Advertisement
JBC

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Vaduva, G.
Right arrow Articles by Ramesh, N.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Vaduva, G.
Right arrow Articles by Ramesh, N.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

J Biol Chem, Vol. 274, Issue 24, 17103-17108, June 11, 1999


The Human WASP-interacting Protein, WIP, Activates the Cell Polarity Pathway in Yeast*

Gabriela VaduvaDagger , Narcisa Martinez-Quiles§, Ines M. Anton§, Nancy C. Martin, Raif S. Geha§, Anita K. HopperDagger parallel , and Narayanaswamy Ramesh§

From the Dagger  Department of Biochemistry and Molecular Biology, Pennsylvania State University College of Medicine, Hershey, Pennsylvania 17033, § Division of Immunology, Children's Hospital, Department of Pediatrics, Harvard Medical School, Boston, Massachusetts 02115, and  Department of Biochemistry, University Louisville Medical School, Louisville, Kentucky 40292

    ABSTRACT
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

WIP, the Wiskott-Aldrich syndrome protein-interacting protein, is a human protein involved in actin polymerization and redistribution in lymphoid cells. The mechanism by which WIP reorganizes actin cytoskeleton is unknown. WIP is similar to yeast verprolin, an actin- and myosin-interacting protein required for polarized morphogenesis. To determine whether WIP and verprolin are functional homologues, we analyzed the function of WIP in yeast. WIP suppresses the growth defects of VRP1 missense and null mutations as well as the defects in cytoskeletal organization and endocytosis observed in vrp1-1 cells. The ability of WIP to replace verprolin is dependent on its WH2 actin binding domain and a putative profilin binding domain. Immunofluorescence localization of WIP in yeast cells reveals a pattern consistent with its function at the cortical sites of growth. Thus, like verprolin, WIP functions in yeast to link the polarity development pathway and the actin cytoskeleton to generate cytoskeletal asymmetry. A role for WIP in cell polarity provides a framework for unifying, under a common paradigm, distinct molecular defects associated with immunodeficiencies like Wiskott-Aldrich syndrome.

    INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

Wiskott-Aldrich syndrome (WAS)1 is an inherited immune deficiency characterized by eczema, bleeding, and recurrent infections. A deficiency in both cellular and humoral immunity is common among all WAS patients (1-3). Lymphocytes and platelets from WAS patients show cytoskeletal abnormalities, and T lymphocytes of WAS patients show diminished proliferative response to stimulation through the T cell receptor-CD3 complex (4).

Molecular analyses of the WAS gene (5) have provided insights into the roles of Wiskott-Aldrich syndrome protein (WASP) in the actin cytoskeleton function and in cell proliferation. WASP binds via its GTPase binding domain to CDC42Hs and weakly to Rac but not to Rho (6). Overexpression of WASP induces formation of actin-containing clusters, indicating a role for WASP in actin polymerization (6). These findings suggest that WASP may provide a connection between CDC42Hs, Rac, and the actin cytoskeleton. One possible link between the actin cytoskeleton and WASP is the recently identified WASP-interacting protein WIP (7). Transfection of WIP into BJAB cells induced actin-containing cerebriform projections beneath the cell membrane, suggesting that WIP may be involved in regulating the dynamics of the actin cytoskeleton.

WIP has sequence similarity to Saccharomyces cerevisiae verprolin, encoded by the VRP1 gene (8). Verprolin interacts directly with the yeast WASP, Las17p (9). This prompted us to determine whether WIP and verprolin are functional homologues. If the human protein is a homologue of the yeast protein, then the genetic and cell biology data available for verprolin should prove useful for learning more about the function of WIP in human cells.

In wild-type yeast cells, the actin cytoskeleton is polarized along the mother-daughter axis (10). When the function of verprolin is impaired (in vrp1-1) or absent (in vrp1 null), the asymmetry of actin cytoskeleton along the mother-bud axis is lost, actin cables are faint or absent, and cytoskeleton-associated functions like endocytosis are compromised (8, 11-13). In addition, vrp1-1 or vrp1 null cells cannot grow at 37 °C (11). WIP suppresses the growth defects of VRP1 missense and null mutations as well as the cytoskeletal and endocytosis defects of vrp1-1 cells. Mutations in conserved domains of WIP impair its ability to suppress vrp1 mutations. Furthermore, WIP has a polarized intracellular localization that often coincides to that of actin. The data support the hypothesis that WIP and verprolin are functional homologues and provide new ways to understand the molecular defects associated with the Wiskott-Aldrich syndrome.

    MATERIALS AND METHODS
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

Strains and General Techniques-- Yeast media was prepared using standard methods (14). Yeast cells were transformed by the one step method (15). Yeast strains used were TZ33 (MATalpha SUP11 ade2-1 mod5-1 ura3-1 lys2-1 leu2-3, 112 his4-519 vrp1-1) and T65-1D (MATalpha ade1 ura3-52 leu2-3, 112 ile MEL1 vrp1::LEU2) (11). Standard recombinant DNA techniques (16) and DH5alpha and RR1 bacterial strains were used. Restriction endonucleases and modifying enzymes were obtained from New England Biolabs (Beverly, MA) or from Promega (Madison, WI).

