|
J Biol Chem, Vol. 274, Issue 25, 17605-17611, June 18, 1999
Correction of Large Mispaired DNA Loops by Extracts of
Saccharomyces cerevisiae*
Stephanie E.
Corrette-Bennett ,
Breck O.
Parker§¶,
Natasha
L.
Mohlman , and
Robert S.
Lahue §
From the Eppley Institute for Research in Cancer and
Allied Diseases, University of Nebraska Medical Center,
Omaha, Nebraska 68198-6805 and the § Department of
Biochemistry and Molecular Biology, University of Massachusetts Medical
Center, Worcester, Massachusetts 01655
 |
ABSTRACT |
Single base mispairs and small loops are
corrected by DNA mismatch repair, but little is known about the
correction of large loops. In this paper, large loop repair was
examined in nuclear extracts of yeast. Biochemical assays showed that
repair activity occurred on loops of 16, 27, and 216 bases, whereas a
G-T mispair and an 8-base loop were poorly corrected under these
conditions. Two modes of loop repair were revealed by comparison of
heteroduplexes that contained a site-specific nick or were covalently
closed. A nick-stimulated repair mode directs correction to the
discontinuous strand, regardless of which strand contains the loop. An
alternative mode is nick-independent and preferentially removes the
loop. Both outcomes of repair were largely eliminated when DNA
replication was inhibited, suggesting a requirement for repair
synthesis. Excision tracts of 100-200 nucleotides, spanning the
position of the loop, were observed on each strand under conditions of limited DNA repair synthesis. Both repair modes were independent of the
mismatch correction genes MSH2, MSH3,
MLH1, and PMS1, as judged by activity in mutant
extracts. Together the loop specificity and mutant results furnish
evidence for a large loop repair pathway in yeast that is distinct from
mismatch repair.
 |
INTRODUCTION |
DNA mispairs can be categorized as either single-base mispairs
such as G-T or loops, in which one strand harbors extra nucleotides. Loops can arise in vivo as polymerase slippage events (1, 2) within repeating elements or between duplicated sequences. These looped
mispairs are precursors for insertion mutations if the loop resides on
the newly replicated strand or for deletion mutations if the template
strand contains the heterology. Thus one biological consequence of loop
repair is to reduce mutation rates of insertions and deletions. Looped
mispairs can also occur during genetic recombination. Processing of
loop-containing recombination intermediates plays an important role in
gene conversion of insertions and deletions (reviewed in Ref. 3) and
provides a second, biologically significant role for loop repair. Given
the richness of repeating elements and duplicated sequences in
eukaryotes, genetic stability of these organisms is particularly
dependent on the ability to repair loops of varying sizes. Small loops
are processed by mismatch repair in bacteria, yeast, and mammalian
systems (reviewed in Refs. 4-7), but little is known about the
processing of large loops. The definition of small and large is
dependent on the experimental system, as described below.
In prokaryotes, small loops are substrates for mismatch correction, but
large loop repair is absent or occurs inefficiently. In vivo
experiments with Escherichia coli and pneumococcus indicate that loops up to 4 nt1 are
corrected by mismatch repair, whereas heterologies of 5 bases or more
are usually poorly corrected (8-11). If repair is elicited by a nearby
mismatch, large loops will undergo correction (11). This co-correction
of large loops suggests that they are poorly recognized in bacteria,
rather than being inherently resistant to correction. In
vitro experiments indicate a similar loop size spectrum for
mismatch repair. MutS protein binds loops of 1-4 nt but not a 5-base
loop (10). Mismatch repair-dependent correction in E. coli extracts is efficient for loops up to 7 nt but repair is very
low for 8-22-base heterologies (12). Thus loop repair in prokaryotes
seems limited to small heterologies, and correction is dependent on
mismatch repair. Exceptions have been reported in which large loops are
processed at low levels in E. coli (13, 14).
