JBC Anatrace, Inc.

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Van Ryk, D. I.
Right arrow Articles by Venkatesan, S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Van Ryk, D. I.
Right arrow Articles by Venkatesan, S.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

J Biol Chem, Vol. 274, Issue 25, 17452-17463, June 18, 1999


Real-time Kinetics of HIV-1 Rev-Rev Response Element Interactions
DEFINITION OF MINIMAL BINDING SITES ON RNA AND PROTEIN AND STOICHIOMETRIC ANALYSIS*

Donald I. Van Ryk and Sundararajan VenkatesanDagger

From the Laboratory of Molecular Microbiology, NIAID, National Institutes of Health, Bethesda, Maryland 20892

    ABSTRACT
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

The kinetics of interaction between the human immunodeficiency virus-1 Rev protein and its RNA target, Rev response element (RRE) RNA was determined in vitro using a biosensor technique. Our results showed that the primary Rev binding site is a core stem-loop RNA molecule of 30 nucleotides that bound Rev at a 1:1 ratio, whereas the 244-nucleotide full-length RRE bound four Rev monomers. At high Rev concentrations, additional binding of Rev to RRE was observed with ratios of more than 10:1. Because RRE mutants that lacked the core binding site and were inactive in vivo bound Rev nonspecifically at these concentrations, the real stoichiometric ratio of Rev-RRE is probably closer to 4:1. Binding affinity of Rev for RRE was approximately 10-10 M, whereas the affinity for the core RNA was about 10-11 M, the difference being due to the contribution of low affinity binding sites on the RRE. Mathematical analysis suggested cooperativity of Rev binding, probably mediated by the Rev oligomerization domains. C-terminal deletions of Rev had no effect on RRE binding, but truncation of the N terminus by as few as 11 residues significantly reduced binding specificity. This method was also useful to rapidly evaluate the potential of aminoglycoside antibiotics, to inhibit the Rev-RRE interaction.

    INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

The genome of HIV-11 is transcribed as a full-length 9-kilobase mRNA that can follow two different "pathways" (1-4). Early in infection, the primary HIV transcript is fully spliced to mRNAs of approximately 2 kilobases in length and then transported from the nucleus to the cytoplasm, where the mRNAs are translated into a variety of small accessory proteins, such as Tat, Rev, and Nef (3-8). Later in the virus lifecycle, unspliced or partially spliced RNAs are exported from the nucleus to the cytosol, where the unspliced RNA is packaged into virus particles; the different partially spliced mRNAs are translated into Gag, Pol, Env, and smaller proteins, such as vif, vpR, and vpU (4, 6-10). This temporal switch in the HIV RNA complexity and the coding potential is mediated by virus coded Rev protein (11-19), an approximately 16-kDa basic RNA-binding protein with two functional domains (Fig. 1A). The N-terminal domain is involved in RNA binding and oligomerization (20-25), whereas the more C-terminal activation domain (13, 26-30) is thought to interact with the nuclear pore-associated proteins, such as hRIP/Rab (31-35), CRM1 (36-39), and nuclear eIF-5A (40, 41). In the absence of Rev, the RNA transcript is fully spliced; the full-length transcript is never observed in the cytoplasm (3, 8, 9, 13, 16-19).

Rev binds specifically to a highly structured 244-nucleotide RNA sequence, the Rev response element (RRE), located in the env gene of the primary transcript (16, 42, 43); this RNA binding (43-48) is essential for the nuclear export of unspliced and partially spliced HIV mRNAs (8, 9, 15, 16,). Lack of functional Rev or RRE completely blocks viral replication. The secondary structure of the RRE RNA is presumed to fold into four stem-loops, designated A, C, D, and E (47) or stem-loops I, III, IV, and V (16), which have branched stem-loop structure, B/B1/B2 (47); or into stem loop II A/B/C (16), linked by a central loop (Fig. 1B). Several studies have shown that most of this RRE structure is dispensable for Rev activity, that a minimal structure composed of the B/B1/B2 (or stem loop II A/B/C) subdomain was active both in vitro and in vivo, and that specific mutations within this region eliminate Rev binding in vitro and trans-activation in vivo (47-58). Notwithstanding the functional definition of the minimal Rev-responsive sequence, Mann et al. (59) have reported that a larger RRE-RNA structure of 351 nucleotides is required for complete biological activity. According to their model, the larger RRE is deemed to act as a "molecular rheostat," which binds multiple Rev monomers up to a functionally optimal threshold of 10-12 Rev monomers per RNA molecule. Furthermore, although a number of groups have demonstrated that a single Rev monomer bound to a high affinity site on the RRE, after which additional Rev molecules were recruited through protein-RNA and protein-protein interactions (20, 58, 60, 61), others have shown that Rev bound to its target RNA in an oligomeric form (62, 63).

Although Rev-RRE interaction has been extensively studied, a number of fundamental questions remain to be answered. These include whether Rev acts solely to transport RRE-containing RNA to the cytoplasm or also actively inhibits splicing, the precise number of Rev monomers bound to each RRE, whether Rev monomers bind sequentially or in oligomeric form and whether this binding is cooperative, and precise knowledge of the various rate constants of Rev-RRE binding. We used surface plasmon resonance (SPR) measurements (see Refs. 63 and 64 for review) to determine the kinetics of Rev-RRE binding. We developed a novel approach to bind RNA to the sensor surface. Rev in solution was then passed through the flow cell under conditions that allowed Rev-RRE interaction. The accumulation of macromolecules on the sensor surface alters the refractive index of the solution in the vicinity of the surface, which is detected and quantified by the instrument, Biacore 2000 (Biacore Inc., Piscataway, NJ). Depending on the binding conditions, initial velocity or steady-state kinetic data can be collected in real time. Our results show that RRE can be subdivided into the following: 1) a minimal site that interacts with one molecule of Rev, 2) a core site that can bind at least two Rev monomers, and 3) the full-length RRE that binds four Rev molecules. With excess Rev concentration, additional binding to other low affinity sites was observed. The high affinity interactions were very strong and specific, with KD values in the 10-10 to 10-11 M range. Finally, this method can be used to rapidly and conveniently investigate RNA-protein interactions in general and was quite useful in rapidly evaluating the effects RNA and protein mutations on the binding, as well as inhibitors of these interactions.