Location of the vrp1-1 Mutation-- Genomic DNA from TZ33 was prepared (17), and the vrp1-1 gene was polymerase chain reaction-amplified using the following primers: 5'-caatgttcggtttgtccgctacattgctg and 5'-gcctcaatattctgcagctgtggactggc. The polymerase chain reaction products from several independent reactions were cloned into pGEM-T vector and subjected to automated sequencing.

Plasmid Constructions-- WIP cDNA or WIP 2 (amino-terminal 116-amino acid truncation of WIP, (7)) cloned in pUC18 were digested with EcoRI, filled in, and redigested with PstI, and the insert was then ligated to SmaI-PstI-digested pEMBLyex4, a pEMBLy (18)-based vector (the vector was a kind gift of Dr. E. Orr, University of Leicester, UK). An artificial initiation codon (ATG) was introduced in WIP2 as follows: 5' region of WIP was amplified using the oligonucleotide pair: 5'-tagagctccatggactacaaggacgacgatgacaagagggataatgattctggaggaagccga and 5'-ctgtctactccactcctgga. WIP2 in pEMBLyex4 was digested with SacI, and the 370-base pair fragment was exchanged with SacI-digested polymerase chain reaction product. WIP-Lys mutant has lysines 47 and 48 changed to alanines. In the WIP-Pro construct, three proline residues within the consensus profilin binding motif 427APPPPPP433, prolines 429, 431, and 433, were mutated to alanines. Both WIP-Lys and WIP-Pro were constructed by mutagenesis using a site-directed mutagenesis kit (Quickchange, Stratagene) and appropriate oligonucleotides as given below (the mutated bases designated by uppercase). For WIP-Lys the oligo was 5'-gggaagaaactaGCgGCgacggtcaccaatgac, and for WIP-Pro the oligo was 5'-ggggcacctGccccaGctccaGcatcaacatctattattagaaatggc. The region containing the WIP-Lys mutation was excised by EcoRI-BstEII digestion and ligated to WIP cDNA digested with EcoRI-BstEII to generate WIP-Lys. The WIP-Lys,Pro double mutant was constructed by exchanging a SfiI-BamHI fragment of WIP containing the WIP-Pro mutation with the corresponding fragment of the WIP-Lys mutant. All constructs were verified by DNA sequence analysis.

Western Analysis-- Anti-Nsp1 antibody was used at 1:20,000 dilution as described (20). Expression of WIP was analyzed with the 1:1,200-diluted anti-WIP antiserum (21) used for the immunofluorescence studies mentioned below.

Immunofluorescence of WIP and phalloidin co-staining of actin in the same cells was carried out in solution as described (8). Briefly, yeast cells were grown on media containing galactose to early logarithmic phase, fixed, digested, (19) and incubated for 1 h with rabbit antiWIP antiserum (21) diluted 1:20. Cells were then washed, incubated for 1 h with anti-rabbit fluorescein-conjugated secondary antibody (1:500), and, after a second round of washes, stained with rhodamine phalloidin (8).

Lucifer yellow endocytosis and Oregon green phalloidin staining were performed as described (8).

Microscopic Imaging and Analysis-- A Nikon Microphot-FX equipped with a B-1E filter cube, a 420-490 excitation filter, and a 515F barrier filter was used. Images were acquired and digitized with a Sensys (Photometrics Ltd., Tucson, AZ) CCD camera, and image processing was done using QED software running on a 6500/225 Power Macintosh. Files were processed using Adobe Photoshop 5.

    RESULTS
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

WIP and Yeast Verprolin Share Sequence Similarity-- Although verprolin is 314-amino acids longer, WIP and verprolin share significant sequence similarity throughout their length, and, more importantly, among defined domains involved in actin, profilin, or WASP interaction (Fig. 1). The WH2 (WASP homology 2) domain of WIP is 44% identical to the actin-interacting WH2 domain of verprolin (Fig. 1). The next highest segment of sequence similarity between WIP and verprolin (43% identity) spans the first 116 amino acids of WIP (Fig. 1).


View larger version (75K):
[in this window]
[in a new window]
 
Fig. 1.   Sequence and domain comparison between verprolin and WIP. The WH2 domain of both proteins is underlined with the stippled blue bar. The amino-terminal 116 amino acids of WIP missing in WIP2 are boxed in blue. Two conserved lysines (47KK48) mutated in WIP-Lys are marked by asterisks. The two potential profilin binding APPPPP motifs are underlined with black bars. The 425Leu right-arrow Pro mutation in vrp1-1 allele is marked with a red asterisk. The carboxyl-terminal WASP-interacting domain of WIP and the homologous region in verprolin are boxed in green. For sequence comparison, identical or conserved residues are marked by uppercase red letters.

