![]()
|
|
||||||||
J Biol Chem, Vol. 274, Issue 24, 17132-17138, June 11, 1999
,
,
From the Kumho Life and Environmental Science Laboratory, 1 Oryong-Dong, Puk-Gu, Kwangju 500-480, Korea,
Biotechnology and Strategic Research Unit, Rubber
Research Institute of Malaysia, P.O. Box 10150, 50908 Kuala Lumpur,
Malaysia, and § Department of General and Experimental
Pathology, University of Vienna, AKH-EBO-3Q, Waehringer Guertel
18-20, Vienna 1090, Austria
| |
ABSTRACT |
|---|
|
|
|---|
Biochemical evidence reported so far suggests
that rubber synthesis takes place on the surface of rubber particles
suspended in the latex of Hevea brasiliensis. We have
isolated and characterized a cDNA clone that encodes a protein
tightly bound on a small rubber particle. We named this protein small
rubber particle protein (SRPP). Prior to this study, this protein was
known as a latex allergen, and only its partial amino acid sequence was
reported. Sequence analysis revealed that this protein is highly
homologous to the rubber elongation factor and the Phaseolus
vulgaris stress-related protein. Southern and Northern analyses
indicate that the protein is encoded by a single gene and highly
expressed in latex. An allergenicity test using the recombinant protein
confirmed that the cloned cDNA encodes the known 24-kDa latex
allergen. Neither ethylene stimulation nor wounding changed the
transcript level of the SRPP gene in H. brasiliensis. An
in vitro rubber assay showed that the protein plays a
positive role in rubber biosynthesis. Therefore, it is likely that SRPP
is a part of the rubber biosynthesis machinery, if not the rubber
polymerase, along with the rubber elongation factor.
Rubber (cis-1,4-polyisoprene), an isoprenoid polymer
with no known physiological function to the plant, is produced in about 2000 plant species with varying degrees of quality and quantity (1).
Rubber is the raw material of choice for heavy duty tires and other
industrial uses requiring elasticity, flexibility, and resilience.
Hevea brasiliensis has been the only commercial source of
natural rubber mainly because of its abundance in the tree, its
quality, and the ease of harvesting. The diminishing acreage of rubber
plantations and life-threatening latex allergy to Hevea rubber, coupled with an increasing demand, have prompted research interests in the study of rubber biosynthesis and the development of
alternative rubber sources.
In H. brasiliensis, rubber synthesis takes place on the
surface of rubber particles suspended in the latex (the cytoplasm of
laticifers). The laticifers are specialized vessels that are located
adjacent to the phloem of the rubber tree. When severed during tapping,
the high turgor pressure inside the laticifers expels latex containing
30-50% (w/w) cis-1,4-polyisoprene. The latex can be
fractionated by centrifugation into three phases: the top fraction
containing mostly rubber particles, the metabolically active middle
fraction (called C-serum), and the bottom fraction of mainly
vacuole-like organelles called lutoids. More than 240 expressed
sequence tags (ESTs)1 have
been identified from the latex of H. brasiliensis2 Kush
et al. (2) have shown differential expression of several rubber biosynthesis-related genes in latex. The rubber elongation factor (REF), an enzyme involved in rubber biosynthesis (3), is highly
expressed in laticifers (4). Laticiferous cells actively translate the
transcribed genes into proteins. About 200 distinct polypeptides are
present in the latex of H. brasiliensis (5). Arokiaraj
et al. (6) observed that the GUS reporter gene
introduced by Agrobacterium-mediated transformation was
expressed in the latex of the transgenic Hevea plant. Genes
expressed in the latex of Hevea can be divided into three
groups based on the proteins they encode: 1) defense-related proteins
such as hevein (7), chitinase (8), Rubber particles are essential components in rubber synthesis in
vitro (17). Most of the experiments showing in vitro
rubber synthesis with labeled isopentenyl pyrophosphate (IPP) have
always required rubber particles. Dennis and Light (3) showed that REF,
a rubber particle-associated protein (RPP), was necessary for rubber
elongation in vitro. Yeang et al. (13) identified a 24-kDa RPP (Hev b 3) (later revised to 22 kDa (18)) tightly bound on
small rubber particles as latex allergen. Pan et al. (19)
identified the most abundant RPP (53 kDa) in guayule, another rubber-producing plant, as a cytochrome P450 known as allene oxide synthase. A United States patent (No. 5,633,433) claims that this protein is necessary for rubber biosynthesis. In light of these observations, it is plausible that the surface of the rubber particle is the appropriate location for a rubber transferase, which polymerizes a hydrophobic polymer into the particle interior while obtaining hydrophilic substrates, like IPP, from the cytosol. As major RPPs, both
REF and Hev b 3 could well be the integral components of the rubber
biosynthesis machinery.
