![]()
|
|
||||||||
J Biol Chem, Vol. 274, Issue 24, 16741-16746, June 11, 1999
From the The FKHR gene was first
identified from its disruption by the t(2;13) chromosomal translocation
seen in the pediatric tumor alveolar rhabdomyosarcoma. It encodes for a
member of the forkhead family of transcription factors. Recently, a
homolog of FKHR in the nematode Caenorhabditis elegans was
identified called DAF-16, which is a downstream target of two Akt
homologs in an insulin-related signaling pathway. We have examined the
possible role of Akt in the regulation of FKHR. We find that FKHR can
bind in vitro to the insulin-responsive sequence (IRS) in
the insulin-like growth factor-binding protein 1 promoter and can
activate transcription from a reporter plasmid containing multiple
copies of the IRS. Expression of active but not inactive Akt can
suppress FKHR-mediated transcriptional activation. Akt can
phosphorylate FKHR in vitro on three phosphoacceptor sites,
at least a subset of which can also be phosphorylated by Akt in
vivo. Importantly, mutation of these three sites to alanine
residues enhances the transcriptional activity of FKHR and renders it
resistant to inhibition by Akt. Expression of an Akt-resistant mutant
of FKHR causes apoptosis in 293T cells in a manner dependent on DNA
binding. These results suggest that FKHR may be a direct nuclear
regulatory target for Akt in both metabolic and cell survival pathways.
Akt, also known as protein kinase B
(PKB)1 and RAC kinase, is a
serine/threonine protein kinase that plays central roles in signaling
in response to mitogens and survival factors (1). The activation of Akt
is triggered by upstream kinases, including phosphatidylinositol
3-kinase (2, 3) and Ca2+/calmodulin-dependent
protein kinase kinase (4). Known physiological substrates for Akt
include glycogen synthase kinase-3 (5), BAD (6, 7), and caspase-9 (8).
However, none of these Akt substrates possess known functions in the
nucleus where a large portion of Akt translocates upon its activation
(1, 9, 10). Transcription factors may be potential nuclear substrates for Akt, which is known to mediate some of insulin's effects on hepatic gene transcription (1).
The FKHR gene was first identified by virtue of its fusion
to the PAX3 gene in the t(2;13) translocation found in the
pediatric soft tissue tumor alveolar rhabdomyosarcoma (11). This gene encodes for a protein containing a DNA-binding motif shared with members of the HNF-3/forkhead family of transcription factors (12-14).
Recently, the nematode Caenorhabditis elegans forkhead transcription factor DAF-16 was identified as a potential homolog of
FKHR (15, 16). Genetic data in C. elegans suggest that DAF-16 is a downstream target of two Akt homologs in an insulin-related signaling pathway (17). We have investigated whether FKHR may be a
direct downstream regulatory target of Akt in mammalian cells. Our data
identify FKHR as a positive transcription regulator that can bind
in vitro to the IGFBP-1 insulin-responsive sequence (IRS) and also induce apoptosis. We have identified three Akt phosphorylation sites in FKHR and have data suggesting that phosphorylation on all or a
subset of these sites contributes to the down-regulation of FKHR's
ability to activate transcription and to induce apoptosis. Because its
activity can be inhibited by Akt phosphorylation, FKHR is a potential
Akt nuclear target in metabolic and survival pathways.
Plasmids
Two oligonucleotides
(GCAAAACAAACTTATTTTGAAGCAAAACAAACTTATTTTGAAGCAAAACAAACTTATTTTGAA and
TCGATTCAAAATAAGTTTGTTTTGCTTCAAAATAAGTTTGTTTTGCTTCAAAATAAGTTTGTTTTGCGTAC) were annealed together and ligating into the KpnI and
XbaI sites of pGL2-Promoter (Promega) to create
3×IRS-luc.