The middle portions of WIP and verprolin contain 10 and 11, respectively, potential SH3 binding domains. In WIP, amino acids 321-415 of this region interact with Nck (21). In verprolin, multiple sites in the SH3 binding domains region interact with the SH3 domain of Myo5p (22).

At the carboxyl terminus, WIP contains a 72-amino acid-long WASP-interacting domain (21) (Fig. 1). The carboxyl-terminal 337 amino acids of verprolin, containing a conserved version of the WASP-binding domain of WIP, binds to yeast WASP, Las17p (9). Although verprolin interacts with Las17p (9), verprolin failed to bind human WASP by two-hybrid analysis (data not shown), suggesting that the conservation of the WASP binding region alone may not be sufficient for human WASP-Vrp1p interaction.

WIP also interacts with profilin (7) and contains two putative profilin binding sequences between amino acids 8-13 and 427-433. The latter is conserved in verprolin, but interaction between verprolin and profilin was not detected by two-hybrid analysis (8).

WIP Is Likely the Human Homologue of Verprolin-- Sequence conservation predicts WIP might be a functional homologue of verprolin. vrp1::LEU2 is a null allele (11), and the vrp1-1 allele contains a Leu right-arrow Pro mutation at amino acid 425, which is part of a proline-rich region homologous to the Nck binding domain (21) of WIP (Fig. 1). Both mutations result in cells unable to grow at 37 °C. WIP cloned in the pEMBLyex4 vector was transfected in vrp1-1 and vrp1 null cells, and its effect on the temperature-sensitive growth defects of these cells was determined. Genes cloned in pEMBLyex4 are expressed from a CYC1 promoter preceded by GAL1-10 upstream-activating sequences, resulting in galactose-inducible gene expression. Cells were grown on glucose-selective media, transferred to media containing either glycerol or galactose, and incubated at various temperatures. As expected, induction by galactose leads to elevated expression of WIP (Fig. 2A).


View larger version (32K):
[in this window]
[in a new window]
 
Fig. 2.   A, Western blot analysis of wild-type and mutant WIP. Approximately 20 µg of total protein extract were loaded in each lane and probed with anti-WIP rabbit antiserum. The blot was reprobed with anti-Nsp1p monoclonal antibody to confirm equal loading in each lane. B, diagram of WIP mutants. Construct names are listed to the left of each construct. The size of each construct is indicated by numbers. Letters above each construct represent the amino acid replacements. CTR, control, vector alone.

vrp1-1 or vrp1 null cells producing WIP are unable to grow at 37 °C on media containing glycerol as the carbon source. These same cells grow on media containing galactose at 37 °C (Table I; Fig. 3, compare A with C). Under the same conditions, vrp1-1 or vrp1 null cells with vector alone fail to grow (Fig. 3C). Thus, as with other human cytoskeletal proteins, high levels of protein are necessary for the complementation (23). The suppression by WIP of the growth defects of vrp1 cells, together with the sequence similarity and domain conservation between the two proteins, indicate that WIP is likely the human homologue of verprolin.

                              
View this table:
[in this window]
[in a new window]
 
Table I
Growth of vrp1-1 and vrp1 null (vrp Delta ) strains bearing WIP plasmids on glycerol (Gly)- and galactose (Gal)-containing media at 23 and 37 °C
GT, generation time in hours at 23 °C on galactose-containing media.


View larger version (54K):
[in this window]
[in a new window]
 
Fig. 3.   WIP, but not amino-terminal-truncated WIP2, complements the temperature sensitivity of vrp1-1 (strain TZ33) and vrp1 null (strain T65-1D) cells. Cells were grown on glucose-containing media then replica-plated on galactose-containing media and incubated for 3 days at 23 °C (A), 34 °C (B), and 37 °C (C). The right half of the plate is strain T65-1D. The left half of the plate is strain TZ33. Genes on plasmids are as follows: 1, vector; 2, VRP1; 3, WIP; 4, WIP2; 5, WIP2; 6, WIP; 7, VRP1; 8, vector.

WIP Restores Actin Cytoskeleton Polarization and Endocytosis in vrp1-1 Yeast Cells-- In a population of vrp1-1 cells, only about 20% of small- and medium-budded cells have polarized cytoskeletons (Fig. 4A). In wild- type cells, under similar conditions, about 80% of cells are polarized (Fig. 4B). WIP expression in vrp1-1 cell increases the proportion of polarized cells to 65% (Fig. 4C). Thus, like verprolin, WIP functionally participates in the mechanism(s) that regulates the polarized distribution of actin patches between the mother and the bud.


View larger version (30K):
[in this window]
[in a new window]
 
Fig. 4.   WIP restores the polarized morphology of actin cytoskeleton in vrp1-1 cells (strain TZ33). Logarithmic cultures of TZ33 transformed with vector alone (A), VRP1 (B), WIP (C), or WIP2 (D) were grown on galactose-containing media at 23 °C, fixed, and then stained with Oregon green phalloidin. Approximately 200 small- and medium-budded cells were scored to quantify cytoskeletal polarization for each strain. Bar, 4 µm.