We are interested in understanding the molecular and biological aspects
of rubber biosynthesis. In a separate study to investigate the gene
expression profile in the rubber-producing tissue, we generated a
number of ESTs from latex. One of the genes most abundantly expressed
in latex was found to be a cDNA clone encoding a major rubber
particle protein, Hev b 3. This protein causes allergenic response in
spina bifida patients, and only its partial amino acid sequence was
determined (13, 18). The gene encoding this protein has not been
cloned. In this study, we isolated and characterized a full-length
cDNA encoding the allergen Hev b 3. We named the gene small rubber
particle protein (SRPP) for a common name. The amino acid sequence of
SRPP is highly homologous to that of REF, suggesting its potential
involvement in rubber biosynthesis. However, there has been no
experimental evidence for the function of SRPP. SRPP has also high
sequence homology to Phaseolus vulgaris stress-related protein (PvSRP) that was reported in the data base entry to be induced
by heavy metals, wounding, and virus infection. The present study shows
that SRPP is not induced by wounding or ethylene but plays a positive
role in rubber biosynthesis.
Plant Material and RNA Isolation--
Latex and leaf samples
were obtained from mature rubber plants (H. brasiliensis
clone RRIM 600) growing at the Rubber Research Institute of Malaysia
(RRIM), Selangor, Malaysia. Latex collection and RNA extraction from
the latex were performed as described in Kush et al. (2)
using the Qiagen Rneasy Plant Minikit (Qiagen Inc., Chatsworth, CA).
Poly(A)+ RNA was isolated using Oligotex-dTTM
mRNA kit (Qiagen Inc.).
Wounding and Ethephon Treatment--
For the effect of wounding,
five H. brasiliensis (clone RRIM 600) trees were wounded
with six nails above and along the slope of the tapping cut while
another five control trees were not punctured. Latex and leaf samples
were collected from each tree about 16 h after puncturing. For the
effect of ethylene stimulation, five H. brasiliensis (clone
RRIM 600) trees were stimulated with an ethylene-releasing agent
(ethephon, 2.5%, v/v) while five control trees were not. Latex and
leaf samples were collected from each tree 2 days after stimulation.
RT-PCR Amplification of SRPP--
First strand cDNA
synthesis was performed by reverse transcribing 0.5 µg of total latex
RNA using a modified oligo-dT primer, T25NN
(5'-GGAGAAGGA(T)25(A/G/C)N-3'). For PCR, 10 µl of the
first strand cDNA synthesis was used to amplify part of the coding
sequence for SRPP. A degenerate primer, BW1, was designed according to sequence similarities between Hev b 1 (commonly known as REF) and
previously published peptide fragments of Hev b 3 (13). The peptide
sequence KYLDFV was chosen (see Fig. 1, underlined). The
primers used to amplify a fragment of the SRPP (Hev b 3) cDNA were
BW1 (5'-AAGCTTAA(A/G)TA(C/T)TIGA(C/T)TT(C/T)GT-3', where I stands for
inosine) and T25NN. The PCR product was excised from an
agarose gel and purified with the QIAEX II agarose gel extraction kit
(Qiagen, Hilden, Germany). Purified PCR products were ligated into the
pCRTM 2.1 vector (TA cloning kit, Invitrogen, NV Leek,
Netherlands). Plasmids of transformed Escherichia coli
strain XL1-Blue were isolated and sequenced by the
dideoxyribonucleotide chain termination method using the Thermo
Sequenase fluorescent labeled primer cycle sequencing kit (Amersham
Pharmacia Biotech). To complete the missing 5'-portion of the cDNA,
the 5'-AmpliFINDERTM RACE kit
(CLONTECH, Palo Alto, CA) was used according to the vendor's instructions. cDNA synthesis was performed with the
T25NN primer and PCR after anchor ligation with the kit's
AmpliFINDER anchor primer and the gene-specific internal primer BW4
(5'-AGGTAATGACCGCATATTGCTCAGC-3'). The complete cDNA sequence of
SRPP cloned by this method is available from the
GenBankTM/EBI data base under accession number
AJ223388.
Construction and Screening of Latex cDNA Library--
A
cDNA library was constructed in a Uni-ZAP II vector according to
the supplier's instructions (Stratagene, La Jolla, CA) using
poly(A)+ RNA prepared from latex. In a separate study using
a subtracted cDNA library (latex Sequencing of cDNA Clones--
Plasmid DNA for sequencing
reactions was prepared by the alkaline lysis method (20) using
WizardTM Plus SV Minipreps DNA purification system kit
(Promega). The sequencing reaction was performed with the ALFexpress
AutoRead sequencing kit (Amersham Pharmacia Biotech) using the
fluorescent dye-labeled M13 universal or reverse primer (provided by
the kit). The nucleotide sequences were obtained by electrophoresis on
an ALF automatic sequencer (Perkin Elmer Corp.).
