 |
INTRODUCTION |
Cdc42p is a member of the Rho/Rac family of GTPases, which play an
essential role in the signal transduction pathways that lead to the
establishment and maintenance of cell polarity and polarized cell
growth in eukaryotic cells (1). In Saccharomyces cerevisiae,
Cdc42p functions in selection of non-random bud sites, rearrangement of
the actin cytoskeleton during bud emergence, and in directing
actin-dependent secretion into an enlarging bud (2-5). The
characteristic loss-of-function cdc42 phenotype, typified by
the cdc42-1ts,
cdc42T17N, cdc42T35A,
cdc42W97R, cdc42D118A,
and cdc42C188S alleles (2, 4-8), is lethality
with cells becoming large, round, and unbudded with multiple nuclei and
delocalized actin and chitin. These alleles affect different aspects of
Cdc42p function, but all lead to defects in bud emergence, suggesting
that Cdc42p primarily functions in this process. However, Cdc42p
localizes to the tips and sides of the enlarging bud following bud
emergence (7), suggesting that Cdc42p regulates polarized cell growth after bud emergence. The mechanisms by which Cdc42p, in conjunction with various effectors and regulators, selects the bud site and maintains polarized growth throughout the cell cycle are still unclear.
There are a number of S. cerevisiae proteins that function
as regulators of Cdc42p activity, including the guanine nucleotide exchange factor Cdc24p (9-13), and the Bem3p, Rga1p, and Rga2p potential GTPase-activating proteins
(GAPs)1 (14-17). Cdc24p
shows genetic as well as two-hybrid interactions with Cdc42p, exhibits
in vitro guanine nucleotide exchange activity against
Cdc42p, and is required for bud emergence. Bem3p, Rga1p, and Rga2p are
potential Cdc42p GAPs, but only Bem3p has been shown to stimulate the
intrinsic GTPase activity of Cdc42p in vitro. Characterization of bem3 rga1 mutants suggest that the GAPs
do not have an essential role in bud emergence, but their elongated bud
morphology (17) suggests that inactivation of Cdc42p to a GDP-bound
state is necessary for cessation of apical polar bud growth. Analysis
of these regulators suggests that the regulation of Cdc42p is critical
for the establishment of bud emergence and may affect cellular
processes later in the cell cycle.
GTP-bound Cdc42p displays physical and/or genetic interactions with a
number of S. cerevisiae downstream effectors, including an
IQGAP homolog Iqg1p/Cyk1p (18-20), a Wiskott-Aldrich syndrome protein
(WASP) homolog Bee1p/Las17p (21), a formin-like protein Bni1p (22-25),
novel Gic1p, Gic2p (26, 27), and the Ste20p, Cla4p, and Skm1p PAK-like
kinases, which are members of the conserved p21(Cdc42/Rac)-activated
kinase (PAK) family of serine/threonine protein kinases (6, 28-36).
Characterization of the PAK kinases implicated both Ste20p and Cla4p in
regulating the actin cytoskeleton (36) and Ste20p in mating and
pheromone response (34) and Cla4p in mitosis and cytokinesis (28, 37),
thereby suggesting that Cdc42p, in addition to its roles in bud
emergence, regulates the pheromone response pathway, mitosis, and
cytokinesis. In addition, Cla4p kinase activity, which is affected by
binding to Cdc42p, peaks in G2/M (29) and cla4
mutants display a mitotic delay (37), further implicating Cdc42p in a
role later in the cell cycle beyond bud emergence. The functional
consequences of Cdc42p interactions with its downstream effectors are
not clear, but recent experiments using green fluorescent protein
(GFP)-tagged Ste20p suggest that Cdc42p may function in localizing
these proteins to the plasma membrane (31, 32). Additionally, Cdc42p
and Cla4p function in the localization of the S. cerevisiae
septin proteins that are thought to be components of the 10-nm filament ring that forms at the bud site prior to budding and remains at the
mother-bud neck region through cytokinesis (38).
To further elucidate Cdc42p cellular function during the cell cycle,
the cdc42V44A allele was characterized. The V44A
mutation lies within the Cdc42p effector domain and was originally
isolated due to its ability to block two-hybrid protein interactions
between Cdc42p and Cdc24p (6). cdc42V44A cells
predominantly had elongated buds containing a single nucleus with a
small percentage of cells conferring a multibudded, multinucleate phenotype indicative of a apical-isotropic switch defect, a
G2/M delay, and a partial cytokinesis defect. The data
presented here also show that localization of actin, chitin, and the
septin ring was altered in elongated-budded
cdc42V44A cells while Cdc42V44Ap
localization appeared to be normal. In conjunction with studies using a
SWE1 CDK inhibitory kinase mutant, which regulates the G2/M morphogenetic checkpoint, these results indicated that
the Cdc42V44A mutant protein activated the G2/M
checkpoint. Cdc42V44Ap is also defective in its
interactions with a subset of CRIB (Cdc42/Rac
interactive binding; Ref. 39) domain-containing
downstream effectors, suggesting that Cdc42V44Ap
differentially interacts with these proteins. Taken together, these
data highlight Cdc42p differential interactions and show that Cdc42p
function is required for timely cell cycle progression.
 |
EXPERIMENTAL PROCEDURES |
Reagents, Media, and Strains--
Enzymes, polymerase chain
reaction (PCR) kits, and other reagents were obtained from standard
commercial sources and used as specified by the suppliers.
Oligonucleotide primers for sequencing and PCR were obtained from
Genosys (The Woodlands, TX). Growth media and maintenance of bacterial
and yeast strains have been described previously (40, 41). The S. cerevisiae strains used are listed in Table
I. The
cla4::TRP1 marker was disrupted by HIS3 in strain TRY3-H by transforming the
trp1::HIS3 marker swap fragment (42), released
from pTH4 by digestion with XhoI and EcoRI, into
TRY1-6B (6). One of the stable His+ integrants was
designated TRY3-H and used for further experiments. Yeast
transformations were performed as described previously (41). Selection
of transformants was on synthetic complete drop-out media lacking
specified amino acid(s) and containing 2% glucose as a carbon source.
To induce the GAL1 promoter, transformants were grown on
solid or liquid media containing 2% raffinose + 2% galactose.