Defects in fluid-phase endocytosis can be detected in yeast by monitoring the uptake of a fluorescent marker such as lucifer yellow into the vacuole, the equivalent of mammalian lysosomes. Although vrp1-1 cells bearing VRP1 on a plasmid internalize lucifer yellow (Fig. 5B), vrp1-1 cells transformed with vector alone are unable to internalize the dye (Fig. 5A). Expression of WIP in vrp1-1 leads to partial suppression of the defect in endocytosis (Fig. 5C).


View larger version (93K):
[in this window]
[in a new window]
 
Fig. 5.   WIP restores endocytosis in vrp1-1 cells (strain TZ33). Logarithmic cultures were grown on galactose-containing media at 23 °C, incubated with lucifer yellow for 30 min, washed, and visualized. A, vector; B, VRP1 on a centromeric plasmid; C, WIP; D, WIP2. In E, F, G, and H, the differential interference contrast (DIC) images corresponding to A, B, C, and D, respectively, are shown. Bar, 4 µm.

The WH2 and the Putative Profilin Binding Domains Are Critical for WIP Function-- To analyze the requirement for the WH2 domain in WIP function, we generated a truncated version of WIP, WIP2, lacking the first 116 amino acids (Fig. 2B). WIP2 was cloned in pEMBLyex4 downstream of a translation initiation codon and tested for its ability to rescue the temperature sensitivity of vrp1 cells. WIP2 is unable to restore endocytosis (Fig. 5D) nor to complement the temperature-sensitive growth defect of either vrp1-1 or the vrp1 null cells on galactose at 37 °C (Fig. 3, compare A with C). However, because Western analysis revealed poor WIP2 expression in yeast (Fig. 2A), no conclusions can be inferred from this lack of complementation.

To address the role of the WH2 domain for WIP function in another way, we generated point mutations in this domain. The sequence KLKK has been shown to be critical for actin binding among several proteins (24). Mutation of 45KK46 abolishes the interaction of the WH2 domain of verprolin with actin (8). A mutant WIP, WIP-Lys, was generated that has the two homologous lysines, 47KK48, replaced by alanines. WIP-Lys is expressed at levels comparable with wild-type WIP (Fig. 2A) but is unable to complement the null mutation (Fig. 6D) and poorly suppresses the vrp1-1 mutation (Fig. 6B). Even at the permissive temperature the generation time of vrp1-1 cells producing WIP-Lys is about 4 times longer than that of vrp1-1 cells producing WIP (Table I). Therefore, lysines 47 and 48 are important for the biological function of WIP.


View larger version (64K):
[in this window]
[in a new window]
 
Fig. 6.   Mutations in WH2 or the putative profilin binding domain of WIP impairs its ability to complement the temperature sensitivity of vrp1-1 cells (A and B) or vrp1 null strain (C and D). Cells were grown on glucose-containing media and then replica plated on galactose-containing media and incubated for 3 days at 23 °C (A and C) or 37 °C (B and D).

WIP interacts with profilin (7) and has two putative APPPPP profilin binding motifs, homologous to those found in profilin-interacting proteins Mena and VASP (24). The second APPPPP motif of WIP is conserved in verprolin (Fig. 1). To test the role of this motif for WIP function, we generated the WIP-Pro mutant (Fig. 2B) in which three proline residues are mutated to alanine, i.e. 427APPPPPP433 to APAPAPA. The expression of WIP-Pro is comparable with that of wild-type WIP (Fig. 2A). The generation time of vrp1-1 cells producing WIP-Pro is 3-fold longer than that of WIP producing vrp1-1 cells (Table I); the growth of vrp1 null cells producing WIP-Pro, although not abolished as for WIP-Lys, is much reduced on galactose at 37 °C in comparison with the same cells producing WIP (Fig. 6D). Furthermore, a double mutant, WIP-Lys,Pro, containing both 47KK right-arrow AA48 and 427APPPPPP right-arrow APAPAPA433 mutations (Fig. 2B), leads to a further increase in generation time as compared with each mutant alone (Table I). Therefore, the two conserved lysines, 47KK48, and the APPPPPP motif contribute to the full activity of WIP in vivo.

Localization of WIP in Yeast-- If WIP performs a conserved function in cell polarity, it should serve as a polarity marker at sites of active cell growth, as does verprolin (8). To test this hypothesis, we determined the intracellular localization of WIP in yeast cells by immunofluorescence using anti-WIP antibody (21). Like verprolin, WIP localizes at regions of active growth in yeast cells in a cell cycle-dependent manner. Although there is WIP staining throughout the cytosol, there are high local concentrations in a punctuated pattern at the site of bud emergence, the tip of the bud, or throughout most of the bud (Fig. 7A, left). The WIP patches often colocalize (Fig. 7A, left, arrows) with actin patches (Fig. 7A, right). The patch-like staining is not present in control cells lacking WIP; a very small percentage of these control cells show diffuse cytoplasmic staining, perhaps because of weakly cross-reacting cytoplasmic protein(s) (Fig. 7B, left). Therefore, it appears that WIP can serve as a polarity marker in yeast, suggesting that the sequence determinants which asymmetrically localize verprolin along the mother-daughter cell axis are conserved in WIP.