Heterologous Expression of SRPP Protein in E. coli--
The SRPP
gene was cloned either in the EcoRI-XhoI site of
pGEX (Amersham Pharmacia Biotech) or in the
BamHI-PvuII site of pRSET (Invitrogen) to
construct pGEX-SRPP or pRSET-SRPP. The E. coli XL1-Blue
transformed with either pGEX-SRPP or pRSET-SRPP was grown to
midstationary phase in Luria broth (LB) containing 50 mg/liter
ampicillin at 30 °C with vigorous aeration. The cultures were
induced by adding IPTG to a concentration of 0.1 mM and
then incubated for another 6 h. All subsequent steps were carried
out at 4 °C. The cells were harvested, washed with 0.1 M
potassium phosphate (pH 7.4) by centrifugation (5000 × g, 10 min), and then disrupted by sonication. The homogenate was centrifuged
at 10,000 × g for 10 min, and the supernatant was used
to determine rubber synthesis activity. The lysate was subjected to
SDS-PAGE according to the standard method of Laemmli (21).
Southern and Northern Blot Analysis--
Genomic DNA from leaf
tissues of a mature H. brasiliensis RRIM 500 was prepared,
digested, and blotted as described in Han et al. (22). For
Northern blot, total RNA was electrophoresed on a 1.4%
agarose-formaldehyde gel and blotted as for Southern blot. A
32P-labeled 175-bp fragment (from 480 to 655 bp in Fig. 1)
from SRPP cDNA was used as a probe. The hybridization was performed with high stringency (22).
In Vitro Rubber Biosynthesis Assay--
Washed rubber particles
(WRP) were prepared by a repeated centrifugation/flotation procedure as
described (23, 24). C-serum or WRP was incubated in 50 µl of reaction
mixture containing 100 mM Tris-HCl, pH 7.5, 80 µM [14C]IPP (55 mCi mmol Inhibition of Patient Serum with Native SRPP--
To inhibit IgE
specific to SRPP in the serum, 170 µl of native SRPP (100 µg
ml Western Blot Analysis--
Native and recombinant SRPP proteins
were separated by SDS-PAGE on 15% gels (21). The gels were
subsequently stained with Coomassie Blue or used for Western blotting
where the proteins in the gel were transferred electrophoretically to a
nitrocellulose membrane. To detect allergen-IgE binding, the
nitrocellulose membrane was blocked with PBS-milk and then incubated
overnight with patient serum inhibited or not inhibited with SRPP as
described above. After three cycles of washing with PBS-milk, the
nitrocellulose membrane was incubated for 1 h with anti-IgE
antiserum conjugated to alkaline phosphatase. After a further three
cycles of washing with PBS-milk, the nitrocellulose membrane was
incubated for 10 min in Tris-buffered saline before being immersed in
5-bromo-4-chloro-3-indolyl phosphate/nitro blue tetrazolium substrate
to generate the colored alkaline phosphatase reaction product.
Isolation and Characterization of SRPP Gene--
Two approaches,
RT-PCR amplification and cDNA library screening, were employed to
clone the gene. Sequence analysis showed that the genes isolated by the
two different methods were identical except for minor differences in
the untranslated regions (UTRs). The RT-PCR-amplified gene has an
additional 21 bp (ATAATCAGTTGATAGCTTCCA) before nucleotide 1 at the
5'-UTR, whereas the cDNA library-derived gene has an additional 9 bp before the poly(A) tail.
The primary latex cDNA library used for screening contained 5 × 107 recombinant phages. Using the PCR-generated SRPP
sequences, 10 positive clones with cDNA inserts (0.8-1.0 kb) were
detected and isolated from 5 × 105 plaques of the
cDNA library. A cDNA clone containing an insert of
approximately 1.0 kb in size was selected and subjected to in
vivo excision for further study. The resulting phagemid was designated pSRPP. Sequence analysis showed that the cDNA insert was
910 bp long (Fig. 1) and contained a
612-bp open reading frame flanked by a 63-bp 5'-UTR and a 181-bp 3'-UTR
including a poly(A) tail of 18 bp. A putative polyadenylation
signal (AATAAA) beginning at bp 794 was identified. The open reading
frame encodes for a 204-amino acid polypeptide with a predicted
molecular mass of 22.4 kDa. The deduced protein is acidic with an
isoelectric point of 4.8, which is similar to that of REF (pI = 5.04). Hydropathy analysis of the deduced amino acid sequence showed
that SRPP is hydrophobic (Fig. 2).
Transmembrane region analysis using the TMpred algorithm indicated that
the SRPP does not have transmembrane helices large enough to span the
lipid bilayers. A computer analysis using the PSORT program (K. Nakai,
Osaka University, Japan) for protein localization sites suggested that
SRPP is localized in cytoplasm.
The predicted amino acid sequence of the SRPP has high similarity to
those of REF (72% in the paired sequence region), PvSRP (68%), and
Arabidopsis thaliana F1N21.4 (48%). PvSRP is believed to be
involved in the defense mechanism and induced by stress or wounding.
The function of the Arabidopsis gene F1N21.4 is not known.
Sequence alignment indicated that there is a highly conserved region
from amino acids 38 to 65 with no match to any known functional domains
(Fig. 3).
