![]()
|
|
||||||||
J Biol Chem, Vol. 274, Issue 24, 16973-16978, June 11, 1999
§,
,
, and
From the
Department of Physiology, Dartmouth Medical
School, Lebanon, New Hampshire 03756-0001 and ¶ Department of
Cellular and Molecular Physiology, School of Medicine, Yale University,
New Haven, Connecticut 06520
| |
ABSTRACT |
|---|
|
|
|---|
The early phase of the stimulatory effect of
aldosterone on sodium reabsorption in renal epithelia is thought to
involve activation of apical sodium channels. However, the genes
initiating this effect are unknown. We used a combination of polymerase
chain reaction-based subtractive hybridization and differential display techniques to identify aldosterone-regulated immediate early genes in
renal mineralocorticoid target cells. We report here that aldosterone rapidly increases mRNA levels of a putative Ser/Thr kinase,
sgk (or serum- and
glucocorticoid-regulated kinase), in its native target cells, i.e. in cortical collecting duct cells. The
effect occurs within 30 min of the addition of aldosterone, is mediated through mineralocorticoid receptors, and does not require de
novo protein synthesis. The full-length sequences of rabbit and
mouse sgk cDNAs were determined. Both cDNAs show
significant homology to rat and human sgk (88-94% at the
nucleotide level, and 96-99% at the amino acid level). Coexpression
of the mouse sgk in Xenopus oocytes with the
three subunits of the epithelial Na+ channel results in a
significantly enhanced Na+ current. These results suggest
that sgk is an immediate early aldosterone-induced gene,
and this protein kinase plays an important role in the early phase of
aldosterone-stimulated Na+ transport.
Aldosterone is a key regulator of Na+ homeostasis. Its
effects are mediated through the mineralocorticoid receptor, a member of the steroid-thyroid receptor superfamily. Although the central role
of aldosterone in the control of renal Na+ transport has
been known for decades, the exact molecular steps of this regulation
are still unknown.
It is generally accepted that aldosterone increases Na+
reabsorption by affecting both the apical amiloride-sensitive
epithelial Na+ channel
(ENaC)1 and the basolateral
Na,K-ATPase (reviewed in Ref. 1). Aldosterone's effects on
Na+ transport can be divided into early and late phases.
The early response, a stimulated apical Na+ influx, takes
place about 0.5-3 h after hormone addition and is thought to be
mediated by activation of pre-existing apical channels (2), whereas the
late phase of aldosterone action (several hours to days) probably
involves synthesis of new Na+ channels (3-7) and
Na,K-ATPase molecules (8).
There is a strong indication that activation of Na+
channels pre-existing in the membrane occurs through post-synthetic
modifications such as phosphorylation or methylation. Regulation of
Na+ channel activity by protein kinases has been described
by several laboratories (9-12). Importantly, aldosterone was found to
increase phosphorylation of specific residues on the Both the early and the late effects of aldosterone are transcription-
and translation-dependent. However, the specific genes involved in the early response to aldosterone are still unknown. Such
immediate early genes might encode enzymes that directly modify ENaC or
increase the activity of regulatory proteins that, in turn, activate
ENaC. Although previous observations by several laboratories including
ours strongly indicate that aldosterone increases the mRNA levels
of ENaC subunits (3-7), this effect does not occur until several hours
or days and is thus unlikely to be responsible for the early effects of aldosterone.
Previous attempts to identify aldosterone-induced proteins using
two-dimensional gel electrophoresis were largely unsuccessful (16, 17).
Although these studies yielded several putative aldosterone-induced
proteins, these proteins were expressed during the late phase and were
probably not specific for aldosterone (16, 17). More recently, Attali
et al. (18) identified a dexamethasone-induced gene
(CHIP) in rat colon; however, it is not induced by
aldosterone in the kidney (19). Spindler et al. (20)
recently described early induced genes in A6 cells. The high
concentrations of aldosterone (1 µM) used in that study, combined with the fact that A6 cells do not have functional
mineralocorticoid receptors (MRs) (21), suggest that those genes are
most likely regulated through glucocorticoid receptors (GR). In
addition, the functional significance of those genes in mammalian
mineralocorticoid target cells remains to be determined.
The goal of this study was to identify and characterize early induced
(or repressed) aldosterone-regulated genes in the native target cells,
i.e. in renal cortical collecting duct (CCD) cells. Primary
cultures of CCD cells express functional MRs and respond to aldosterone
with enhanced Na+ transport and increased ENaC mRNA
expression (5, 22). Thus, this model system is ideally suited to
identify aldosterone-induced genes.
