|
J Biol Chem, Vol. 274, Issue 24, 17103-17108, June 11, 1999
The Human WASP-interacting Protein, WIP, Activates the Cell
Polarity Pathway in Yeast*
Gabriela
Vaduva ,
Narcisa
Martinez-Quiles§,
Ines M.
Anton§,
Nancy C.
Martin¶,
Raif S.
Geha§,
Anita K.
Hopper , and
Narayanaswamy
Ramesh§
From the Department of Biochemistry and Molecular
Biology, Pennsylvania State University College of Medicine, Hershey,
Pennsylvania 17033, § Division of Immunology, Children's
Hospital, Department of Pediatrics, Harvard Medical School, Boston,
Massachusetts 02115, and ¶ Department of Biochemistry, University
Louisville Medical School, Louisville, Kentucky 40292
 |
ABSTRACT |
WIP, the Wiskott-Aldrich syndrome
protein-interacting protein, is a human protein
involved in actin polymerization and redistribution in lymphoid cells.
The mechanism by which WIP reorganizes actin cytoskeleton is unknown.
WIP is similar to yeast verprolin, an actin- and myosin-interacting
protein required for polarized morphogenesis. To determine whether WIP
and verprolin are functional homologues, we analyzed the function of
WIP in yeast. WIP suppresses the growth defects of VRP1
missense and null mutations as well as the defects in cytoskeletal
organization and endocytosis observed in vrp1-1 cells. The
ability of WIP to replace verprolin is dependent on its WH2 actin
binding domain and a putative profilin binding domain. Immunofluorescence localization of WIP in yeast cells reveals a pattern
consistent with its function at the cortical sites of growth. Thus,
like verprolin, WIP functions in yeast to link the polarity development
pathway and the actin cytoskeleton to generate cytoskeletal asymmetry.
A role for WIP in cell polarity provides a framework for unifying,
under a common paradigm, distinct molecular defects associated with
immunodeficiencies like Wiskott-Aldrich syndrome.
 |
INTRODUCTION |
Wiskott-Aldrich syndrome
(WAS)1 is an inherited immune
deficiency characterized by eczema, bleeding, and recurrent infections. A deficiency in both cellular and humoral immunity is common among all
WAS patients (1-3). Lymphocytes and platelets from WAS patients show
cytoskeletal abnormalities, and T lymphocytes of WAS patients show
diminished proliferative response to stimulation through the T cell
receptor-CD3 complex (4).
Molecular analyses of the WAS gene (5) have provided insights into the
roles of Wiskott-Aldrich syndrome protein (WASP) in the actin
cytoskeleton function and in cell proliferation. WASP binds via its
GTPase binding domain to CDC42Hs and weakly to Rac but not to Rho (6).
Overexpression of WASP induces formation of actin-containing clusters,
indicating a role for WASP in actin polymerization (6). These findings
suggest that WASP may provide a connection between CDC42Hs, Rac, and
the actin cytoskeleton. One possible link between the actin
cytoskeleton and WASP is the recently identified WASP-interacting
protein WIP (7). Transfection of WIP into BJAB cells induced
actin-containing cerebriform projections beneath the cell membrane,
suggesting that WIP may be involved in regulating the dynamics of the
actin cytoskeleton.
WIP has sequence similarity to Saccharomyces cerevisiae
verprolin, encoded by the VRP1 gene (8). Verprolin interacts
directly with the yeast WASP, Las17p (9). This prompted us to determine whether WIP and verprolin are functional homologues. If the human protein is a homologue of the yeast protein, then the genetic and cell
biology data available for verprolin should prove useful for learning
more about the function of WIP in human cells.
In wild-type yeast cells, the actin cytoskeleton is polarized along the
mother-daughter axis (10). When the function of verprolin is impaired
(in vrp1-1) or absent (in vrp1 null), the asymmetry of actin cytoskeleton along the mother-bud axis is lost, actin cables are faint or absent, and cytoskeleton-associated functions
like endocytosis are compromised (8, 11-13). In addition, vrp1-1 or vrp1 null cells cannot grow at
37 °C (11). WIP suppresses the growth defects of VRP1
missense and null mutations as well as the cytoskeletal and endocytosis
defects of vrp1-1 cells. Mutations in conserved domains of
WIP impair its ability to suppress vrp1 mutations.
Furthermore, WIP has a polarized intracellular localization that often
coincides to that of actin. The data support the hypothesis that WIP
and verprolin are functional homologues and provide new ways to
understand the molecular defects associated with the Wiskott-Aldrich syndrome.
 |
MATERIALS AND METHODS |
Strains and General Techniques--
Yeast media was prepared
using standard methods (14). Yeast cells were transformed by the one
step method (15). Yeast strains used were TZ33 (MAT SUP11
ade2-1 mod5-1 ura3-1 lys2-1 leu2-3, 112 his4-519 vrp1-1)
and T65-1D (MAT ade1 ura3-52 leu2-3, 112 ile MEL1
vrp1::LEU2) (11). Standard recombinant DNA techniques (16) and DH5 and RR1 bacterial strains were
used. Restriction endonucleases and modifying enzymes were obtained
from New England Biolabs (Beverly, MA) or from Promega (Madison, WI).
Location of the vrp1-1 Mutation--
Genomic DNA from TZ33 was
prepared (17), and the vrp1-1 gene was polymerase chain
reaction-amplified using the following primers:
5'-caatgttcggtttgtccgctacattgctg and 5'-gcctcaatattctgcagctgtggactggc. The polymerase chain reaction products from several independent reactions were cloned into pGEM-T vector and subjected to automated sequencing.
Plasmid Constructions--
WIP cDNA or WIP 2 (amino-terminal
116-amino acid truncation of WIP, (7)) cloned in pUC18 were digested
with EcoRI, filled in, and redigested with PstI,
and the insert was then ligated to
SmaI-PstI-digested pEMBLyex4, a pEMBLy (18)-based
vector (the vector was a kind gift of Dr. E. Orr, University of
Leicester, UK). An artificial initiation codon (ATG) was
introduced in WIP2 as follows: 5' region of WIP was amplified using the
oligonucleotide pair:
5'-tagagctccatggactacaaggacgacgatgacaagagggataatgattctggaggaagccga and
5'-ctgtctactccactcctgga. WIP2 in pEMBLyex4 was digested with SacI, and the 370-base pair fragment was exchanged with
SacI-digested polymerase chain reaction product. WIP-Lys
mutant has lysines 47 and 48 changed to alanines. In the WIP-Pro
construct, three proline residues within the consensus profilin binding
motif 427APPPPPP433, prolines 429, 431, and
433, were mutated to alanines. Both WIP-Lys and WIP-Pro were
constructed by mutagenesis using a site-directed mutagenesis kit
(Quickchange, Stratagene) and appropriate oligonucleotides as given
below (the mutated bases designated by uppercase). For WIP-Lys the
oligo was 5'-gggaagaaactaGCgGCgacggtcaccaatgac, and for WIP-Pro the
oligo was 5'-ggggcacctGccccaGctccaGcatcaacatctattattagaaatggc. The region containing the WIP-Lys mutation was excised by
EcoRI-BstEII digestion and ligated to WIP
cDNA digested with EcoRI-BstEII to generate
WIP-Lys. The WIP-Lys,Pro double mutant was constructed by exchanging a
SfiI-BamHI fragment of WIP containing the WIP-Pro mutation with the corresponding fragment of the WIP-Lys mutant. All
constructs were verified by DNA sequence analysis.
Western Analysis--
Anti-Nsp1 antibody was used at 1:20,000
dilution as described (20). Expression of WIP was analyzed with the
1:1,200-diluted anti-WIP antiserum (21) used for the immunofluorescence
studies mentioned below.
Immunofluorescence of WIP and phalloidin co-staining of actin in
the same cells was carried out in solution as described (8). Briefly,
yeast cells were grown on media containing galactose to early
logarithmic phase, fixed, digested, (19) and incubated for 1 h
with rabbit antiWIP antiserum (21) diluted 1:20. Cells were then
washed, incubated for 1 h with anti-rabbit
fluorescein-conjugated secondary antibody (1:500), and, after a
second round of washes, stained with rhodamine phalloidin (8).
Lucifer yellow endocytosis and Oregon green phalloidin staining were
performed as described (8).
Microscopic Imaging and Analysis--
A Nikon Microphot-FX
equipped with a B-1E filter cube, a 420-490 excitation filter, and a
515F barrier filter was used. Images were acquired and digitized with a
Sensys (Photometrics Ltd., Tucson, AZ) CCD camera, and image processing
was done using QED software running on a 6500/225 Power Macintosh.
Files were processed using Adobe Photoshop 5.
 |
RESULTS |
WIP and Yeast Verprolin Share Sequence Similarity--
Although
verprolin is 314-amino acids longer, WIP and verprolin share
significant sequence similarity throughout their length, and, more
importantly, among defined domains involved in actin, profilin, or WASP
interaction (Fig. 1). The WH2
(WASP homology 2) domain of WIP is 44%
identical to the actin-interacting WH2 domain of verprolin (Fig. 1).
The next highest segment of sequence similarity between WIP and
verprolin (43% identity) spans the first 116 amino acids of WIP (Fig.
1).