    EXPERIMENTAL PROCEDURES
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

Construction and Amplification of RRE Element DNA Fragments-- The RRE element had been subcloned form the proviral plasmid pNL432 (positions 7749-7992, 244 base pairs) as described (47). RRE mutants used here have been described in Refs. 47 and 56, except for the B/B1/B2 stem-loop RRE fragment (RRE/SLIIB, spanning nucleotides 53-110, but deleting nucleotides 90-104) (Fig. 2A), which was generated by hybridization of two oligonucleotides tagged with the bacteriophage T7 RNA polymerase promoter and (dT)18 at the 5'- and 3'-ends, respectively. All other RRE DNA elements were amplified and tagged at the 5'-end with a T7 promoter and at the 3'-end with (dT)18 by PCR using oligonucleotides complementary to the 5'- and 3'-ends of the desired RRE element at the following positions (47, 56): RRE, RRE-3A, and RRE/Z, 5'-positions 1-18, 3'-positions 227-244; RRE/T, 5'-positions 40-57, 3'-positions 196-213; RRE/HH, 5'-positions 50-68, 3'-positions 96-113. The TAR-DNA element used was generated by hybridization of the following oligonucleotides tagged at the 5'-end with the T7-RNA polymerase promoter and with a (A)18 tail at the 3'-end: 5'-TGAATTGTAATACGACTCACTATAGGCTTTTTGCCTGTACTGGGTCTCT CTGGTTAGACCAGATCTGAGCCTGGGAGAAAAAAAAAAAAAAAAAAA-3' and 5'-TTTTTTTTTTTTTTTTTTCTCCCAGGCTCAGATCTGGTCTAACCAGAGAGACCCAGTACAGGCAAAAAGCCTATAGTGAGTCGTATTACAATTCA-3'.

In Vitro RNA Synthesis and Purification-- T7 promoter-tagged PCR amplified RRE DNA fragments (0.5 pmol) were used as templates to transcribe RRE RNA (47, 56) using the Riboprobe Gemini Systems kit from Promega Corp. (Madison, WI). Full-length RNA tagged at the 3'-end with (A)18 was purified by hybridization to oligo(dT)25 linked magnetic beads (Dynal Corp., A.S., Oslo, Norway) as follows. The beads (50 µl) were washed twice as described by the manufacturer in deionized water and once in hybridization buffer (30 mM sodium phosphate, pH 7.4, 450 mM NaCl, 3 mM EDTA, 0.1% Triton X-100) and suspended in 25 µl of the same buffer. Freshly transcribed RNA (1 µmol) in 25 µl of hybridization buffer was added to the beads and incubated with occasional mixing for 30 min at room temperature. The beads were immobilized with a magnet and washed twice with 100 µl of fresh hybridization buffer. Bound RNA was eluted by adding 50 µl of deionized water and incubating for 5 min at room temperature. The beads were again immobilized using a magnet and the eluted RNA was ethanol precipitated and made up to a final concentration of 0.5 mg/ml in TE buffer (10 mM Tris-HCl, pH 8.0, and 1 mM EDTA).

Proteins and Peptides-- HIV-1 Rev and Nef proteins were expressed in Escherichia coli from the thermally inducible coliphage lambda  pL promoter and purified as described (66). Before use in these experiments, the previously purified Rev protein was reassessed by gel electrophoresis and gel filtration under denaturing conditions. The RRE RNA binding potential was determined by electrophoretic mobility shift assay (EMSA) and filter binding assays as described (47, 56). The in vivo functional potential of Rev protein and Rev domain peptides were determined by protein transfection (67) in Rev-dependent HIV-1 gag expression assay essentially as described (47, 56). Wild type Rev fused to MS coliphage-2 coat protein (MS2-C) and mutant versions of Rev in the same context were expressed in E. coli (68), molecularly tagged to maltose-binding protein. For SPR use, the maltose-binding protein moiety was excised by protease X digestion and further purified as described (68). The different Rev peptides used in this study were purified by two cycles of reversed phase high pressure liquid chromatography on C18 columns, and their purity was checked by automated Edman degradation through 30 or 40 cycles and mass spectrometry. RRE RNA binding potential of individual peptides was also determined by EMSA and filter binding assay in the presence of heparin, but without tRNA competitor (47, 56).

SPR Analysis of Rev-RRE Interactions-- A Biacore 2000TM instrument was used throughout this study. A 5'-biotin U-(dT)18 oligomer (5 µM in 20 mM Tris-HCl, pH 7.4, containing 0.15 M NaCl) was bound to the surface of streptavidin-coated sensor chips (Biacore Inc.) at a flow rate of 5 µl/min for 10 min. The chips were then washed 5 times with 25 µl each of 50 mM NaOH at a flow rate of 5 µl/min to stabilize the surface prior to the binding of RNA. (A)18 containing RRE RNAs were immobilized in each flow cell by hybridization to the 5'-biotin U-(dT)18 oligomer in running buffer (10 mM HEPES, pH 7.4, 450 mM NaCl, 3 mM EDTA, 0.1% Triton X-100) at a flow rate of 1 µl/min at 25 °C. The duration of each injection was varied depending on the surface RNA density that was desired for each individual experiment. All RNAs were activated by sequential incubation at 42 °C, at room temperature, and on ice, each for 10 min in running buffer prior to injection over the sensor chip. Following RNA loading, 20 µl of protein dissociation buffer (10 mM HEPES, pH 7.4, 250 mM NaCl, 3 mM EDTA, 0.05% Triton X-100, 0.1% SDS) was passed over the surface at a flow rate of 10 µl/min to ensure that all RNAs were tightly bound. In general, RNA chips with between 10 response units (RUs) (low density) and 200 RUs (high density) immobilized RNA were used in the various experiments. Purified protein in running buffer was passed over the RNA surface through multiple rounds at a flow rate of 10-100 µl/min depending on whether data pertaining to steady-state or initial velocity conditions were to be collected. Bound proteins were completely removed after each round of injection by passing 20 µl of dissociation buffer at a flow rate of 10 µl/min over the sensor surface. This treatment did not remove more than 1% of bound RNA over the course of the experiment. To regenerate the surface, the RNA was completely removed by injecting 75 µl of 50 mM NaOH at a flow rate of 25 µl/min, allowing the sensor chip to be reused multiple times.

Data Analysis-- Nonlinear fitting of the primary sensogram data was used to calculate the association and dissociation rate constants using the BIAevaluation 2.1 software (Biacore Inc.) and as recommended (69, 70). The dissociation rate constants, kd1 and kd2, for two parallel dissociation reactions, were derived for Rev binding to RRE, RRE/T, and RRE/HH using the equation,
R(t)=R<SUB>1</SUB><UP>e</UP><SUP><UP>−</UP>k<SUB>d1</SUB>(t−t<SUB>o</SUB>)</SUP>+(R<SUB>o</SUB>−R<SUB>1</SUB>)<UP>e</UP><SUP><UP>−</UP>k<SUB>d2</SUB>(t−t<SUB>o</SUB>)</SUP> (Eq. 1)
where R(t) is the response at time t (in seconds), Ro is the total response at the start of dissociation at to, R1 is the contribution to R0 from component 1, (Ro - R1) is the contribution to Ro from component 2. The association rate constants, ka1 and ka2, for Rev binding to two ligand components on RRE, RRE/T, and RRE/HH were then derived using the equation,
R(t)=R<SUB><UP>eq1</UP></SUB>(1−<UP>e</UP><SUP><UP>−</UP>(k<SUB>a1</SUB>C<UP>+</UP>k<SUB>d1</SUB>)(t<UP>−</UP>t<SUB>o</SUB>)</SUP>)+R<SUB><UP>eq2</UP></SUB>(1−<UP>e</UP><SUP><UP>−</UP>(k<SUB>a2</SUB>C<UP>+</UP>k<SUB>d2</SUB>)(t<UP>−</UP>t<SUB>o</SUB>)</SUP>) (Eq. 2)
where Req1 and Req2 are the steady state response levels for components 1 and 2, respectively, C is the molar concentration of the analyte, and to is the start time for association. The dissociation rate constant, kd, for Rev binding to the single site on RRE/SLIIB was derived using the equation,
R(t)=R<SUB>o</SUB><UP>e</UP><SUP><UP>−</UP>k<SUB>d</SUB>(t<UP>−</UP>t<SUB>o</SUB>)</SUP> (Eq. 3)
where R(t) is the response at time t (in seconds), Ro is the response at the start of dissociation, and to is the start time for dissociation. The association rate constant, ka, for the single site Rev-RRE/SLIIB binding reaction was derived using the equation,
<UP>R</UP>(<UP>t</UP>)= <UP>R</UP><SUB><UP>eq</UP></SUB>(<UP>1-e<SUP>−</SUP></UP>(<UP>k</UP><SUB><IT>a</IT></SUB><UP>C</UP>+ <UP>k</UP><SUB><IT>d</IT></SUB>)(<UP>t−to</UP>) (Eq. 4)
where Req is the steady state response level, C is the molar concentration of the analyte, and kd is the dissociation rate constant. Affinities were calculated from the rate constants; KD = kd/ka.