View this table:
[in this window]
[in a new window]
|
Table I
Yeast strains
TRY3-H was generated by integrating a trp1::HIS3
fragment into TRY1-6B (6). TRY3-HV was generated by mating TRY3-H with
TRY5-8C. TRY5 was generated by integrating a linearized pRS306
(cdc42V44A) into DJD6-11. TRY11 was generated by
crossing Y604 with JSO-1B. TRY15 was generated by crossing TRY5-3A
with DLY1028.
|
|
Intragenic suppression of the cdc42D118A
dominant-negative mutant and the cdc42G12V
dominant-activated mutant by the V44A mutation in strain W303-1A was determined using plasmids pRS315(pGAL1/10),
pRS315(pGAL1-CDC42), pRS315(pGAL1-cdc42D118A) (5),
pRS315(pGAL1/10-cdc42V44A,D118A),
pRS315(pGAL1/10-cdc42G12V) (5), and
pRS315(pGAL1/10-cdc42G12V,V44A). Transformants
were selected on SC
Leu plates at 23 °C and individual transformants were streaked to SC
Leu containing 2% glucose or 2%
galactose + 2% raffinose and incubated at 23 °C.
To determine if the Cdc42V44Ap could function as the sole
copy of Cdc42p within the cell, the integrating plasmid
pRS306(cdc42V44A), which was linearized within
the URA3 gene, was transformed into the
CDC42/
cdc42::TRP1 ura3-52/ura3-52
diploid DJD6-11; stable Ura+ transformants had
cdc42V44A, under the control of the endogenous
CDC42 promoter, integrated at the ura3 locus.
Spores from 11 tetrads were grown at 23 °C and then streaked on
selective media to determine marker distributions; segregants that
contained the cdc42V44A mutant allele in a
cdc42 background were Ura+ Trp+.
All Ura+ Trp+ segregants grew at 16 °C,
23 °C, and 30 °C, but not at 37 °C, indicating that
cdc42V44A encoded a functional protein at low
but not high temperatures. One of these temperature-sensitive
segregants, designated TRY5-3A, was selected for further study. To
characterize the cdc42V44A phenotype at
37 °C, wild type (C276-4A), cdc42V44A
(TRY5-3A), and cdc42-1ts (DJTD2-16A) strains
were grown at 20 °C in YEPD liquid media to early log phase, at
which point half the culture was shifted to the non-permissive
temperature of 37 °C for 6 h. To characterize plasmid-mediated
suppression of the cdc42V44A morphology, high
copy plasmids YEp351 (43), YEp351(CDC42) (5), YEp13(BEM3) and YEp13(RGA1) (17),
YEp351(CDC24), p425-75(STE20) (kindly provided
by J. Kurjan), YEp351(CLA4), pKIN2(SKM1) (33), and YEp13(CDC12) (kindly provided by B. Haarer) were
transformed into the cdc42V44A strain TRY5-3A.
Transformants were grown in SC
Leu liquid media at 23 °C to mid-log
phase and sonicated briefly, and the morphology was quantified. The
results presented represent the percent of abnormally budded cells in
the total population of budded cells (n = 200 cells)
and are representative of at least three independent transformation experiments.
Plasmids and DNA Manipulations--
Recombinant DNA
manipulations (40) and plasmid isolation from E. coli (44)
were performed as described previously (6). Automated DNA sequencing at
the Vermont Cancer Center DNA Sequencing Facility was used to sequence
all gene constructs. Site-directed mutagenesis was performed with the
QuikChange site-directed mutagenesis kit (Stratagene, La Jolla, CA).
The plasmid pRS315(CLA4) was created by inserting the
HindIII plus SacII fragment containing Cla4p from
plasmid pBB130 (kindly provided by B. Benton) into pRS315 cut with
HindIII plus SacII. YEp351(CLA4) was
created by inserting the HindIII plus SacI
CLA4 fragment from pRS315(CLA4) into YEp351 cut
with HindIII plus SacI. pRS315(GFP-CDC3) was created by cutting
TD150(GFP-CDC3) (kindly provided by B. Haarer) with
BamHI plus NotI to release the
GFP-CDC3 fragment, which was ligated to pRS315 cut with
BamHI plus NotI. pRS315(GFP-CDC12) was
created by cutting TD150(GFP-CDC12) (kindly provided by B. Haarer) with BamHI plus NotI to release the
GFP-CDC12 fragment, which was ligated to pRS315 cut with
BamHI plus NotI. To create plasmid
pAS1-CYH2(cdc42V44A),
pAS1-CYH2(cdc42V44A,D118A,C188S) (6) was cut
with restriction enzymes EagI plus SalI,
releasing the C-terminal portion of CDC42 containing the
D118A and C188S mutations, which was replaced with the wild type
sequence from pRS315(CDC42). To create
pRS315(cdc42V44A,D118A), the C-terminal portion
of CDC42 containing the D118A mutation was released from
pRS315(cdc42D118A) (5) with EagI plus
SalI and ligated into pRS315 to create pRS315(3'
cdc42D118A).
pRS315(cdc42V44A) was digested with
EagI to release the N-terminal portion of CDC42
containing the V44A mutation which was ligated into pRS315(3' cdc42D118A) digested with EagI,
thereby creating plasmid pRS315(cdc42V44A,
D118A). The plasmid p415MET(GFP
S65T-A8-CDC42) was constructed by cutting
pREP3X(GFP-A8)2
with SpeI and SmaI to release a 730-base pair
fragment (containing a GFPS65T C-terminal in-frame fusion
with eight alanine residues), which was ligated to p415MET (kindly
provided by M. Funk) cut with SpeI and SmaI. The
CDC42 fragment was obtained from pGAL(GFP-CDC42) (kindly provided by J. O'Dell and A. Adams) by cutting with
HindIII, blunt ending the site with Klenow fragment of DNA
polymerase I, and then cutting with SalI. The fragment was
then ligated to p415MET25 (GFP-A8) cut with SmaI
and SalI. To create
p416MET(GFPS65T-A8-CDC42), a
SpeI plus XhoI GFP
S65T-A8-CDC42 fragment released from
p415MET(GFPS65T-A8-CDC42) was
subcloned into the SpeI/XhoI-digested p416MET
(kindly provided by M. Funk).
PCR and Site-directed Mutagenesis--
To create
pEG202(cdc42V44A,C188S),
cdc42V44A was amplified from
pAS1-CYH2(cdc42V44A) by PCR using the Expand
Long Template PCR system (Roche Molecular Biochemicals). The
5'-primer sequence used in the PCR reaction was
GGAATTCCATATGCAAACGCTAAAGTGTG (underlined
sequence is an EcoRI site; double underlined sequence is an
NdeI site that contains the CDC42 start codon),
and the 3'-primer sequence was
CGCGGATCCGACTACAAAATTGTAGATTTTTTACTTTTCTTGATAACAGG (underlined sequence contains a BamHI site followed by
the CDC42 stop codon and the reverse complement of
CDC42; Cys188 to Ser; underlined G is C in the
wild type sequence). The PCR cycling parameters were 30 cycles of
94 °C for 30 s, 55 °C for 30 s, and 72 °C for 1 min.
