose as the carbon source and either
harboring an empty expression vector or GAL:T7 as indicated.
A, Northern filter hybridized with hsp82
gene-specific probe 2 (see Fig. 1A for map position);
B, probe 1 (see Fig. 1A for map position);
C, ACT1 probe to detect actin gene transcripts as
a loading control.

View larger version (36K):
[in a new window]
Fig. 3.
Oligo(dT) chromatography reveals that a
fraction of T7 RNA polymerase-generated hsp82
transcripts are processed and polyadenylated. Total RNA was
isolated from heat-shocked wild type (WT) cells grown in
medium with glucose as the carbon source or from T7hsp82
cells grown in medium with galactose as the carbon source, harboring a
GAL:T7 expression vector integrated at the LEU2 locus.
Northern filter of total RNA (T) or the poly(A)+
fraction (A+) hybridized with hsp82
gene-specific probe 2 (see Fig. 1A for map position).

View larger version (41K):
[in a new window]
Fig. 4.
Nucleosome disruption is dependent on the RNA
polymerase used for transcription. A, nuclei were
isolated from non-heat-shocked wild type cells grown in medium with
glucose as the carbon source (polymerase II (POL II),
lane 1) or from strains bearing T7hsp82 alleles,
without (B) (lanes 2-5) or with (C)
(lanes 6-9) the T7 RNA polymerase terminator dimer, grown
in medium with galactose as the carbon source, either harboring an
empty expression vector or GAL:T7 as indicated. Samples from the
indicated separate experiments were digested with DNase I, and DNA was
purified, cleaved with EcoRV, separated by electrophoresis,
and blotted, and the filters were hybridized with a
EcoRV-truncated probe 1 (see Fig. 1A for map) for
indirect end labeling (42). The dark band at the
bottom represents cross-hybridizing HSC82
sequences (3). Hypersensitive sites are depicted either as closed
arrows or vertical bars. Filled circles
represent half-nucleosomal cleavage sites within the hsp82
gene, and open circles depict whole nucleosomal cleavage
sites. The terminator dimer is shown on the gene map as tandem
open arrows. Most samples shown in pairwise comparisons for
individual experiments were run on the same gel but have been
rearranged to optimize presentation. Calibration on the left
is absolute DNA length and on the right is map position on a
linear scale with respect to the HSP82 gene transcription
start site.
![]()
DISCUSSION
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES
![]()
ACKNOWLEDGEMENT
![]()
FOOTNOTES
![]()
ABBREVIATIONS
![]()
REFERENCES
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES
Copyright © 1999 by The American Society for Biochemistry and Molecular Biology, Inc.
![]()
CiteULike
Complore
Connotea
Del.icio.us
Digg
Reddit
Technorati What's this?
This article has been cited by other articles:
![]() |
X. Zhu, J. Ling, L. Zhang, W. Pi, M. Wu, and D. Tuan A facilitated tracking and transcription mechanism of long-range enhancer function Nucleic Acids Res., August 17, 2007; (2007) gkm595v1. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Thiriet and J. J. Hayes Replication-independent core histone dynamics at transcriptionally active loci in vivo Genes & Dev., March 15, 2005; 19(6): 677 - 682. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. J. Sims III, R. Belotserkovskaya, and D. Reinberg Elongation by RNA polymerase II: the short and long of it Genes & Dev., October 15, 2004; 18(20): 2437 - 2468. [Abstract] [Full Text] [PDF] |
||||
![]() |
V. M. Sharma, B. Li, and J. C. Reese SWI/SNF-dependent chromatin remodeling of RNR3 requires TAFIIs and the general transcription machinery Genes & Dev., February 15, 2003; 17(4): 502 - 515. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Kimura and P. R. Cook Kinetics of Core Histones in Living Human Cells: Little Exchange of H3 and H4 and Some Rapid Exchange of H2B J. Cell Biol., June 18, 2001; 153(7): 1341 - 1354. [Abstract] [Full Text] [PDF] |
||||
![]() |
V. Morales and H. Richard-Foy Role of Histone N-Terminal Tails and Their Acetylation in Nucleosome Dynamics Mol. Cell. Biol., October 1, 2000; 20(19): 7230 - 7237. [Abstract] [Full Text] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||