![]()
|
|
||||||||
J Biol Chem, Vol. 274, Issue 24, 17017-17024, June 11, 1999
,
, and
From the Institut für Biologie II/Botanik, Universität
Freiburg, Schänzlestrasse 1, 79104 Freiburg, Germany and the
Department of Biological Chemistry, The Institute of Life
Sciences, The Hebrew University of Jerusalem,
Jerusalem 91904, Israel
| |
ABSTRACT |
|---|
|
|
|---|
A UV response that involves the Ras proteins and
AP-1 transcription factors has recently been described in mammals and
yeast. To test whether an equivalent response exists in plants, we
monitored the expression of Arabidopsis histidinol
dehydrogenase gene (HDH), a homologue of the yeast
HIS4 gene, which is strongly induced by UV light and is a
target of the transcriptional activator Gcn4. We show that
HDH mRNA levels increase specifically in response to
UV-B light. Only small increases were detected upon exposure to other
wavelengths. To isolate plant genes involved in this UV response, a
gcn4 mutant was transfected with an Arabidopsis thaliana cDNA library. A new type of nucleotide diphosphate
kinase (NDPK Ia) with a significant homology to the human tumor
suppressor protein Nm23 rescued the gcn4 phenotype. NDPK Ia
specifically binds to the HIS4 promoter in
vitro and induces HIS4 transcription in yeast. In
Arabidopsis, the NDPK Ia protein is located in the nucleus
and cytosol. Expression studies in seedlings revealed that the level of
NDPK Ia mRNA, like that of HDH, increases
in response to UV-B light. It appears that NDPK Ia and HDH are
components of a novel UV-responsive pathway in A. thaliana.
Exposure of cells and organisms to UV light evokes a complex set
of protective and repair responses. Because short wavelengths are
absorbed mostly by nucleic acids, it is reasonable to assume that the
most significant UV-mediated damages occur in cellular DNA. Various DNA
repair systems are indeed induced following exposure to UV. This
response has been identified in all prokaryotes and eukaryotes studied
(1-4). However, additional UV responses exist in eukaryotes, which
seem to be unrelated to repair mechanisms (reviewed in Ref. 5). In
mammalian cells, this response involves activation of membrane
components, such as tyrosine kinase receptors and the proto-oncoprotein
Ras (6-9). Activated Ras in turn induces cytoplasmic cascades that
lead to activation of transcription factors of the AP-1 family
(e.g. c-Jun and ATF2) and NF In yeast, the bZIP transcription factor Gcn4 is activated not only by
UV but also by amino acid starvation. Under these conditions, Gcn4
activation does not involve the Ras cascade, but rather the activity of
the Gcn2 kinase (12, 14, 15). Activation of Gcn4 in response to amino
acid starvation seems rational because Gcn4 target genes encode amino
acid biosynthetic enzymes. Some of the most prominent Gcn4 targets are
HIS3 and HIS4, which encode enzymes of histidine
biosynthesis (16). Although starvation and UV induce different signal
transduction elements for activation of Gcn4, both stimuli need intact
Gcn4 for induction of HIS genes (12, 14).
Plants also respond to UV in the range between 280 nm and 350 nm by a
complex set of reactions (17). Beside the activation of DNA repair
systems (reviewed in Ref. 3), plants respond with the rapid synthesis
of pigments, primarily flavonoids, which requires activation of
specific genes and transcription factors (18). Although
UV-dependent cis-acting elements were identified in the promoter of chalcone synthase, which encodes a key enzyme in
flavonoid synthesis, the biochemical system that senses the UV signal
and exerts the relevant genes is still elusive. Indirect evidence
points to the involvement of calcium, calmodulin, and kinases in
UV-dependent flavonoid synthesis (19-21) and to the involvement of jasmonate in UV-dependent expression of
proteinase inhibitor genes (22), suggesting that various UV signaling
pathways exist in plants.
It is assumed that amino acid biosynthesis in plants is similar to that
in bacteria and yeast (23). This similarity is manifested in the fact
that several genes related to this pathway were capable of functionally
complementing the respective yeast mutants (24-27). Histidine
biosynthesis in Arabidopsis involves several genes with high
sequence homology to corresponding genes from yeast. Representative examples are the genes encoding imidazole glycerol phosphate
dehydratase (IPGD)1 with 44%
identity to yeast HIS3 (28), and histidinol dehydrogenase (HDH) with 51% idendity to yeast HIS4 (29).