Here we report that in rabbit CCD cells, aldosterone rapidly induces
the levels of sgk mRNA, and this induction does not
require de novo protein synthesis, indicating that
sgk is a primary aldosterone-induced gene. In addition, when
co-expressed in Xenopus oocytes, sgk
significantly increases the amiloride-sensitive Na+
current, suggesting that it plays an important role in the
physiological effect of aldosterone.
CCD Cell Isolation and Culture--
CCD cells were isolated from
rabbit renal cortex by solid-phase immunoadsorption, using a monoclonal
antibody against an ectoantigen on these cells, as described previously
(23, 24). CCD cells were grown in primary cultures on porous-bottomed
dishes as described in Refs. 23 and 24. After reaching confluence, the
cultures were incubated in Dulbecco's modified Eagle's medium/F-12
medium with 10% fetal bovine serum, which was charcoal-stripped four times, to avoid the influence of possible corticosterone and cortisol contamination from fetal bovine serum. (According to our measurements, this procedure eliminates >99.0% of the glucocorticoids present in
serum.) After 24 h, the medium was changed to serum-free medium containing 10 nM aldosterone, the specific GR agonist
RU28362, the GR-antagonist RU486 (25), or vehicle for 15 min to 24 h. The effect of corticosteroids on transepithelial voltage and
amiloride-sensitive current was determined as described previously
(22). To inhibit protein synthesis, cultures were pre-incubated for 30 min with 5 µg/ml cycloheximide before the addition of the steroid;
cycloheximide was continuously present during incubation with steroids.
RNA Isolation and PCR-based Suppression Subtractive
Hybridization--
From the cultured cells, poly(A) RNA was isolated
using Ambion's Poly(A)Pure kit, and total RNA was isolated using TRI
ReagentTM (Molecular Research Center, Inc.). PCR-based
subtractive hybridization and suppression PCR were performed using
methods described in Refs. 26 and 27 and the PCR-SelectTM
kit (CLONTECH). Two cDNA pools were synthesized
using 2 µg of poly(A) RNA from each control and aldosterone-treated
cells. cDNAs were digested with RsaI for 2 h, and
subtractive hybridization and suppression PCR were performed as
described previously (26, 27) and in the protocol included with the
PCR-SelectTM kit, with the following modifications. We used
modified nested primers by adding a RsaI half-site (AC) plus
two different nucleotides at each end. The use of combinations of 16 upper and 16 lower nested primers modified in this way resulted in the
subdivision of the resulting cDNAs into 256 subpools. In addition,
we used a touchdown PCR for the second round of PCR with three cycles each of annealing at 75 °C, 74 °C, and 73 °C for 2 min,
followed by eight cycles at 72 °C for 2 min. The final extension was
at 72 °C for 20 min. The resulting DNA fragments were separated on a
sequencing size nondenaturing acrylamide gel and visualized on a
FluorImagerTM 575 after staining with Sybr-Green I.
Sequencing and Cloning of Differentially Expressed
cDNAs--
cDNA fragments that were differentially expressed
in two control or aldosterone-treated cDNA pools originating from
separate RNA preparations and from different subtractive hybridizations were excised from the gel and re-amplified using the same nested primers as in the first amplification. After verifying that the right
cDNA fragment was amplified, DNA sequencing was performed by the
Dye Deoxy Terminator chemistry on an ABI 373A automated sequencer. The
cDNAs were subcloned into pCR-Blunt vector (Invitrogen) and
transformed into TOP10 One Shot Competent cells (Invitrogen). Plasmid
DNAs were re-sequenced. Gene-specific PCR primers were designed and
used for quantitative RT-PCR.
Quantitative RT-PCR--
To determine the relative abundance of
sgk mRNA in control and steroid-treated CCD cells, we
used quantitative RT-PCR methods as described previously (5, 28-31).
cDNA was synthesized using 2 µg of total RNA from control or
steroid-treated CCD cells (5). Sense (5'-GAACCACGGGCTCGTTTCTAT-3') and
antisense (5'-GCAGGCCATACAGCATCTCAT-3') PCR primers were selected based
on the sequence of rabbit sgk. These primers amplify a
298-base pair PCR product. Reactions were performed under standard
conditions with four different amounts (10, 2.5, 0.625, and 0.156 ng)
of cDNA originating from control or steroid-treated cells. After a
2-min denaturation at 96 °C, PCR was carried out for 25 cycles
(95 °C for 45 s, 57 °C for 45 s, and 72 °C for 1 min), and then a final extension was done at 72 °C for 8 min. The
relative abundance of Isolation of the Full-length Rabbit sgk by 5' and 3' Rapid
Amplification of cDNA Ends--
mRNA isolated from CCD cells
was reverse transcribed with a lock-docking oligo(dT) primer, using a
Marathon kit (CLONTECH). After second strand
synthesis and adaptor ligation, two rounds of PCR were carried out. The
first PCR was primed with the appropriate gene-specific antisense
primers (primer 1, GCAGGCCATACAGCATCTCAT; primer 2, GAACCACGGGCTCGTTTCTAT) and the adaptor-specific sense primer (AP-1;
CLONTECH). In the second PCR, a nested adaptor
primer (AP-2; CLONTECH) and nested gene-specific
primers (primer 1N, CACACCCGAGTATCTTGCACCTGAG; primer 2N,
TGGGTTACCTGCACTCTCTGAACATC) were used. Products from the second PCR
were fractionated on agarose, purified, reamplified, and sequenced.