    RESULTS
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

RNA Preparation and Binding Protocol-- The HIV-1 Rev protein is crucial for virus replication; viral replication is abolished in the absence of functional Rev. Fig. 1A shows the crucial functional domains of Rev located between amino acids 22 and 85, and the putative secondary structure of the cognate RNA target, the RRE, is shown in Fig. 1B. Kinetic analysis of Rev-RRE interactions was done by means of SPR measurements using a biosensor instrument, Biacore 2000. For this purpose, we bound the different RNA targets to the sensor surface, rather than Rev, because the locally high density of multiple immobilized Rev monomers may induce unwanted aggregation and trap free-flowing RRE-RNAs nonspecifically. To immobilize different RNAs in an easily reversible manner, we developed a novel hybridization technique, shown diagrammatically in Fig. 1B, that is a modification of the technique described by Wood (71) for DNA-DNA hybridization. Briefly, RRE-DNA fragments tagged at the 5'-end with the T7-RNA polymerase promoter, and 18 dT nucleotides at the 3'-end were generated by PCR (see under "Experimental Procedures"). 3'-poly(A)-tailed RRE RNA was synthesized by T7 transcription, purified by oligo(dT) chromatography, and then hybridized to a biotin-U-(dT)18 oligomer that had been previously bound to a streptavidin-derivatized sensor chip. Using this protocol, the RNA molecules were all presented in the same orientation, which could freely interact with Rev. Injection of a low salt buffer containing 0.1% SDS effectively removed bound Rev at the end of each sensogram run without removing the RNA. The total amount of RNA lost from the sensor surface over the course of a typical experiment was less than 1% (data not shown). To completely regenerate the sensor chip, the RNA was removed by brief injection of 50 mM NaOH, allowing the chip to be re-used multiple times with different RNA preparations.


View larger version (38K):
[in this window]
[in a new window]
 
Fig. 1.   Schematic diagram of Rev, secondary structure of RRE RNA, and overview of the RNA capture and SPR protocol. A, schematic illustration of HIV-1 Rev protein with the putative functional domains involved in nuclear localization and RNA binding, oligomerization, and activation highlighted and identified. B, (dT)18 oligomer biotinylated at the 5'-end was bound to streptavidin covalently linked to a carboxymethyl dextran matrix attached to a thin gold film over a glass support. RRE-RNAs were immobilized by hybridization between the 3'-poly(A) tail and the surface-bound oligo(dT) followed by multiple rounds of Rev injection.

Specificity of Rev-RRE Binding-- To test the specificity of Rev binding in this protocol, Rev was injected over a sensor surface to which either the HIV-1 RRE or the HIV-1 TAR RNA had been bound. As seen in Fig. 3A, Rev binds efficiently to RRE-RNA, but not to the TAR-RNA. A non-RNA-binding protein, HIV-1 Nef, was also tested with both RNA chips as an additional control for nonspecific interactions. As expected, Nef did not bind to these surfaces. Rev also did not bind to the surface of flow cells lacking bound RRE-RNA. An "empty" flow cell was used routinely as a background control (not shown).

The specificity of Rev-RRE interaction was also tested by competitive inhibition of Rev binding. 50 nM Rev was preincubated with increasing concentrations of either RRE/HH (nucleotides 50-113 of RRE (Fig. 2A)) lacking the poly(A) tail or yeast tRNA prior to injection over a sensor surface to which RRE/T (nucleotides 39-214 of RRE) (Fig. 2A) had been previously bound. A representative experiment is shown in Fig. 3B. Increasing the concentration of free RRE/HH RNA significantly inhibited the binding of Rev to the surface bound RNA, resulting in a maximal 75% inhibition of Rev binding to the surface bound RRE/T, whereas tRNA had no effect. Relatively high concentration of competitor RNA in solution was required to obtain significant inhibition because under the conditions used in SPR, the local concentration of immobilized RNA was higher than that of the competitor RNA (1-2 µM RRE/HH in solution) required for ~50% inhibition. Furthermore, RRE/HH bound to Rev in solution was in equilibrium and could have dissociated during the analysis, allowing Rev to bind to unoccupied sites on the surface bound RRE/T. In addition, RRE/T has four Rev binding sites, whereas RRE/HH has only two (see below). RRE/HH was used as the competitor RNA here because sufficiently high concentrations of the larger RNAs proved too difficult to manipulate under these conditions.



View larger version (56K):
[in this window]
[in a new window]
 
Fig. 2.   Structure and sequence of RNAs and proteins. A, putative secondary structures of various RRE RNAs used in this study. Full-length HIV-1 RRE, a 244-nucleotide sequence used in this study, is shown; RRE/T is a truncation mutant containing nucleotides 40-213 of the RRE; RRE/HH denotes nucleotides 50-113 (stem/loops B/B1/B2); RRE/SLIIB is composed of stem/loop B/B1 includes nucleotides 51-89 appended to nucleotides 105-110; RRE/Z is RRE from which the stem/loops B/B1/B2 (nucleotides 50-113) had been excised; and RRE-3A is a mutant RRE in which three Gs (denoted by arrows) at positions 56-58 had been exchanged for three As. B, amino acid sequence of different Rev proteins described in the text. Wherever appropriate, deleted residues are indicated by dashes. REV T 87 refers to Rev protein truncated at the 87th residue. REV Delta 25-34/MS-C denotes a REV/MS2 coat protein fusion containing a deletion of REV residues 25-34. The Rev sequence with the deletion (denoted by dashes) stops at the arrow, and italics denote the MS-2 coat protein sequence beyond this point. REV 12-88 and REV 17-87 are synthetic peptides encompassing residues 12-88 and 17-87 respectively. Other peptides shown include REV 22-86Delta 25-34, a REV peptide of residues 22-86 and containing a deletion of residues 25-34; REV 22-86Delta 53-66, sequence 22-86 with a deletion of residues 53-66; REV 22-86Delta 24-34Delta 53-66, sequence 22-86 with deletions of residues 24-34 and 53-66; REV 22-40:DLRE:45-60, sequence between residues 22 and 60 and containing a DLRE (underlined italics) substitution for residues 41-44; and REV 22-40:KKKK:45-60, sequence between residues 22 and 60 and containing a KKKK (underlined italics) substitution for residues 41-44.