View larger version (75K):
[in this window]
[in a new window]
|
Fig. 1.
Sequence and domain comparison between
verprolin and WIP. The WH2 domain of both proteins is
underlined with the stippled blue bar. The
amino-terminal 116 amino acids of WIP missing in WIP2 are
boxed in blue. Two conserved lysines
(47KK48) mutated in WIP-Lys are marked by
asterisks. The two potential profilin binding APPPPP motifs
are underlined with black bars. The
425Leu Pro mutation in vrp1-1 allele is
marked with a red asterisk. The carboxyl-terminal
WASP-interacting domain of WIP and the homologous region in verprolin
are boxed in green. For sequence comparison,
identical or conserved residues are marked by uppercase red
letters.
|
|
The middle portions of WIP and verprolin contain 10 and 11, respectively, potential SH3 binding domains. In WIP, amino acids 321-415 of this region interact with Nck (21). In verprolin, multiple
sites in the SH3 binding domains region interact with the SH3 domain of
Myo5p (22).
At the carboxyl terminus, WIP contains a 72-amino acid-long
WASP-interacting domain (21) (Fig. 1). The carboxyl-terminal 337 amino
acids of verprolin, containing a conserved version of the WASP-binding
domain of WIP, binds to yeast WASP, Las17p (9). Although verprolin
interacts with Las17p (9), verprolin failed to bind human WASP by
two-hybrid analysis (data not shown), suggesting that the conservation
of the WASP binding region alone may not be sufficient for human
WASP-Vrp1p interaction.
WIP also interacts with profilin (7) and contains two putative profilin
binding sequences between amino acids 8-13 and 427-433. The latter is
conserved in verprolin, but interaction between verprolin and profilin
was not detected by two-hybrid analysis (8).
WIP Is Likely the Human Homologue of Verprolin--
Sequence
conservation predicts WIP might be a functional homologue of verprolin.
vrp1::LEU2 is a null allele (11), and the vrp1-1 allele contains a Leu Pro mutation at amino acid
425, which is part of a proline-rich region homologous to the Nck
binding domain (21) of WIP (Fig. 1). Both mutations result in cells unable to grow at 37 °C. WIP cloned in the pEMBLyex4 vector was transfected in vrp1-1 and vrp1 null cells, and
its effect on the temperature-sensitive growth defects of these cells
was determined. Genes cloned in pEMBLyex4 are expressed from a
CYC1 promoter preceded by GAL1-10
upstream-activating sequences, resulting in galactose-inducible gene
expression. Cells were grown on glucose-selective media, transferred to
media containing either glycerol or galactose, and incubated at various
temperatures. As expected, induction by galactose leads to elevated
expression of WIP (Fig.
2A).