As summarized below, eukaryotic mismatch repair is active on loops up
to about 12-13 nt. In contrast to bacteria, however, a number of
experiments indicate that eukaryotes also repair large loops, a
possibility that was suggested previously (5). Available evidence
suggests that mismatch repair and large loop repair are distinct
pathways but that their correction activities overlap partially for
certain loop sizes. When transformed into Saccharomyces cerevisiae, plasmids harboring 8- or 12-base heterologies undergo loop correction (15). Repair is partially reduced but not eliminated by
mutation in the mismatch repair gene PMS1 (16). Examination of the mutation rates of microsatellite and minisatellite repeats indicates that loops of 1-13 nt are efficiently repaired by mismatch repair, as mutations in MSH2, MSH3, MLH1, or
PMS1 lead to increased mutation rates for these repeats
(17-20). In contrast, mutation rates of repeating elements of 16 or 20 bp are unaffected by mutations in MSH2, MSH3, or
MSH6 (19). Correction of strand slippage events between
small tandem repeats in the DNA polymerase pol3-t mutant also depends on the size of the loop and on the mismatch repair genes
PMS1, MSH2, and MSH3; loops of 1 or 7 nt are efficiently processed by mismatch repair, whereas loops of 31 or
61 bases are not targets for this repair system (21). As an alternative to large loop repair, it has been suggested that recombinational repair
may function to correct certain types of replicational errors arising
in replication-impaired backgrounds such as pol3-t or
rad27 (22-24). In addition to possible loop processing by
double-strand break recombination, the evidence in this paper and
another (25) provides direct evidence for repair of large loops.
Certain alleles appear to undergo correction by an unusual, low
efficiency process; transformation with a 38-base heterology arising
from one such exceptional allele resulted in an apparent low level of
repair that was reduced by mutations in MSH2 or
MSH6 (26).
Large loop repair is also active during yeast meiosis. Most large (>15
bp) insertions or deletions undergo gene conversion at normal levels
(27-29), consistent with correction of a looped intermediate (reviewed
in Ref. 3). Looped intermediates can be visualized directly if they are
capable of forming stable hairpin heteroduplexes during yeast meiosis
(30, 31). Such hairpins are poorly corrected in yeast (28, 29), but
co-correction is observed if a well repaired mismatch is near the
hairpin (32). One loop repair activity was revealed by examination of
gene conversion of a 26-bp non-palindromic insertion. Gene conversion
(and, by inference, loop repair) was reduced in msh2 or
rad1 mutants but was unaffected by rad2 or
rad14 mutations (33). No other mismatch repair mutants were
reported in this study.
Evidence from mammalian systems is also consistent with co-existence of
small loop mismatch repair and a distinct large loop repair system.
Heteroduplexes with loops up to 283 nt are efficiently repaired when
transformed into mammalian cells (34-36). Similar conclusions have
been drawn from recombination experiments (37-39), although the loops
tested were smaller. Microsatellite instability measurements and
in vitro assays indicate that loops of 1-4 bases are
substrates for mismatch repair (reviewed in Refs. 4-6). Conversely, in vitro assays on loops of 8 or 16 nt were repaired
independently of human MLH1 function (40). In another study
(41), loops of 5-27 bases were corrected in extracts defective in
human MSH2. Complementation experiments with purified
hMutS or hMutS proteins indicated a reduced dependence on the
purified proteins as the loop size was increased. These authors (41)
attributed large loop repair to a pathway distinct from mismatch repair.
The evidence from yeast and mammalian systems provides indirect support
for a large loop repair system that is independent of mismatch repair.
In this paper we furnish biochemical evidence for large loop repair in
yeast. Efficient in vitro correction was observed for loops
of 16, 27, and 216 nt. Substrate specificity was indicated by little to
no correction of an 8-base loop or a G-T mispair. Large loop repair
required DNA synthesis and was independent of the mismatch repair genes
MSH2, MSH3, PMS1, and MLH1.
A recent paper by Modrich and colleagues (25) provides biochemical
evidence for a similar function in extracts from human cells.
 |
EXPERIMENTAL PROCEDURES |
Reagents and Enzymes--
Standard reagents, including molecular
biology grade CsCl, were obtained from Sigma. Hydroxyapatite resin was
a product of Bio-Rad. All restriction enzymes were obtained from New
England Biolabs or Stratagene. Exonuclease V was from U. S. Biochemical Corp. Enzymatic reactions were performed as recommended by
the manufacturers. Rad1 protein and Rad10 protein were the generous gifts of A. Tomkinson (University of Texas Health Science Center, San Antonio).