It was therefore decided to test whether HDH, the plant
homologue of HIS4, is UV responsive, as is the case in
yeast. We demonstrate here that this is indeed the case. We show that
UV-B irradiation of Arabidopsis seedlings specifically
stimulates HDH mRNA accumulation. This result suggests
that a UV-dependent Ras/AP-1 cascade might exist in plants,
which is similar to the mammalian and yeast cascade. This plant pathway
could be revealed via systematic functional complementation of the
relevant yeast mutants. In a first functional complementation screen,
we searched for Arabidopsis thaliana cDNAs that would
rescue the gcn4 phenotype. We have identified a new nucleoside diphosphate kinase (termed NDPK Ia) from
Arabidopsis with remarkable homology to the mammalian tumor
suppressor protein Nm23. Nm23-H2 was reported to bind DNA and is
hypothesized to be a transcriptional regulator (30). We show that
Arabidopsis NDPK Ia binds the promoter of HIS4
and induces HIS4 transcription in yeast. Its transcription
in plants is strongly induced by UV-B light in a pattern very similar
to that of HDH expression. NDPK Ia might play a role as a
transcriptional regulator in the UV-B light-mediated expression of
histidine biosynthesis in plants and yeast. Our results also imply that
aspects of the (non-DNA damage) UV response are common to plants and yeast.
Escherichia coli and Yeast Strains--
E. coli strain XL1 blue
(Stratagene, La Jolla, CA) was used for plasmid manipulations and
amplification of a cDNA library. Expression of glutathione
S-transferase (GST) fusion proteins was carried out in the
strain M15[pREP4] (Qiagen, Hilden, Germany). Nearly isogenic
Saccharomyces cerevesiae strains SP1 (MATa, his3, can,
ade8, leu2, trp1 ura3), SP1 harboring HIS3 (isogenic to
SP1 but with integrated HIS3), and gcn4 Plant Material, Cell and Protoplast Formation Culture, and
Transient Transformation--
A. thaliana (L.) ecotype
Landsberg erecta were grown on soil with 16 h light/8 h dark
cycles at 20 °C, and leaf, stem, and floral tissues were isolated
from 6-week-old plants. Etiolated seedlings were grown on filter paper
for 3 or 5 days in darkness and then transferred to different light
programs. An isogenic, auxotrophic A. thaliana cell culture
was grown in MS medium containing 0.6% sucrose under continuous
irradiation (25 °C at 120 rpm) and subcultured weekly (10 ml in 40 ml of fresh medium). Cell cultures were used 3 days after passage for
protoplast formation. Cells (10 g) were digested for 3.5 h at room
temperature in 1.2% Cellulase Onozuka R-10 and 0.25% Macerozyme
dissolved in MS/0.3 M mannitol and then diluted with 1 volume of 0.24 M CaCl2 and precipitated for 3 min at 400 × g. The cell pellet was resuspended in
electroporation buffer (10 mM Tris/HEPES (pH 7.2), 15 mM MgCl2, 0.5 M sucrose) and
flotated after centrifugation (5 min at 140 × g). The
supernatant contained high amounts of intact protoplasts that were
directly used for transformation. Protoplasts (8 × 106) were mixed with 75 µg of plasmid DNA, incubated for
1 min at room temperature and transformed by electroporation (810 V/cm2, 125 µF). Cells were subsequently incubated in
MS/0.5 M mannitol for 10-16 h until detection of green
fluorescent protein (GFP) fluorescence.
Light Sources--
UV-B light irradiation was carried out with
two Phillips TL/12 bulbs and one Osram 36W/73 bulb and DNA-damaging
fluences cut-off by a 305 nm filter (Schott, Mainz, Germany). The
fluence rate was 21 µmol of
photons·m Screening of Yeast under Starvation Conditions--
Large scale
yeast transformation was carried out according to (32). Young,
light-grown Arabidopsis seedlings were used for the
preparation of the cDNA library that was integrated into the yeast
expression vector pFL61. The cDNA was constitutively expressed under the control of a PGK promoter in yeast (33) and was
kindly provided by M. Minet (CNRS, Gif sur Yvette, France). For
complementation of the yeast gcn4 mutant, cells were
transformed with the cDNA library and grown at 30 °C for 5-6
days on plates containing synthetic complete medium CM lacking uracil
and histidine and supplemented with 20 mM 3-aminotriazole
(CMUH + 3-AT). Plasmids from growing colonies were isolated and
re-transformed into gcn4 to confirm complementation and
exclude false positives.
Plasmid Constructions--
Arabidopsis cDNA
clones from the complementation screen were excised from pFL61 by
NotI digestion and integrated into pKS for sequence
analysis. The N terminus of NDPK Ia was subsequently cloned by rapid
amplifications of 5' cDNA ends from an Arabidopsis cDNA library. For construction of fusion proteins,
BamHI-compatible restriction sites were introduced at the
5'-ends and SalI sites at the 3'-ends of NDPK Ia
and of Protein Expression and Electrophoretic Mobility Shift
Assay--
The
DNA binding of NDPK Ia was assessed in gel electrophoretic mobility
shift assays. Standard reactions were carried out with 32P-end-labeled yeast HIS4 promoter fragments
containing the Gcn4 sites ( Determination of Specific Enzymatic Activity--
NDPK activity
was measured spectrophotometrically in a coupled pyruvate
kinase/lactate dehydrogenase assay using 100-400 ng of recombinant
protein (39). To determine the effect of DNA binding on the enzyme,
activity fractions containing NDPK (400 ng) and DNA from the
HIS4 promoter (1 ng) were preincubated on ice for 30 min
before determination of the enzymatic analysis.