View larger version (15K):
[in this window]
[in a new window]
 
Fig. 7.   Colocalization of WIP and yeast actin. WIP immunofluorescence was performed in vrp1-1 cells grown on galactose and bearing WIP plasmid (A, left panels) or bearing vector alone (B, left panel). The right panels represent the same cells stained with rhodamine phalloidin. Colocalization between WIP and actin (indicated by arrows) can be seen in many but not all cortical patches. Bar, 3 µm.


    DISCUSSION
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

A Cytoskeletal Polarity Pathway Conserved from Yeast to Humans-- We show that the WASP-interacting protein WIP is likely the human homologue of yeast cell polarity protein verprolin. The defects in cytoskeletal polarity and endocytosis of vrp1 mutant are suppressed by WIP. Therefore, WIP participates in the polarity pathway in yeast and interacts with the yeast cytoskeletal machinery, presumably by providing a function conserved from yeast to humans. WIP is not the only human protein able to supply a cytoskeletal function in yeast. Two isoforms of human fimbrin, T- and L- fimbrins, when expressed from a GAL1 promoter, complement the sac6 null mutant and restore the polarization of the actin cytoskeleton (23). Analogously, the inducible CUP1, but not a constitutive promoter, has proven useful for studies of complementation of the hog1 null mutant by CSBP1 human mitogen-activated protein kinase (25). It appears that besides the conservation of actin across species (26), there is a remarkable degree of conservation between actin-binding proteins as well, supporting the hypothesis that the machinery responsible for polarized morphogenesis shares conserved elements among eukaryotes.

In addition to WIP, two other conserved proteins, CDC42Hs and WASP, emerge as strong candidates for acting in a hierarchical manner to convey polarity signals to the actin cytoskeleton. CDC42Hs human gene complements the yeast cdc42-1 and cdc42-4 mutants (27). Polarization of T cells toward antigen-presenting cells is dependent on CDC42Hs because T cells transfected with CDC42G12V (a mutant locked in the GTP-bound conformation) or CDC42D57Y (a mutant locked in the GDP-bound conformation) are unable to polarize their cytoskeletons toward the antigen (28). In yeast, Cdc42p is a major cell polarity establishment protein (29) required for actin nucleation (30). Thus both the yeast and human CDC42 proteins function in cell polarity.

A CDC42Hs effector, human WASP, has profound effects on actin polymerization (6). The yeast homologue of WASP, encoded by LAS17/BEE1, binds actin (30) and activates the actin assembly sites in the cortical cytoskeleton (31).

Like verprolin, WASP-interacting WIP may perform its function in cytoskeletal organization by localizing to specialized regions of the cell and recruiting additional proteins such as actin to initiate morphogenic changes. Thus, the CDC42Hs-WASP-WIP pathway possibly fulfills the critical function of generating and enforcing cytoskeletal polarity.

Other components in the pathway may exist and CDC42Hs, WASP, and WIP may also be involved in other pathways. CDC42Hs is also required for the induction of DNA synthesis upon mitogen activation of the c-Jun NH2-terminal kinase/stress-activated protein kinase (JNK/SAPK) mitogen-activated protein kinase cascade (32). WASP may act as a molecular switch, because it interacts with a multitude of proteins, including phospholipase C, Tec family members Btk, Itk, Tec, Grb, as well as p59fyn and Nck (33-35). WIP also interacts with Nck (21). Further work is required to fully delineate all pathways in which these proteins are involved.

Is Wiskott-Aldrich Syndrome a Cell Polarity Disease?-- The clinical features of WAS suggest that cytoskeletal polarity defects may be the cause for an altered immune response. Morphological and biochemical studies show that the cytoskeletons of lymphocytes affected by WAS are aberrant (36, 37) and unable to polarize toward polysaccharide antigen-presenting cells (38). Recognition of mitogenic stimuli requires cell polarization mediated by cytoskeletal rearrangements (28, 39). WAS lymphocytes are not able to respond to immobilized anti-CD3 antibodies (37) and have diminished response to chemoattractants and a profound decrease in polarization (40, 41). When monocytes are stimulated with chemoattractants, rapid rearrangements of F-actin toward the poles occur. In contrast, actin distribution is uniform in monocytes derived from WAS patients (40). Because both WIP (7) and WASP (6) are involved in the redistribution of F-actin and because CDC42Hs is involved in macrophage chemotaxis (42), these three interacting proteins may act in a hierarchical order to trigger cell polarity. That WIP is able to restore polarity to vrp1-1 cells supports this contention.

Ligand engagement of the CD3 T cell receptor promotes its endocytosis (43), a function dependent on the actin cytoskeleton. Restoration by WIP of the endocytosis defects of vrp1 cells may reflect its ability to perform an analogous function in human cells. Further work is necessary to understand the possible role of WASP and WIP in endocytosis and their relevance in WAS.