View larger version (32K):
[in this window]
[in a new window]
|
Fig. 2.
A, Western blot analysis of wild-type
and mutant WIP. Approximately 20 µg of total protein extract were
loaded in each lane and probed with anti-WIP rabbit
antiserum. The blot was reprobed with anti-Nsp1p monoclonal antibody to
confirm equal loading in each lane. B, diagram of WIP
mutants. Construct names are listed to the left of each construct. The
size of each construct is indicated by numbers.
Letters above each construct represent the amino acid
replacements. CTR, control, vector alone.
|
|
vrp1-1 or vrp1 null cells producing WIP are
unable to grow at 37 °C on media containing glycerol as the carbon
source. These same cells grow on media containing galactose at 37 °C
(Table I; Fig.
3, compare A with
C). Under the same conditions, vrp1-1 or
vrp1 null cells with vector alone fail to grow (Fig.
3C). Thus, as with other human cytoskeletal proteins, high
levels of protein are necessary for the complementation (23). The
suppression by WIP of the growth defects of vrp1 cells,
together with the sequence similarity and domain conservation between
the two proteins, indicate that WIP is likely the human homologue of
verprolin.
View this table:
[in this window]
[in a new window]
|
Table I
Growth of vrp1-1 and vrp1 null (vrp ) strains bearing WIP plasmids
on glycerol (Gly)- and galactose (Gal)-containing media at 23 and
37 °C
GT, generation time in hours at 23 °C on galactose-containing media.
|
|

View larger version (54K):
[in this window]
[in a new window]
|
Fig. 3.
WIP, but not amino-terminal-truncated WIP2,
complements the temperature sensitivity of vrp1-1
(strain TZ33) and vrp1 null (strain T65-1D)
cells. Cells were grown on glucose-containing media then
replica-plated on galactose-containing media and incubated for 3 days
at 23 °C (A), 34 °C (B), and 37 °C
(C). The right half of the plate is
strain T65-1D. The left half of the plate is
strain TZ33. Genes on plasmids are as follows: 1, vector;
2, VRP1; 3, WIP; 4, WIP2;
5, WIP2; 6, WIP; 7, VRP1;
8, vector.
|
|
WIP Restores Actin Cytoskeleton Polarization and Endocytosis in
vrp1-1 Yeast Cells--
In a population of vrp1-1 cells,
only about 20% of small- and medium-budded cells have polarized
cytoskeletons (Fig. 4A). In
wild- type cells, under similar conditions, about 80% of cells are
polarized (Fig. 4B). WIP expression in vrp1-1
cell increases the proportion of polarized cells to 65% (Fig.
4C). Thus, like verprolin, WIP functionally participates in
the mechanism(s) that regulates the polarized distribution of actin
patches between the mother and the bud.

View larger version (30K):
[in this window]
[in a new window]
|
Fig. 4.
WIP restores the polarized morphology of
actin cytoskeleton in vrp1-1 cells (strain
TZ33). Logarithmic cultures of TZ33 transformed with vector alone
(A), VRP1 (B), WIP (C), or
WIP2 (D) were grown on galactose-containing media at
23 °C, fixed, and then stained with Oregon green phalloidin.
Approximately 200 small- and medium-budded cells were scored to
quantify cytoskeletal polarization for each strain. Bar, 4 µm.
|
|
Defects in fluid-phase endocytosis can be detected in yeast by
monitoring the uptake of a fluorescent marker such as lucifer yellow
into the vacuole, the equivalent of mammalian lysosomes. Although
vrp1-1 cells bearing VRP1 on a plasmid
internalize lucifer yellow (Fig.
5B), vrp1-1 cells
transformed with vector alone are unable to internalize the dye (Fig.
5A). Expression of WIP in vrp1-1 leads to
partial suppression of the defect in endocytosis (Fig.
5C).