In Vivo Localization Studies in Arabidopsis Protoplasts--
GFP
fluorescence in transiently transformed Arabidopsis
protoplasts was studied by epifluorescence and Nomarski interference contrast microscopy and analyzed in an Axiovert microscope (Zeiss, Oberkochem, Germany). Excitation of GFP was performed with standard fluorescein isothiocyanate filters, and a clear distinction between GFP
fluorescence and background fluorescence could be detected (see Fig. 6,
A and B). For each construct, 10-20 protoplasts
were documented using an automatic Contax 167 MT camera and Eastman Kodak Co. 64T film.
RNA Preparation, Northern Blot Analysis, and Primer
Extension--
RNA from Arabidopsis was isolated as
described (40). Gene-specific cDNA probes of HDH (29)
and IPGD (28) were kindly provided by Dr. E. Ward (Ciba,
Research Triangle Park, NC), and these probes, as well as a
BamHI/SalI fragment of NDPK Ia and 18SrRNA, were labeled by random priming (Roche Molecular
Biochemicals); 107 cpm was used for hybridization. Aliquots
of 20 µg of total RNA were used for Northern blot hybridization as
described previously (40). Membranes were washed twice in 2× SSC/0.2%
SDS at 42 °C and in 1× SSC/0.2% SDS at 64 °C. X-ray films were
exposed at
Total RNA from yeast was prepared from cultures grown to logarithmic
phase on synthetic complete medium (lacking uracil) and was assayed by
primer extension analysis (12). RNA (20 µg) was hybridized with 1 ng
of 32P-labeled oligonucleotides (HIS4,
5'-CAAGTGTTCGGCTG TTTTAGCATC-3'; HIS3,
5'-CGCAATCTGAATCTTGGTTTC-3'; actin,
5'-GTTATCAATAACCAAAGCAGCAAC-3'). Avian myeloblastosis virus reverse
transcriptase was used for the extension reaction, and the products
were separated on 6% acrylamide/7 M urea gels.
Nucleotide Sequence Accession Number--
The nucleotide
sequence for the full-length NDPK Ia has been deposited in the
GenBankTM data base under accession number AJ012758. The
corresponding Expression of HDH, the Arabidopsis Homologue of Yeast HIS4, Is
Induced by UV-B Light--
To test whether a UV response similar to
the yeast Ras/Gcn4-mediated response (which results in induction of
HIS4 transcription) exists in plants, we studied the effect
of different wavelengths on transcription of the Arabidopsis
HDH gene. RNAs were prepared from seedlings that were grown in
darkness for 3 days and then transferred to different wavelengths.
Northern blot analyses of these RNAs (Fig.
1) show that HDH mRNA
levels are strongly expressed in the presence of UV-B light, whereas
exposure to either white light, UV-A, blue light, or red light
irradiation did not result in significant expression. Remarkably, the
difference between UV-A and UV-B irradiation consisted only in
additional wavelengths from 305 to 340 nm (2 µmol·m Isolation of Arabidopsis cDNA, Which Rescues Starvation
Sensitivity of a Yeast gcn4 Mutant--
The high degree of
conservation of the UV response between yeast and plants suggests the
use of yeast mutants for functional cloning of plant genes involved in
this response. To test this approach, we introduced an
Arabidopsis cDNA library (33) into a gcn4
mutant. Transformants were grown under amino acid limitation (20 mM 3-AT). Under these conditions, cells survive only if
they express an intact Gcn4 (16). Therefore, gcn4 cells
harboring the empty expression plasmid pFL61 were unable to grow,
whereas a wild type strain (SP1) grew normally (Fig.
2). Following transformation of
Arabidopsis cDNA library, several colonies grew on the
3-AT plates. The corresponding plasmids were rescued and reintroduced into the gcn4 strain for a second round of screening. One
clone remained that rendered gcn4 cells capable of growing
under amino acid limitation (Fig. 2).
Sequence analysis of the cDNA revealed a strong homology to
nucleoside diphosphate kinases from other organisms (Fig.
3). The size of the cDNA was 806 base
pairs, and it encoded an ORF of 152 amino acids (GenBankTM
accession number AF058391, also referred to as
The unexpected isolation of NDPK Ia as a suppressor of cells lacking
Gcn4 activity raises the question of specificity. Does NDPK Ia induce
transcription of Gcn4 target genes, or does it rescue the
gcn4 phenotype via an indirect mechanism, as described (42)?
To address this question, we determined NDPK Ia DNA binding activity
and its ability to induce HIS4 and HIS3
transcription in yeast. We also monitored its intracellular
localization and light-dependent transcription in
Arabidopsis.