A cDNA construct containing the full-length open reading frame of
wild-type FKHR (11) was assembled into the mammalian expression vector
pcDNA3 (Invitrogen). An expression vector for FLAG-tagged FKHR was
created by ligating a KpnI/XbaI cDNA fragment
from pcDNA3-FKHR into
pcDNA3-FLAG.2 pcDNA3
expression plasmids for FLAG-tagged FKHR H215R, FKHR T24A, FKHR S256A,
FKHR S319A, FKHR(AAA), and FKHR(AAA) H215R were constructed by
polymerase chain reaction mutagenesis and verified by sequencing. GST
expression vectors for FKHR-N and FKHR-C were constructed by ligating
NcoI and EcoRI-cut fragments, respectively, from
pcDNA3- FKHR into pGEX-KG (18). FKHR-N and FKHR-C are predicted to
include residues 1-257 and 211-416 (11), respectively. FKHR-N T24A, FKHR-C S256A, FKHR-C S319A, and FKHR-C(AA) were subcloned into pGEX-KG
by ligation of the appropriate NcoI or EcoRI-cut
fragments cut from pcDNA3 constructs.
Production and Purification of GST Fusion Proteins
The expression and purification of GST fusion proteins was
performed using DH5 Transient Transfection Reporter Assay
293 cells grown in 12-well plates were transfected using
LipofectAMINE (Life Technologies, Inc.) with 0.1 µg of pcDNA3 or FKHR expression plasmid, 0.1 µg of luciferase reporter, and 10 ng of
pCMV- EMSA
Binding reactions contained binding buffer (50 mM
Tris (pH 7.5), 13 mM MgCl2, 1 mM
EDTA, 5% glycerol, 1 mM dithiothreitol), 0.5 µg of
poly(dI-dC), 0.5 µg of poly(dA-dT), 0.5 ng of 32P-labeled
oligonucleotide probe, and purified GST fusion protein (50 ng) or
cellular lysate (2 µg). After 10-min incubation at 22 °C, reaction
products were separated on a 4% polyacrylamide gel containing 0.5 × Tris borate-EDTA.
Immunoprecipitation/in Vitro Kinase Assay
293 cells transfected with HA-tagged myr-Akt or Akt K179M
plasmid were lysed and whole cell extracts prepared by resuspending in
lysis buffer (50 mM Tris-HCl (pH 7.5), 0.1% Triton X-100,
1 mM EDTA, 50 mM NaF, 10 mM sodium
Cell Death Assays
Morphologic Assay--
293T cells were transfected with 0.1 µg
of pCMV- Gel Fragmentation Assay--
293T cells grown on 10-cm plates
were transfected with 4 µg of Bluescript and 4 µg of pcDNA3 or
FLAG-tagged FKHR expression plasmid. 48 h after transfection,
cells were lysed and DNA precipitated as described previously (21).
The IRS in the IGFBP-1 promoter has been shown previously to be
bound specifically in vitro by HNF-3, a forkhead family
member (22, 23). We performed in vitro DNA binding assays to
determine whether FKHR might be able to recognize the IGFBP-1 IRS also. In EMSAs, we found that when expressed as a glutathione
S-transferase (GST) fusion protein, an N-terminal fragment
of FKHR containing the forkhead DNA-binding motif could bind to a probe
containing the IGFBP-1 IRS (Fig.
1A). In contrast, probes
containing either of two mutant versions of the IRS (Fig.
1A) were not bound by FKHR. Significantly, these two IRS
mutations have been shown to eliminate the response of the IGFBP-1
promoter to insulin in transient transfection assays (23). We found
that mutation of histidine 215 in FKHR to arginine (H215R) signficantly
reduced DNA binding activity (Fig. 1A). This histidine
residue is conserved in all forkhead family members and is involved in
making contacts with DNA (24). In order to examine whether recombinant
full-length FKHR expressed in mammalian cells could also bind to the
IGFBP-1 IRS, we performed EMSA with radiolabeled IGFBP-1 IRS probe
using extracts from transfected 293 cells. Extracts from cells
transfected with FLAG-FKHR were found to contain a novel supershifted
complex not found when using control extracts (Fig. 1B).