View larger version (16K):
[in this window]
[in a new window]
 
Fig. 3.   Specificity of Rev-RRE binding and competitive inhibition. A, overlay sensogram plots of 100 nM HIV-1 Rev or Nef proteins injected at 100 µl/min over a sensor surface to which either HIV-1 RRE or TAR RNAs had been bound. The arrow indicates the end of the association phase and start of the dissociation phase. B, Rev interaction with the RRE sensor in the presence of increasing amounts of RRE/HH RNA or yeast tRNA in solution. Data are plotted as percentage of resonance signal obtained with 100 nM Rev in the absence of any RNAs in solution. .

Equilibrium Binding and Stoichiometry of Rev-RRE Interactions-- The stoichiometry of Rev-RRE binding was determined by equilibrium binding protocols described under "Experimental Procedures." Briefly, increasing concentrations of Rev was injected at low flow rates for extended times (5 µl/min for 20 min) over a sensor chip to which precisely known quantities of RNA had been bound. A typical example of sensogram series of Rev interacting with the full-length RRE-RNA is shown in Fig. 4A. The total amount of bound Rev was measured 5 s before the end of the injection/association phase (arrow), which was then followed by a short dissociation phase. For clarity, the regeneration phase of each run has been omitted in this figure. Because the amounts of bound RNA and protein are both known, the ratio of protein:RNA can be calculated using the conversion factors; 1 RU of RNA bound = 0.8 pg of RNA/mm2 flow cell surface area, and 1 RU of protein bound = 1 pg of protein/mm2 (65, 72, 73).2 Fig. 4B shows the results of these analyses with different RRE-RNAs used in this study. Each point on the different plots represents the average of at least three independent runs using different batches of the respective RNAs. As expected, Rev associated efficiently with RRE and RRE/T RNAs, but the amount of Rev bound leveled off at approximately four Rev monomers per molecule of RNA at about 350-400 nM of injected Rev. However, at 400 nM Rev, a breakpoint was reached at which the amount of Rev bound to the full-length RRE increased rapidly to a ratio of more than 10:1 at 1 µM injected Rev. This was also obvious from closer inspection of the sensograms in Fig. 4A. Unlike the sensogram run at 400 nM Rev, in which a state of equilibrium was reached relatively early in the injection phase, sensograms at Rev inputs greater than 400 nM display an increase in the resonance signal as additional Rev is bound throughout the time course of the experiment. Runs at lower analyte (Rev) concentrations also have a gently rising slope as the core (high) affinity sites were loaded; runs at 50 or 100 nM Rev have, in addition, a rapidly increasing signal early in the association phase as the core RRE site becomes saturated. With a truncated RRE, RRE/T (Fig. 2A), which lacked most of stem/loop A, no break point between two classes of binding sites was evident (Fig. 4B). RRE/T RNA bound only four Rev monomers. In contrast, two other RRE mutants, namely RRE/Z, deleted for the core binding site, and RRE-3A, wherein the three Gs at the core site were changed to three As (Fig. 2A), bound little or no Rev at low concentrations of the protein (as expected from their null phenotypes). However, with high Rev input; i.e. 300 nM for RRE/Z or 400 nM for RRE-3A), there was significant protein binding. This suggested that although initial nucleation of these mutant RNAs is inefficient, once the Rev monomer bound to these RNAs, the protein could quickly accumulate, possibly aided by protein-protein interactions. As the size of the RNA decreased, the number of Rev monomers that can bind was also reduced. Even at the highest concentrations of injected Rev, no more than one Rev monomer was bound to the minimal RNA, RRE/SLIIB (Fig. 2A), whereas the RRE/HH bound two Rev monomers (Fig. 4B). Taken together, these results suggested the presence of two classes of Rev binding sites on the RRE, which are designated as high and low affinity binding sites. They also showed that protein interactions through the Rev oligomerization interphase were in and of themselves insufficient to permit the accumulation of Rev on the sensor surface unless a sufficiently large RNA target was available.


View larger version (21K):
[in this window]
[in a new window]
 
Fig. 4.   Equilibrium binding of Rev to RRE and calculated Rev-RRE stoichiometries. A, sensogram runs at different Rev concentrations under conditions approaching equilibrium (flow rate < 10 µl/min). The arrow denotes the point at which injection was switched to dissociation buffer. B, plot of relative stoichiometry of Rev per immobilized RRE RNA species. Individual graphs represent the number of Rev monomers bound to the respective RNAs plotted as a function of Rev concentration (in nM). Each point (with error bars) represents the average of three independent experiments with different preparations of each RNA species.

Rev-RRE Binding Kinetics-- The presence on RRE of both high and low affinity binding sites for Rev had a significant effect on the calculation of the kinetics of Rev-RRE interaction. As seen in Fig. 5, A and B, a very close fit to the primary sensogram was calculated for Rev binding to the truncated RNAs, RRE/SLIIB and RRE/HH, respectively, with the best fit curves generated using the BIAevaluation 3.0 (Biacore Inc.) software (heavy dashed lines) almost completely superimposable over the experimental plots. The association kinetics were not significantly affected by changes in the flow rate or density of RNA on the sensor surface (data not shown), indicating that mass transport limitations were not a factor under these experimental conditions. However, for the larger RNAs, RRE/T (Fig. 5C) and RRE (Fig. 5D), the calculated fits deviated significantly from the experimental plots, thus contributing significantly to errors in the determination of binding affinities of Rev for these large RNAs. The presence of more than one on-rate for the binding of Rev to the full-length RRE may account for these discrepancies. Although not obvious in the primary sensograms, transformation of the association phase of the sensogram revealed a significant increase in the rate of Rev binding to RRE as the concentration of Rev was progressively increased (Fig. 6A). Whether this resulted from increased accessibility of Rev to the low affinity binding sites on RRE, reflected potential cooperativity in Rev binding (mediated through the oligomerization domains of the protein), or a combination of both could not be determined.


View larger version (35K):
[in this window]
[in a new window]
 
Fig. 5.   Binding kinetics of Rev to target RNAs and calculated best fits. Sensogram profiles of Rev binding to RRE/SLIIB (A), RRE/HH (B), RRE/T (C), and full-length RRE (D) RNA sensor surfaces. In each panel, sensograms obtained with different Rev inputs (denoted inside each panel) are overlaid. The best theoretical fit (denoted by the heavy dashed line) for each sensogram was calculated using BIAevaluation 3.0 software and is overlaid on each plot.