Northern Blot Analysis--
Northern blot analysis was carried
out using standard protocols. In brief, 2 µg of total RNA from
control or aldosterone-treated (30 min) CCD cells was fractionated on a
1.2% agarose gel containing 1.1% formaldehyde. RNA was transferred to
a BrightStar-Plus positively charged nylon membrane (Ambion) and probed
with 32P-labeled antisense rabbit sgk RNA probe
generated using the Lig'Scrib and Strip-EZ kits (Ambion) with T7 RNA
polymerase. Prehybridization was performed at 65 °C for 2 h in
NorthernMaXTM Prehybridization/Hybridization Buffer
(Ambion). Hybridization was done for 16 h using the same
conditions as described for prehybridization. Three washes were carried
out at 65 °C for 30 min each with 0.1× SSC and 1% SDS, and then
two washes were carried out with 0.1× SSC and 0.1% SDS for 20 min
each. After the final wash, the blot was exposed to x-ray film.
Generation of 3'-UTR Expression of ENaC and sgk in Xenopus Oocytes and Measurements of
Amiloride-sensitive Currents with the Two-electrode Voltage
Clamp--
cRNA from Use of the PCR Select and Differential Display Method to Identify
Aldosterone-regulated Genes--
Rabbit CCD cells cultured on
permeable filters (22, 24) were subjected to a short-term (1-h)
aldosterone treatment. mRNAs differentially expressed in the
control and aldosterone-treated cells were identified using a
combination of suppression PCR-based subtraction hybridization (26, 27)
and differential display (32) methods. Only those cDNA fragments
that showed differential expression (control versus
aldosterone) in two separate cDNA pools originating from different
animals were further studied.
This method resulted in a highly reproducible pattern of amplified DNA
fragments from the subtracted cDNA pools. Despite enrichment for
genes preferentially expressed in the control or aldosterone-treated cells, many cDNAs were shared in the two pools. This is to be expected, because the two cell populations differed only in the presence or absence of aldosterone for 1 h, and subtraction of common cDNAs is not complete. However, about 30-40% of cDNA
fragments seemed unique.
Aldosterone Induces the Expression of sgk, a Ser/Thr Kinase in
Rabbit CCD Cells--
One of the cDNA fragments (~350 base
pairs) that showed increased expression in the aldosterone-treated
mRNAs was excised, reamplified, and sequenced. BLAST search
indicated that this cDNA shows very high homology to human and rat
sgk (which is a serum-and glucocorticoid-regulated putative
serine/threonine kinase (33, 34). Gene-specific PCR primers were then
used to amplify a 298-base pair amplicon. The identity of this PCR
product as the rabbit sgk was verified by sequencing. The
nucleotide sequence of this cDNA was 91% and 88% identical to the
human and rat sgk (33, 34), respectively. The sequence of
the rabbit sgk was determined using DNAs obtained by 3' and
5' rapid amplification of cDNA ends. The predicted amino acid
sequence is 98% and 97% identical to the human and rat
sgk (Fig. 1), indicating that
the differentially expressed mRNA encodes the rabbit
sgk. In addition, a significant homology was found between
the 5'-UTRs of the rabbit, human, and rat sgk.
A representative RT-PCR is shown in Fig.
2A, demonstrating that the
level of sgk mRNA is markedly increased in
aldosterone-treated cells as compared with control. At the same time,
aldosterone treatment did not affect the level of
The time course of aldosterone induction of sgk mRNA
expression was determined by quantitative RT-PCR, using RNA originating from CCD cultures incubated with vehicle or 10 nM
aldosterone for different periods (15 min to 24 h) in serum-free
medium. We and others have previously shown that quantitative RT-PCR is
a sensitive and accurate method to determine changes in the relative abundance of mRNAs (5, 28-31, 35, 36). Fig. 2B shows a
representative time curve of sgk mRNA levels in control
and aldosterone-treated CCD cells. Aldosterone rapidly increased the
levels of sgk mRNA; the difference versus
control was already significant at 30 min (242 ± 30% of control,
p < 0.005; n = 7). sgk
mRNA levels increased further until 4 h and then declined
(Fig. 2B), although mRNA levels after 24 h of
aldosterone treatment were still significantly higher than control
values. Mean values of sgk mRNA levels were 280 ± 30% (n = 11), 385 ± 60% (n = 7), 302 ± 50% (n = 10), and 235 ± 43%
(n = 4) of the paired time-control after 60 min, 120 min, 240 min, and 24 h after aldosterone treatment, respectively.