Inclusion of a FLAG antibody but not an unrelated antibody in the
reactions significantly disrupted this complex, indicating that it
contained FLAG-FKHR. This complex bound to the IRS specifically because it was not seen when either of the two mutant probes was used (data not
shown). Consistent with a critical role of histidine 215 for DNA
binding, lysates from cell transfected with FLAG-FKHR H215R contained
no detectable binding activity for the IRS probe (Fig.
1B).
Next, we wished to test whether FKHR might be able to activate
transcription through the IGFBP-1 IRS. A C-terminal region of FKHR has
been found previously to activate transcription when fused to a
heterologous DNA-binding domain (25, 26). We constructed a luciferase
reporter construct (3×IRS-luc), which contained three tandem copies of
the IGFBP-1 IRS placed upstream of a basal promoter and the firefly
luciferase gene. Transfection of epitope-tagged FKHR in 293 cells
resulted in transcriptional enhancement in a dose-dependent
manner with 3×IRS-luc, whereas no enhancement was observed with a
reporter plasmid lacking IRS elements (Fig. 1C). In
contrast, FKHR H215R was unable to elicit any significant activation of
3×IRS-luc. The H215R mutation, however, did not impair the ability of
FKHR to transactivate when fused to the yeast GAL4 DNA-binding domain
(data not shown). Collectively, these results suggest that FKHR can
activate transcription directly through the IRS from the IGFBP-1 promoter.
Since expression of active Akt is known to be sufficient to mimic
insulin's inhibitory effects on transcription through the IGFBP-1 IRS
(27), we tested whether FKHR might be able to be negatively regulated
by Akt. Cotransfection of plasmid for wild-type, but not kinase-dead
Akt, containing a point mutation in its catalytic domain (K179M),
resulted in a significant repression of FKHR-mediated transcriptional
activation (Fig. 2). A constitutively
active mutant of Akt containing a myristoylated amino terminus
(myr-Akt) was also a potent inhibitor (data not shown). Thus, Akt can
suppress transcriptional activation by FKHR, and this effect requires
the catalytic activity of Akt.
Negative Regulation of the Forkhead Transcription Factor FKHR
by Akt*
§,
, and
§**
Department of Biological Chemistry and
¶ Department of Pathology and Comprehensive Cancer Center,
** Institute of Gerontology, University of Michigan Medical School Ann
Arbor, Michigan 48109 and the
Department of Pathology and
Laboratory Medicine, University of Pennsylvania School of Medicine,
Philadelphia, Pennsylvania 19104
![]()
ABSTRACT
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS AND DISCUSSION
REFERENCES
![]()
INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS AND DISCUSSION
REFERENCES
![]()
EXPERIMENTAL PROCEDURES
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS AND DISCUSSION
REFERENCES
bacteria as described previously (18).
-gal. Bluescript (Strategene) was included in all samples to
adjust the total DNA transfected to 0.8 µg. Luciferase assays were
performed as described previously (19).
-glycerol phosphate, 5 mM sodium pyrophosphate, 1 mM Na3VO4, 0.1%
2-mercaptoethanol). Clarified extracts were incubated with anti-HA
monoclonal antibody (Babco), and immunoprecipitates were incubated with
6.6 mM MOPS (pH 7.2), 8.3 mM
-glycerol
phosphate (pH 7.0), 0.33 mM Na3VO4,
0.33 mM dithiothreitol, 10 µCi of
[
-32P]ATP, 25 mM MgCl2, 166 µM ATP, and 50 ng of GST fusion protein at 30 °C for
30 min.
-gal, 0.5 µg of Bluescript (Strategene), and 0.5 µg of
pcDNA3 or FLAG-tagged FKHR expression vector. 24 h after
transfection, at least 300 transfected cells per sample were analyzed
for apoptosis as described previously (20).
![]()
RESULTS AND DISCUSSION
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS AND DISCUSSION
REFERENCES

View larger version (38K):
[in a new window]
Fig. 1.