SRPP Is a Single-copy Gene--
To determine the copy number of
the SRPP gene, Southern blot hybridization analysis was performed using
a random primed 175-bp fragment (Fig. 1, from 480 to 655 bp) from SRPP
cDNA as a hybridization probe. This sequence is the least
homologous region in the sequence alignment with other related genes
(Fig. 3). A single hybridizing band was observed in each restriction
digest (Fig. 4), suggesting that SRPP is
most likely encoded by a single gene per haploid genome. However, when
the entire SRPP cDNA sequence was used as a probe, four bands were
detectable on the blot (data not shown).
Immunoblots and Inhibition Experiments--
To confirm that the
cDNA we cloned encodes for the previously known 24-kDa protein (Hev
b 3), immunoblot analyses of natural and recombinant SRPP were
performed with antisera from spina bifida patients. This 24-kDa protein
is known to be tightly associated with the small rubber particle where
rubber synthesis is actively occurring. Natural and recombinant SRPP
proteins were equivalent in their ability to bind IgE (Fig.
5). The IgE reactivity to both natural
and recombinant SRPP proteins could be equally inhibited by
preincubation of the sera with native SRPP protein.
Expression of the SRPP Gene--
Northern blot analysis showed a
single band of 1.0 kb for SRPP from both leaf and latex samples. The
level of transcripts was most abundant in latex (Fig.
6). The expression of SRPP in responses
to wounding and ethylene stimulation was investigated at both
transcription and translation levels. We found that neither wounding
nor ethephon treatment changed the expression of SRPP at both
transcriptional (Fig. 6) and translational levels (data not shown).
This result suggested that the function of this rubber particle-associated protein is likely in areas other than defense.
SRPP Plays a Positive Role in Rubber Biosynthesis in Vitro--
To
determine whether SRPP is involved in rubber biosynthesis, in
vitro rubber biosynthesis assays using Hevea C-serum
and WRP were performed by adding SRPP protein to the reaction mixture. SRPP was expressed in E. coli as a glutathione
S-transferase (GST)-SRPP fusion protein under the control of
the IPTG-inducible tac promoter (Fig.
7). The bacterial extracts of the culture
after IPTG induction were used as a source of SRPP recombinant protein.
As a control, either the same bacterial extract without IPTG induction
or the culture of E. coli harboring pGEX vector with no
insert was used. Both C-serum and WRP per se contain native
SRPP as well as REF and exhibited a fairly high level of rubber
biosynthetic activity (about 8,000 cpm) compared with control reaction
(about 900 cpm) (Fig. 8). Rubber
transferase in the control was inactivated by the addition of 25 mM EDTA that chelates Mg2+ ion necessary for
the activity of the enzyme. As shown in Fig. 8, the amounts of
[14C]IPP incorporated into rubber were substantially
increased with the addition of recombinant SRPP. The increase of
[14C]IPP incorporation was dependent upon the amounts of
SRPP protein added to the reaction mixture. [14C]IPP
incorporation was increased about 4-fold by the addition of 15 µl of
bacterial extract expressing GST-SRPP fusion protein to the reaction
mixture containing either 5 µl of C-serum or 10 mg of WRP. In
contrast, no increase of [14C]IPP incorporation was
observed in the control reaction containing bacterial extracts from
either the culture without IPTG induction or the culture expressing
only the GST protein.
To further confirm that SRPP plays a role in rubber biosynthesis,
polyclonal antibodies from SRPP-challenged rabbit serum and monoclonal
antibodies from mouse were prepared (13), and their ability to inhibit
rubber biosynthesis in C-serum was tested. The untreated blood serum
and the culture supernatant were used as a control without further
purification. Fig. 8 shows that the polyclonal and monoclonal
antibodies generated against SRPP protein inhibited rubber biosynthesis
to a much greater extent than the control serum. At higher
concentrations of the control serum, some inhibition of rubber
biosynthesis was observed. A more severe reduction in rubber
biosynthesis was observed with polyclonal antibodies than with
monoclonal antibodies. This differential inhibitory effect could be
because of the immuno-cross-reactivity of the polyclonal antibody with
REF (data not shown) because of the high sequence homology to SRPP
(Fig. 3). It is also possible that the polyclonal antibody binds to
both SRPP and REF, and possibly to other proteins with sequence
homology with SRPP, and inhibits rubber biosynthesis to a greater
extent than monoclonal antibody that binds to only SRPP. These results
suggest that SRPP is involved in rubber biosynthesis in
vitro.
SRPP Catalyzes the Formation of Polyisoprenes without the Presence
of WRP--
We tested whether SRPP can catalyze the successive
condensing reactions of IPP to the rubber-initiating molecule FPP
without the presence of WRP. The in vitro rubber assay was
carried out with or without the addition of WRP using bacterial
extracts of the cells expressing only GST protein, bacterial extracts
without IPTG induction, and bacterial extracts of the cells expressing GST-SRPP fusion protein with IPTG induction. The reaction products of
the rubber assay were analyzed by reverse phase TLC. The radiolabeled products synthesized by WRP were retained at the origin, indicating long-chain length rubber (Fig. 9).