Heteroduplex Preparations--
f1 phage MR1, MR3, MR9, MR11,
MR24, MR30, and MR33 were kindly provided by P. Modrich (Duke
University). DNA from these phage was used to create heteroduplex
molecules as described below. The details of loop sequence and location
are provided by Littman et al. (25). An additional
phage variant with a 16-bp insertion in the EcoRI site of
MR11 was created in our laboratory by insertion of a duplex
oligonucleotide. The resulting phage, MR11+16, contains the sequence 5'
AATTGCTAGCAAGCTT 3' on the viral strand as confirmed by DNA
sequencing. The underlined sequence encodes a site for NheI.
Both single-stranded and double-stranded DNA from the f1 phage were
purified from E. coli strain JM101 (F' traD36
lacIq (lacZ)M15
proA+B+/supE thi
(lac-proAB)) using published procedures (42). Heteroduplexes were prepared by slight variations of the method of Lu et
al. (43) as described (42, 44). Briefly, double-stranded DNA harboring the desired sequence on the complementary (C) strand was
linearized with Sau96I. In some cases, HincII was
used for linearization. The linear product was mixed with a 10-fold
excess (w/w) of single-strand circular DNA containing the viral (V)
strand sequence. NaOH denaturation and subsequent neutralization
resulted in heteroduplex formation. Two consecutive hydroxyapatite
columns were used to remove the bulk of the excess single-strand DNA. Linear homoduplex contaminants were removed by treatment with exonuclease V (U. S. Biochemical Corp.). Heteroduplexes were
further purified on one or two CsCl gradients in the presence of
ethidium bromide. To create substrates that are covalently closed on
both strands, the nicked heteroduplexes were treated with DNA ligase. The resulting covalently closed molecules were purified by agarose gel
electrophoresis in the presence of 1 µg/ml ethidium bromide. The DNA
was subsequently released from the gel slice by treatment with
-agarase (New England Biolabs) according to the manufacturer's recommendations. Final heteroduplex preparations were 98% pure, as
judged by agarose gel electrophoresis.
Nicked heteroduplexes prepared by the method described in the previous
paragraph contain a nick 114 bp 5' to the loop. In one experiment, the
nick was placed 797 bp 5' to the loop by cleavage of the
double-stranded DNA with HincII instead of
Sau96I. Heteroduplex formation and purification were
performed the same way for both types of nicked substrate.
Heteroduplexes were created by combining the respective C and V strands
from the following f1 phage: G/T, MR3 and MR1 (45); C8, MR
33 and MR 24 (41); V16, MR11 and MR11+16 (this work); C27, MR9 and MR11; V27, MR11 and MR9;
V216, MR11 and MR30 (25) for C27,
V27 and V216. In our nomenclature, the C or V
designates the strand containing the loop, and the numeric descriptor
indicates the number of bases in the loop.
Yeast Strains--
Yeast strains used in this study were either
DY6 (MATa ura3-52 leu2 trp1 prb1-1122 pep4-3
prc1-407; from B. Jones, Carnegie-Mellon University via T. Hsieh,
Duke University) or isogenic derivatives. Gene disruptions to yield
msh2::Tn10LUK msh3::TRP1 and
pms1 mlh1::URA3 derivatives were performed by
two rounds of single-step protocols (46), whereas the
rad1::URA3 strain arose from a single round of
disruption. Knock-out plasmids were kindly provided by R. Kolodner
(University of California at San Diego) for MSH2, M. Liskay
(Oregon Health Sciences University) for MLH1, and L. Prakash
(University of Texas Health Sciences) for RAD1. Knock-out
plasmids for PMS1 and MSH3 were created in our
laboratory. All derivatives were confirmed by Southern blotting and by
appropriate genetic tests.
Nuclear Extract Preparation--
Nuclear extracts were prepared
essentially as described by Wang et al. (47). Fifteen liters
of cells were grown to an A600 of approximately
2.0 and harvested, and spheroplasts were prepared by incubation with
Zymolyase 100T (ICN Pharmaceuticals). Washed spheroplasts were lysed by
homogenization with a Yamato LSC Homogenizer (model LH-41). Nuclei were
isolated by differential centrifugation, and nuclear proteins were
extracted by addition of NaCl to a final concentration of 0.2 M. Following removal of intact nuclei, protein was
precipitated with ammonium sulfate at a final concentration of 0.35 mg/ml. Dialyzed protein was stored at 80 °C. Protein concentration
was determined by the method of Lowry et al. (48) after
precipitation with trichloroacetic acid.