DNA binding and transcriptional activation by
FKHR. A, specific DNA binding by a bacterially
expressed fragment of FKHR. GST fusion proteins were tested in EMSA
with radiolabeled DNA probe containing the human IGFBP-1
insulin-responsive sequence (IRS WT) or either of two
mutated versions (IRS mut1, IRS mut2). The
sequences of the top strands of the probes used are shown above, with
mutated bases in bold. The sequences in the IGFBP-1 IRS,
which are similar to other IRSs, are underlined. The
presence of multiple shifted bands in lane 3 is reproducible
and may be due to protein degradation. B, DNA binding of
recombinant epitope-tagged FKHR. 293 cells were transiently transfected
with empty vector or FLAG-tagged FKHR plasmid. Whole cell lysates were
prepared and used in EMSA with radiolabeled IRS WT probe. The
arrowhead points to the DNA binding activity that exists in
FLAG-FKHR-transfected, but not control, lysates. Monoclonal antibodies
to FLAG (M2, Sigma) or HA (Babco) were included in binding reactions as
indicated. An immunoblot of lysates using FLAG antibody is shown on the
right. C, FKHR activates transcription from a
reporter construct containing three copies of the IGFBP-1 IRS. 293 cells were transfected with 3×IRS-luc or reporter plasmid lacking the
IRS sequence (pGL2-luc), pCMV-
-gal, and FLAG-tagged FKHR plasmid.
The relative amounts of FKHR plasmid transfected is indicated, 1 signifying 10 ng. Cell lysates were prepared 24 h after
transfection and luciferase activities measured, adjusted to
-gal
activity. Values are expressed relative to control. An immunoblot of
the same lysates using anti-FLAG M2 antibody is shown below.

View larger version (27K):
[in a new window]
Fig. 2.
FKHR-mediated transcriptional activation is
inhibited by Akt. 293 cells were transfected with 3×IRS-luc,
pCMV-
-gal, FLAG-FKHR, and GST-Akt WT or GST-Akt K179M. Luciferase
activity was determined as in Fig. 1C. The results are given
as the mean ± S.D. of duplicate cultures and are representative
of three independent experiments. An immunoblot of lysates using FLAG
or GST antibody is shown below.
The amino acid sequence of FKHR contains three putative consensus Akt
phosphorylation sites (Thr24, Ser256, and
Ser319) (Fig. 3A),
all of which are conserved in the C. elegans DAF-16 transcription factor (17). In order to test whether any of these sites
might be phosphorylated in vitro by Akt, we performed kinase assays using immunoprecipitated HA-tagged myr-Akt or Akt
K179M from cell lysates. Because of difficulties we had in
expressing full-length FKHR in bacteria, we expressed and purified two
smaller fragments of FKHR as GST fusion proteins to test as potential substrates. One fragment included Thr24 (FKHR-N) and the
other contained Ser256 and Ser319 (FKHR-C).
Both GST-FKHR-N and GST-FKHR-C were phosphorylated by
immunoprecipitated myr-Akt but not inactive Akt (Fig. 3A). In contrast, no phosphorylation was seen when GST was used as a
substrate (Fig. 3A). Next, versions of each FKHR protein
containing alanine substitutions at phosphoacceptor sites were compared
as substrates for myr-Akt. Mutation of Thr24 in GST-FKHR-N
was found to prevent its phosphorylation (Fig. 3B,
top). Also, mutation of Ser256 and
Ser319 each individually led to a partial reduction in
phosphorylation of GST-FKHR-C, while mutation of both eliminated any
detectable phosphorylation (Fig. 3B, bottom).