Arabidopsis NDPK Ia Binds to the Yeast HIS4 Promoter in
Vitro--
The finding that NDPK Ia is able to complement the
gcn4 mutation implies its function as a transcriptional
regulator. The yeast HIS4 promoter contains three Gcn4
binding sites (43) and represents a target of the complementation
screening. A fragment of the promoter (from HIS4 Transcription Is Activated by NDPK Ia in Yeast--
The
direct involvement of NDPK Ia in transcriptional activation of
HIS genes was demonstrated in yeast. Gcn4 cells
harboring either the control plasmid pFL61, the NDPK Ia expression
plasmid, or The Enzymatic Activity of NDPK Ia Is Not Altered in the Presence of
DNA in Vitro--
The results presented above suggest that NDPK Ia was
able to rescue gcn4 cells by virtue of its function as a
transcriptional activator that binds DNA. This result is not entirely
unexpected because mammalian NDPKs have already been suggested as DNA
binding proteins and transcriptional regulators (30, 44). Yet it raises the question of whether this activity of the protein is separated from
its enzymatic activity as a kinase of nucleoside diphosphates. The
enzymatic activity of NDPK Ia was determined and showed efficient transfer of the terminal phosphate group from ATP to either GDP, UDP,
or CDP. The corresponding km values for these
substrates were 0.43 mM for CDP, 0.44 mM for
UDP, and 0.38 mM for GDP and are similar to values
determined for NDPKs from other plants (45). Addition of
HIS4 promoter DNA (1-100 ng) to the reaction mixture did
not significantly influence the enzymatic activity (data not shown). It
seems, therefore, that DNA binding of NDPK Ia to HIS4 promoter does not affect its kinase activity.
NDPK Ia Is Localized in the Cytosol and Nucleus of Arabidopsis
Protoplasts--
The capability of NDPK Ia to bind DNA in
vitro and its effect on gene expression in yeast point to a
nuclear localization of the protein as has been shown for
NDPKs in human cells (46, 47). To study the intracellular
localization of NDPK Ia in plants, the full-length cDNA and its
N-terminal deletion were expressed as GFP fusion in
Arabidopsis protoplasts. GFP fluorescence in protoplasts was
analyzed by epifluorescence and Nomarski interference contrast
microscopy (Fig. 6). For comparison, GFP
fusion constructs targeted to different compartments of
Arabidopsis cells were chosen: a cytosol localized
phytochrome A-GFP (Fig. 6C), a nuclear targeted NLS-GFP
(Fig. 6D) (consisting of the nuclear leading sequence of the
bZIP protein CPRF4) (48), and a chloroplast-located GGP-GFP (Fig.
6E) (Geranyl-Geranyl pyrophosphate synthase) (49). The detection of GFP fluorescence indicated that both the NDPK Ia mRNA Is Induced by UV-B Light in Arabidopsis
Seedlings--
Light-dependent expression of NDPK
Ia mRNA in etiolated Arabidopsis seedlings was
determined by Northern blot analysis (Fig. 7). Seedlings were grown in darkness and
then transferred to different wavelengths for 72 h. NDPK
Ia cDNA hybridized to a mRNA of about 800 base pairs. No
cross-hybridization to other NDPKs was detectable. Seedlings irradiated
with UV-B light strongly expressed NDPK Ia mRNA, whereas
white light, UV-A, blue light, and red light irradiation caused only
low mRNA accumulation (Fig. 7A). Three independent experiments revealed that this expression pattern is strikingly identical to that of HDH (Fig. 1).
Irradiation of seedlings for 2-24 h with UV-B light revealed that NDPK
Ia and the genes related to histidine synthesis IPGD and
HDH were transiently stimulated 6 h after start of
irradiation, and mRNAs of all three genes reaccumulated after
longer irradiation (Fig. 7B). The expression of IPGD
mRNA was considerably lower but correlated with HDH and
NDPK Ia mRNA accumulation.
The spatial expression pattern of NDPK Ia was determined in tissues
from adult plants and revealed mRNA accumulation in green leaves
and flowers, but no expression in green stems (Fig. 7C).
This report provides the first evidence for a novel plant response
that is similar to the yeast Ras/Gcn4-mediated UV response. Transcription of a plant gene, HDH, was found to respond to
UV just like the transcription of its yeast homologue HIS4.
Also, a new Arabidopsis nucleoside diphosphate kinase (NDPK
Ia), which was identified by functional complementation of the yeast
gcn4 mutant, was shown to be UV-responsive and to induce
expression of genes related to histidine synthesis in yeast. NDPK Ia
binds to the HIS4 promoter in vitro, and
HIS4 transcription is stimulated by NDPK Ia in the absence
of Gcn4 activity. These results imply that NDPK Ia acts as a
transcriptional activator in yeast. Partial complementation of
gcn4 is also achieved by the maize transcription factor
Opaque-2 (50, 51), but other functional homologues of Gcn4
have so far not been isolated from plants. Under our selective conditions (20 mM 3-AT), bZIP proteins from
Arabidopsis and parsley with considerable sequence homology
to Opaque-2 (GBF1 and GBF2 (52); CPRF1, CPRF2, and CPRF4 (36, 48))
failed to complement the gcn4 phenotype (data not shown).