The resulting 576-base pair PCR fragment was digested with
EcoRI plus BamHI and inserted into
EcoRI/BamHI-digested pEG202. The resulting
construct was sequenced to verify the fusion and
cdc42V44A,C188S sequence.
pEG202(cdc42G12V,V44A,C188S) was created
using the QuikChangeTM site-directed mutagenesis kit from
Stratagene. pEG202(cdc42V44A,C188S) was the DNA
template for the mutagenesis. The nucleotide sequence of the forward
mutagenic primer was GTCGGTGATGTTGCTGTTGGGAAAACG (Gly12 to Val; underlined T is G in the wild type
sequence), and the reverse mutagenic primer was
CGTTTTCCCAACAGCAACAT-CACCGAC (Gly12 to Val;
underlined A is C in the wild type sequence). The cycling parameters
for the mutagenesis were 12 cycles of 95 °C for 30 s, 55 °C
for 30 s, and 68 °C for 21 min.
pRS315(pGAL1-cdc42G12V,V44A) was also
created using the QuikChangeTM kit,
pRS315(cdc42V44A) as the DNA template, and the
mutagenic primers containing the G12V mutation and cycling parameters
described above. The resulting plasmid
pRS315(cdc42G12V,V44A) was cut with
NdeI to release the cdc42G12V,V44A
fragment, which was inserted into
pRS315(pGAL1-CDC42) cut with NdeI.
Sequencing of both plasmids resulting from the mutagenesis confirmed
the sequence of the cdc42G12V,V44A,C188S and
cdc42G12V,V44A alleles.
p416MET(GFPS65T-A8-cdc42V44A)
was also created using the QuikChangeTM kit with
p416MET(GFP S65T-A8-CDC42) as the
DNA template. The nucleotide sequence of the forward mutagenic
primer was CGATAACTATGCGGTGACTGCGATGATTGGTGATGAACC (Val44 to Ala; underlined C is T in the wild type
sequence) and the reverse mutagenic primer was
GGTTCATCACCAATCATCGCAGTCACCGCATAGTTATCG (Val44
to Ala; underlined G is A in the wild type sequence). The cycling parameters for the mutagenesis were as above.
Two-hybrid Protein Interactions--
The methods for
performing two-hybrid analysis have been described previously (45, 46).
Strain EGY48-p1840 (provided by R. Brent and R. Finley, Harvard
University) containing pJG4-5(CLA4) (28),
pJG4-5(SKM1) (kindly provided by D. Lew),
pJG4-5(GIC1), pJG4-5(GIC2) (27), or p717 (also
known as pJG4-5(BNI1 1-1214 aa)) (23) and the various
CDC42 constructs pEG202(CDC42),
pEG202(cdc42C188S),
pEG202(cdc42D118A, C188S),
pEG202(cdc42G12V, C188S) (17),
pEG202(cdc42smallgap,C188S) (kindly provided by
D. Lew), pEG202(cdc42V44A,C188S) and
pEG202(cdc42G12V,V44A,C188S) were selected on
SC
His
Trp media containing 2% galactose + 2% raffinose at
23 °C. Strain EGY48-p1840 containing pRL222(STE20) (kindly provided by M. Whiteway) or pGADC2(IQG1) (20) and
the various pEG202(CDC42) constructs were selected on
SC
His
Leu containing 2% glucose. LexA-DBD fusions in vector pEG202
are under the ADH constitutive promoter. GAL4-AD
fusions in vector pJG4-5 are under the pGAL1 inducible
promoter. GAL4-AD fusions in vector pRL222 or pGADC2 are
under the ADH constitutive promoter.
-Galactosidase liquid assays were performed in triplicate, and
-galactosidase units
were calculated as described previously (47).
Photomicroscopy--
Cells were grown in the appropriate liquid
media at 23 °C to mid-log phase. Cells were collected, sonicated,
and examined morphologically. Methods for preparing and staining cells
with 4',6-diamidino-2-phenylindole (DAPI), Calcofluor, and
rhodamine-phalloidin have been described previously (48). Cells
containing GFP-Cdc3p, GFP-Cdc12p, and GFP-A8-Cdc42p
constructs were grown to mid-log phase, sonicated and observed. Cells
containing GFP-A8-Cdc42p constructs were grown in
SC
Ura
Met media for expression from the methionine repressible
promoter. Photomicroscopy using Hoffman modulation optics was performed
on an Olympus BH-2 epifluorescence microscope. DAPI-stained cells were
examined on a Nikon TE300 inverted microscope equipped with
epifluorescence illumination and Nomarski optics. Video images were
obtained using a VE1000SIT camera (Dage-MTI, Michigan City IN). The
magnification of the image was adjusted with projection optics placed
between the microscope and the video camera. Nikon filter cube UV-2A
(excitation 330-380 nm, emission >420 nm) was used for visualizing
DAPI fluorescence. Photomicroscopy using phase contrast optics (Fig. 2,
B and C) was also performed on an E400 Nikon
microscope (Omega Optical, Brattleboro, VT). GFP-A8-Cdc42p
expressing cells were visualized on this microscope using Omega optical
filter cube XF100 and DAPI staining was visualized with Omega optical
filter cube XF06 filter. All cell and plate images were digital images
that were obtained using a Dage VE-VG-5 video frame grabber card (Scion
Corp, Frederick, MD) and analyzed in Adobe Photoshop 5.0 (Adobe
Systems, Inc., San Jose, CA) on a PowerTower 180 MacOS computer
(PowerComputing, Round Rock, TX). Where indicated, cells from the same
culture but different fields were manipulated into collages using Adobe Photoshop 5.0.
 |
RESULTS |
cdc42V44A Mutant Cells Have an Apical-Isotropic Switch
Defect and a Partial Cytokinesis Defect--
The V44A mutation lies
within the Cdc42p effector domain and was identified in a screen for
point mutations that interfered with two-hybrid interactions between
the Cdc42D118A, C188S mutant protein and Cdc24p (6). The
V44A mutation intragenically suppressed the dominant negative growth
and morphological phenotype associated with the
cdc42D118A allele at 23 °C and the dominant
lethality associated with the cdc42G12V
activated allele (data not shown), raising the possibility that the
V44A mutation led to an inactive protein. However, the
cdc42V44A mutant allele could complement a
cdc42 mutation in strain TRY5-3A, and these cells grew
at 16 °C, 23 °C, and 30 °C, but not at 37 °C, indicating
that cdc42V44A encoded a functional protein at
low but not high temperatures. At 23 °C, ~80% of the
cdc42V44A cells had abnormally elongated buds
and the cells appeared considerably larger than wild type cells (Fig.