View larger version (93K):
[in this window]
[in a new window]
|
Fig. 5.
WIP restores endocytosis in
vrp1-1 cells (strain TZ33). Logarithmic cultures
were grown on galactose-containing media at 23 °C, incubated with
lucifer yellow for 30 min, washed, and visualized. A,
vector; B, VRP1 on a centromeric plasmid;
C, WIP; D, WIP2. In E, F,
G, and H, the differential interference contrast
(DIC) images corresponding to A, B, C,
and D, respectively, are shown. Bar, 4 µm.
|
|
The WH2 and the Putative Profilin Binding Domains Are Critical for
WIP Function--
To analyze the requirement for the WH2 domain in WIP
function, we generated a truncated version of WIP, WIP2, lacking the first 116 amino acids (Fig. 2B). WIP2 was cloned in
pEMBLyex4 downstream of a translation initiation codon and tested for
its ability to rescue the temperature sensitivity of vrp1
cells. WIP2 is unable to restore endocytosis (Fig. 5D) nor
to complement the temperature-sensitive growth defect of either
vrp1-1 or the vrp1 null cells on galactose at
37 °C (Fig. 3, compare A with C). However, because Western analysis revealed poor WIP2 expression in yeast (Fig. 2A), no conclusions can be inferred from this lack of complementation.
To address the role of the WH2 domain for WIP function in another way,
we generated point mutations in this domain. The sequence KLKK has been
shown to be critical for actin binding among several proteins (24).
Mutation of 45KK46 abolishes the interaction of
the WH2 domain of verprolin with actin (8). A mutant WIP, WIP-Lys, was
generated that has the two homologous lysines,
47KK48, replaced by alanines. WIP-Lys is
expressed at levels comparable with wild-type WIP (Fig. 2A)
but is unable to complement the null mutation (Fig.
6D) and poorly suppresses the
vrp1-1 mutation (Fig. 6B). Even at the
permissive temperature the generation time of vrp1-1 cells
producing WIP-Lys is about 4 times longer than that of
vrp1-1 cells producing WIP (Table I). Therefore, lysines 47 and 48 are important for the biological function of WIP.

View larger version (64K):
[in this window]
[in a new window]
|
Fig. 6.
Mutations in WH2 or the putative profilin
binding domain of WIP impairs its ability to complement the temperature
sensitivity of vrp1-1 cells (A and
B) or vrp1 null strain (C
and D). Cells were grown on
glucose-containing media and then replica plated on
galactose-containing media and incubated for 3 days at 23 °C
(A and C) or 37 °C (B and
D).
|
|
WIP interacts with profilin (7) and has two putative APPPPP profilin
binding motifs, homologous to those found in profilin-interacting proteins Mena and VASP (24). The second APPPPP motif of WIP is
conserved in verprolin (Fig. 1). To test the role of this motif for WIP
function, we generated the WIP-Pro mutant (Fig. 2B) in which
three proline residues are mutated to alanine, i.e.
427APPPPPP433 to APAPAPA. The expression of
WIP-Pro is comparable with that of wild-type WIP (Fig. 2A).
The generation time of vrp1-1 cells producing WIP-Pro is
3-fold longer than that of WIP producing vrp1-1 cells
(Table I); the growth of vrp1 null cells producing WIP-Pro,
although not abolished as for WIP-Lys, is much reduced on galactose at
37 °C in comparison with the same cells producing WIP (Fig.
6D). Furthermore, a double mutant, WIP-Lys,Pro, containing both 47KK AA48 and 427APPPPPP
APAPAPA433 mutations (Fig. 2B), leads to a
further increase in generation time as compared with each mutant alone
(Table I). Therefore, the two conserved lysines,
47KK48, and the APPPPPP motif contribute to the
full activity of WIP in vivo.
Localization of WIP in Yeast--
If WIP performs a conserved
function in cell polarity, it should serve as a polarity marker at
sites of active cell growth, as does verprolin (8). To test this
hypothesis, we determined the intracellular localization of WIP in
yeast cells by immunofluorescence using anti-WIP antibody (21). Like
verprolin, WIP localizes at regions of active growth in yeast cells in
a cell cycle-dependent manner. Although there is WIP
staining throughout the cytosol, there are high local concentrations in
a punctuated pattern at the site of bud emergence, the tip of the bud,
or throughout most of the bud (Fig.
7A, left). The WIP
patches often colocalize (Fig. 7A, left,
arrows) with actin patches (Fig. 7A,
right). The patch-like staining is not present in control
cells lacking WIP; a very small percentage of these control cells show
diffuse cytoplasmic staining, perhaps because of weakly cross-reacting
cytoplasmic protein(s) (Fig. 7B, left).
Therefore, it appears that WIP can serve as a polarity marker in yeast,
suggesting that the sequence determinants which asymmetrically localize
verprolin along the mother-daughter cell axis are conserved in WIP.