Without the presence of WRP, reactions with GST protein alone or
uninduced extracts showed no detectable IPP incorporation activity
(Fig. 9, lanes a and b). Only the
reaction with the bacterial extracts of cells expressing GST-SRPP
fusion protein produced polyisoprene (lane c).
Most of the reaction products synthesized by GST-SRPP fusion protein
were retained at the origin, but a distribution of weak bands migrating with the solvent was detected above the origin (lane
c). These results suggest that the reaction products
synthesized by GST-SRPP fusion protein are mainly a mixture of
long-chain length polymers. We are currently examining the nature of
these long-chain length polymers.
Because rubber biosynthesis takes place in laticifers, genes
highly expressed in such tissues may code for the enzymes involved in
rubber synthesis. Kush et al. (2) reported a number of genes highly expressed in latex compared with leaves. They found that latex
RNAs are highly enriched in transcripts encoding rubber biosynthesis-related enzymes (20-100-fold) as well as defense-related proteins (10-50-fold). In a separate study we have identified about
245 ESTs from the latex cDNA library.2 Rubber
biosynthesis-related genes (e.g. REF and SRPP) along with defense genes are among the most abundant transcripts. The latex has
been suggested to play some protective roles because of the high
concentration of defense-related proteins in latex (26). However, it
remains to be answered why Hevea species allocate excessive
energy and resource to rubber synthesis.
Rubber particles of H. brasiliensis latex can be separated
by ultracentrifugation into two distinct fractions: Zone 1 fraction (large rubber particles) and Zone 2 fraction (small rubber particles). The size of rubber particles ranges from about 10 µm to below 0.2 µm (27, 28). Each rubber particle contains hundreds to thousands of
rubber molecules within this enclosing interface (28). Analysis using
gel permeation chromatography revealed that the small rubber particles
contained rubber of higher molecular weight than the large rubber
particles. Rubber particles are not simply an inert ball of rubber.
Siler et al. (27) analyzed the composition of rubber
particles of four rubber-producing plants including H. brasiliensis and suggested that the rubber particle surface is a
mosaic of protein, conventional membrane lipids, and other components.
Among many latex proteins, two main proteins remain associated with
rubber particles after repeated washing: REF (14 kDa) with large
rubber particles and SRPP (23 kDa) with small rubber
particles (13).
Rubber transferase (cis-prenyltransferase) activity has been
reported from the rubber particle-bound proteins of three
rubber-producing plants, H. brasiliensis (17, 29),
Parthenium argentatum (23, 30), and Ficus
elastica (24). Although at least two rubber particle-associated
proteins, a REF and a rubber transferase, have been suggested to be
involved in rubber biosynthesis in H. brasiliensis (3, 31,
32), the detailed mechanism of rubber biosynthesis has not been
investigated. Although the gene coding for rubber transferase has not
been cloned, a full-length cDNA encoding REF has been cloned (4).
It has been established that REF plays a functional role in rubber
polymerization (3, 31). However, the actual role of REF and the nature
of rubber transferase in cis-1,4-polyisoprene elongation has
not been fully assessed. It is possible that SRPP is involved in rubber
biosynthesis, as the rubber particle is the site of rubber synthesis
and SRPP is one of the two major RPPs. In the current study, we
established that SRPP has high amino acid sequence homology to REF and
plays a positive role in rubber synthesis. Furthermore, we showed that SRPP synthesized long-chain polyisoprene without other rubber particle
proteins (Fig. 9, lane c). These findings, along
with the fact that SRPP is tightly associated with small rubber
particles and is abundantly expressed in latex, suggest that SRPP plays a similar role in rubber synthesis as REF does and could potentially be
a rubber transferase.
In addition to the postulated role in rubber biosynthesis, its high
sequence homology to PvSRP suggests that SRPP is involved in defense
mechanism. PvSRP is believed to play a role in plant defense mechanism
and is regulated by heavy metal stress, wounding, and virus infection.
We tested to see if SRPP is induced by ethephon treatment or wounding.
Ethylene regulates fruit ripening, germination, senescence, and the
expression of the response to environmental stresses such as mechanical
wounding, infection, and waterlogging (33) by stimulating changes in
gene expression. Ethephon treatment increased (approximately 5-20
times) several defense genes including chitinase,
pathogenesis-regulated protein, and phenylalanine ammonia-lyase in
H. brasiliensis (2). Northern blot analyses indicated that the SRPP gene is not induced by wounding or ethephon treatment. These
results showed that the expression pattern of the gene is different
from the kidney bean stress-related protein (PvSRP). Furthermore, the
calculated isoelectric point of SRPP (pI = 4.8) was quite
different from that of PvSRP (pI = 9.47), suggesting that SRPP is
biochemically distinct from PvSRP. These findings indicate that the
function of this rubber particle-associated protein is likely in areas
other than defense.