1A, upper
panel), suggesting that Cdc42V44Ap was partially
functional at 23 °C. Additionally, ~15% of the cells were
multibudded (Fig. 1B). Staining of these cells with the
fluorescent DNA stain DAPI (Fig. 1A, lower
panel) indicated that 56% of the abnormally budded cells
had 1 nucleus (Fig. 1A, arrowheads), 35% had two
nuclei and 9% of the cells had more than two nuclei (Fig.
1A, arrows). The elongated-budded morphology along with the multinucleated cells indicated that
Cdc42V44Ap conferred a delay in the apical-isotropic switch
in bud growth and in the G2/M transition as well as a
partial cytokinesis defect to cells at 23 °C.

View larger version (68K):
[in this window]
[in a new window]
|
Fig. 1.
Morphological characterization of the
cdc42V44A mutant. A, the
morphological phenotype and DNA content of the
cdc42V44A strain TRY5-3A was compared with wild
type C276-4A cells at 23 °C using Nomarski optics (upper
panels) and DAPI staining (lower
panels). Cells were grown in YEPD liquid media to mid-log
phase and sonicated briefly before observation. Scale
bar, 10 µm. B, multibudded
cdc42V44A cells at 23 °C (strain
TRY5-3A).
|
|
To determine whether cdc42V44A had a cytokinesis
or cell separation defect, cdc42V44A cells were
fixed, treated with the cell wall-digesting enzyme glusulase, and the
morphological phenotype quantified pre- and post-glusulase. The
percentage of budded and multibudded cells in the glusulase-treated
cells decreased by 30%, correlating with a 30% increase in the
unbudded cell population. These results suggested that
cdc42V44A cells have a cell separation defect.
However, ~8% of the budded population post-glusulase were still
multibudded, suggesting that cytokinesis may be defective or at least
delayed in these cells.
The cdc42V44A phenotype at 37 °C was also
characterized to determine the basis for the lethality. After 6 h
at 37 °C, the cdc42V44A strain had a mixed
population of cells with 62% being abnormally budded and 38% being
large, round, and unbudded as compared with prototypic
cdc42-1ts cells, 69% of which were large,
round, and unbudded (n = 100 cells). This 37 °C
phenotype differed not only from the cdc42-1ts
phenotype, but also from the abnormal 20 °C morphology of
cdc42V44A cells, in which no large, round,
unbudded cells were observed.
The cdc42V44A Mutant Triggers the
Swe1p-dependent Morphogenetic Checkpoint to Delay the
Apical-Isotropic Switch and Nuclear Division--
The
cdc42V44A elongated-budded phenotype suggested
that these cells have a delay in the apical-isotropic growth switch,
resulting in hyperpolarized cortical actin. Indeed,
cdc42V44A cells showed an abnormal cortical
actin localization pattern as compared with wild type cells (Fig.
2A). Cortical actin was polarized to the tips of elongated buds, suggesting that the
apical-isotropic growth switch that occurs during the G2/M
transition was delayed in cdc42V44A cells. This
actin localization pattern was similar to the patterns seen in abnormal
cla4 cells (Fig. 2A) and was less severe but similar to the actin localization seen in
cdc12ts cells at non-permissive temperatures
(data not shown; Ref. 49). These results also suggested that
cdc42V44A defects may trigger the
Swe1p-dependent G2/M morphogenetic checkpoint, which monitors the apical-isotropic switch through the Clb2p/Cdc28p regulatory kinase (50-53).

View larger version (86K):
[in this window]
[in a new window]
|
Fig. 2.
Actin localization and suppression of the
cdc42V44A morphology by
swe1. A, C276-4A (wild
type), TRY5-3A (cdc42V44A), and TRY1-9D
( cla4) cells were grown in YEPD at 23 °C to mid-log
phase, fixed and stained with the actin fluorescent stain
rhodamine-phalloidin using standard fixation and staining procedures.
All cells were sonicated briefly before observation. B,
TRY15-23B ( swe1), TRY15-23A
(cdc42V44A), and TRY15-21A
(cdc42V44A swe1) were grown in
YEPD liquid media at 23 °C to mid-log phase, sonicated briefly, and
observed. C, TRY15-23B ( swe1) and TRY15-21A
(cdc42V44A swe1) were grown in
YEPD liquid media at 23 °C to mid-log phase, stained with DAPI, and
sonicated briefly before observation. Scale bars,
10 µm.
|
|
To examine whether cdc42V44A defects triggered
the Swe1p-dependent morphogenetic checkpoint, the
cdc42V44A mutant phenotype was examined in a
swe1 background. A cdc42V44A
swe1 double mutant no longer exhibited the
elongated-budded phenotype characteristic of
cdc42V44A cells at 23 °C (Fig.
2B), which supported an apical-isotropic switch delay that
was Swe1p-dependent. However, the morphology of these cells
was not completely normal, with 55% of the
cdc42V44A
swe1 budded cells
displaying a multibudded or irregular morphology (Fig. 2B).
DAPI staining revealed that 29% of all
cdc42V44A
swe1 cells contained
greater than two nuclei (Fig. 2C), indicating that the
swe1 mutation did not suppress and may exacerbate the cdc42V44A multinucleate phenotype. The multiple
nuclei were also unevenly distributed in mother and daughter cells with
some daughter cells having two nuclei (Fig. 2C,
leftmost panel). The increased number of nuclei
per cell and the abnormal multibudded morphology of cdc42V44A
swe1 cells indicated
that loss of Swe1p exacerbated Cdc42V44Ap effects,
highlighting the cytokinesis and/or cell separation defect. The nuclear
staining of cdc42V44A cells (Fig. 1A)
as compared with cdc42V44A
swe1
cells also suggested that cdc42V44A cells had a
nuclear division delay, which is characteristic of activation of the
G2/M morphogenetic checkpoint.
To confirm whether these mutant cells truly had a cell cycle delay,
cell synchrony experiments to follow the nuclear cycle were attempted.
However, due to the mutant morphology, standard cell synchrony
experiments, such as
-factor arrest, were unsuccessful. However, it
was found that growth in 0.5 M NaCl remediated the abnormally budded morphological and multinucleate phenotypes at 23 °C with 82% of the budded cdc42V44A cells
(strain TRY5-8C) having a normal budded morphology and none of the
normally budded cells having more than 2 nuclei. Furthermore, cdc42V44A cells grown in NaCl and then shifted
to restrictive temperatures in fresh media without NaCl were found to
be a nearly uniform population of large unbudded cells. These results
suggested that NaCl remediated the 23 °C mutant morphology but did
not remediate the cdc42V44A temperature sensitivity.