View larger version (15K):
[in this window]
[in a new window]
|
Fig. 7.
Colocalization of WIP and yeast actin.
WIP immunofluorescence was performed in vrp1-1 cells grown
on galactose and bearing WIP plasmid (A, left
panels) or bearing vector alone (B, left
panel). The right panels represent the same cells
stained with rhodamine phalloidin. Colocalization between WIP and actin
(indicated by arrows) can be seen in many but not all
cortical patches. Bar, 3 µm.
|
|
 |
DISCUSSION |
A Cytoskeletal Polarity Pathway Conserved from Yeast to
Humans--
We show that the WASP-interacting protein WIP is likely
the human homologue of yeast cell polarity protein verprolin. The defects in cytoskeletal polarity and endocytosis of vrp1
mutant are suppressed by WIP. Therefore, WIP participates in the
polarity pathway in yeast and interacts with the yeast cytoskeletal
machinery, presumably by providing a function conserved from yeast to
humans. WIP is not the only human protein able to supply a cytoskeletal function in yeast. Two isoforms of human fimbrin, T- and L- fimbrins, when expressed from a GAL1 promoter, complement the
sac6 null mutant and restore the polarization of the actin
cytoskeleton (23). Analogously, the inducible CUP1, but not
a constitutive promoter, has proven useful for studies of
complementation of the hog1 null mutant by CSBP1 human
mitogen-activated protein kinase (25). It appears that besides the
conservation of actin across species (26), there is a remarkable degree
of conservation between actin-binding proteins as well, supporting the
hypothesis that the machinery responsible for polarized morphogenesis
shares conserved elements among eukaryotes.
In addition to WIP, two other conserved proteins, CDC42Hs and WASP,
emerge as strong candidates for acting in a hierarchical manner to
convey polarity signals to the actin cytoskeleton. CDC42Hs human gene
complements the yeast cdc42-1 and cdc42-4
mutants (27). Polarization of T cells toward antigen-presenting cells
is dependent on CDC42Hs because T cells transfected with
CDC42G12V (a mutant locked in the GTP-bound conformation)
or CDC42D57Y (a mutant locked in the GDP-bound
conformation) are unable to polarize their cytoskeletons toward the
antigen (28). In yeast, Cdc42p is a major cell polarity establishment
protein (29) required for actin nucleation (30). Thus both the yeast
and human CDC42 proteins function in cell polarity.
A CDC42Hs effector, human WASP, has profound effects on actin
polymerization (6). The yeast homologue of WASP, encoded by
LAS17/BEE1, binds actin (30) and activates the actin
assembly sites in the cortical cytoskeleton (31).
Like verprolin, WASP-interacting WIP may perform its function in
cytoskeletal organization by localizing to specialized regions of the
cell and recruiting additional proteins such as actin to initiate
morphogenic changes. Thus, the CDC42Hs-WASP-WIP pathway possibly
fulfills the critical function of generating and enforcing cytoskeletal polarity.
Other components in the pathway may exist and CDC42Hs, WASP, and WIP
may also be involved in other pathways. CDC42Hs is also required for
the induction of DNA synthesis upon mitogen activation of the c-Jun
NH2-terminal kinase/stress-activated protein kinase (JNK/SAPK) mitogen-activated protein kinase cascade (32). WASP may act
as a molecular switch, because it interacts with a multitude of
proteins, including phospholipase C, Tec family members Btk, Itk, Tec,
Grb, as well as p59fyn and Nck (33-35). WIP also
interacts with Nck (21). Further work is required to fully delineate
all pathways in which these proteins are involved.
Is Wiskott-Aldrich Syndrome a Cell Polarity Disease?--
The
clinical features of WAS suggest that cytoskeletal polarity defects may
be the cause for an altered immune response. Morphological and
biochemical studies show that the cytoskeletons of lymphocytes affected
by WAS are aberrant (36, 37) and unable to polarize toward
polysaccharide antigen-presenting cells (38). Recognition of mitogenic