View larger version (26K):
[in this window]
[in a new window]
 
Fig. 6.   Analysis of association and dissociation phases of Rev binding to RRE. A, data points corresponding to the association phase of each sensogram are presented as derivative semi-log plots (ln(dRU/dT)) versus time (in seconds). Individual plots correspond to results obtained for sensogram runs with different Rev inputs. B, data points corresponding to the dissociation phase of each sensogram are presented as semi-log plots of [ln(RU0/RUn)] versus time. Individual plots correspond to results obtained for sensogram runs with different Rev inputs.

Transformation of the data from the dissociation phase of the sensograms representing Rev interaction with the larger RNAs also revealed significant deviations in the observed off-rates (as indicated by the slopes) that were more pronounced for sensograms generated at high Rev inputs (Fig. 6B). The apparent initial rates of dissociation of Rev from RRE increased significantly for all sensogram runs performed at Rev concentrations exceeding 500 nM. Presumably, at these higher protein concentrations, the dissociation rates of the low affinity binding sites predominate. As a consequence, the estimates of the dissociation rate constants were made using data generated with less than 400 nM injected Rev. However, even at these levels, two different off-rates could be calculated in which the rate of dissociation from the low affinity site is 3 orders of magnitude faster (~10-2 versus ~10-5, Table I) than that seen for the high affinity site. The above considerations resulted in some ambiguities in the calculated affinity constants for Rev interaction with the larger RNAs, shown in Table I. Similar analyses of sensograms of Rev interaction with the truncated targets, RRE/HH and RRE/SLIIB, did not reveal such discrepancies in the off-rates at different Rev inputs (data not shown). But experiments with the truncated RNAs allowed us to calculate a binding affinity constant (KD) of 4 × 10-11 (Table I) for Rev interaction with the high affinity site with high confidence in light of the close theoretical fits obtained for these interactions (Fig. 5, A and B). The substantially lower affinities of Rev for RRE and RRE/T implied in these calculations are most likely a reflection of the contributions of low affinity site binding. The apparent association rate constants (ka1 and ka2) for the low and high affinity sites are not too different, which may be due to the rapid association rate of Rev for the high affinity site masking the potential differences in the association rate for the low affinity sites.

                              
View this table:
[in this window]
[in a new window]
 
Table I
Rate constants and affinities of Rev for different RRE and mutant RRE RNAs

Mass transport of the analyte, in this case, Rev to the surface bound ligand can, under certain conditions be rate-limiting. This may introduce errors in the calculation of molecular on and off rates. To determine whether Rev was mass transport limited, the Rev-RRE interaction was examined at various flow rates and RNA surface densities. No significant difference in the Rev-RRE binding kinetics could be detected (data not shown), indicating that mass transport limitations were not a factor under our experimental conditions.

Effect of Rev Mutations on RRE Binding-- As shown in Fig. 1A, Rev contains multiple functional domains, with the extreme N and C termini considered nonessential to Rev function. To test the effects of mutations in these functional regions on Rev-RRE interactions, we injected a variety of Rev mutant proteins or peptides over surfaces to which the different RNAs had been bound. As shown in Fig. 7A, the C-terminal region of Rev is not essential for RNA binding because the termination mutant RevT87 (Rev terminated at amino acid 87) bound RRE very efficiently. This mutant protein behaved in all respects like the full-length Rev (not shown). By contrast, even short deletions of the N-terminal portion of Rev had a profound effect on the behavior of the protein. The two peptides Rev12-88 and Rev 17-87 appear to bind very well to the RRE loaded flow cell used here (see Fig. 7, C and E, respectively). However, these peptides also bound almost as well to the empty flow cell, which lacked even the biotin-U(dT)18 linker (see Fig. 7, D and F). This is in marked contrast to RevT87, which does not bind to the empty flow cell (Fig. 7B). The deflection observed in Fig. 7B is due to the increased refractive index of the injected solutions that contain increasing concentrations of protein, and not to specific binding. Proteins or peptides containing deletion mutations in the oligomerization domains (M42 (RevDelta 25-34/MS-C), Rev22-86Delta 25-34, and Rev22-86Delta 53-66 or Rev22-86Delta 24-34Delta 53-66) did not bind to any RNA used (data not shown). Similarly, peptides with mutations in the RNA binding domain (e.g. 22-40:DLRE:45-60 or 22-40:KKKK:45-60, each replacing four arginines at positions 41-44) also did not bind to any of the RNAs used here (data not shown). This confirmed previous results (13, 20-25, 75) demonstrating the importance of this region of Rev to stable RNA binding.


View larger version (37K):
[in this window]
[in a new window]
 
Fig. 7.   Specificity of binding of Rev peptides to sensor surfaces with or without immobilized RNAs. Sensograms profiles of Rev protein truncated at residue 87 binding to RRE (A) or a control chip (B); synthetic Rev peptide, Rev12-88 of residues 12-88 with RRE (C) or control chip (D); and synthetic Rev peptide, Rev17-87 with RRE (E) or control chip (F). The different plots in each panel represent sensogram runs at different Rev or peptide concentrations.

Evaluation of Inhibitors of Rev-RRE Interactions-- It has been previously reported (76) that small molecules that bind RNA, such as the aminoglycoside antibiotics (e.g. neomycin B), can inhibit the binding of Rev to RRE. To investigate whether this method could be used to rapidly evaluate this inhibitory reaction, Rev, at a concentration of 100 nM, was incubated with increasing concentrations of either neomycin B or hygromycin B prior to injection over a sensor surface to which RRE/T had been bound. As seen in Fig. 8A, neomycin B efficiently inhibited the binding of Rev to the RNA, with maximal inhibition between 10 and 25 µM of the antibiotic. In contrast, hygromycin B did not inhibit Rev binding at any concentration tested (Fig. 8B). Kanamycin A and tetracycline were tested as well, and neither one inhibited Rev binding (data not shown). These results demonstrated that this technique could be used to screen rapidly and conveniently the effectiveness of potential inhibitors of Rev-RRE and, by extension, any RNA-protein interactions in real time.


View larger version (25K):
[in this window]
[in a new window]
 
Fig. 8.   Inhibition of Rev-RRE interaction by antibiotics. Sensogram overlay plots of 100 nM Rev preincubated with increasing concentrations of neomycin B (A) or hygromycin B (B) binding to RRE/T. Specific concentrations of the indicated antibiotics are shown.