Although the biological significance of rubber to the producing plant
is not obvious, natural rubber is of great commercial importance.
Elucidation of a mechanism for rubber biosynthesis may provide crucial
knowledge bases for genetic manipulation of the Hevea rubber
tree to improve rubber productivity and quality and to aid the
development of alternative rubber crops by transgenic expression of the
gene(s) responsible for rubber formation. The present study identified
SRPP as a potential candidate for rubber transferase. Although SRPP
seems to catalyze the formation of long-chain length rubber, it remains
to be determined whether SRPP plays a direct role in elongating the
rubber chain or contributes indirectly by synthesizing the initiating
molecules necessary for rubber biosynthesis. More biochemical studies
with the purified SRPP are required to further characterize the exact
nature of the involvement of this protein in rubber biosynthesis.
Unfortunately, the E. coli expression system we used in the
present study produced most of the fusion protein in insoluble form. We
therefore are attempting to obtain large quantities of soluble protein
using either Pichia or baculovirus expression systems.
Furthermore, we are currently investigating the possible role of SRPP
as a rubber transferase in transgenic plants expressing SRPP and
REF.
![]()
INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES
-1,3-glucanase (9), and HEVER
(10); 2) rubber biosynthesis-related proteins such as REF (4),
hydroxymethylglutaryl-CoA reductase (11), and farnesyl diphosphate
synthase (12); and 3) latex allergens (proteins) such as Hev b 3 (13),
Hev b 4, Hev b 5 (14, 15), and Hev b 7 (16). Biological functions of
the allergenic proteins are largely unknown.
![]()
MATERIALS AND METHODS
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES
leaf), we identified an EST
whose deduced amino acid sequence matched with the known partial
sequence of Hev b 3.2 From the sequence information of the
EST clone, we designed a PCR primer corresponding to the sequences from
+185 to +211 bp in SRPP (see Fig. 1). This primer (upstream) and T7
primer (downstream) were used to amplify SRPP from the latex cDNA
library. PCR was performed for 30 cycles of 30 s at 94 °C,
30 s at 50 °C, and 2 min at 72 °C, with a 5-min preheat and
a 10-min final extension at 72 °C. The PCR product was used to
screen 5 × 105 plaques of the latex cDNA library.
The cDNA clones hybridized to the probe were subjected to in
vivo excision according to the protocol provided by the cDNA
library kit and sequenced. One clone carrying a full-length cDNA
insert was designated as pSRPP and chosen for further study.
1,
Amersham Pharmacia Biotech), 20 µM FPP, 1 mM
MgSO4, and 1 mM dithiothreitol for 6 h at
25 °C. For control experiments, 25 mM EDTA was added to
the reaction mixture to chelate Mg2+ ion necessary for
rubber transferase activity. The reaction was stopped by adding 25 mM EDTA. The resulting [14C]IPP-incorporated
rubber was quantified by using either a filtration or a benzene
extraction method. For the filtration method, the reaction mixture was
filtered through either 0.02 or 0.1 µM anodisc membrane
(Whatman). The filter was subjected to repeated washing with 1 M HCl and 95% ethanol (23), and the remaining
radioactivity on the washed filters was determined by a liquid
scintillation counter (Beckman). For the benzene extraction method, the
reaction mixture was extracted three times with 2 volumes of benzene.
The benzene extract was mixed with a Ready Solv HP scintillation
mixture (Beckman), and the radioactivity was determined by a liquid
scintillation counter.
1) was added to a mixture containing 0.35 ml of patient
serum, 1.3 ml of 5% nonfat milk in phosphate-buffered saline (PBS),
and 90 µl of 1% sodium azide. A sample of uninhibited patient serum was similarly treated, but SRPP was replaced with water. The serum samples were incubated overnight at 7 °C.
![]()
RESULTS
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

View larger version (54K):
[in a new window]
Fig. 1.
Nucleotide
(GenBankTM/EBI accession no.
AF051317) and deduced amino acid sequences of SRPP.
Numbers of the nucleotide sequence are indicated on the left
margin, and those of the amino acid sequence are indicated
on the right margin. The underlined
region is the sequence from which the degenerate primer was
designed for RT-PCR amplification of the SRPP gene.

View larger version (9K):
[in a new window]
Fig. 2.
Hydropathy plot calculated from the deduced
amino acid sequence of SRPP. The analysis was performed according
to Kyte and Doolittle (34).

View larger version (56K):
[in a new window]
Fig. 3.
Comparison of the deduced amino acid sequence
of SRPP with REF (GenBankTM/EBI accession
no. P15252) (see Ref. 36) and PvSRP
(GenBankTM/EBI accession no.
1326163). The alignment was made using the ClustalW
program. Gaps in the sequences are indicated by dashes.
Numbers of amino acids are indicated on the right
margin.

View larger version (69K):
[in a new window]
Fig. 4.