In conclusion, although different levels of complexity operate in yeast and humans, a model emerges in which the polarity pathway described here has been adapted by various cells to specifically serve their cytoskeletal functions. Further dissection of this pathway in both yeast and metazoans will increase the understanding of its function and its connections with other signaling pathways.

    ACKNOWLEDGEMENTS

We thank David Stanford, James Stanford, Srimonti Sarkar, and Ann Benko for comments on the manuscript and stimulating discussions.

    FOOTNOTES

* This work was supported by a Penn State Geisinger Cancer Center First Award (to G. V.), National Science Foundation Grants MCB-9506810 and MCB-9528216 (to A. K. H. and N. C. M.), and National Institutes of Health Grants AI-37130 and HL-59561 (to N. R. and R. S. G.).The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

parallel To whom correspondence should be addressed. Tel.: 717-531-6008; Fax: 717-531-7072; E-mail: ahopper{at}psu.edu.

    ABBREVIATIONS

The abbreviations used are: WAS, Wiskott-Aldrich syndrome; WASP, WAS protein.

    REFERENCES
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES
  1. Remold-O'Donnell, E., and Rosen, F. S. (1993) Immunodeficiencies, pp. 225-241, Harwood Academic Publishers Gmbh, Chur, Switzerland
  2. Nonoyama, S., and Ochs, H. D. (1998) Curr. Opin. Immunol. 10, 407-412[CrossRef][Medline] [Order article via Infotrieve]
  3. Ochs, H. D. (1998) Springer Semin. Immunopathol. 19, 435-458[CrossRef][Medline] [Order article via Infotrieve]
  4. Molina, I. J., Sancho, J., Terhorst, C., Rosen, F. S., and Remold-O'Donnell, E. (1993) J. Immunol. 151, 4383-4390[Abstract]
  5. Derry, J. M. J., Ochs, H. D., and Francke, U. (1994) Cell 78, 635-644[CrossRef][Medline] [Order article via Infotrieve]
  6. Symons, M., Derry, J. M., Karlak, B., Jiang, S., Lemahieu, V., Mccormick, F., Francke, U., and Abo, A. (1996) Cell 84, 723-734[CrossRef][Medline] [Order article via Infotrieve]
  7. Ramesh, N., Anton, I. M., Hartwig, J. H., and Geha, R. S. (1997) Proc. Natl. Acad. Sci. U. S. A. 94, 14671-14676[Abstract/Free Full Text]
  8. Vaduva, G., Martin, N. C., and Hopper, A. K. (1997) J. Cell Biol. 139, 1821-1833[Abstract/Free Full Text]
  9. Naqvi, S. N., Zahn, R., Mitchell, D. A., Stevenson, B. J., and Munn, A. L. (1998) Curr. Biol. 8, 959-962[CrossRef][Medline] [Order article via Infotrieve]
  10. Adams, A. E., and Pringle, J. R. (1984) J. Cell Biol. 98, 934-945[Abstract/Free Full Text]
  11. Zoladek, T., Vaduva, G., Hunter, L. A., Boguta, M., Go, B. D., Martin, N. C., and Hopper, A. K. (1995) Mol. Cell. Biol. 15, 6884-6894[Abstract]
  12. Donnelly, S. F., Pocklington, M. J., Pallotta, D., and Orr, E (1993) Mol. Microbiol. 10, 585-596[CrossRef][Medline] [Order article via Infotrieve]
  13. Munn, A. L., Stevenson, B. J., Geli, M. I., and Riezman, H. (1995) Mol. Biol. Cell 6, 1721-1742[Abstract]
  14. Sherman, F. (1991) Methods Enzymol. 194, 3-21[CrossRef][Medline] [Order article via Infotrieve]
  15. Chen, D.-C, Yang, B.-C., and Kuo, T.-T (1992) Curr. Genet. 21, 83-84[CrossRef][Medline] [Order article via Infotrieve]
  16. Sambrook, J., Fritsch, E. F., and Maniatis, T (1989) Molecular Cloning: A Laboratory Manual, 2nd Ed., Cold Spring Harbor Laboratory, Cold Spring Harbor, NY
  17. Adams, A., Gottschling, D. E., Kaiser, C. A., and Stearns, T. (1997) Methods in Yeast Genetics, p. 109, Cold Spring Harbor Laboratory, Cold Spring Harbor, NY
  18. Baldari, C., and Cesarini, G (1985) Gene 35, 27-32[CrossRef][Medline] [Order article via Infotrieve]
  19. Pringle, J. R., Adams, A. E. M., Drubin, D. G., and Haarer, B. K. (1991) Methods Enzymol. 194, 565-602[Medline] [Order article via Infotrieve]
  20. Tolerico, H. L., Benko, A. L., Aris, J. P., Stanford, D. R., Martin, N. C., and Hopper, A. K. (1999) Genetics 151, 57-75[Abstract/Free Full Text]
  21. Anton, I. M., Lu, W., Mayer, B. J., Ramesh, N., and Geha, R. S. (1998) J. Biol. Chem. 273, 20992-20995[Abstract/Free Full Text]