Using this NaCl remediation as a means to increase cell synchrony, cell
cycle reciprocal shift experiments were performed to determine if there
was a delay in the nuclear cycle of cdc42V44A
cells relative to cdc42V44A
swe1
cells. cdc42V44A cells (strain TRY5-8C) and
cdc42V44A
swe1 cells (strain
TRY15-21A) were grown in 0.5 M NaCl media to late-log
phase, washed, and then shifted to 37 °C in fresh media without NaCl
for 1 h to obtain a population in which ~80% of the cells were
unbudded and >80% of the cells were uninuclear. These cells were then
shifted to permissive temperature (23 °C) and observed over time
with DAPI to determine when nuclear division occurred. Both
cdc42V44A and cdc42V44A
swe1 mutant cells began budding ~1 h after the shift to
23 °C and the abnormally elongated budded phenotype in
cdc42V44A mutant cells became apparent ~30 min
later with buds increasing in length over time. At 4 h after the
shift to permissive temperatures, ~50% of the abnormally budded
cells had two nuclei, suggesting that these cells eventually complete
nuclear division. In contrast to cdc42V44A
cells, ~50% of the cdc42V44A
swe1 cells had two or more nuclei within 2 h after
the temperature shift. These results indicated that
cdc42V44A cells had an ~2-h nuclear division
delay as compared with cdc42V44A
swe1 cells and indicated further that the
cdc42V44A cell cycle delay is
Swe1p-dependent.
cdc42V44A Cells Have Abnormal Chitin Localization and
Aberrant and Delocalized Septin Ring Structures--
To determine if
chitin was delocalized as seen in other cdc42 mutants,
cdc42V44A cells were stained with the chitin
stain Calcofluor. The haploid cdc42V44A cells
had a normal axial budding pattern, but ~50% of the budded cells did
not form a defined chitin ring at the mother-bud neck region and had
diffuse chitin localized around the entire periphery of the cell (Fig.
3). The cdc42V44A
mutant cells staining pattern was comparable to that seen in
cla4 (Fig. 3) and cdc12 mutants (data not
shown; Ref. 54). The mother-bud neck region of
cdc42V44A cells also appeared wider than wild
type cells and was comparable to the enlarged neck region of
cla4 cells. These results suggested that one of the
mechanistic defects in cdc42V44A cells was
delocalized chitin deposition. Since chitin localization is dependent
on the septins, these observations suggested that cdc42V44A cells had defects in septin ring
localization.

View larger version (94K):
[in this window]
[in a new window]
|
Fig. 3.
Chitin and GFP-Cdc12p localization in
cdc42V44A mutant cells. C276-4A,
TRY5-3A, and TRY1-9D (see Fig. 2 legend) were grown in YEPD at
23 °C to mid-log phase, fixed and stained with the chitin-specific
fluorescent stain Calcofluor. To observe GFP-Cdc12p localization in
cdc42V44A cells, pRS315(GFP-CDC12)
was transformed into EGY48 (wild type), TRY5-8C
(cdc42V44A) and TRY1-9D ( cla4).
Large arrows point to cells with slightly
elongated neck. Arrowheads point to abnormal GFP-Cdc12p
localization in a morphologically mutant
cdc42V44A cells. GFP-Cdc12p images are collages
from the same cell culture manipulated in Adobe Photoshop 5.0. Scale bar, 10 µm.
|
|
To further explore a possible link between Cdc42V44Ap and
septins, we compared the localization of Cdc3p and Cdc12p tagged with GFP, which were expressed from their endogenous promoters in plasmid pRS315, in wild type and cdc42V44A cells (Fig.
3; only GFP-Cdc12p is shown; GFP-Cdc3p gave identical results). In wild
type cells, both GFP-Cdc3p and GFP-Cdc12p localized to the mother-bud
neck region as a bright ring structure and many of the cells showed a
double ring structure at the neck region, as was seen in
immunofluorescence localization studies with anti-Cdc3p and anti-Cdc12p
antibodies (Fig. 3; Refs. 55 and 56). It was also noted that the
overexpression of either GFP-Cdc3p or GFP-Cdc12p did not alter the
morphology of wild type cells. In contrast to wild type cells,
expression of GFP-Cdc3p and GFP-Cdc12p did alter the morphology of
cdc42V44A cells with >50% of cells appearing
normal. The elongated budded cells typically seen in the
cdc42V44A cell population made up only a small
percentage of the cdc42V44A cell population
overexpressing either septin protein, suggesting that Cdc3p or Cdc12p
suppressed the morphological defects seen in
cdc42V44A cells alone. Overexpression of Cdc12p
alone also showed the same quantitative level of suppression, but it
did not suppress the cdc42V44A temperature
sensitive defect. However, the morphology of the elongated budded cells
overexpressing either GFP-Cdc3p, GFP-Cdc12p, or Cdc12p was altered from
the typical cdc42V44A cell morphology as
evidenced by the presence of cells with normal buds but a slightly
elongated neck region (Fig. 3, arrows; normally budded cells
with the slightly elongated neck regions were considered abnormally
budded cells in the quantitative analysis of GFP-Cdc3p, GFP-Cdc12p, or
Cdc12p suppression).
The cdc42V44A cells containing GFP-Cdc3p or
GFP-Cdc12p that appeared to have normal buds had intact, properly
localized septin rings. In normally budded cells with a slightly
extended neck region, both GFP-Cdc3p and GFP-Cdc12p containing septin
rings appeared to be intact. However, in these abnormal cells, the
septin ring was localized at the base of the rounded bud at the point of constriction as opposed to at the mother-bud neck region
(arrows in Fig. 3 show GFP-Cdc12p-containing cells which are
representative of GFP-Cdc3p cells). Furthermore, of the elongated
budded cells seen, many appeared to have a diffuse septin ring and GFP
fluorescence could be seen at the tip and around the sides of the bud
(Fig. 3, arrowheads). This aberrant septin ring localization
was seen in 82% of the abnormally elongated budded cells. These
results suggested that the Cdc42V44Ap had an adverse effect
on the localization of Cdc3p and Cdc12p and the structural formation of
the septin ring.
Abnormal localization of GFP-Cdc3p and GFP-Cdc12p was also observed in
cla4 cells, with the abnormally elongated budded cells having a diffuse staining pattern and bud tip staining pattern that was
similar to the patterns seen in cdc42V44A cells
(Fig. 3, arrowheads). The
cla4 cells also had
intact septin rings in normal cells and intact rings that were wider or
delocalized in elongated budded cells (Fig. 3, arrows).
Interestingly, the percentage of abnormally budded cells in the
cla4 cell population did not change upon overexpression
of GFP-Cdc3p or GFP-Cdc12p, suggesting that overexpression of Cdc3p or
Cdc12p could not suppress the abnormal morphology associated with
cla4 cells (see "Discussion").