SRPP is encoded by a single gene. Ten
micrograms of genomic DNA isolated from leaf tissues was digested with
EcoRI (E), HindIII (H), and
EcoRI + HindIII (EH). These enzymes do
not have restriction sites inside the coding region of SRPP. The
digested DNA was size- fractionated on 0.8% agarose gel, blotted, and
hybridized with the same probe used in Northern blot analysis. Sizes of
the hybridizing bands are indicated on the left
margin.

View larger version (111K):
[in a new window]
Fig. 5.
Electrophoretic separation and
immunodetection of SRPP proteins. A, Coomassie Blue
staining. Lanes 1 and 1', recombinant SRPP
protein; lanes 2 and 2', native SRPP protein.
B, Western blot of a matching gel to show binding of SRPP
protein with IgE in plasma from latex-allergic (spina bifida) patients.
Lanes 1 and 2, serum not inhibited; lanes
1' and 2', serum inhibited with native SRPP. Molecular
weight standards are shown in lane M.

View larger version (83K):
[in a new window]
Fig. 6.
Northern blot analysis of SRPP
transcript. Fifteen micrograms of total RNA isolated from leaf and
latex of H. brasiliensis were hybridized with a
32P-labeled 175-bp fragment (from 480 to 655 bp in Fig. 1)
from SRPP cDNA. The SRPP transcript is more abundant in latex than
in leaf tissue. The same 175-bp probe was used to hybridize 15 µg of
total RNA isolated from the latex of H. brasiliensis trees
with no treatment (EC and WC), 2.5% ethephon
stimulation (ET), and wounding (WT) as described
under "Materials and Methods." The lower panel shows the
ethidium bromide-stained rRNA under UV light before blotting,
indicating the loading of a similar amount of total RNA.

View larger version (74K):
[in a new window]
Fig. 7.
Overexpression of SRPP in E. coli. Expression vectors (pGEX-SRPP and pRSET-SRPP)
were constructed in which the fusion protein was driven by the T7
promoter, made IPTG-inducible, and transformed into E. coli
XL1-Blue. Expression was induced by the addition of 0.1 mM
IPTG, and total cell proteins were analyzed after 4 h by SDS-PAGE
as described under "Materials and Methods." Left
panel, SRPP expression from E. coli cells
harboring pGEX-SRPP; Right panel, SRPP expression
from E. coli cells harboring pRSET-SRPP. M,
molecular markers; C, E. coli cells harboring
pGEX-SRPP not induced; I, E. coli cells harboring
pGEX-SRPP after 4 h of induction. The molecular mass (kDa) of the
markers is indicated in the middle. An asterisk
in the right margin indicates the migration of
SRPP.

View larger version (18K):
[in a new window]
Fig. 8.
SRPP plays a positive role in rubber
biosynthesis in vitro. a,
[14C]IPP incorporation into rubber as a function of SRPP
concentration. The rubber elongation assay was performed in 50 µl of
reaction mixture containing 10 mg of WRP and the indicated amounts of
SRPP. Each value is the mean of three experiments for bacterial
extracts of the cells expressing GST-SRPP fusion protein with IPTG
induction (
), bacterial extracts without IPTG induction (
), and
bacterial extracts of the cells expressing only the GST protein (
).
b, concentration dependence of antibody-SRPP inhibition of
rubber biosynthesis. The indicated amounts of antibody raised against
SRPP were added to 50 µl of reaction mixture containing 5 µl of
C-serum. Each value is the mean of three experiments for control rabbit
(
) and mouse (
) serum without antibody formation, monoclonal
antibody (
), and polyclonal antibody (
).

View larger version (85K):
[in a new window]
Fig. 9.
Reverse phase TLC radiochromatograms of the
reaction products. We tested whether SRPP can catalyze the
successive condensing reactions of IPP to the rubber-initiating
molecule FPP without other RPPs. In vitro rubber assay was
carried out with (lane WRP) or without the
addition of WRP using bacterial extracts of the cells expressing only
GST protein (lane a), bacterial extracts without
IPTG induction (lane b), and bacterial extracts
of the cells expressing GST-SRPP fusion protein with IPTG induction
(lane c). The radioactive reaction products were
treated with potato acid phosphatase according to the method of Fujii
et al. (35), extracted with hexane/benzene, and analyzed by
TLC on reverse phase RP-18 in a solvent system of acetone:water (9:1,
v/v). The distribution of 14C-labeled reaction products on
the TLC plate was analyzed by a BAS 1500 PhosphorImager (Fuji).
s.f., solvent front; ori.,
origin.