    DISCUSSION
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

Using SPR to investigate RNA-protein interactions has a number of advantages over traditional methods, such as EMSA (77) or filter binding assay (78). The SPR technique provides kinetic data more conveniently than other techniques and allows a rapid evaluation of potential inhibitors of these interactions. Besides these obvious advantages, the SPR method provides a more precise determination of both initial velocity and steady-state parameters. In the EMSA and the filter binding method, substantial time elapses before the RNA-protein complexes are quantitated. As such, in a complex interaction involving multiple binding sites on the RNA, the kinetic parameters evaluated by these methods may reflect a pseudo-steady-state averaging of individual interactions. This results in a wide distribution of RRE-Rev complexes of different stoichiometries appearing as discrete bands in EMSA gels. Whereas this pseudo-steady-state analysis may not be a problem if the low affinity interactions have fast off rates, the high levels of Rev (µM versus nM in the SPR) used in the EMSA may spuriously reinforce the low-affinity interactions through nonspecific trapping of RNA by Rev oligomers. Filter binding assays in general use a lower range of protein concentration and are therefore comparable with the SPR assays. Although individual kd for RRE-Rev interactions can be estimated fairly well by filter binding assays, this method is inadequate for obtaining directly, precise estimates of the chemical on rates (ka), because even at low concentrations of Rev, the system approaches equilibrium within 5 min (Fig. 4A).

The RNA capture technique described here resulted in a stable sensor surface that could be used through multiple rounds of protein binding but still allowed complete regeneration of the surface, permitting reuse with different RNAs. Immobilizing the RNA at its 3'-end through a rigid RNA-DNA hybrid presents the ligand in the same orientation, unlike the situation when proteins or RNAs are bound directly to the dextran surface of the chip. This is particularly crucial in systems such as this, in which multiple Rev monomers bind to the RNA. As such, it would be difficult, if not impossible to determine the stoichiometry of Rev-RRE binding if Rev was constrained by being bound to the chip. In fact, attempts to link Rev to the dextran matrix followed by injection of soluble RRE were unsuccessful (data not shown).

One area of continued controversy involves the stoichiometry of Rev-RRE interactions. Several studies have shown that between 8 and 10 Rev molecules bind to the 244-nucleotide RRE in vitro (44, 45, 47, 50, 52, 53, 60) and Rev multimers on RRE may be necessary for trans-activation (54, 61, 62). Mann et al. (59) have claimed that the functional RRE sequence is substantially larger than previously described and that complete trans-activation requires 10 or more Rev molecules bound per RRE. Although our full-length RRE (described as truncation 3 by Mann et al. (59)) was capable of binding 10 or more Rev monomers (Fig. 4B), these high ratios represent an extreme case with high Rev inputs. Our RRE RNA bound Rev very efficiently, reaching a plateau of 4:1 (Rev-RRE) at approximately 400 nM injected Rev, and showed significant activity in vivo. On the other hand, both RRE-3A and RRE/Z, mutant RNAs that inactivate or delete the core binding site for Rev (Fig. 2A), bound little or no Rev at low concentrations of the injected protein, but at higher concentrations (300-400 nM), Rev accumulates on these RNAs. Because both of these mutant RNAs are inactive in vivo (47, 56), we feel that the Rev binding to the mutant RNAs seen in SPR assay is directed to the low affinity sites that may be unavailable under conditions that exist in infected cells. In other words, although it is possible to force the RNAs to bind large amounts of Rev in vitro, the in vivo relevance of these results is questionable.

Another difference between these results and those of Mann et al. (59) is that they only detected a 2:1 Rev:RNA ratio with their truncation 5 mutant, which is a rough equivalent of RRE/T species described in this manuscript. We obtained a 4:1 Rev:RNA ratio for RRE/T RNA with binding kinetics essentially identical to that of Rev binding the full-length RRE. A maximal 2:1 ratio was obtained in our assay only with a considerably smaller target RNA such as RRE/HH (stem/loops B/B1/B2). Reducing the size further (RRE/SLIIB) yielded an RNA molecule that bound Rev at a 1:1 ratio and still retained a somewhat reduced in vivo Rev response (54, 56, 58). Kinetic analysis (see below) confirmed that this was the core high affinity Rev binding site.

There has been some dispute regarding whether Rev binds the RRE as a monomer or whether protein multimerization is a prerequisite for RNA binding. Although the kinetics presented here cannot settle this dispute, the fact that the minimal high affinity binding site (RRE/SLIIB) bound Rev at a 1:1 ratio and the slightly larger RRE/HH yields a 2:1 protein:RNA ratio suggested that the initial binding to RRE must involve a Rev monomer, followed by multimerization in situ, in agreement with previous reports (10, 58, 81, 82). It has also been suggested that a critical threshold level of Rev on RRE is required for trans-activation (59, 61, 79, 80) and also that the RRE acts as a molecular rheostat (59) regulating the sequential addition of Rev monomers to achieve the critical threshold. Although the results presented here tend to support these suggestions, we disagree with some of the details. As discussed above, the number of Rev monomers bound to each RRE is unlikely to be more than four in vivo. EMSA of Rev binding to stem II RNA (RRE/HH equivalent) suggested that Rev bound this RNA with a stoichiometry of 3:1 (53). Because RRE/HH preserved only 50% of the in vivo activity obtained with full-length RRE (54, 56), it may be reasoned that four Rev monomers have to be bound to the target for maximal Rev response in vivo. In point of fact, full Rev response was obtained with RNA targets containing a RRE/HH dimer (54, 56), which had a potential to bind four Rev monomers.

A precise determination of Rev binding kinetics was made difficult by the contribution of both high and low affinity binding sites on the RNA and by the presence in Rev of oligomerization domains that may result in cooperative RNA binding. These limitations underlay the inability of the BIAevaluation 3.0 program to provide a good theoretical fit to the sensograms of Rev binding to RRE and RRE/T, whereas excellent fits were possible when the truncated RNA targets RRE/HH and RRE/SLIIB were used. Use of these shorter RNAs reduced or eliminated the contributions of the low affinity binding sites in the larger RNAs and probably precluded the contributions by Rev oligomer binding. Both RRE/HH and RRE/SLIIB showed affinities for Rev on the order of 4 × 10-11 M despite being calculated using different models (double reciprocal plots for RRE/HH and single site model for RRE/SLIIB). The difference in the affinity constants for RRE and RRE/T compared with those for RRE/HH and RRE/SLIIB is undoubtedly due to the residual contributions of the low affinity sites in the larger RNAs in the calculation of the koff functions (Table I, low affinity versus high affinity kd values). The low affinity binding constant, KD, differed by 3-4 orders of magnitude from the high affinity counterpart. The contribution of the low affinity sites is shown by transformation of the dissociation phase of Rev binding (Fig. 6B). The dissociation rates increase substantially at higher concentrations of injected Rev, when the contribution of the low affinity sites might be expected to predominate. Furthermore, the KD values for the RRE and RRE/T, representing the contribution of the high affinity binding site in the double reciprocal plots, imply affinities of Rev for these larger RNAs to be at least an order of magnitude more than the previous estimates (44-47, 49, 81).

Although the calculated association rates of Rev did not vary substantially no matter which RNA was used (Table I), transformation of these data showed changes in the rates of association with increasing concentrations of Rev (Fig. 6A). As the Rev concentration increased, so did the apparent association rate. This phenomenon was not observed with the RRE/SLIIB (data not shown). We interpret these results to be a consequence of cooperative binding of Rev to the RRE, mediated by Rev oligomerization. Because RRE/SLIIB can only bind one molecule of Rev, cooperative binding was not an issue. Furthermore, because Rev bound with high affinity to RRE/SLIIB, this showed that high affinity binding is possible in the absence of multimerization, in agreement with the suggestion of Daly et al. (81, 82).