Loop Repair Assays--
All loop repair assays were performed as
described here unless otherwise noted. The 15-µl reaction mixture
contained 20 mM Hepes-KOH, pH 7.6, 1 mM
glutathione, 1.5 mM ATP, 0.1 mM each dNTP, 0.05 mg/ml bovine serum albumin, and 24 fmol (0.1 µg) of looped substrate.
When repair to both strands was being evaluated, the reaction was
doubled; the DNA was split in half prior to restriction digestion. In
some experiments, dNTPs were omitted with or without the addition of
dideoxy-NTPs (0.1 mM each). The repair reaction was
initiated by the addition of 50-100 µg of yeast nuclear protein with
subsequent incubation at 30 °C for 60 min. In some cases 5 pmol of
purified Rad1p (with or without 6 pmol of Rad10p) was added to the
reaction mix at time 0. Quenching of the reaction was achieved by the
addition of 30 µl of 25 mM EDTA, pH 8.0. For negative
controls, the EDTA solution was added prior to the nuclear extract, and
the samples were placed on ice. Following incubation, the substrate was
purified by phenol and ether extractions, ethanol precipitation, and
drying under vacuum. Each sample was resuspended in 14 µl of
restriction buffer (1× Buffer 2, 1× acetylated bovine serum albumin;
New England Biolabs). All restriction digests contained 6 units of
Bsp106I (Stratagene) to linearize the DNA. Repair that led
to removal of the loop was evaluated by addition of 5 units of
EcoRI for substrates C27, V27,
V16, and V216. Repair in favor of the loop was
evaluated with 2.5 units of NheI. For the C8
substrate, the corresponding digests utilized 3 units of
XcmI or 6 units of XhoI. Repair of the G-T
mispair was tested with HindIII or XhoI, as
described (45). Following incubation at 37 °C for 60 min, the
restriction digestions were analyzed on a 1% agarose gel. Unless
otherwise noted, the gels were stained in a 1:10,000 dilution of Vistra
Green dye (Amersham Pharmacia Biotech), and densitometric analysis of
repair efficiencies was performed using a Molecular Dynamics Storm 860 PhosphorImager using the Blue Fluorescence/Chemiluminescence mode.
Repair activity was measured as DNA present at 3.1 + 3.3-kb bands
divided by the total heteroduplex recovered and then converted to
femtomoles of loop repaired per h per mg of yeast nuclear protein. For
conventional photographic purposes, the gel was subsequently stained in
a solution of 1 µg/ml ethidium bromide.
Analysis of Repair Intermediates Produced under Conditions of
Limited Repair DNA Synthesis--
The analysis of the excision tracts
is based on published methods (25, 49). The excision intermediates were
trapped by the omission of exogenous dNTPs from the reaction, resulting
in the inhibition of repair synthesis. In the analysis of the
complementary strand, the amount of DNA was doubled (to 48 fmol) to
increase the sensitivity of detection. Following restriction by
SspI, the samples were separated by electrophoresis through
a 6% denaturing polyacrylamide gel (45 mM Tris borate, pH
7.6, 1 mM EDTA, 8.3 M urea) and subsequently
electrotransferred to a Hybond-N filter (Amersham Pharmacia Biotech)
and UV cross-linked. DNA oligonucleotide probes were 5'-end-labeled and
used to visualize regions of interest on both the viral and the
complementary strands of the substrate. The sequences of the
oligonucleotides used were as follows: oBL222 (ATTGTTCTGGATATTACCAG)
corresponding to the MR11 viral strand nucleotides 5216-5235 and
oBL223 (CTGGTAATATCCAGAACAAT) and oBL224 (ATTCGCGTTAAATTTTTGTT)
corresponding to MR11 complementary strand nucleotides 5235-5216 and
5915-5896, respectively. Analysis was performed using a Storm 860 PhosphorImager (Molecular Dynamics).
 |
RESULTS |
Looped Heteroduplex Substrates Are Corrected in Yeast Nuclear
Extracts--
Loop repair was examined using a biochemical assay.