These results support the notion that Thr24,
Ser256, and Ser319 all can serve as Akt
phosphorylation sites in vitro.
|
We observed FKHR expression by Western blot using lysates prepared from
cells transfected with FLAG-FKHR and either wild-type Akt or
kinase-dead Akt. FLAG-tagged FKHR migrated as multiple immunoreactive
bands by SDS-PAGE in the presence of serum (Fig. 3C,
top). Cotransfection of wild-type, but not kinase-dead, Akt altered the migration of these bands. The fastest migrating band disappeared whereas new slower migrating bands appeared. We observed a
reproducible increase in FKHR protein levels when wild-type Akt was
expressed, which may be due to a stabilizing effect of phosphorylation.
In order to determine whether the slower migrating bands might
represent phosphorylated forms, we treated immunoprecipitated FLAG-tagged FKHR from the same lysates coexpressing wild-type Akt with
phosphatase. Phosphatase treatment resulted in a collapse of the
bands into a faster migrating band. (Fig. 3C,
middle). Inclusion of the phosphatase inhibitors vanadate
and NaF prevented this collapse (data not shown). Thus, the alterations
in migrating bands caused by Akt expression are due to phosphorylation.
Next, we compared the effect of wild-type Akt on the migration of
FLAG-tagged wild-type FKHR and FKHR(AAA). FKHR(AAA) migrated as a
single band, which comigrated with the fastest migrating band for
wild-type FKHR, suggesting that Thr24, Ser256,
and/or Ser319 might be phosphorylated by endogenous kinases
(Fig. 3C, bottom). Whereas wild-type Akt caused a
shift in migration of bands for wild-type FKHR, the single band seen
for FKHR(AAA) remained unchanged. Thus, overexpression of Akt can alter
the phosphorylation state of FKHR in vivo, and this can be
visualized as a mobility shift by SDS-PAGE. Also, the intactness of all
or a subset of the three in vitro phosphorylation sites is
important for this mobility shift and phosphorylation. These data
support the idea that Akt can phosphorylate FKHR on at least a subset
of the in vitro phosphorylation sites (Thr24,
Ser256, and Ser319) in vivo.
Next, we examined whether the three Akt phosphorylation sites were important for FKHR activity in vivo. We found that proteins containing alanine substitutions at the three phosphoacceptor sites singly (T24A, S256A, and S319A) or together (AAA) possessed greater activity than wild-type protein (Fig. 3D). Thus, phosphorylation on each of these three sites may contribute to the inhibition of transcriptional activation by FKHR. When myr-Akt was coexpressed, we found that single mutations of each of the three potential Akt phosphorylation sites resulted in partial resistance to Akt inhibition, while mutation of all three sites together produced a mutant form of FKHR that was relatively insensitive to inhibition (Fig. 3D). These data support a model whereby phosphorylation on Thr24, Ser256, and Ser319 each contributes to the inhibitory effects of Akt.
In addition to its roles in glucose transport and metabolism, Akt is a
critical mediator of cell survival signals elicited by serum and growth
factors including insulin. Since Akt serves as an inhibitor of
apoptosis, and FKHR is negatively regulated by Akt, we tested whether
FKHR might have proapoptotic activity. We transfected 293T cells with
wild-type FKHR or FKHR(AAA) and examined transfected cells 48 h
later for apoptotic morphology. Transfection of FKHR(AAA) induced
features of apoptosis as identified by rounded cells and membrane
blebbing (Fig. 4A).
FKHR(AAA)-transfected cells also displayed chromatin condensation and
nuclear fragmentation, which are also typical features of apoptotic
cells (data not shown). Furthermore, FKHR(AAA) caused DNA fragmentation
and activated caspase-3 as assessed in a substrate cleavage assay (Fig.
4A, data not shown). In contrast, wild-type FKHR caused only
a slight but reproducible level of apoptosis in morphological assays
and caused relatively insignificant levels of DNA fragmentation,
despite having higher levels of expression than FKHR(AAA) (Fig.