GFP-A8-Cdc42V44Ap Localizes Properly to
Regions of Polarized Growth--
The altered localization of actin,
chitin, and septin proteins in cdc42V44A cells
raised the possibility that these morphological defects could be due to
delocalization of Cdc42p. To explore Cdc42p localization patterns
through the cell cycle, Cdc42p was fused in-frame to the C terminus of
GFP containing a C-terminal eight alanine linker, and expressed from a
methionine-repressible promoter in wild type strain TRY11-7D. The
GFP-A8-Cdc42p fusion was able to complement the
cdc42-1ts mutant, indicating that
GFP-A8-Cdc42p was
functional.3 As seen
previously with endogenous Cdc42p and anti-Cdc42p antibodies (7),
GFP-A8-Cdc42p localized to the presumptive bud site prior to bud emergence, and to the sides and tip of emerging buds (Fig. 4, upper panels).
In most medium to large budded cells, GFP-A8-Cdc42p was
localized to the tips and sides of buds (Fig. 4, upper
panels), which was not clearly distinguished previously (7).
In addition, in most large budded cells, GFP-A8-Cdc42p was
localized at the mother-bud neck region (Fig. 4, upper
panels), suggesting that Cdc42p may function later in the
cell cycle around the time of cytokinesis and/or cell separation. A
similar localization pattern was seen for a
GFP-A8-Cdc42V44A fusion protein (Fig. 4,
upper panels), indicating that the
cdc42V44A morphological defects were not due to
delocalized Cdc42V44Ap. GFP-A8-Cdc42p and
GFP-A8-Cdc42V44Ap were also expressed in the
cla4 strain TRY1-9D and both GFP-A8-Cdc42p constructs localized to the presumptive bud sites, to the tips of
elongated buds and to the mother-bud neck region in some cells (Fig. 4,
lower panels). These results suggested that
Cdc42p localization was not dependent on Cla4p. The localization of
GFP-A8-Cdc42p to the elongated bud tip suggested that
Cdc42p may regulate, or be dependent on, the apical-isotropic growth
switch and that the mitotic delay characteristic of cla4
mutants may result in prolonged localization of Cdc42p to the bud
tip.

View larger version (66K):
[in this window]
[in a new window]
|
Fig. 4.
GFP-A8-Cdc42p localization.
p416MET(GFPS65T-A8-CDC42) and
p416MET(GFPS65T-A8-cdc42V44A)
were transformed into TRY11-7D (wild type) and TRY1-9D
( cla4). Transformants were selected on SC Ura plates,
and then selected transformants were grown at 23 °C to mid-log phase
in SC Ura Met liquid media for expression from the
methionine-repressible promoter.
|
|
Two-hybrid and Genetic Evidence Indicated Cdc42V44Ap
Had Altered Interactions with Downstream Effectors Cla4p, Gic1p, and
Gic2 but Not Ste20p, Skm1p, Bni1p, or Iqg1p--
Since the V44A
mutation is located in the effector domain, it seemed likely that the
primary defect of Cdc42V44Ap was due to altered
interactions with its regulators and effectors. Previous two-hybrid
experiments had indicated that the V44A mutation affected interactions
between Cdc42p and Cdc24p (6) supporting this hypothesis. To further
explore Cdc42V44Ap interactions, two-hybrid analysis was
performed with known Cdc42p effectors. Two-hybrid interactions between
Cla4p and the Cdc42V44A,C188S mutant protein were
significantly decreased, but not abolished, in comparison to
interactions between Cla4p and the Cdc42C188Sp (Fig.
5; the C188S mutation was introduced to
override the normal plasma membrane localization of Cdc42p). The
Cdc42G12V,V44A,C188Sp also showed a reduced interaction
with Cla4p as compared with Cdc42G12V,C188Sp interactions
(data not shown). These results suggested that the V44A mutation
partially inhibited interactions between Cdc42p and Cla4p. The V44A
mutation also affected interactions with the novel effectors Gic1p and
Gic2p with both proteins showing a reduced interactions with Cdc42p
when the V44A mutation was present (Fig. 5) and also when in
conjunction with the G12V mutation (data not shown).

View larger version (23K):
[in this window]
[in a new window]
|
Fig. 5.
Cdc42V44Ap two-hybrid protein
interactions. -Galactosidase liquid assays were performed in
triplicate. These data are the averages of one triplicate assay for
each interaction and are representative of at least four independent
-galactosidase liquid assays for each interaction.
|
|
In contrast, the V44A mutation did not affect interactions of either
Cdc42C188Sp or Cdc42G12V, C188Sp with
downstream effectors Ste20p, the third PAK homolog Skm1p, the Bni1p
formin or the cytokinesis effector Iqg1p (Fig. 5). The interactions
between Skm1p and Cdc42p were relatively weak (4.3 ± 1.4 Miller
units) when compared with the interactions between Cdc42C188Sp and Cla4p or Ste20p (Fig. 5), but they did
increase when Cdc42p was locked in the activated GTP-bound state by the
G12V mutation (43.3 ± 1.4 Miller units with
Cdc42G12V, C188Sp and 33.1 ± 3.7 Miller
units with Cdc42G12V,V44A,C188Sp), suggesting that Skm1p is
a bona fide Cdc42p downstream effector. None of the proteins
tested interacted with the presumably GDP-bound Cdc42D118Ap
as was previously reported (data not shown; Refs. 17 and 28)), or with
a Cdc42 deletion derivative missing amino acids 32-40 of the effector
domain (data not shown), suggesting that all these proteins have some
contact with the Cdc42 effector domain. Overall, these two-hybrid
results suggested that the V44A mutation differentially altered
interactions with Cla4p, Gic1p, and Gic2p, but did not affect
interactions with Ste20p, Skm1p, Bni1p, or Iqg1p.
To further define which Cdc42p regulators and effectors were affected
by the V44A mutation, suppression of the
cdc42V44A temperature sensitivity or
morphological defect by proteins known to interact with Cdc42p was
examined. High copy plasmids containing CDC42,
BEM3, RGA1, CDC24, STE20,
CLA4, or SKM1 under their endogenous promoters,
or GIC2 under the ADH promoter were transformed
into cdc42V44A strain TRY5-3A, and
transformants were streaked at 23 °C and 37 °C. Plasmids
containing CDC42 completely complemented the
cdc42V44A morphological defect at 23 °C and
could also complement the temperature sensitive lethality. However, it
could only partially complement the morphological phenotype at 37 °C
(data not shown), suggesting that the V44A mutation was semi-dominant
at 37 °C. Overexpression of the other seven proteins could not
suppress the cdc42V44A temperature-sensitive
lethality (data not shown), and overexpression of Bem3p, Rga1p, Skm1p,
or Gic2p did not affect the morphology of
cdc42V44A cells at 23 °C. In contrast,
overexpression of Cla4p from a high copy plasmid showed efficient
suppression with 81% of the budded cells displaying a normal
budded morphology. Effective suppression of the
cdc42V44A morphology was also seen with the low
copy number plasmid pRS315(CLA4), but the level of
abnormally budded cells was consistently higher with
YEp351(CLA4) versus pRS315(CLA4),
suggesting that suppression by CLA4 was dosage dependent.