The difference versus control samples at the same times was
statistically significant at each time point (p < 0.01; Student's two-tailed t test.)
Northern analysis confirmed the early induction because a ~ 2.4-kb mRNA transcript hybridizing with the rabbit sgk
RNA probe was significantly increased in RNA originating from CCD cells after a 30-min treatment with 10 nM aldosterone (Fig.
2C).
sgk is an immediate early gene regulated at the
transcriptional level by glucocorticoids and serum, and these stimuli
did not require de novo protein synthesis (37). The rapid
time course of induction in CCD cells strongly suggests that the
induction is also a direct effect. This conclusion was confirmed by
testing the effect of aldosterone on sgk mRNA levels
during inhibition of protein synthesis. The induction of sgk
by aldosterone was unaffected by cycloheximide (Fig.
3), indicating that it does not require
de novo protein synthesis.
Aldosterone, particularly at high concentrations, can bind GRs,
although its affinity for the GR is significantly lower than for the MR
(38). To verify that the effect of aldosterone is mediated through MRs,
we studied the effect of aldosterone in the presence of saturating
concentrations of the GR antagonist RU486. The induction of
sgk mRNA by aldosterone was unchanged when GRs were
blocked by RU486 (Fig. 4), indicating
that the effect of aldosterone was indeed mediated through the MR. Fig.
4 also shows that in CCD cells, activation of GRs with a pure GR
agonist, RU28362, also elevated sgk mRNA expression.
Sequence Determination of the Full-length Mouse sgk--
Searching
of the GenBankTM expressed sequence tag database with the
rabbit sgk sequence for matching sequences revealed several sequences with high homology to fragments of the rabbit sgk.
Multiple alignments indicated that the IMAGE Consortium construct clone ID 570181 is likely to contain the complete coding sequence of the
mouse sgk. Sequence analysis of this clone revealed a
2429-base pair sequence that showed a 91% nucleotide identity to the
rat sgk, and an 88% identity to human sgk. To
verify the identity of this clone as the mouse sgk, a
restriction analysis was carried out, which revealed the predicted
patterns (data not shown). The longest open reading frame of the mouse
sgk sequence predicts a 431-amino acid protein with 97%,
96%, and 86% identity to the rat (33), human (34), and shark (39)
sgk, respectively (Fig. 1).
sgk Increases the Activity of ENaC when Expressed in Xenopus
Oocytes--
To examine the functional effect of sgk on
ENaC, we co-expressed the mouse sgk with ENaC subunits in
oocytes. Previous studies indicated that the half-life of
sgk transcripts is extremely short (<30 min in mammary
epithelia; Ref. 37), and its 3'-UTR contains AU-rich regions (Ref. 37
and our data) characteristic for short-lived transcripts. Therefore, we
generated a construct by eliminating the entire 3'-UTR of the mouse
sgk cDNA and inserting it into the SP64poly(A) vector.
Oocytes were injected with either the three subunits of ENaC alone or
in combination with the stabilized mouse sgk. After 36 h of incubation, the amiloride-sensitive components of whole cell
currents were measured with the two-electrode voltage clamp technique.
In four independent experiments using different batches of oocytes, we
observed significantly larger amiloride-sensitive currents in oocytes
co-injected with ENaC and sgk than in oocytes injected with
ENaC alone. In three of the four experiments, the difference was highly
significant (p < 0.0001). The results obtained with all oocytes (34 in the ENaC group and 29 in the ENaC + sgk
group) are summarized in Fig. 5. The mean
amiloride-sensitive current measured at Several lines of evidence suggest that the early increase in
Na+ transport by aldosterone involves activation of
pre-existing Na+ channels in the apical membrane of
Na+-transporting epithelia (2, 9). However, the gene
products responsible for this effect have yet to be identified. The
question of whether ENaC or regulatory proteins are direct targets of
post-synthetic modifications initiated by aldosterone still remains.
Previous studies suggested that both carboxymethylation and
phosphorylation of the ENaC or associated regulatory proteins might be
involved in this regulation (9-11, 15, 40, 41).