Sequence comparison of NDPK Ia with cDNAs from other plants
revealed a high degree of homology to chloroplast-located type II NDPKs
(39). Three Arabidopsis NDPK sequences are described in the
data bases, of which two contain putative organellar leader sequences.
However, several facts make it unlikely that NDPK Ia is located in the
chloroplast: (i) there is no homologous pattern of its N terminus with
chloroplast leader sequences from other plants, (ii) the NDPK Ia/GFP
fusion and the leader-free deletion ( Which genes could be the target of NDPK Ia in plants? Given its effect
on the yeast HIS4 gene together with the
UV-dependent expression of HDH, it is tempting
to speculate that NDPK Ia target genes encode enzymes of amino acid
biosynthesis pathways, in particular of the histidine synthesis
pathway. Analysis of the HDH promoter should reveal whether
it serves as a NDPK Ia target. NDPK Ia mRNA is strongly
stimulated after UV-B light irradiation of Arabidopsis seedlings, and there is an obvious correlation to the expression of
HDH, the Arabidopsis homologue of yeast
HIS4. Similarly to yeast, induction of histidine
biosynthetic genes in Arabidopsis occurs not only following
exposure to UV light but also during starvation (57), providing
additional proof of the similarity between the systems.
Although the mammalian and yeast Ras/AP-1 cascades were shown to play
important roles in protecting against UV irradiation (6, 12, 58), this
process is not well understood. In addition, it is difficult to
interpret the relevance of the UV-dependent expression of
HDH and NDPK Ia in Arabidopsis. However, using the UV
responsive genes identified in this study as a starting point, it
should be possible to reveal the plant signal transduction pathway and
to investigate its biological significance. Considering the similarity
to the corresponding system in yeast, it is suggested that the use of
yeast genetics could considerably facilitate such studies.
![]()
INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES
B (6, 10, 11). A similar UV
response, which is not related to DNA damage, has also been identified
in yeast (12). In this organism, the UV response involves activation of
Ras2, which leads to activation of a transcription factor of the AP-1
family (Gcn4, a functional homologue of c-Jun) (13). As a result, Gcn4
target genes, such as HIS4 (see below), are strongly
activated by UV. Indirect evidence suggests that these conserved
Ras2/AP-1 pathways have a protective function (5, 12).
![]()
EXPERIMENTAL PROCEDURES
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES
1
(MAT a, ura3, leu2, gcn4
1) were used in this study
(12).
2·s
1 emitting light between
305 and 380 nm. The UV-A spectra (19 µmol of
photons·m
2·s
1, 340-390 nm), blue light
(38 µmol of photons·m
2·s
1) and red
light (19 µmol of photons·m
2·s
1)
irradiations, and the dim green safe light in which the plants were
harvested have been described elsewhere (31).
1-79 NDPK Ia ORF by PCR using the gene-specific
primers (5'-end, CCAGGCCTCGTTGTATGCCATCAGGTTTCACC;
1-79
5'-end, GGA TCCAAATGGAGGACGTTG; 3'-end, GTCGACCTCCCTTAGCCATGT) and subcloned into pKS. The GST fusion cassette pGEX-5x-1 (Amersham Pharmacia Biotech) was BamHI/SalI-digested, and
the NDPK Ia cDNA was integrated in-frame at the C
terminus of the glutathione S-transferase cDNA. The GFP
expression cassette was removed from the pBI121-mGFP4 construct
(34) by HindIII/EcoRI digestion and transferred
into pUC18 (mGFP4-pUC18). Afterward a 5' BamHI followed
by an in-frame SmaI restriction site were introduced into
mGFP4 coding region by PCR using the primers following primers: 5'-end,
CGGGATCCCGCCCGGGATGAGTAAAGGAGAAGAACTTTTCACTG; 3'-end,
GCGGAGCTCTTATTTGTATAGTTCATCCATCCATGCC. The resulting plasmid (mAV 4)
was used for the construction of the NDPK Ia coding regions fused to the C terminus of GFP in mGFP4 by
BamHI/SalI digestion and in-frame integration
into mAV4. The NLS-mGFP4 and PHYA-mGFP4 constructs will be described
elsewhere. All new DNA sequences were verified by sequencing both strands.
1-79 NDPK Ia-GST fusion protein was expressed in
M15pREP4, and single step purification of the fusion protein was
carried out as described (35). The N-terminal GST protein was removed by cleavage of the fusion protein with 10 µg of factor Xa (in 20 mM Tris (pH 8), 100 mM NaCl, 2 mM
CaCl2) for 12 h at 20 °C. All purification steps
were monitored by protein staining of each fraction after SDS-PAGE.