It has been demonstrated that the C-terminal residues beyond amino acid 87 were dispensable for Rev function (60, 74), and consistent with this, the Rev termination mutant (RevT87) showed good discrimination between RRE/T and the unsubstituted flow cell (see Fig. 7, A and B). In addition, this protein behaved identically to the full-length Rev in all the kinetic measurements (data not shown). This was in contrast to an earlier report that showed by EMSA that residues near the C terminus of Rev beyond position 91 might be required for oligomerization of Rev on the RNA (81). Other studies (63, 82) have suggested that the N-terminal domain of HIV-1 Rev was required for the discrimination between specific and nonspecific RNA binding. The results presented in Fig. 7 seem to support this, but possibly not for the reasons cited by Daly et al. (82). Peptides in which the first 11 or 16 amino acids had been deleted do bind to the sensor surface to which RRE/T had been bound (Fig. 7, C and E, respectively). However, these peptides also had considerable affinity to a flow cell to which neither RNA nor biotin U-(dT)18 linker had been bound (Fig. 7, D and F). The differences in amplitude between the unsubstituted flow cell and the one containing RRE/T could be attributed to at least two factors: either 1) these peptides retain some residual specificity for the RNA over the dextran matrix contained in the flow cell, or 2) the underivatized chip has a larger number of charged sites available for protein binding, or a combination of the two. Even if the observed differences in the sensograms of peptide binding to the RRE versus control chip (Fig. 7, C versus D and E versus F) reflected binding specificity, the rapid dissociation of peptides from the sensor surface precluded derivation of kinetic parameters, reminiscent of the situation when the steady state binding of Rev peptides to RRE was evaluated by EMSA or filter binding assay (82). Although the in vitro peptide binding appeared to be largely nonspecific, Rev domain peptides encompassing residues 17-87 or residues 23-87 were capable of trans-activating RRE RNA targets in vivo but not the mutated RRE counterpart lacking the core site.3 Interestingly, these peptides also activated HTLV-I RexRE RNA and a RRE chimera that had substituted the core site for the MS2 phage translational operator RNA.3 The differences in the in vitro and in vivo behavior of the peptides may be reconciled if it is presumed that the RRE binding by the Rev domain peptide(s) reflects a somewhat nonspecific lower order electrostatic interaction between the arginine forks in the peptide and the phosphate backbone of RNA, similar to the initial "searching and discriminatory" process in the case of Rev as it finally docks on to the active site on RRE RNA through higher order interactions. This idea is bolstered by experiments in which peptides with mutations in the RNA binding domain that replace several arginine residues (e.g. 22-40:DLRE:45-60 or 22-40:KKKK:45-60) do not bind to any surface (data not shown), even though these short peptides are largely unstructured and carry a net positive charge. In vivo, even the lower order interaction between authentic Rev domain peptides and RNA may be sufficiently bolstered by ancillary cellular factors to enable trans-activation in the absence of stringent RNA sequence specificity.

Finally, it has been reported (76) that certain antibiotics can selectively inhibit Rev-RRE interactions. Neomycin B completely inhibited Rev binding to RRE/T (Fig. 8A), whereas hygromycin B (Fig. 8B), tetracycline, or kanamycin A (data not shown) had no inhibitory effects. The maximum inhibitory effect occurred between 10 and 25 µM neomycin B co-injected with Rev, whereas Zapp et al. (76) reported that 1 µM neomycin B produced maximal effects. These differences could be attributed to the fact that in the SPR assay, approximately 12-fold more Rev was used than was the case in gel-shift assay of Zapp et al. (76) (16 ng of Rev versus 1.3 ng). A high Rev concentration was necessary in our case to obtain a good signal in the absence of neomycin. Furthermore, in the kinetic system of the biosensor, Rev and neomycin B are competing for the same binding site (76), and if Rev binds more tightly than the antibiotic to this site, a higher concentration of the antibiotic might be required to obtain maximal inhibition. Nonetheless, these results demonstrate the usefulness of this system to rapidly evaluating potential inhibitors of Rev-RRE interactions.

RNA-protein interactions are a crucial element in cellular metabolism. Although a number of methods are available to investigate these processes, most are tedious and time consuming. The technique outlined here provides a more convenient means of assessing binding kinetics, stoichiometry, specificity, and potential inhibitors of protein-RNA binding in real time, and as such provides a significant advance over the more traditional methods, even in a complex system such as that seen for the HIV-1 Rev and its target, the RRE.

    ACKNOWLEDGEMENTS

We gratefully acknowledge the technical advice from our late colleague, Sergei Khilko of NIAID and NIDDK, National Institutes of Health. We thank Peter Schuck of Bioengineering and Physical Science program at the National Institutes of Health for help and advice in the mathematical analysis and Jonathan Silver and Malcolm A. Martin of the Laboratory of Molecular Microbiology, NIAID, National Institutes of Health, for critical reading of the manuscript. We thank John E. Coligan of NIAID for peptide synthesis.

    FOOTNOTES

* The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

Dagger To whom correspondence should be addressed: NIAID, National Institutes of Health, Bldg. 10, Rm. 6A05, 9000 Rockville Pike, Bethesda, MD 20892-1576. Tel.: 301-496-6359; Fax: 301-402-4122; E-mail: aradhana{at}helix.nih.gov.

2 M. Robinson, personal communication.

3 K.-S. Jeong and S. Venkatesan, unpublished data.

    ABBREVIATIONS

The abbreviations used are: HIV, human immunodeficiency virus; RRE, Rev response element; SPR, surface plasmon resonance; RU, response unit(s); EMSA, electrophoretic mobility shift assay; T, truncated; HH, hammerhead.