![]()
DISCUSSION
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES
| |
ACKNOWLEDGEMENTS |
|---|
We thank Drs. Pill-Soon Song, Jeong Mook Kim, and Eric Johnson for their critical reading of the manuscript and Min Yung Kang, In Jeong Kim, Jin Sook Kim, and Ji Yeon Lee for technical assistance. We also thank Dr. Samsidar Hamzah at the Rubber Research Institute of Malaysia for help with SRPP protein quantification.
| |
FOOTNOTES |
|---|
* This work was supported by Grant 297066-5 from the Agricultural Research Promotion Center (to K-H. H.), by the Korean Ministry of Agriculture, and in part by IRPA Grant 01-04-04-0039 from the Malaysian Ministry of Science, Technology, and the Environment. This is Kumho Life and Environmental Science Laboratory Publication 28.The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
The nucleotide sequence(s) reported in this paper has been submitted to the GenBankTM/EMBL Data Bank with accession number(s) AJ223388, AF051317, and 1326163.
¶ To whom correspondence should be addressed: Dept. of Forestry, Michigan State University, 126 Natural Resources Bldg., East Lansing, MI 48824. Tel.: 517-355-0093; Fax: 517-432-1143; E-mail: hanky{at}pilot.msu.edu.
2 K-H. Han, D. H. Shin, J. Yang, I. J. Kim, S. K. Oh, and K.-S. Chow, submitted for publication.
| |
ABBREVIATIONS |
|---|
The abbreviations used are:
EST, expressed
sequence tag;
GST, glutathione S-transferase;
IPP, isopentenyl diphosphate;
PAGE, polyacrylamide gel electrophoresis;
REF, rubber elongation factor;
RPP, rubber particle protein;
RT-PCR, reverse
transcriptase-polymerase chain reaction;
SRPP, small rubber particle
protein;
PvSRP, Phaseolus vulgaris stress-related protein;
WRP, washed rubber particle;
bp, base pair(s);
IPTG, isopropyl-1-thio-
-D-galactopyranoside;
FPP, farnesyl
pyrophosphate;
PBS, phosphate-buffered saline;
UTR, untranslated
region;
kb, kilobase.
| |
REFERENCES |
|---|
|
|
|---|
This article has been cited by other articles:
![]() |
K.-S. Chow, K.-L. Wan, Mohd. N. M. Isa, A. Bahari, S.-H. Tan, K Harikrishna, and H.-Y. Yeang Insights into rubber biosynthesis from transcriptome analysis of Hevea brasiliensis latex J. Exp. Bot., July 1, 2007; 58(10): 2429 - 2440. [Abstract] [Full Text] [PDF] |
||||
![]() |
I. J. Kim, S. B. Ryu, Y. S. Kwak, and H. Kang A novel cDNA from Parthenium argentatum Gray enhances the rubber biosynthetic activity in vitro* J. Exp. Bot., February 1, 2004; 55(396): 377 - 385. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. P. Singh, S. G. Wi, H. Kang, G. C. Chung, and Y. S. Kim Simple and Rapid Methods for SEM Observation and TEM Immunolabeling of Rubber Particles J. Histochem. Cytochem., August 1, 2003; 51(8): 1105 - 1108. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. Kongsawadworakul and H. Chrestin Laser Diffraction: A New Tool for Identification and Studies of Physiological Effectors Involved in Aggregation-Coagulation of the Rubber Particles from Hevea Latex Plant Cell Physiol., July 15, 2003; 44(7): 707 - 717. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. P. Singh, S. G. Wi, G. C. Chung, Y. S. Kim, and H. Kang The micromorphology and protein characterization of rubber particles in Ficus carica, Ficus benghalensis and Hevea brasiliensis J. Exp. Bot., March 1, 2003; 54(384): 985 - 992. [Abstract] [Full Text] [PDF] |
||||
![]() |
U. Sookmark, V. Pujade-Renaud, H. Chrestin, R. Lacote, C. Naiyanetr, M. Seguin, P. Romruensukharom, and J. Narangajavana Characterization of Polypeptides Accumulated in the Latex Cytosol of Rubber Trees Affected by the Tapping Panel Dryness Syndrome Plant Cell Physiol., November 15, 2002; 43(11): 1323 - 1333. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Kang, M. Y. Kang, and K.-H. Han Identification of Natural Rubber and Characterization of Rubber Biosynthetic Activity in Fig Tree Plant Physiology, July 1, 2000; 123(3): 1133 - 1142. [Abstract] [Full Text] |
||||
![]() |
B. Bohle, B. Wagner, U. Vollmann, D. Buck, B. Niggemann, Z. Szepfalusi, G. Fischer, O. Scheiner, H. Breiteneder, and C. Ebner Characterization of T Cell Responses to Hev b 3, an Allergen Associated with Latex Allergy in Spina Bifida Patients J. Immunol., April 15, 2000; 164(8): 4393 - 4398. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. K. Oh, K. H. Han, S. B. Ryu, and H. Kang Molecular Cloning, Expression, and Functional Analysis of a cis-Prenyltransferase from Arabidopsis thaliana. IMPLICATIONS IN RUBBER BIOSYNTHESIS J. Biol. Chem., June 9, 2000; 275(24): 18482 - 18488. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| All ASBMB Journals | Molecular and Cellular Proteomics |