In vitro transcription and subsequent in vitro
translation reactions were carried out as described in (36).
235 to
67) (37). Each binding reaction
was performed with 1 ng of 32P-labeled probe, 100 ng of
protein, 100 ng of poly(dI-dC) in Gcn4-binding buffer (38). The mixture
was incubated for 30 min on ice, and NDPK Ia/DNA complexes resolved on
6% native polyacrylamide gels.
80 °C using intensifying screens.
1-79 NDPK Ia sequence has been deposited under
GenBankTM accession number AF058391.
![]()
RESULTS
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES
2·s
1), underscoring the high
degree of specificity of the response to UV-B light. Our results also
demonstrates that in plants, like in yeast, expression of a gene
related to histidine biosynthesis is induced by UV light. The light
regime (UV-B supplemented by UV-A) stimulates photoreactivation in
Arabidopsis, leading to the reversion of possible damage to
DNA (3).

View larger version (72K):
[in a new window]
Fig. 1.
HDH mRNA levels in Arabidopsis
seedlings are stimulated by UV-B light. Northern blot
analysis of RNA prepared from etiolated seedlings, grown for 3 days in
darkness and then irradiated for 72 h with red (R),
blue (B), UV-A, UV-B, or white (W) light or kept
in darkness (D). 20 µg of total RNA per lane was
separated. The blot was hybridized with HDH cDNA, and after removal
of the probe, it was rehybridized with 18 S rDNA.

View larger version (56K):
[in a new window]
Fig. 2.
Complementation of yeast gcn4
phenotype by Arabidopsis NDPK Ia. gcn4
(gcn4
) strain containing either the control plasmid pFL61
or pFL61 with Arabidopsis NDPK Ia cDNA and the sp1 wild
type strain harboring pFL61 were streaked on CMUH and 20 mM
3-AT. Photographs of plates were taken after 3 days of incubation at
30 °C.
1-79 NDPK Ia). The N
terminus was extended by rapid amplifications of 5' cDNA ends,
resulting in an ORF of 231 amino acids (Fig. 3) (GenBankTM
accession number AJ012758, also referred to as NDPK Ia), and the
corresponding protein had an apparent size of approximately 25 kDa
(data not shown). The protein contains domains, which are described in
other NDPKs as a ATP/GTP binding site motif A (P-loop, amino acids
166-173), and the crucial site for the catalytic mechanism (His-197).
In addition, two out of the three basic amino acids (Lys-113 and
Lys-214), which are crucial for DNA binding of the human homologue
Nm23-H2 (41), were found in the NDPK Ia sequence. The cDNA contains
an N-terminal extension, which is common in plant type II
NDPKs. Although this region is suggested to mediate chloroplast targeting of some plant NDPKs, no similarity to known chloroplast leader sequences was found for NDPK Ia by the use of data
base PSORT. Further data base searches revealed three more NDPK
sequences from A. thaliana (ecotype Columbia). Compared with
NDPK Ia, NDPK 2 differs in only 3 amino acids (98.7% identity), whereas NDPK 3 shows only 39% identity. NDPK 1 lacks an N-terminal extension and has a 53.9% homology to NDPK Ia (Fig. 3). The high similarity to NDPK 2 may reflect the cloning of an identical gene from
a different ecotype (Landsberg erecta versus Columbia). The highest level of identity from other plants including the N-terminal extension was found for spinach and pea NDPK (62.8%). Surprisingly, a
remarkable sequence identity was also found with the Drosophila Awd (abnormal wing disc) gene (57%) and with the human
tumor-suppressor proteins Nm23-H1 (54%) and Nm23-H2 (51%).

View larger version (59K):
[in a new window]
Fig. 3.
Multiple alignment of NDPK Ia and comparison
with sequences from other NDPKs. Numbering refers to the amino
acid residues. The percentage of identity between NDPK Ia and related
proteins is calculated either including the N-terminal region
(+L) or excluding the N terminus (
L). Residues
identical to NDPK Ia amino acid residues are indicated by
asterisks (*). The accession numbers for A. thaliana (Columbia) proteins were AF017641 (NDPK 1),
AC017640 (NDPK 2), and AF044265 (NDPK3).