The main finding of this study is that aldosterone rapidly increases
the mRNA levels of a putative Ser/Thr kinase in the native mineralocorticoid target cells, and this kinase is able to activate ENaC when co-expressed in Xenopus oocytes.
sgk is a member of the Ser/Thr protein kinase family. It
belongs to a subfamily of Ser/Thr kinases, which, unlike other protein kinases, are predominantly regulated at the transcriptional level (33,
34, 37). sgk was first cloned from rat mammary epithelial cells (33) and was found to be regulated by glucocorticoids and serum
(37). Additional studies revealed that follicle-stimulating hormone and
alterations in cell volume also regulate sgk expression (34,
42). While this paper was under review, Chen et al. (43) reported that dexamethasone, a glucocorticoid, rapidly induces sgk in a Xenopus kidney cell line (A6), and
in situ hybridization indicated that sgk mRNA
levels are also increased in the kidney of rats treated with
aldosterone. These authors also found that the A6 sgk
stimulated the current of oocytes injected with Xenopus ENaC. Importantly, sgk is an immediate early gene (33, 37, 44, 45), and there is a functional glucocorticoid response element in
its promoter.
The finding that aldosterone rapidly induces the expression of a
Ser/Thr kinase in its target cells and that this induction seems to be
a direct effect is interesting for several reasons. First, previous
studies suggested that protein kinases are involved in the hormonal
regulation of ENaC (9-12). Most importantly, aldosterone increases the
phosphorylation of Ser and Thr residues of the carboxyl-terminal region
of The mechanism by which sgk activates Na+ current
has not been examined in this study but will be determined in
additional experiments. In light of the present results, a plausible
mechanism is direct phosphorylation of Ser and Thr residues on ENaC
subunits that results in the activation of ENaC. In this respect, it is
interesting to note that sgk is also induced by serum (37),
and insulin increases phosphorylation of the same Ser and Thr
residues on An interesting observation is that in human hepatoma cells,
sgk is induced by changes in cell volume: shrinkage
increases sgk mRNA levels, whereas swelling reduces
sgk mRNA levels (39). This would seem logical if
sgk played an important role not only in the regulation of
Na+ entry but also in the control of cell volume. On one
hand, aldosterone induces sgk, which activates
Na+ channels, thereby increasing intracellular
Na+, resulting in an increase in cell volume. On the other
hand, cell swelling rapidly decreases the expression of sgk,
creating a negative feedback in cell volume regulation. Such feedback
could also explain the decline in sgk mRNA levels at
24 h despite the continuous presence of aldosterone (Fig. 2).
In this study, we also found that sgk mRNA is induced by
glucocorticoids in CCD cells, similarly as in other cell types (37, 43). Because aldosterone has some affinity for the GR, it was important
to verify that aldosterone acted through the MRs. Data obtained with
receptor-specific antagonists indicate that the induction of
sgk by aldosterone in CCD cells is indeed mediated through
MRs. Thus, activation of either the MR or the GR results in the
activation of the same gene in CCD cells. This is not surprising, because in vitro MR and GR bind to the same consensus
sequences (glucocorticoid response element), and no unique
mineralocorticoid receptor elements have been identified thus far.
Despite the ubiquitous expression of the GR, mineralocorticoid target
cells in vivo respond only to aldosterone, due to the
cell-specific expression of the enzyme 11 In summary, this study demonstrates that aldosterone rapidly stimulates
the expression of sgk, a Ser/Thr protein kinase in the
native target cells in the kidney. This effect is direct because it
does not require de novo protein synthesis and is mediated through MRs. sgk, when coexpressed in Xenopus
oocytes with all three ENaC subunits, leads to a significant increase
in Na+ current, suggesting that this protein kinase plays
an important role in the early phase of aldosterone-stimulated
Na+ transport.
![]()
INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES
- and
-ENaC
subunits in vivo in Madin-Darby canine kidney cells (13).
The kinase that mediates this effect has not yet been identified.
Aldosterone-enhanced Na+ channel activity seems to involve
methylation of apical membrane proteins (9, 14). A recent report
demonstrated that aldosterone increases carboxymethylation of the
-ENaC in A6 cells, and carboxymethylation of ENaC reconstituted in
planar lipid bilayers leads to an increase in open probability
(15).
![]()
EXPERIMENTAL PROCEDURES
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES
-actin mRNA in each CCD cell sample was
determined using primers and conditions as described previously (28).
cDNA samples derived from control and steroid-treated cells were
always amplified simultaneously. The PCR products were separated on a
5% polyacrylamide gel and quantitated by densitometry using a
FluorImagerTM 575 (Molecular Dynamics). The slope of the
amount of PCR products versus the amount of template
cDNA was derived by linear regression. These values were normalized
for the amount of
-actin mRNA.