    REFERENCES
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES
  1. Muesing, M. A., Smith, D. H., Cabradilla, C. D., Benton, C. V., Lasky, L. A., and Capon, D. J. (1985) Nature 313, 450-458[CrossRef][Medline] [Order article via Infotrieve]
  2. Kim, S. Y., Byrn, R., Groopman, J., and Baltimore, D. (1989) J. Virol. 63, 3708-3713[Abstract/Free Full Text]
  3. Feinberg, M. B., Jarret, R. F., Aldovini, A., Gallo, R. C., and Wong-Staal, F. (1986) Cell 46, 807-817[CrossRef][Medline] [Order article via Infotrieve]
  4. Cullen, B. R. (1992) Microbiol. Rev. 56, 375-394[Abstract/Free Full Text]
  5. Malim, M. H., Hauber, J., Fenrick, R., and Cullen, B. R. (1988) Nature 335, 181-183[CrossRef][Medline] [Order article via Infotrieve]
  6. Ahmad, N., Maitra, R., and Venkatesan, S. (1989) Proc. Natl. Acad. Sci. U. S. A. 86, 6111-6115[Abstract/Free Full Text]
  7. Robert-Guroff, M., Popovic, M., Gartner, S., Markham, P., Gallo, R. C., and Reitz, M. (1990) J. Virol. 64, 3391-3398[Abstract/Free Full Text]
  8. Schwartz, S., Felber, B. K., Benko, D. M., Fenyo, E.-M., and Pavlakis, G. N. (1990) J. Virol. 64, 2519-2529[Abstract/Free Full Text]
  9. Felber, B. K., Hadzopoulou-Cladaras, M., Cladaras, C., Copeland, T., and Pavlakis, G. (1989) Proc. Natl. Acad. Sci. U. S. A. 86, 1495-1499[Abstract/Free Full Text]
  10. Malim, M. H., and Cullen, B. R. (1993) Mol. Cell. Biol. 13, 6180-6189[Abstract/Free Full Text]
  11. Sodroski, J., Goh, W. C., Rosen, C. A., Dayton, A., Terwilliger, E., and Haseltine, W. A. (1986) Nature 321, 412-417[CrossRef][Medline] [Order article via Infotrieve]
  12. Knight, D. M., Flomerfelt, F. A., and Ghrayeb, J. (1987) Science 236, 837-840[Abstract/Free Full Text]
  13. Malim, M. H., Bohnlein, S., Hauber, J., and Cullen, B. R. (1989) Cell 58, 205-214[CrossRef][Medline] [Order article via Infotrieve]
  14. Emerman, M., Vazeur, R., and Peden, K. (1989) Cell 57, 1155-1165[CrossRef][Medline] [Order article via Infotrieve]
  15. Hammarskjold, M.-L., Heimer, J., Hammarksjold, B., Sangwan, I., Albert, L., and Rekosh, D. (1989) J. Virol. 63, 1959-1966[Abstract/Free Full Text]
  16. Malim, M. H., Hauber, J., Le, S.-Y., Maizel, J. V., and Cullen, B. R. (1989) Nature 338, 254-257[CrossRef][Medline] [Order article via Infotrieve]
  17. Felber, B. K., Drysdale, C. M., and Pavlakis, G. N. (1990) J. Virol. 64, 3734-3741[Abstract/Free Full Text]
  18. Cochrane, A. W., Jones, K. S., Beidas, S., Dillon, P. J., Skalka, A. M., and Rosen, C. A. (1991) J. Virol. 65, 5305-5313[Abstract/Free Full Text]
  19. Hammarskjold, M.-L., Li, H., Rekosh, D., and Prasad, S. (1994) J. Virol. 68, 951-958[Abstract/Free Full Text]
  20. Cochrane, A. W., Perkins, A., and Rosen, C. A. (1990) J. Virol. 64, 881-885[Abstract/Free Full Text]
  21. Hope, T. J., Huang, X., McDonald, D., and Parslow, T. G. (1990) Proc. Natl. Acad. Sci. U. S. A. 87, 7787-779[Abstract/Free Full Text]
  22. Bohnlein, E., Berger, J., and Hauber, J. (1991) J. Virol. 65, 7051-7055[Abstract/Free Full Text]
  23. Venkatesh, L. K., Mohammed, S., and Chinnadurai, G. (1990) Virology 176, 39-47[CrossRef][Medline] [Order article via Infotrieve]
  24. Kjems, J., Frankel, A. D., and Sharp, P. A. (1991) Cell 67, 169-178[CrossRef][Medline] [Order article via Infotrieve]
  25. Hammerschmid, M., Palmeri, D., Ruhl, M., Jaksche, H., Weichselbraun, I., Bohnlein, E., Malim, M. H., and Hauber, J. (1994) J. Virol. 68, 7329-7335[Abstract/Free Full Text]
  26. Venkatesh, L. K., and Chinnadurai, G. (1990) Virology 178, 327-330[CrossRef][Medline] [Order article via Infotrieve]
  27. Mermer, B., Felber, B. K., Campbell, M., and Pavlakis, G. N. (1990) Nucleic Acids Res. 18, 2037-2044[Abstract/Free Full Text]
  28. Hope, T. J., Bond, B. L., McDonald, D., Klein, N. P., and Parslow, T. G. (1991) J. Virol. 65, 6001-6007[Abstract/Free Full Text]
  29. Malim, M. H., McCarn, D. F., Tiley, L. S., and Cullen, B. R. (1991) J. Virol. 65, 4248-4254[Abstract/Free Full Text]
  30. Weichselbraun, I., Farrington, G. K., Rusche, J. R., Bohnlein, E., and Hauber, J. (1992) J. Virol. 66, 2583-2587[Abstract/Free Full Text]
  31. Fischer, U., Meyer, S., Teufel, M., Heckel, C., Luhrmann, R., and Rautmann, G. (1994) EMBO J. 13, 4105-4115[Medline] [Order article via Infotrieve]
  32. Fischer, U., Huber, J., Boelens, W. C., Mattaj, I. W., and Luhrmann, R. (1995) Cell 82, 475-483[CrossRef][Medline] [Order article via Infotrieve]
  33. Bogerd, H. P., Fridell, R. A., Madore, S., and Cullen, B. R. (1995) Cell 82, 485-494[CrossRef][Medline] [Order article via Infotrieve]
  34. Stutz, F., Neville, M., and Rosbash, M. (1995) Cell 82, 495-506[CrossRef][Medline] [Order article via Infotrieve]
  35. Fritz, C. C., Zapp, M. L., and Green, M. R. (1995) Nature 376, 530-533[CrossRef][Medline] [Order article via Infotrieve]
  36. Fornerod, M., Ohno, M., Yoshida, M., and Mattaj, I. W. (1997) Cell 90, 1051-1060[CrossRef][Medline] [Order article via Infotrieve]
  37. Fukuda, M., Asano, S., Nakamura, T., Adachi, M., Yoshida, M., Yanagida, M., and Nishida, E. (1997) Nature 390, 308-311[CrossRef][Medline] [Order article via Infotrieve]
  38. Ossareh-Nazari, B., Bachelerie, F., and Dargemont, C. (1997) Science 278, 141-144[Abstract/Free Full Text]
  39. Stade, K., Ford, C. S., Guthrie, C., and Weis, K. (1997) Cell 90, 1041-1050[CrossRef][Medline] [Order article via Infotrieve]
  40. Bevec, D., Jaksche, H., Oft, M., Wohl, T., Himmelspach, M., Pacher, A., Schebesta, M., Koettnitz, K., Dobrovnik, M., Csonga, R., Lottspeich, F., and Hauber, J. (1992) Science 271, 1858-1860[Abstract]
  41. Ruhl, M., Himmelspach, M., Bahr, G. M., Hammerschmid, Jaksche, H., Wolff, B., Aschauer, H., Farrington, G. K., Probst, H., Bevec, D., and Hauber, J. (1993) J. Cell Biol. 123, 1309-1320[Abstract/Free Full Text]
  42. Rosen, C. A., Terwilliger, E., Dayton, A., Sodroski, J. G., and Haseltine, W. A. (1988) Proc. Natl. Acad. Sci. U. S. A. 85, 2071-2075