stimuli requires cell polarization mediated by cytoskeletal rearrangements (28, 39). WAS lymphocytes are not able to respond to
immobilized anti-CD3 antibodies (37) and have diminished response to
chemoattractants and a profound decrease in polarization (40, 41). When
monocytes are stimulated with chemoattractants, rapid rearrangements of
F-actin toward the poles occur. In contrast, actin distribution is
uniform in monocytes derived from WAS patients (40). Because both WIP
(7) and WASP (6) are involved in the redistribution of F-actin and
because CDC42Hs is involved in macrophage chemotaxis (42), these three
interacting proteins may act in a hierarchical order to trigger cell
polarity. That WIP is able to restore polarity to vrp1-1
cells supports this contention.
Ligand engagement of the CD3 T cell receptor promotes its endocytosis
(43), a function dependent on the actin cytoskeleton. Restoration by
WIP of the endocytosis defects of vrp1 cells may reflect its
ability to perform an analogous function in human cells. Further work
is necessary to understand the possible role of WASP and WIP in
endocytosis and their relevance in WAS.
In conclusion, although different levels of complexity operate in yeast
and humans, a model emerges in which the polarity pathway described
here has been adapted by various cells to specifically serve their
cytoskeletal functions. Further dissection of this pathway in both
yeast and metazoans will increase the understanding of its function and
its connections with other signaling pathways.
 |
ACKNOWLEDGEMENTS |
We thank David Stanford, James Stanford,
Srimonti Sarkar, and Ann Benko for comments on the manuscript and
stimulating discussions.
 |
FOOTNOTES |
*
This work was supported by a Penn State Geisinger Cancer
Center First Award (to G. V.), National Science Foundation Grants MCB-9506810 and MCB-9528216 (to A. K. H. and N. C. M.), and
National Institutes of Health Grants AI-37130 and HL-59561 (to N. R.
and R. S. G.).The costs of publication of this
article were defrayed in part by the
payment of page charges. The article
must therefore be hereby marked
"advertisement" in
accordance with 18 U.S.C. Section
1734 solely to indicate this fact.
To whom correspondence should be addressed. Tel.:
717-531-6008; Fax: 717-531-7072; E-mail: ahopper{at}psu.edu.
 |
ABBREVIATIONS |
The abbreviations used are:
WAS, Wiskott-Aldrich
syndrome;
WASP, WAS protein.
 |
REFERENCES |
-
Remold-O'Donnell, E.,
and Rosen, F. S.
(1993)
Immunodeficiencies, pp. 225-241, Harwood Academic Publishers Gmbh, Chur, Switzerland
-
Nonoyama, S.,
and Ochs, H. D.
(1998)
Curr. Opin. Immunol.
10,
407-412[CrossRef][Medline]
[Order article via Infotrieve]
-
Ochs, H. D.
(1998)
Springer Semin. Immunopathol.
19,
435-458[CrossRef][Medline]
[Order article via Infotrieve]
-
Molina, I. J.,
Sancho, J.,
Terhorst, C.,
Rosen, F. S.,
and Remold-O'Donnell, E.
(1993)
J. Immunol.
151,
4383-4390[Abstract]
-
Derry, J. M. J.,
Ochs, H. D.,
and Francke, U.
(1994)
Cell
78,
635-644[CrossRef][Medline]
[Order article via Infotrieve]
-
Symons, M.,
Derry, J. M.,
Karlak, B.,
Jiang, S.,
Lemahieu, V.,
Mccormick, F.,
Francke, U.,
and Abo, A.
(1996)
Cell
84,
723-734[CrossRef][Medline]
[Order article via Infotrieve]
-
Ramesh, N.,
Anton, I. M.,
Hartwig, J. H.,
and Geha, R. S.
(1997)
Proc. Natl. Acad. Sci. U. S. A.
94,
14671-14676[Abstract/Free Full Text]
-
Vaduva, G.,
Martin, N. C.,
and Hopper, A. K.
(1997)
J. Cell Biol.
139,
1821-1833[Abstract/Free Full Text]
-
Naqvi, S. N.,
Zahn, R.,
Mitchell, D. A.,
Stevenson, B. J.,
and Munn, A. L.
(1998)
Curr. Biol.
8,
959-962[CrossRef][Medline]
[Order article via Infotrieve]
-
Adams, A. E.,
and Pringle, J. R.
(1984)
J. Cell Biol.
98,
934-945[Abstract/Free Full Text]
-
Zoladek, T.,
Vaduva, G.,
Hunter, L. A.,
Boguta, M.,
Go, B. D.,
Martin, N. C.,
and Hopper, A. K.
(1995)
Mol. Cell. Biol.
15,
6884-6894[Abstract]
-
Donnelly, S. F.,
Pocklington, M. J.,
Pallotta, D.,
and Orr, E
(1993)
Mol. Microbiol.
10,
585-596[CrossRef][Medline]
[Order article via Infotrieve]
-
Munn, A. L.,
Stevenson, B. J.,
Geli, M. I.,
and Riezman, H.
(1995)
Mol. Biol. Cell
6,
1721-1742[Abstract]
-
Sherman, F.
(1991)