Mouse sgk/pSP64poly(A) Construct--
The
entire 3'-UTR of the mouse sgk was removed by
HindIII digestion, and the plasmid was ligated into
pSP64poly(A) vector (Promega). The ligated DNA was transformed into
Escherichia coli DH5
cells, and plasmid from the
resulting clones was verified by sequencing and linearized with
EcoRI.
-,
-, and
-subunits of rat ENaC and
mouse sgk were synthesized with T7 or SP6 mMESSAGE mMACHINE kit
(Ambion). Stage V-VI oocytes were isolated from Xenopus
laevis, defolliculated by collagenase treatment, and
injected with 1 ng of cRNA of each subunit of ENaC with or without 1 ng
of sgk cRNA. Oocytes were kept at 19 °C in amphibian solution
supplemented with 1 µM amiloride for 36 h before
experiments. Whole cell currents were measured with constant perfusion
(100 mM sodium gluconate, 4 mM KCl, 2 mM CaCl2, and 10 mM Hepes, pH 7.4)
with a two-electrode voltage clamp (Oocyte Clamp C-725B; Warner
Instrument Corp.). The magnitude of the amiloride-sensitive current was
calculated as the difference of whole cell currents in the absence and
presence of 10 µM amiloride in the perfusate. Membrane
voltage was held at
100 mV, and IV curves were obtained by changing
the voltage in 20 mV steps from
180 to 80 mV using an ITC-16 A/D
converter (Instrutech), the Pulse software (HEKA Elektronik, Lambrecht,
Germany), and a Power Macintosh computer. Data were filtered at 250 Hz
and sampled at 1 kHz.
![]()
RESULTS
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

View larger version (81K):
[in a new window]
Fig. 1.
Alignment of the deduced amino acid sequence
of rabbit sgk with the human, rat, and mouse
sequences. The rabbit and mouse sequences were determined in this
study, the rat sequence was determined in Ref. 33, and the human
sequence was determined in Ref. 34. Amino acid differences between
species are highlighted.
-actin mRNA
(Fig. 2A). Thus, in additional experiments, the relative
abundance of sgk mRNA was always normalized to the level
of
-action mRNA in the same cDNA sample to correct for
variation in RNA integrity and efficiency of reverse transcription.

View larger version (20K):
[in a new window]
Fig. 2.
Aldosterone induces sgk
mRNA expression in CCD cells. A,
representative RT-PCR of sgk and
-actin from
control and aldosterone-treated cells. CCD cells were incubated with
vehicle or 10 nM aldosterone at 37 °C for 30 min. Serial
dilutions of cDNA were used as a template (3 to 0.12 ng). The
amount of sgk mRNA was markedly induced by aldosterone
(upper bands) whereas the amount of
-actin mRNA
remained unchanged (lower bands). B, a
representative time course of the effect of aldosterone on
sgk mRNA levels. The levels of sgk mRNA
were determined using quantitative RT-PCR and normalized for
-actin
mRNA as described under "Experimental Procedures."
C, Northern blot analysis of the expression of
sgk mRNA in control- and aldosterone-treated CCD cells.
Rabbit CCD cells were incubated with 10 nM aldosterone for
30 min at 37 °C. Two µg of total RNA were analyzed by
hybridization using a 32P-labeled antisense sgk
cRNA probe.

View larger version (32K):
[in a new window]
Fig. 3.
Cycloheximide does not prevent
aldosterone-induction of sgk. CCD cells were pre-incubated
with vehicle or 5 µg/ml cycloheximide (CHX) for 30 min at
37 °C, and then 10 nM aldosterone or vehicle was added
to the cells, and incubation continued for 60 min. sgk mRNA
levels were determined by quantitative RT-PCR and normalized for
-actin mRNA levels.
, vehicle;
, aldosterone; stripped
bar: aldosterone + cycloheximide;
, cycloheximide. n = 4 for each group. *, p < 0.05 using Student's
paired t test (two-tailed) when compared with control.
Aldosterone versus aldosterone + cycloheximide was not
significant.

View larger version (15K):
[in a new window]
Fig. 4.
The induction of aldosterone is mediated
through mineralocorticoid receptors. CCD cells were incubated with
vehicle, 1 µM RU28362 (a GR agonist), 10 nM
aldosterone, or 10 nM aldosterone plus 1 µM
RU486 (a GR antagonist) for 60 min at 37 °C. *, p < 0.01 using Student's paired t test when compared with
values of control samples at the same time points.