When Cdc24p was overexpressed in cdc42V44A
cells, 43% of the budded cells had a normal budded phenotype while
55% of the budded cells had a normal budded phenotype when Ste20p was
overexpressed, suggesting that expression of these proteins only
partially suppressed the mutant phenotypes. Together with the
two-hybrid data, these results suggest that Cdc42V44Ap
altered interactions with Cla4p are the primary contributor to the
cdc42V44A morphological defect.
To further examine the functional relationship between
Cdc42V44Ap and Cla4p, a cdc42V44A
cla4 double mutant was tested for synthetic lethality.
The cdc42V44A
cla4::trp1::HIS3 diploid strain
TRY3-HV was sporulated and, of 95 spores (from 50 tetrads), none were
Ura+ Trp+ His+, suggesting that the
cdc42V44A
cla4 double mutant is
inviable at 23 °C. To confirm this apparent synthetic lethality, a
LEU2-based CDC42 plasmid,
pRS315(CDC42), was transformed into TRY3-HV, and upon
sporulation and tetrad dissection, three Ura+
Trp+ His+ Leu+ spores were
isolated, indicating that a cdc42V44A
cla4 double mutant could be rescued by CDC42
on a plasmid. All three segregants were stably Leu+,
indicating that these spores required plasmid-borne CDC42
for survival and confirming that cdc42V44A
cla4 double mutant displayed synthetic lethality. Similar
synthetic lethality was observed with the
cdc42-1ts mutant allele (28). These results
indicate that these mutant Cdc42 proteins cannot function as the sole
copy of Cdc42p in the cell without a functional Cla4p. Similar
cdc42V44A constructs were made with
ste20,
bem3,
rga1,
cdc3-1ts, and cdc12-5ts
mutants, but none of these double mutants displayed synthetic lethality.
 |
DISCUSSION |
S. cerevisiae Cdc42p has been implicated in a number of
different processes from bud emergence to pheromone response, but mostly through indirect information obtained from characterization of
known Cdc42p interacting regulators and effectors. Insight into Cdc42p
direct functions and interactions have been limited to characterization
of mutants that primarily have defects that disrupt the polarity of the
actin cytoskeleton and prevent bud emergence or affect the
nucleotide-binding state of Cdc42p. The cdc42V44A allele gave rise to an elongated
multibudded, multinuclear phenotype, a phenotype that differed from
other previously characterized cdc42 mutant alleles.
Analysis of this novel effector domain mutant cdc42V44A showed that Cdc42p was required for
triggering the apical-isotropic growth switch and for timely
progression through the G2/M transition.
Based on the altered two-hybrid interactions with Cla4p, the
dosage-dependent suppression by CLA4 and the
synthetic lethality of the cdc42V44A
cla4 double mutant, Cdc42V44Ap effects on
morphology and the cell cycle were likely manifested through Cla4p.
Data implicating Cdc42p in the regulation of Cla4p kinase activity
during the cell cycle have been reported previously. Cla4p kinase
activity was found to be most active during mitosis, and when the Cla4p
CRIB domain was deleted, kinase activity peaked closer to
G1/START (29). Cla4p also has been shown to biochemically and genetically interact with the Gin4p and Nap1p kinases, which are
thought to play a role in regulating the Clb2p/Cdc28p
kinase-dependent G2/M transition (37, 57, 58).
Therefore, Cdc42V44Ap altered interactions with Cla4p may
be affecting the regulatory pathway that controls passage through the
G2/M transition to cause a nuclear division delay that at
least partially contributes to the mutant phenotype.
Recently, the septin proteins, among their many roles during the cell
cycle, have also been implicated in regulating entry into mitosis (58,
59), which suggests that the septin structural defects seen in
cdc42V44A may trigger the G2/M
checkpoint. Septin ring formation occurs in the G1 phase of
the cell cycle ~15 min prior to bud emergence (56), and is required
for proper chitin ring formation prior to bud emergence at the
presumptive bud site, but is not required for bud emergence itself (38,
54). Previously, cdc42 loss of function mutants were found
to have delocalized chitin and were unable to localize or form a septin
ring (38). The delocalized chitin deposition and lack of a chitin ring
in 50% of cdc42V44A cells suggested that
Cdc42V44Ap is affecting the function or structure of the
septin ring and the delocalization of GFP-Cdc3p and GFP-Cdc12p
corroborated this hypothesis. The diffuse and delocalized GFP-Cdc3p and
GFP-Cdc12p staining patterns in cdc42V44A
elongated-budded cells (Fig. 3) suggested that Cdc42V44Ap
affected septin ring formation or maintenance but not localization of
the septins to the bud. Therefore, along with its role in localizing the septins to the presumptive bud site, Cdc42p may play a role in the
structural assembly and maintenance of the septin ring.
The correlation between the cdc42V44A
morphological defects and Cdc42p interactions with Cla4p and the
aberrant ring structure seen in these mutant cells suggests that
together Cdc42p and Cla4p regulate the septins. There are several lines
of evidence that support a functional relationship between Cdc42p,
Cla4p, and the septins. First, a
cla4 mutant had defects
in the maintenance of the septin ring to the mother-bud neck region as
shown in Fig. 3 that were similar to the septin ring defects seen in
cdc42V44A cells.
cla4ts ste20 double mutant cells have
also been shown to have similar defects in septin ring maintenance
(28). Second, several genetic interactions between Cdc42p, Cla4p, and
the septins have been established including synthetic lethality
observed with
cla4 cdc42V44A and
cla4 cdc42-1 double mutants as well as cla4
cdc12 double mutants (28). Further evidence to support this
hypothesis is that Gin4p mitosis-specific phosphorylation is dependent
on Cla4p whose mitosis-specific phosphorylation is dependent on Nap1p
and Cdc42p (37). Gin4p kinase activity promotes septin organization and
the septins interact with, and are dependent on Gin4p for proper ring
structure (60). Therefore, Cdc42V44Ap reduced interaction
with Cla4p may be affecting Cla4p functional association with Gin4p
thereby interfering with septin ring structure. The ability of Cla4p
and Cdc12p to suppress cdc42V44A could be due to
the overexpressed proteins localizing and functioning properly,
allowing cells to progress through G2/M.