  22. Anderson, B. L., Boldogh, I., Evangelista, M., Boone, C., Greene, L. A., and Pon, L. A. (1998) J. Cell Biol. 141, 1357-1370[Abstract/Free Full Text]
  23. Adams, A. E., Shen, W., Lin, C. S., Leavitt, J., and Matsudaira, P. (1995) Mol. Cell. Biol. 15, 69-75[Abstract]
  24. Gertler, F. B., Niebuhr, K., Reinhard, M., Wehland, J., and Soriano, P. (1996) Cell 87, 227-239[CrossRef][Medline] [Order article via Infotrieve]
  25. Kumar, S., McLaughlin, M. M., McDonnell, P. C., Lee, J. C., Livi, G. P., and Young, P. R. (1995) J. Biol. Chem. 270, 29043-29046[Abstract/Free Full Text]
  26. Ng, R., and Abelson, J. (1980) Proc. Natl. Acad. Sci. U. S. A. 77, 3912-3916[Abstract/Free Full Text]
  27. Munemitsu, S., Innis, M. A., Clark, R., McCormick, F., Ullrich, A., and Polakis, P. (1990) Mol. Cell. Biol. 10, 5977-5982[Abstract/Free Full Text]
  28. Stowers, L., Yelon, D., Berg, L. J., and Chant, J. (1995) Proc. Natl. Acad. Sci. U. S. A. 92, 5027-5031[Abstract/Free Full Text]
  29. Adams, A. E., Johnson, D. I., Longnecker, R. M., Sloat, B. F., and Pringle, J. R. (1990) J. Cell Biol. 111, 131-142[Abstract/Free Full Text]
  30. Li, R. (1997) J. Cell Biol. 136, 649-658[Abstract/Free Full Text]
  31. Lechler, T., and Li, R. (1997) J. Cell Biol. 138, 95-103[Abstract/Free Full Text]
  32. Lamarche, N., Tapon, N., Stowers, L., Burbelo, P. D., Aspenstrom, P., Bridges, T., Chant, J., and Hall, A. (1996) Cell 87, 519-529[CrossRef][Medline] [Order article via Infotrieve]
  33. Rivero-Lezcano, O. M., Marcilla, A., Sameshima, J. H., and Robbins, K. C. (1995) Mol. Cell. Biol. 15, 5725-5731[Abstract]
  34. Banin, S., Truong, O., Katz, D. R., Waterfield, M. D., Brickell, P. M., and Gout, I. (1996) Curr. Biol. 6, 981-988[CrossRef][Medline] [Order article via Infotrieve]
  35. Featherstone, C. (1997) Science 275, 27-28[Free Full Text]
  36. Kenney, D., Cairns, L., Remold-O'Donnell, E., Peterson, J., Rosen, F. S., and Parkman, R. (1986) Blood 68, 1329-1332[Abstract/Free Full Text]
  37. Gallego, M. D., Santamaria, M., Pena, J., and Molina, I. J. (1997) Blood 90, 3089-3097[Abstract/Free Full Text]
  38. Ochs, H. D., Slichter, S. J., Harker, L. A., Von Behrens, W. E., Clark, R. A., and Wedgwood, R. J. (1980) Blood 55, 243-252[Free Full Text]
  39. Phatak, P. D., and Packman, C. H. (1994) J. Cell. Physiol. 159, 365-370[CrossRef][Medline] [Order article via Infotrieve]
  40. Badolato, R., Sozzani, S., Malacarne, F., Bresciani, S., Fiorini, M., Borsatti, A., Albertini, A., Mantovani, A., Ugazio, A. G., and Notarangelo, L. D. (1998) J. Immunol. 161, 1026-1033[Abstract/Free Full Text]
  41. Zicha, D., Allen, W. E., Brickell, P. M., Kinnon, C., Dunn, G. A., Jones, G. E., and Thrasher, A. J. (1998) Br. J. Haematol. 101, 659-665[CrossRef][Medline] [Order article via Infotrieve]
  42. Allen, W. E., Zicha, D., Ridley, A. J., and Jones, G. E (1998) J. Cell Biol. 141, 1147-1157[Abstract/Free Full Text]
  43. Luton, F., Legendre, V., Gorvel, J. P., Schmitt-Verhulst, A. M., and Boyer, C. (1997) J. Immunol. 158, 3140-3147[Abstract]


Copyright © 1999 by The American Society for Biochemistry and Molecular Biology, Inc.
Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
J. Biol. Chem.Home page
S. Isgandarova, L. Jones, D. Forsberg, A. Loncar, J. Dawson, K. Tedrick, and G. Eitzen
Stimulation of Actin Polymerization by Vacuoles via Cdc42p-dependent Signaling
J. Biol. Chem., October 19, 2007; 282(42): 30466 - 30475.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
S. Tsuboi
A Complex of Wiskott-Aldrich Syndrome Protein with Mammalian Verprolins Plays an Important Role in Monocyte Chemotaxis.
J. Immunol., June 1, 2006; 176(11): 6576 - 6585.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
K. L. Butterfield-Gerson, L. Z. Scheifele, E. P. Ryan, A. K. Hopper, and L. J. Parent
Importin-{beta} Family Members Mediate Alpharetrovirus Gag Nuclear Entry via Interactions with Matrix and Nucleocapsid
J. Virol., February 15, 2006; 80(4): 1798 - 1806.
[Abstract] [Full Text] [PDF]