Methods Enzymol.
194,
3-21[CrossRef][Medline]
[Order article via Infotrieve]
-
Chen, D.-C,
Yang, B.-C.,
and Kuo, T.-T
(1992)
Curr. Genet.
21,
83-84[CrossRef][Medline]
[Order article via Infotrieve]
-
Sambrook, J.,
Fritsch, E. F.,
and Maniatis, T
(1989)
Molecular Cloning: A Laboratory Manual, 2nd Ed., Cold Spring Harbor Laboratory, Cold Spring Harbor, NY
-
Adams, A.,
Gottschling, D. E.,
Kaiser, C. A.,
and Stearns, T.
(1997)
Methods in Yeast Genetics, p. 109, Cold Spring Harbor Laboratory, Cold Spring Harbor, NY
-
Baldari, C.,
and Cesarini, G
(1985)
Gene
35,
27-32[CrossRef][Medline]
[Order article via Infotrieve]
-
Pringle, J. R.,
Adams, A. E. M.,
Drubin, D. G.,
and Haarer, B. K.
(1991)
Methods Enzymol.
194,
565-602[Medline]
[Order article via Infotrieve]
-
Tolerico, H. L.,
Benko, A. L.,
Aris, J. P.,
Stanford, D. R.,
Martin, N. C.,
and Hopper, A. K.
(1999)
Genetics
151,
57-75[Abstract/Free Full Text]
-
Anton, I. M.,
Lu, W.,
Mayer, B. J.,
Ramesh, N.,
and Geha, R. S.
(1998)
J. Biol. Chem.
273,
20992-20995[Abstract/Free Full Text]
-
Anderson, B. L.,
Boldogh, I.,
Evangelista, M.,
Boone, C.,
Greene, L. A.,
and Pon, L. A.
(1998)
J. Cell Biol.
141,
1357-1370[Abstract/Free Full Text]
-
Adams, A. E.,
Shen, W.,
Lin, C. S.,
Leavitt, J.,
and Matsudaira, P.
(1995)
Mol. Cell. Biol.
15,
69-75[Abstract]
-
Gertler, F. B.,
Niebuhr, K.,
Reinhard, M.,
Wehland, J.,
and Soriano, P.
(1996)
Cell
87,
227-239[CrossRef][Medline]
[Order article via Infotrieve]
-
Kumar, S.,
McLaughlin, M. M.,
McDonnell, P. C.,
Lee, J. C.,
Livi, G. P.,
and Young, P. R.
(1995)
J. Biol. Chem.
270,
29043-29046[Abstract/Free Full Text]
-
Ng, R.,
and Abelson, J.
(1980)
Proc. Natl. Acad. Sci. U. S. A.
77,
3912-3916[Abstract/Free Full Text]
-
Munemitsu, S.,
Innis, M. A.,
Clark, R.,
McCormick, F.,
Ullrich, A.,
and Polakis, P.
(1990)
Mol. Cell. Biol.
10,
5977-5982[Abstract/Free Full Text]
-
Stowers, L.,
Yelon, D.,
Berg, L. J.,
and Chant, J.
(1995)
Proc. Natl. Acad. Sci. U. S. A.
92,
5027-5031[Abstract/Free Full Text]
-
Adams, A. E.,
Johnson, D. I.,
Longnecker, R. M.,
Sloat, B. F.,
and Pringle, J. R.
(1990)
J. Cell Biol.
111,
131-142[Abstract/Free Full Text]
-
Li, R.
(1997)
J. Cell Biol.
136,
649-658[Abstract/Free Full Text]
-
Lechler, T.,
and Li, R.
(1997)
J. Cell Biol.
138,
95-103[Abstract/Free Full Text]
-
Lamarche, N.,
Tapon, N.,
Stowers, L.,
Burbelo, P. D.,
Aspenstrom, P.,
Bridges, T.,
Chant, J.,
and Hall, A.
(1996)
Cell
87,
519-529[CrossRef][Medline]
[Order article via Infotrieve]
-
Rivero-Lezcano, O. M.,
Marcilla, A.,
Sameshima, J. H.,
and Robbins, K. C.
(1995)
Mol. Cell. Biol.
15,
5725-5731[Abstract]
-
Banin, S.,
Truong, O.,
Katz, D. R.,
Waterfield, M. D.,
Brickell, P. M.,
and Gout, I.
(1996)
Curr. Biol.
6,
981-988[CrossRef][Medline]
[Order article via Infotrieve]
-
Featherstone, C.
(1997)
Science
275,
27-28[Free Full Text]
-
Kenney, D.,
Cairns, L.,
Remold-O'Donnell, E.,
Peterson, J.,
Rosen, F. S.,
and Parkman, R.
(1986)
Blood
68,
1329-1332[Abstract/Free Full Text]
-
Gallego, M. D.,
Santamaria, M.,
Pena, J.,
and Molina, I. J.
(1997)
Blood
90,
3089-3097[Abstract/Free Full Text]
-
Ochs, H. D.,
Slichter, S. J.,
Harker, L. A.,
Von Behrens, W. E.,
Clark, R. A.,
and Wedgwood, R. J.
(1980)
Blood
55,
243-252[Free Full Text]
-
Phatak, P. D.,
and Packman, C. H.
(1994)
J. Cell. Physiol.
159,
365-370[CrossRef][Medline]
[Order article via Infotrieve]
-
Badolato, R.,
Sozzani, S.,
Malacarne, F.,
Bresciani, S.,
Fiorini, M.,
Borsatti, A.,
Albertini, A.,
Mantovani, A.,
Ugazio, A. G.,
and Notarangelo, L. D.
(1998)
J. Immunol.
161,
1026-1033[Abstract/Free Full Text]
-
Zicha, D.,
Allen, W. E.,
Brickell, P. M.,
Kinnon, C.,
Dunn, G. A.,
Jones, G. E.,
and Thrasher, A. J.
(1998)
Br. J. Haematol.
101,
659-665[CrossRef][Medline]
[Order article via Infotrieve]
-
Allen, W. E.,
Zicha, D.,
Ridley, A. J.,
and Jones, G. E
(1998)
J. Cell Biol.
141,
1147-1157[Abstract/Free Full Text]
-
Luton, F.,
Legendre, V.,
Gorvel, J. P.,
Schmitt-Verhulst, A. M.,
and Boyer, C.
(1997)
J. Immunol.
158,
3140-3147[Abstract]
Copyright © 1999 by The American Society for Biochemistry and Molecular Biology, Inc.