Loop-containing DNA molecules were created with defined size and
location of the heterology (Fig.
1A). We use a nomenclature in
which the letter C or V indicates the presence of the loop on the
complementary or viral strand, respectively. The numeral indicates the
loop size in nucleotides. Thus C27 refers to a 27-base loop
on the complementary strand (Fig. 1A). The two strands carry
different restriction enzyme sites. For example, C27 has an
NheI site within the looped complementary strand but an
EcoRI sequence on the unlooped viral strand. For
V27, the loop containing the NheI site resides on the viral strand. The presence of the heterology prevents cleavage by either enzyme. If the loop undergoes correction upon incubation with
yeast cellular proteins, repair can be assessed by the acquisition of
restriction sensitivity. In our analysis, unrepaired DNA migrates as a
6.4-kb linear molecule, whereas repair products are observed at 3.3 and
3.1 kb. The precise sizes of the DNA bands vary slightly depending on
the size of the loop. The strandedness of repair is also revealed by
this analysis. For example, correction of C27 to
NheI sensitivity indicates repair in favor of the loop, whereas cleavage by EcoRI is specific for loop removal.
Another cis-acting feature of these heteroduplexes is the
presence or absence of a site-specific nick on the C strand, 114 bp 5'
from the loop. These substrates are referred to as nicked or covalently closed, respectively.

View larger version (38K):
[in this window]
[in a new window]
|
Fig. 1.
In vitro assay for large loop
repair. The heteroduplex substrate is diagrammed schematically in
A, using a 27-nt loop on the complementary (C)
strand as an example. Heteroduplex DNA molecules were constructed in
which the strand with the inserted sequence includes an NheI
site, whereas the opposite strand contains a site for EcoRI.
In some cases, a site-specific nick was present on the C strand 114 bp
5' to the loop. The viral (V) strand was covalently closed
in all substrates. The loop renders the heteroduplex resistant to both
NheI and EcoRI. Hence, double digests of
Bsp106I with either enzyme result in a full-length (6.4 kb)
linear product. If loop repair occurs upon incubation with yeast
extract, the DNA becomes sensitive to EcoRI if repair occurs
on the looped strand or the DNA is rendered sensitive to
NheI if the unlooped strand is corrected. Appropriate
digests reveal the repair bands (3.3 plus 3.1 kb) upon agarose gel
electrophoresis. B shows results of a typical assay using
heteroduplexes C27 (27-nt loop on the C strand) and
V27 (loop on the V strand). N and E
refer to NheI and EcoRI, respectively. The lanes
marked 0 time show the background level of cutting when
repair activity was prevented. The lanes marked 60 min are
the results after incubation with yeast extract and subsequent
restriction analysis. In all cases, EcoRI sensitivity
indicates loop removal, and NheI sensitivity results from
loop retention.
|
|
Repair activity on nick-containing C27 and V27
heteroduplexes is demonstrated in Fig. 1B. The lanes marked
0 min are negative controls where repair was prevented by
the addition of EDTA prior to addition of extract. Subsequent scoring
for restriction enzyme sensitivity showed little or no DNA migrating at
the position of the repair products. In contrast, incubation for 60 min
with yeast nuclear proteins resulted in significant repair of the 27-nt loop. Repair of the C27 molecule to an
EcoRI-sensitive form is shown in the 4th lane,
indicating correction that removed the loop on the nick-containing
strand. There was little if any repair on the closed, viral strand (to
NheI sensitivity). Correction of the V27
substrate led to substantial repair on both strands (last 2 lanes), a characteristic that is considered in more detail below.
Repair of the C27 and V27 molecules was
dependent on the protein concentration in the assay (data not shown).
Repair Activity Is Determined by Loop Size--
Based on the
results in Fig. 1, it seemed likely that large loop repair was
occurring in yeast extracts. This activity was also specific for the
loop size, as shown in Table I and Fig. 2. The specific activity of correction to
EcoRI sensitivity was about equal for C27,
V27, and V216 (Table I), suggesting that loops
in this size range are readily repaired. As shown in Fig. 2, correction
of V16 (3rd and 4th lanes)
also occurred at similar levels to V27 (1st and
2nd lanes), whereas heteroduplexes containing a
C8 loop or a G-T mispair yielded little or no repair under
these conditions (5th to 8th lanes).