Home page
Mol. Biol. CellHome page
P. K. Mattila, O. Quintero-Monzon, J. Kugler, J. B. Moseley, S. C. Almo, P. Lappalainen, and B. L. Goode
A High-affinity Interaction with ADP-Actin Monomers Underlies the Mechanism and In Vivo Function of Srv2/cyclase-associated Protein
Mol. Biol. Cell, November 1, 2004; 15(11): 5158 - 5171.
[Abstract] [Full Text] [PDF]


Home page
JCBHome page
G. Eitzen, L. Wang, N. Thorngren, and W. Wickner
Remodeling of organelle-bound actin is required for yeast vacuole fusion
J. Cell Biol., August 28, 2002; 158(4): 669 - 679.
[Abstract] [Full Text] [PDF]


Home page
J. Cell Sci.Home page
D. J. Seastone, E. Harris, L. A. Temesvari, J. E. Bear, C. L. Saxe, and J. Cardelli
The WASp-like protein Scar regulates macropinocytosis, phagocytosis and endosomal membrane flow in Dictyostelium
J. Cell Sci., March 9, 2002; 114(14): 2673 - 2683.
[Abstract] [Full Text] [PDF]


Home page
GeneticsHome page
J. Mochida, T. Yamamoto, K. Fujimura-Kamada, and K. Tanaka
The Novel Adaptor Protein, Mti1p, and Vrp1p, a Homolog of Wiskott-Aldrich Syndrome Protein-Interacting Protein (WIP), May Antagonistically Regulate Type I Myosins in Saccharomyces cerevisiae
Genetics, March 1, 2002; 160(3): 923 - 934.
[Abstract] [Full Text] [PDF]


Home page
Microbiol. Mol. Biol. Rev.Home page
M. B. Goldberg
Actin-Based Motility of Intracellular Microbial Pathogens
Microbiol. Mol. Biol. Rev., December 1, 2001; 65(4): 595 - 626.
[Abstract] [Full Text] [PDF]


Home page
JCBHome page
G. Jung, K. Remmert, X. Wu, J. M. Volosky, and J. A. H. III
The Dictyostelium CARMIL Protein Links Capping Protein and the Arp2/3 Complex to Type I Myosins through Their SH3 Domains
J. Cell Biol., June 25, 2001; 153(7): 1479 - 1498.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
H. Yamaguchi, H. Miki, S. Suetsugu, L. Ma, M. W. Kirschner, and T. Takenawa
Two tandem verprolin homology domains are necessary for a strong activation of Arp2/3 complex-induced actin polymerization and induction of microspike formation by N-WASP
PNAS, October 26, 2000; (2000) 190351397.
[Abstract] [Full Text]


Home page
JCBHome page
M. Evangelista, B. M. Klebl, A. H.Y. Tong, B. A. Webb, T. Leeuw, E. Leberer, M. Whiteway, D. Y. Thomas, and C. Boone
A Role for Myosin-I in Actin Assembly through Interactions with Vrp1p, Bee1p, and the Arp2/3 Complex
J. Cell Biol., January 24, 2000; 148(2): 353 - 362.
[Abstract] [Full Text] [PDF]


Home page
J. Cell Sci.Home page
D Pruyne and A Bretscher
Polarization of cell growth in yeast
J. Cell Sci., January 2, 2000; 113(4): 571 - 585.
[Abstract] [PDF]


Home page
J. Biol. Chem.Home page
M.-F. Carlier, P. Nioche, I. Broutin-L'Hermite, R. Boujemaa, C. Le Clainche, C. Egile, C. Garbay, A. Ducruix, P. Sansonetti, and D. Pantaloni
GRB2 Links Signaling to Actin Assembly by Enhancing Interaction of Neural Wiskott-Aldrich Syndrome Protein (N-WASp) with Actin-related Protein (ARP2/3) Complex
J. Biol. Chem., July 14, 2000; 275(29): 21946 - 21952.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
H. Yamaguchi, H. Miki, S. Suetsugu, L. Ma, M. W. Kirschner, and T. Takenawa
Two tandem verprolin homology domains are necessary for a strong activation of Arp2/3 complex-induced actin polymerization and induction of microspike formation by N-WASP
PNAS, November 7, 2000; 97(23): 12631 - 12636.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Vaduva, G.
Right arrow Articles by Ramesh, N.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Vaduva, G.
Right arrow Articles by Ramesh, N.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 All ASBMB Journals   Molecular and Cellular Proteomics 
 Journal of Lipid Research   ASBMB Today 
Copyright © 1999 by the American Society for Biochemistry and Molecular Biology.
Advertisement
spacer
Advertisement
Advertisement