100 mV in oocytes injected
with ENaC alone was 4.42 ± 0.66 µA. Oocytes co-injected with
ENaC and sgk expressed significantly larger currents with a
mean of 9.78 ± 0.90 µA (p < 0.0001) (Fig. 5A). The difference between the two groups was observed at
all membrane voltages as shown in the current-voltage relations of Fig.
5B. These results indicate that sgk, directly or
indirectly, stimulates the activity of ENaC when both proteins are
expressed in the same cell.

View larger version (19K):
[in a new window]
Fig. 5.
Effect of sgk on the
magnitude of the amiloride-sensitive current expressed in oocytes.
Xenopus laevis oocytes were injected with cRNA
from ENaC alone (
) or ENaC with sgk (
). Oocyte
currents were measured with the two-electrode voltage clamp in the
presence of 100 mM sodium gluconate in the bathing
solution. The amiloride-sensitive component is the difference of the
whole cell currents in the absence and presence of 10 µM
amiloride in the perfusate. A, mean current of oocytes at a
membrane potential of
100 mV. B, current-voltage relations
of amiloride-sensitive whole cell currents. The solid lines
represent the fit with the constant field equation. Each point in the
ENaC group is the mean of 34 oocytes, and each point in the ENaC + sgk group is the mean of 29 oocytes. Error bars
represent S.E. The p value of the difference between the two
groups is <0.00001.
![]()
DISCUSSION
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES
- and
-ENaC in vivo (13). Furthermore, the finding that sgk significantly increases the amiloride-sensitive
current through ENaC in oocytes strongly indicates that this kinase is important in aldosterone-stimulated Na+ reabsorption.
- and
-ENaC that are phosphorylated after
aldosterone (13). Because fetal bovine serum is a rich source of growth
factors, it is conceivable that the insulin-mediated increase in ENaC
activity is also mediated through phosphorylation via sgk.
Alternatively, sgk could phosphorylate and thereby activate
regulatory proteins, such as enzymes mediating post-synthetic
modifications of ENaC. In this respect, it is tempting to speculate
that sgk might activate a carboxymethyl transferase, which
can be stimulated by aldosterone (15), and lead to Na+
channel activation this way. Phosphorylation of ENaC or a regulatory protein might also change the trafficking of ENaC. It is quite conceivable that these possibilities are not alternatives, but rather,
aldosterone regulates multiple events simultaneously. For instance,
phosphorylation of ENaC or modifying enzymes might proceed
simultaneously with methylation, resulting in activation of ENaC due to
changes in kinetics or open probability. At the same time, aldosterone,
through sgk or other early induced/repressed gene products,
may also regulate the trafficking of ENaC, thereby increasing the
number of channels in the membrane.
-hydroxysteroid
dehydrogenase-2 that eliminates endogenous glucocorticoids (46).
However, if mineralocorticoid target cells are treated with synthetic
glucocorticoids, which are not subject to degradation by
11
-hydroxysteroid dehydrogenase-2, activation of the GR by
glucocorticoids results in an increase in transepithelial Na+ transport similar to that seen following activation of
the MR by aldosterone (22).
| |
FOOTNOTES |
|---|
* This work was supported by National Institutes of Health Grants DK39523, DK41841, and HL56163 (to C. C.).The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
The nucleotide sequence(s) reported in this paper has been submitted to the GenBankTM/EMBL Data Bank with accession number(s) AF139638 (mouse sgk) and AF139639 (rabbit sgk).
§ To whom correspondence should be addressed. Tel.: 603-650-2581; Fax: 603-650-6130; E-mail: aniko.fejes-toth{at}dartmouth.edu.
| |
ABBREVIATIONS |
|---|
The abbreviations used are: ENaC, epithelial Na+ channel; PCR, polymerase chain reaction; MR, mineralocorticoid receptor; GR, glucocorticoid receptor; CCD, cortical collecting duct; RT-PCR, reverse transcription-polymerase chain reaction; UTR, untranslated region; SSC, standard saline-citrate.