Interestingly, overexpression of GFP-Cdc12p did not suppress the
cla4 elongated-bud phenotype, but was able to partially suppress the cdc42V44A phenotype, suggesting
that the cdc42V44A mutant had a milder septin
localization defect than the
cla4 mutant. It should also
be noted that the penetrance of the elongated-bud morphological defect
was higher in cdc42V44A cells (80% of budded
cells) than in
cla4 mutant cells (50% of budded cells).
This difference in penetrance suggested that the cdc42V44A phenotype was not solely the result of
altered interactions with Cla4p. Two-hybrid analysis revealed that the
V44A mutation, in addition to reducing interactions with Cla4p,
affected interactions with Cdc24p (6) and effectors Gic1p and Gic2p
(Fig. 5). The correlation between the reduced interactions between
Cdc42V44Ap and Gic1p or Gic2p is difficult to assess since
the functions of Gic1p and Gic2p are not well defined and Gic2p, unlike
Cla4p, was unable to suppress the cdc42V44A
morphological defect. However, gic1 gic2 double mutants
appear to have defects in nuclear migration (27), suggesting that the reduced two-hybrid interactions seen between Cdc42V44Ap and
Gic1p and Gic2p were contributing to the nuclear division delay seen in
cdc42V44A cells. Furthermore, genetic
interactions between Gic1p, Gic2p, and Cla4p have been observed (27),
suggesting that these proteins may have overlapping roles as Cdc42p
effectors. Therefore, the reduced interactions between
Cdc42V44Ap and Cla4p, Gic1p, and Gic2p are all likely
contributing to the cdc42V44A phenotype and may
explain why the cdc42V44A phenotype is more
severe than the cla4 mutant phenotype. Taken together, these
results suggested that the severity of the
cdc42V44A G2/M delay was not due to
a specific alteration of Cdc42p function and/or protein interactions,
but was the result of a combination of altered functions and
interactions with several regulators and effectors including Cdc24p,
Cla4p, Gic1p, and Gic2p.
The proper localization of the GFP-Cdc42V44A fusion protein
suggested further that the effects of the V44A mutation are most likely the result of altered protein interactions as opposed to a localization defect (Fig. 4). It is interesting to note that wild type
GFP-A8-Cdc42p localized not only to the pre-bud site and
the tips and sides of elongating buds but also to the mother-bud neck
region in some larger budded cells, suggesting a function in
cytokinesis and/or cell separation. The partial cytokinesis and cell
separation defect in cdc42V44A cells also
supports a role for Cdc42p at later stages in the cell cycle although
what that function is remains unclear. GFP-A8-Cdc42p also
localized properly regardless of the presence of Cla4p, suggesting that
Cdc42p localization is not dependent Cla4p.
The cdc42V44A
swe1 phenotype (Fig.
2) is consistent with Cdc42V44Ap activating the
G2/M morphogenetic checkpoint that controls the apical-isotropic growth switch and entry into mitosis. Swe1p, the
S. cerevisiae homolog of the Schizosaccharomyces
pombe CDK inhibitory kinase Wee1p, phosphorylates the Cdc28p
cyclin-dependent kinase on residue Y19 (61, 62), thereby
inhibiting Cdc28p kinase activity and resulting in a G2
phase cell-cycle delay. Swe1p is required for the morphogenetic
checkpoint, and monitors the actin cytoskeleton and possibly other
structural components required during the budding process (51, 53, 63),
and
swe1 mutants no longer delay at G2 phase.
The aberrant phenotype associated with the
cdc42V44A
swe1 double mutant
suggested that
swe1 suppressed the elongated-budded phenotype characteristic of a G2/M delay but did not
alleviate the aberrant multibudded and multinucleate defects associated with Cdc42V44Ap, suggesting that the G2/M delay
is necessary to repair or compensate for the effects of
Cdc42V44Ap in order to allow the cell to proceed through
the checkpoint. However, since some cdc42V44A
cells are multibudded and multinucleate even post-glusulase treatment, which indicated that a percentage of the cells do have a cytokinesis defect, the G2/M delay may not always be sufficient for
alleviating Cdc42V44Ap effects.
Actin depolarization prior to relocalization to the mother-bud neck
region for cytokinesis is characteristic of the apical-isotropic growth
switch that occurs during the G2/M transition and requires activation of the Clb2p/Cdc28p kinase complex (51, 52). However, the
cdc42V44A G2/M delay did not seem to
be the result of a depolarized cytoskeleton or a loss of bud emergence.
Rather, proper actin polarization and bud emergence in
cdc42V44A cells suggested that
Cdc42V44Ap exerts some other cellular effect prior to the
G2/M transition that is initiating the G2/M
morphogenetic checkpoint. Since one of the mechanistic defects observed
in cdc42V44A cells is in septin ring structure,
passage through the G2/M checkpoint in these cells may be
regulated through the septins. If this is the case, then
cdc42V44A cells that were able to form a stable
septin ring during the mitotic delay may have progressed through the
checkpoint allowing for viability, while those cells that never formed
a stable ring did not recover from the checkpoint resulting in the
cytokinesis defect seen in some cells. The septin proteins have
recently been implicated in regulating the Swe1p morphogenetic
checkpoint pathway through their interactions with Hsl1p, a Nim1p-like
protein that negatively regulates Swe1p, and Hsl1p homologs Kcc1p and
Gin4p (59).
swe1 also suppressed the cdc12
elongated-bud phenotype and the
swe1 cdc12 double mutant
had similar morphological and nuclear phenotypes to those seen in
cdc42V44A
swe1 cells (59).
Therefore, Cdc42p-dependent regulation of septin
organization may be required for progressing through the G2/M morphogenetic checkpoint.
The data presented here strongly suggest that Cdc42p is required for
timely cell cycle progression and is dependent on differential interactions with its regulators and downstream effectors for function.
The differential interactions seen between Cdc42V44Ap and
various regulators and effectors most likely contributed to the severe
morphological defects associated with cdc42V44A.
Surprisingly, this mutant is still viable, suggesting that Cdc42p functioning with other proteins in the cell can compensate for these
altered interactions. The characterization of
cdc42V44A also suggested that Cdc42p has a
direct role in septin ring structural maintenance that is mediated by
Cla4p. What still remains unclear is how Cdc42p signals are passaged
through its various interactions with regulators and downstream
effectors to structural cellular components like actin and the septins.
Future characterization of cdc42 mutants that
mechanistically disrupt interactions with various regulators, effectors
and structural components of the cell polarity pathway should be useful
in discerning the Cdc42p-dependent signals required for bud
emergence, the G2/M transition and cytokinesis.