4A). Since the apoptotic activities of wild-type FKHR and
FKHR(AAA) correlate with their relative abilities to activate
transcription (Fig. 3D), apoptosis induced by FKHR may
involve its ability to activate gene transcription. Consistent with
this idea, introduction of an H215R mutation, which disrupts DNA
binding (Fig. 1A), in FKHR(AAA) significantly reduced its
ability to induce apoptosis as assessed by both morphology and DNA
fragmentation (Fig. 4B). As expected, this mutation resulted
in a protein that was impaired in its ability to activate transcription
from the 3×IRS-luc reporter (data not shown). Thus, the induction of
apoptosis by FKHR(AAA) is likely to be dependent, at least in part, on
its ability to function as a transcription factor. We postulate that
the residual apoptotic activity seen with this mutant protein may be
due to residual DNA binding activity and/or synergistic interactions
with endogenous forkhead proteins.
|
Our data suggest that FKHR is a direct target of the protein kinase
Akt. The C. elegans AKT/DAF-16 pathway is regulated by an
insulin-like receptor and is thought to be involved in reproductive metabolism, dauer state entry, and longevity (15, 16). Given our
biochemical data suggesting a role for Akt in the direct
phosphorylation and inhibition of FKHR, a similar relationship between
AKT-1/2 and DAF-16 would be predicted to exist. Because of its
abilities to bind in vitro to the IGFBP-1 IRS and activate
transcription from a reporter containing multiple IRSs, FKHR is a
candidate mediator of IGFBP-1 expression. Further experiments are
necessary to determine whether endogenous FKHR may be an important
target of insulin in regulating hepatic IGFBP-1 gene transcription. We also find that FKHR possesses proapoptotic activity, especially when it
exists in the more active "dephosphorylated" state. The ability of
FKHR to induce apoptosis appears to depend on its transcriptional activity. It will be of considerable interest to determine whether endogenous FKHR may be involved in promoting apoptosis in response to
known apoptotic stimuli. If so, FKHR may represent an important regulatory target for anti-apoptotic signals that utilize Akt. While
this manuscript was in preparation, it was reported that another member
of the forkhead family, which is related to FKHR, is also negatively
regulated by Akt (28). It will be of interest to determine whether FKHR
and other related family members may possess redundant or nonredundant
roles in vivo.
| |
ACKNOWLEDGEMENTS |
|---|
We are grateful to T. Brtva and A. Vojtek for providing us with GST-Akt plasmids. We thank T. Franke for HA-tagged Akt plasmids.
| |
FOOTNOTES |
|---|
* This work was supported by the National Institutes of Health (to K.-L. G.).The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
§ To whom correspondence should be addressed (E. D. T. or K.-L. G.): Dept. of Biological Chemistry, University of Michigan Medical School, Ann Arbor, MI 48109. Fax: 734-763-4581 (for both E. D. T. and K.-L. G.); E-mail: edtang{at}umich.edu (for E. D. T.) or kunliang{at}umich.edu (for K.-L. G.).
2 E. D. Tang and K.-L. Guan, unpublished data.
| |
ABBREVIATIONS |
|---|
The abbreviations used are:
PKB, protein kinase
B;
HA, hemagglutinin;
-gal,
-galactosidase;
PAGE, polyacrylamide
gel electrophoresis;
GST, glutathione S-transferase;
HNF-3, hepatic nuclear factor 3;
X-gal, 5-bromo-4-chloro-3-indolyl-
-D-galactopyranoside;
IGFBP-1, insulin-like growth factor-binding protein-1;
IRS, insulin-responsive sequence;
EMSA, electrophoretic mobility shift
assay;
MOPS, 4-morpholinepropanesulfonic acid;
WT, wild-type.