238 to
58) was
therefore chosen as a probe for DNA binding assay. The N-terminal
deletion of NDPK Ia (
1-79 NDPK Ia) was expressed as GST fusion
protein, followed by proteolytical treatment to remove the GST tag
before subjected to electrophoretic mobility shift assay. The NDPK Ia
full-length protein was expressed by coupled in vitro
transcription/translation reactions and subjected to electrophoretic
mobility shift assay. Fig. 4 shows that
both proteins strongly bind to the HIS4 promoter (Fig. 4,
A, lane 1, and C, lane 1). Surprisingly, the
1-79 NDPK Ia-GST fusion protein was unable to bind to the promoter
under identical conditions as used for the cleaved NDPK Ia protein
(Fig. 4A, lane 2 compared with lane 1). Under our
conditions, the human homologous protein Nm23-H2 (which was kindly
provided by Dr. M. Veron, Institut Pasteur, Paris, France) also
interacts with the HIS4 promoter (Fig. 4A, lane
4). As expected, DNA binding of Nm23-H2 was strongly inhibited by
excess of poly(dI-dC) (not shown); poly-pyrimidine-rich sequences were
shown to be putative binding sites of Nm23-H2 (44). For Arabidopsis NDPK Ia and its N-terminal deletion, 100 ng of
poly(dI-dC) (Fig. 4) or 500 ng of salmon sperm DNA (Fig. 4C,
lanes 1 and 3) did not interfere with DNA binding. The
binding specificity of NDPK Ia,
1-79 NDPK Ia, and Nm23-H2 to the
HIS4 promoter was further demonstrated by efficient
competition of the binding with excess of unlabeled probe (Fig. 4,
B, lanes 1-7, and C, lanes 3-7).
![]()
View larger version (21K):
[in a new window]
Fig. 4.
NDPK Ia binds to the yeast HIS4
promoter. DNA binding activity was determined by
electrophoretic mobility shift assay using radiolabeled HIS4 promoter (
238 to
58) as a probe.
The DNA fragment was incubated with recombinant
1-79 NDPK Ia and
Nm23-H2 (A and B) or with reticulocyte lysates
programmed with NDPK Ia mRNA (C).
1-79
NDPK Ia interacts with DNA (A, lanes 1 and 4),
whereas the fusion protein and GST do not bind (A, lanes 2 and 3). Unlabeled probe was added in the indicated molar
excess over probe (B, lanes 2-4, 6, and 7, and
C, lanes 4-7). 500 ng of salmon sperm DNA (ss)
was added to the reticulocyte lysate as a competitor of unspecific DNA
binding (C, lane 2). FP, free probe.
1-79 NDPK Ia were grown under nonlimiting conditions.
Cells of the RAS2Val-19 strain in which
HIS4 expression is constitutively induced (12) were used as
a positive control. Primer extension analysis revealed, that
HIS3 and HIS4 expression was marginal in
gcn4 (Fig. 5, lanes 1 and 4), whereas HIS4 transcripts were
strongly increased in three independent experiments if
1-79 NDPK Ia
(lane 2) or the full-length protein (lane 5) was
expressed in this mutant. HIS4 transcript levels, determined
in strains expressing NDPK Ia, were comparable to levels measured in
RAS2Val-19 (lane 3), indicating the
constitutive activation of the signaling cascade. NDPK Ia was also able
to stimulate HIS3 transcripts in the absence of UV light or
starvation, but the induction was significantly lower than that of
HIS4 (Fig. 5, lanes 1-3).

View larger version (40K):
[in a new window]
Fig. 5.
NDPK Ia activates HIS3 and
HIS4 expression in gcn4. The
levels of HIS3 and HIS4 mRNA were monitored by primer extension
using radiolabeled gene-specific oligonucleotides. RNAs were prepared
from gcn4 strains containing either the control plasmid
pFL61 (lanes 1 and 4), pFL61 with cDNA of
NDPK Ia (lane 5), or the N-terminal deletion
(
1-79 NDPK Ia) (lane 2).
Ras2Val19 (lane 3) was used as a
control exhibiting constitutive HIS expression. 20 µg of
total RNA was used in each reaction.
1-79 NDPK Ia-GFP (Fig. 6F) and the full-length protein (Fig.
6G) are distributed between the nucleus and the cytosol.
Comparison with GGP-GFP excludes their localization in chloroplasts.
Irradiation of the protoplasts did not affect the intracellular
distribution of NDPK Ia-GFP within the cell (data not shown).

View larger version (34K):
[in a new window]
Fig. 6.
Intracellular sorting of GFP fusion proteins
in Arabidopsis protoplasts. Epifluorescence
(left column) and Nomarski interference contrast microscopy
(right column) images of untransformed cells (A)
and cells transiently transformed with mGFP4 (B)
cytosolic PHYA-GFP (C), nuclear-targeted NLS fused to GFP
(D), chloroplast-targeted GGP-GFP (E),
1-79
NDPK Ia-GFP (F), or NDPK Ia-GFP (G). After
transformation by electroporation, protoplasts were kept for 10 h
in darkness prior to analysis. Left and right columns show identical
protoplasts. Arrows indicate the positions of the
nuclei.

View larger version (29K):
[in a new window]
Fig. 7.