CiteULike Complore Connotea Del.icio.us Digg Reddit Technorati What's this?
This article has been cited by other articles:

|
 |

|
 |
 
S. Isgandarova, L. Jones, D. Forsberg, A. Loncar, J. Dawson, K. Tedrick, and G. Eitzen
Stimulation of Actin Polymerization by Vacuoles via Cdc42p-dependent Signaling
J. Biol. Chem.,
October 19, 2007;
282(42):
30466 - 30475.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. Tsuboi
A Complex of Wiskott-Aldrich Syndrome Protein with Mammalian Verprolins Plays an Important Role in Monocyte Chemotaxis.
J. Immunol.,
June 1, 2006;
176(11):
6576 - 6585.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
K. L. Butterfield-Gerson, L. Z. Scheifele, E. P. Ryan, A. K. Hopper, and L. J. Parent
Importin-{beta} Family Members Mediate Alpharetrovirus Gag Nuclear Entry via Interactions with Matrix and Nucleocapsid
J. Virol.,
February 15, 2006;
80(4):
1798 - 1806.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
P. K. Mattila, O. Quintero-Monzon, J. Kugler, J. B. Moseley, S. C. Almo, P. Lappalainen, and B. L. Goode
A High-affinity Interaction with ADP-Actin Monomers Underlies the Mechanism and In Vivo Function of Srv2/cyclase-associated Protein
Mol. Biol. Cell,
November 1, 2004;
15(11):
5158 - 5171.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
G. Eitzen, L. Wang, N. Thorngren, and W. Wickner
Remodeling of organelle-bound actin is required for yeast vacuole fusion
J. Cell Biol.,
August 28, 2002;
158(4):
669 - 679.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
D. J. Seastone, E. Harris, L. A. Temesvari, J. E. Bear, C. L. Saxe, and J. Cardelli
The WASp-like protein Scar regulates macropinocytosis, phagocytosis and endosomal membrane flow in Dictyostelium
J. Cell Sci.,
March 9, 2002;
114(14):
2673 - 2683.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. Mochida, T. Yamamoto, K. Fujimura-Kamada, and K. Tanaka
The Novel Adaptor Protein, Mti1p, and Vrp1p, a Homolog of Wiskott-Aldrich Syndrome Protein-Interacting Protein (WIP), May Antagonistically Regulate Type I Myosins in Saccharomyces cerevisiae
Genetics,
March 1, 2002;
160(3):
923 - 934.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. B. Goldberg
Actin-Based Motility of Intracellular Microbial Pathogens
Microbiol. Mol. Biol. Rev.,
December 1, 2001;
65(4):
595 - 626.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
G. Jung, K. Remmert, X. Wu, J. M. Volosky, and J. A. H. III
The Dictyostelium CARMIL Protein Links Capping Protein and the Arp2/3 Complex to Type I Myosins through Their SH3 Domains
J. Cell Biol.,
June 25, 2001;
153(7):
1479 - 1498.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
H. Yamaguchi, H. Miki, S. Suetsugu, L. Ma, M. W. Kirschner, and T. Takenawa
Two tandem verprolin homology domains are necessary for a strong activation of Arp2/3 complex-induced actin polymerization and induction of microspike formation by N-WASP
PNAS,
October 26, 2000;
(2000)
190351397.
[Abstract]
[Full Text]
|
 |
|

|
 |

|
 |
 
M. Evangelista, B. M. Klebl, A. H.Y. Tong, B. A. Webb, T. Leeuw, E. Leberer, M. Whiteway, D. Y. Thomas, and C. Boone
A Role for Myosin-I in Actin Assembly through Interactions with Vrp1p, Bee1p, and the Arp2/3 Complex
J. Cell Biol.,
January 24, 2000;
148(2):
353 - 362.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
D Pruyne and A Bretscher
Polarization of cell growth in yeast
J. Cell Sci.,
January 2, 2000;
113(4):
571 - 585.
[Abstract]
[PDF]
|
 |
|

|
 |

|
 |
 
M.-F. Carlier, P. Nioche, I. Broutin-L'Hermite, R. Boujemaa, C. Le Clainche, C. Egile, C. Garbay, A. Ducruix, P. Sansonetti, and D. Pantaloni
GRB2 Links Signaling to Actin Assembly by Enhancing Interaction of Neural Wiskott-Aldrich Syndrome Protein (N-WASp) with Actin-related Protein (ARP2/3) Complex
J. Biol. Chem.,
July 14, 2000;
275(29):
21946 - 21952.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
H. Yamaguchi, H. Miki, S. Suetsugu, L. Ma, M. W. Kirschner, and T. Takenawa
Two tandem verprolin homology domains are necessary for a strong activation of Arp2/3 complex-induced actin polymerization and induction of microspike formation by N-WASP
PNAS,
November 7, 2000;
97(23):
12631 - 12636.
[Abstract]
[Full Text]
[PDF]
|
 |
|
Copyright © 1999 by the American Society for Biochemistry and Molecular Biology.
|
Advertisement
Advertisement
|