| |
REFERENCES |
|---|
|
|
|---|
This article has been cited by other articles:
![]() |
V. McEneaney, B. J. Harvey, and W. Thomas Aldosterone Regulates Rapid Trafficking of Epithelial Sodium Channel Subunits in Renal Cortical Collecting Duct Cells via Protein Kinase D Activation Mol. Endocrinol., April 1, 2008; 22(4): 881 - 892. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Terada, H. Kuwana, T. Kobayashi, T. Okado, N. Suzuki, T. Yoshimoto, Y. Hirata, and S. Sasaki Aldosterone-Stimulated SGK1 Activity Mediates Profibrotic Signaling in the Mesangium J. Am. Soc. Nephrol., February 1, 2008; 19(2): 298 - 309. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Taruno, N. Niisato, and Y. Marunaka Intracellular calcium plays a role as the second messenger of hypotonic stress in gene regulation of SGK1 and ENaC in renal epithelial A6 cells Am J Physiol Renal Physiol, January 1, 2008; 294(1): F177 - F186. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. Zhao, R. Lehr, A. M. Smallwood, T. F. Ho, K. Maley, T. Randall, M. S. Head, K. K. Koretke, and C. G. Schnackenberg Crystal structure of the kinase domain of serum and glucocorticoid-regulated kinase 1 in complex with AMP PNP Protein Sci., December 1, 2007; 16(12): 2761 - 2769. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Li, S. Koshy, and H. G. Folkesson Involvement of {alpha}ENaC and Nedd4-2 in the conversion from lung fluid secretion to fluid absorption at birth in the rat as assayed by RNA interference analysis Am J Physiol Lung Cell Mol Physiol, October 1, 2007; 293(4): L1069 - L1078. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. O. Wielputz, I.-H. Lee, A. Dinudom, S. Boulkroun, N. Farman, D. I. Cook, C. Korbmacher, and R. Rauh (NDRG2) Stimulates Amiloride-sensitive Na+ Currents in Xenopus laevis Oocytes and Fisher Rat Thyroid Cells J. Biol. Chem., September 21, 2007; 282(38): 28264 - 28273. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. F. Husted, K. A. Volk, R. D. Sigmund, and J. B. Stokes Discordant effects of corticosteroids and expression of subunits on ENaC activity Am J Physiol Renal Physiol, September 1, 2007; 293(3): F813 - F820. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. A. Martel, D. Michael, G. Fejes-Toth, and A. Naray-Fejes-Toth Melanophilin, a novel aldosterone-induced gene in mouse cortical collecting duct cells Am J Physiol Renal Physiol, September 1, 2007; 293(3): F904 - F913. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. C. Pao, J. A. McCormick, H. Li, J. Siu, C. Govaerts, V. Bhalla, R. Soundararajan, and D. Pearce NH2 terminus of serum and glucocorticoid-regulated kinase 1 binds to phosphoinositides and is essential for isoform-specific physiological functions Am J Physiol Renal Physiol, June 1, 2007; 292(6): F1741 - F1750. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. Cordas, A. Naray-Fejes-Toth, and G. Fejes-Toth Subcellular location of serum- and glucocorticoid-induced kinase-1 in renal and mammary epithelial cells Am J Physiol Cell Physiol, May 1, 2007; 292(5): C1971 - C1981. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. Fejes-Toth and A. Naray-Fejes-Toth Early Aldosterone-Regulated Genes in Cardiomyocytes: Clues to Cardiac Remodeling? Endocrinology, April 1, 2007; 148(4): 1502 - 1510. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. Fakitsas, G. Adam, D. Daidie, M. X. van Bemmelen, F. Fouladkou, A. Patrignani, U. Wagner, R. Warth, S. M.R. Camargo, O. Staub, et al. Early Aldosterone-Induced Gene Product Regulates the Epithelial Sodium Channel by Deubiquitylation J. Am. Soc. Nephrol., April 1, 2007; 18(4): 1084 - 1092. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Nielsen, T.-H. Kwon, J. Frokiaer, M. A. Knepper, and S. Nielsen Maintained ENaC trafficking in aldosterone-infused rats during mineralocorticoid and glucocorticoid receptor blockade Am J Physiol Renal Physiol, January 1, 2007; 292(1): F382 - F394. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Y. Huang, K. M. Boini, H. Osswald, B. Friedrich, F. Artunc, S. Ullrich, J. Rajamanickam, M. Palmada, P. Wulff, D. Kuhl, et al. Resistance of mice lacking the serum- and glucocorticoid-inducible kinase SGK1 against salt-sensitive hypertension induced by a high-fat diet Am J Physiol Renal Physiol, December 1, 2006; 291(6): F1264 - F1273. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Rexhepaj, F. Grahammer, H. Volkl, C. Remy, C. A. Wagner, D. Sandulache, F. Artunc, G. Henke, S. Nammi, G. Capasso, et al. Reduced intestinal and renal amino acid transport in PDK1 hypomorphic mice FASEB J, November 1, 2006; 20(13): 2214 - 2222. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Sandu, F. Artunc, M. Palmada, R. Rexhepaj, F. Grahammer, A. Hussain, C. Yun, D. R. Alessi, and F. Lang Impaired intestinal NHE3 activity in the PDK1 hypomorphic mouse Am J Physiol Gastrointest Liver Physiol, November 1, 2006; 291(5): G868 - G876. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. Lang, C. Bohmer, M. Palmada, G. Seebohm, N. Strutz-Seebohm, and V. Vallon |