Accumulation of NDPK Ia,
HDH, and IPGD mRNA is coordinated
and stimulated by UV-B light in Arabidopsis
seedlings. Northern blot analyses of RNA isolated from
seedlings, irradiated for 72 h with different wavelengths
(A), from 5-day dark-grown seedlings irradiated for 2-24 h
with UV-B light (B), and from different tissues of adult
plants (C). A, the blot used in this panel has
been already shown in Fig. 1 and was rehybridized with NDPK
Ia cDNA. B, 5-day-old etiolated seedlings were
transferred for 2-24 h to UV-B light (UV) or kept in
darkness (D) until harvest at the indicated time points
(2-24 h). C, leaves (lane 1), stems (lane
2), and flowers (lane 3) were harvested from 4-week-old
light-grown plants. In all cases, 20 µg of total RNA was used. The
blots were hybridized with NDPK Ia, HDH, IPGD, and 18 S rDNA
probes as indicated.
![]()
DISCUSSION
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES
1-79) are localized in the
cytosol and nucleus but not in Arabidopsis chloroplasts
(Fig. 5), and (iii) the expressed protein is not transported into
isolated chloroplasts in vitro (data not shown). Our
findings indicate that NDPK Ia is expressed as a 25-kDa protein without
further posttranslational modification in Arabidopsis. In
mammalian cells, the NDPK Nm23-H2 was shown to function as a
DNA-binding protein and is proposed to act directly as a
transcriptional regulator (30, 44). Amino acids that are crucial for
DNA binding activity (41) are conserved in the Arabidopsis
NDPK Ia sequence. Nm23-H2, as well as NDPKs from other organisms, are
distributed in the nucleus and cytosol (47, 53, 54), as was found for NDPK Ia. These NDPKs may make up a subfamily, which might be involved in transcriptional processes. Complementation of gcn4 by
NDPK Ia and the direct stimulation of HIS4 transcription
strongly suggest a direct involvement of NDPK Ia in
trans-activation. However, the protein has only weak
trans-activation potential in a yeast one-hybrid system
(data not shown) and is more likely to function as a co-factor
modifying Bas1, Bas2, or other activators. These factors also bind to
the HIS4 promoter and are responsible for expression of
HIS4 under limiting conditions (55). Similarly, the
transcriptional activation capacity of Nm23-H2 is still a matter of
controversy, and its putative function as a cofactor modifying
trans-acting factors during tumor suppression has been discussed (56).
| |
FOOTNOTES |
|---|
* This work was supported in part by Grant I-486-98-13/96 from the German-Israeli Foundation for Scientific Research and Development.The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
The nucleotide sequence(s) reported in this paper has been submitted to the GenBankTM/EMBL Data Bank with accession number(s) AF058391 and AJ012758.
§ To whom correspondence should be addressed. Tel.: 49-761-2032709; Fax: 49-761-2032612; E-mail: frohnmey{at}ruf.uni-freiburg.de.
| |
ABBREVIATIONS |
|---|
The abbreviations used are: IPGD, imidazole glycerol phosphate dehydratase; GFP, green fluorescent protein; GST, glutathione S-transferase; HDH, histidinol dehydrogenase; NDPK, nucleoside diphosphate kinase; 3-AT, 3-aminotriazole.
| |
REFERENCES |
|---|
|
|
|---|
This article has been cited by other articles:
![]() |
P. E. Verslues, G. Batelli, S. Grillo, F. Agius, Y.-S. Kim, J. Zhu, M. Agarwal, S. Katiyar-Agarwal, and J.-K. Zhu Interaction of SOS2 with Nucleoside Diphosphate Kinase 2 and Catalases Reveals a Point of Connection between Salt Stress and H2O2 Signaling in Arabidopsis thaliana Mol. Cell. Biol., November 15, 2007; 27(22): 7771 - 7780. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Dorion, F. Dumas, and J. Rivoal Autophosphorylation of Solanum chacoense cytosolic nucleoside diphosphate kinase on Ser117 J. Exp. Bot., December 1, 2006; 57(15): 4079 - 4088. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Zhu, A. Dong, D. Meyer, O. Pichon, J.-P. Renou, K. Cao, and W.-H. Shen Arabidopsis NRP1 and NRP2 Encode Histone Chaperones and Are Required for Maintaining Postembryonic Root Growth PLANT CELL, November 1, 2006; 18(11): 2879 - 2892. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Shen, J.-I. Kim, and P.-S. Song NDPK2 as a Signal Transducer in the Phytochrome-mediated Light Signaling J. Biol. Chem., February 18, 2005; 280(7): 5740 - 5749. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Johansson, A. MacKenzie-Hose, I. Andersson, and C. Knorpp Structure and Mutational Analysis of a Plant Mitochondrial Nucleoside Diphosphate Kinase. Identification of Residues Involved in Serine Phosphorylation and Oligomerization Plant Physiology, October 1, 2004; 136(2): 3034 - 3042. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Fukamatsu, N. Yabe, and K. Hasunuma Arabidopsis NDK1 is a Component of ROS Signaling by Interacting with Three Catalases Plant Cell Physiol., October 15, 2003; 44(10): 982 - 989. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Moon, B. Lee, G. Choi, D. Shin, D. |