| |
REFERENCES |
|---|
|
|
|---|
This article has been cited by other articles:
![]() |
M. P. Housley, J. T. Rodgers, N. D. Udeshi, T. J. Kelly, J. Shabanowitz, D. F. Hunt, P. Puigserver, and G. W. Hart O-GlcNAc Regulates FoxO Activation in Response to Glucose J. Biol. Chem., June 13, 2008; 283(24): 16283 - 16292. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. C. Ward, A. V. Hoekstra, L. J. Blok, P. Hanifi-Moghaddam, J. R. Lurain, D. K. Singh, B. M. Buttin, J. C. Schink, and J. J. Kim The Regulation and Function of the Forkhead Transcription Factor, Forkhead Box O1, Is Dependent on the Progesterone Receptor in Endometrial Carcinoma Endocrinology, April 1, 2008; 149(4): 1942 - 1950. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Yan, V. A. Lavin, L. R. Moser, Q. Cui, C. Kanies, and E. Yang PP2A Regulates the Pro-apoptotic Activity of FOXO1 J. Biol. Chem., March 21, 2008; 283(12): 7411 - 7420. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. M. Emerling, F. Weinberg, J.-L. Liu, T. W. Mak, and N. S. Chandel PTEN regulates p300-dependent hypoxia-inducible factor 1 transcriptional activity through Forkhead transcription factor 3a (FOXO3a) PNAS, February 19, 2008; 105(7): 2622 - 2627. [Abstract] [Full Text] [PDF] |
||||
![]() |
W. Cai, J. C. He, L. Zhu, X. Chen, G. E. Striker, and H. Vlassara AGE-receptor-1 counteracts cellular oxidant stress induced by AGEs via negative regulation of p66shc-dependent FKHRL1 phosphorylation Am J Physiol Cell Physiol, January 1, 2008; 294(1): C145 - C152. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Hatta and L. A. Cirillo Chromatin Opening and Stable Perturbation of Core Histone:DNA Contacts by FoxO1 J. Biol. Chem., December 7, 2007; 282(49): 35583 - 35593. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. J. Barreyro, S. Kobayashi, S. F. Bronk, N. W. Werneburg, H. Malhi, and G. J. Gores Transcriptional Regulation of Bim by FoxO3A Mediates Hepatocyte Lipoapoptosis J. Biol. Chem., September 14, 2007; 282(37): 27141 - 27154. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Huang and D. J. Tindall Dynamic FoxO transcription factors J. Cell Sci., August 1, 2007; 120(15): 2479 - 2487. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. D Rudd, I. Gonzalez-Robayna, I. Hernandez-Gonzalez, N. L Weigel, W. E Bingman III, and J. S Richards Constitutively active FOXO1a and a DNA-binding domain mutant exhibit distinct co-regulatory functions to enhance progesterone receptor A activity J. Mol. Endocrinol., June 1, 2007; 38(6): 673 - 690. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Tanno, J. Sakamoto, T. Miura, K. Shimamoto, and Y. Horio Nucleocytoplasmic Shuttling of the NAD+-dependent Histone Deacetylase SIRT1 J. Biol. Chem., March 2, 2007; 282(9): 6823 - 6832. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Li, Y. Zhou, R. Wang, H. Zhang, Y. Dong, and C. Ip Selenium sensitizes MCF-7 breast cancer cells to doxorubicin-induced apoptosis through modulation of phospho-Akt and its downstream substrates Mol. Cancer Ther., March 1, 2007; 6(3): 1031 - 1038. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Munoz-Fontela, L. Marcos-Villar, P. Gallego, J. Arroyo, M. Da Costa, K. M. Pomeranz, E. W.-F. Lam, and C. Rivas Latent Protein LANA2 from Kaposi's Sarcoma-Associated Herpesvirus Interacts with 14-3-3 Proteins and Inhibits FOXO3a Transcription Factor J. Virol., February 1, 2007; 81(3): 1511 - 1516. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. M. Hinman, J. N. Bushanam, W. A. Nichols, and A. B. Satterthwaite B Cell Receptor Signaling Down-Regulates Forkhead Box Transcription Factor Class O 1 mRNA Expression via Phosphatidylinositol 3-Kinase and Bruton's Tyrosine Kinase J. Immunol., January 15, 2007; 178(2): 740 - 747. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Guo, S. L. Dunn, and M. F. White The Reciprocal Stability of FOXO1 and IRS2 Creates a Regulatory Circuit that Controls Insulin Signaling Mol. Endocrinol., December 1, 2006; 20(12): 3389 - 3399. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Zhang, X. C. He, W.-G. Tong, T. Johnson, L. M. Wiedemann, Y. Mishina, J. Q. Feng, and L. Li Bone Morphogenetic Protein Signaling Inhibits Hair Follicle Anagen Induction by Restricting Epithelial Stem/Progenitor Cell Activation and Expansion Stem Cells, December 1, 2006; 24(12): 2826 - 2839. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Onuma, B. T. Vander Kooi, J. N. Boustead, J. K. Oeser, and R. M. O'Brien Correlation between FOXO1a (FKHR) and FOXO3a (FKHRL1) Binding and the Inhibition of Basal Glucose-6-Phosphatase Catalytic Subunit Gene Transcription by Insulin Mol. Endocrinol., November 1, 2006; 20(11): 2831 - 2847. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Armoni, C. Harel, S. Karni, H. Chen, F. Bar-Yoseph, M. R. Ver, M. J. Quon, and E. Karnieli FOXO1 Represses Peroxisome Proliferator-activated Receptor-{gamma}1 and -{gamma}2 Gene Promoters in Primary Adipocytes: A NOVEL PARADIGM TO INCREASE INSULIN SENSITIVITY J. Biol. Chem., July 21, 2006; 281(29): 19881 - 19891. [Abstract] [Full Text] [PDF] |
||||
![]() |
X.-Y. Dong, C. Chen, X. Sun, P. Guo, R. L. Vessella, R.-X. Wang, L. W.K. Chung, W. Zhou, and J.-T. Dong FOXO1A Is a Candidate for the 13q14 Tumor Suppressor Gene Inhibiting Androgen Receptor Signaling in Prostate Cancer. Cancer Res., July 15, 2006; 66(14): 6998 - 7006. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. E. Schade, J. J. Powers, M. W. Wlodarski, and J. P. Maciejewski Phosphatidylinositol-3-phosphate kinase pathway activation protects leukemic large granular lymphocytes from undergoing homeostatic apoptosis Blood, June 15, 2006; 107(12): 4834 - 4840. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Chen, I. Yusuf, H.-M. Andersen, and D. A. Fruman FOXO Transcription Factors Cooperate with {delta}EF1 to Activate Growth Suppressive Genes in B Lymphocytes. J. Immunol., March 1, 2006; 176(5): 2711 - 2721. [Abstract] [Full Text] [PDF] |
||||
![]() |
K.-J. Yin, C. Y. Hsu, X.-Y. Hu, H. Chen, S.-W. Chen, J. Xu, and J.-M. Lee Protein phosphatase 2A regulates bim expression via the Akt/FKHRL1 signaling pathway in amyloid-beta peptide-induced cerebrovascular endothelial cell death. J. Neurosci., February 22, 2006; 26(8): 2290 - 2299. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. B. Alvero, W. Chen, A. C. Sartorelli, P. Schwartz, T. Rutherford, and G. Mor Triapine (3-aninopyridine-2-carboxaldehyde thiosemicarbazone) Induces Apoptosis in Ovarian Cancer Cells Reproductive Sciences, February 1, 2006; 13(2): 145 - 152. [Abstract] [PDF] |
||||
![]() |
A. R. Wende, J. M. Huss, P. J. Schaeffer, V. Giguere, and D. P. Kelly PGC-1{alpha} Coactivates PDK4 Gene Expression via the Orphan Nuclear Receptor ERR{alpha}: a Mechanism for Transcriptional Control of Muscle Glucose Metabolism Mol. Cell. Biol., December 15, 2005; 25(24): 10684 - 10694. [Abstract] [Full Text] [PDF] |
||||
![]() |
O. Puig and R. Tjian Transcriptional feedback control of insulin receptor by dFOXO/FOXO1 Genes & Dev., October 15, 2005; 19(20): 2435 - 2446. [Abstract] [Full Text] [PDF] |
||||