The small amount of repair of C8 in the 5th lane
of Fig. 2 is considered in more detail later. The general lack of
repair for C8 and G-T suggests specificity of the reaction
for large loops but not smaller heterologies, with a cut-off somewhere
between 8 and 16 nt. The negative results with the G-T mispair and the
C8 loop also argue against nonspecific reactions, such as
random excision and resynthesis or simple loop clipping by
endonucleases. Had either of these nonspecific pathways been operative,
there should have been correction of the G-T mispair and/or the
C8 loop. To test if C8 repair were being
inhibited by a diffusible substance in the heteroduplex preparation, a
mixing experiment was performed in which nicked V27 and
C8 loop substrates were present together. V27
heteroduplex correction still occurred readily in the presence of the
C8 loop (data not shown), indicating that no inhibitor was
present.
View this table:
[in this window]
[in a new window]
|
Table I
Correction efficiencies of looped mispairs
Repair efficiencies after 60 min incubation with yeast extract are
given as the range of values observed for 2-4 independent
measurements. Efficiencies less than the detectable level of the assay
are indicated as upper limits. For all substrates, EcoRI
sensitivity indicates loop removal, whereas NheI sensitivity
occurs by retention of the loop.
|
|

View larger version (36K):
[in this window]
[in a new window]
|
Fig. 2.
Repair assays with different size
heterologies. Repair assays were performed as described under
"Experimental Procedures" for nicked V27,
V16, C8, and G-T heteroduplexes. The assay
results were determined initially by fluorescence-based quantitation
and then by ethidium bromide staining and photography. The figure shows
the results by ethidium bromide staining. The 1st lane of
each pair shows correction in favor of the covalently closed V strand
(loop retention and NheI sensitivity for V27 and
V16; loop removal to XcmI sensitivity for
C8; and correction to A-T pair to HindIII
sensitivity for G-T). The 2nd lane of each pair indicates
repair in favor of the nick-containing C strand (loop removal to
EcoRI sensitivity for V27 and V16;
loop retention to XhoI sensitivity for C8; and
correction to G-C pair to XhoI sensitivity for G-T). The
C8 loop contains an XhoI site in the loop and an
XcmI site on the opposite strand (41), rather than the
NheI and EcoRI sites present in the other looped
substrates.
|
|
Two Modes of Loop Repair Occur in Yeast Extracts--
Based on
parallels with mismatch repair (reviewed in Refs. 4-6), it seemed
reasonable to expect that in vitro loop repair might require
a nicked substrate, with correction directed primarily to the strand
containing the discontinuity. However, repair of the nicked
V16, V27, and V216 heteroduplexes
resulted in substantial levels of correction on both strands (Fig. 2
and Table I). This unexpected result led us to consider the possibility
of two modes for repairing loops (Fig.
3). One mode is nick-stimulated and results in correction of the nick-containing strand. For nicked V27 (Fig. 3A), the nick-stimulated mode would
yield NheI-sensitive product. The other mode is
nick-independent, with correction leading to removal of the loop and
subsequent EcoRI sensitivity for V27. In the
case of the nicked C27 heteroduplex (Fig. 3C),
both repair outcomes would contribute to accumulation of
EcoRI-sensitive material, but no NheI-cleavable
DNA would result. The results in Table I for the nicked
C27, V27, and V216 substrates are
consistent with the predictions from this two-mode repair model. We
also infer that loop repair by the nick-stimulated mode is directed to
the discontinuous strand, regardless of which strand harbors the
nick.

View larger version (17K):
[in this window]
[in a new window]
|
Fig. 3.
Two-mode loop repair model. Loop repair
outcomes are predicted for nicked V27 heteroduplex
(A), covalently closed V27 substrate
(B), or nicked C27 heteroduplex (C).
For nicked V27, repair stimulated by the nick leads to
correction on the discontinuous strand and concomitant sensitivity to
NheI. In contrast, nick-independent correction on the looped
V strand would yield EcoRI-sensitive products. In the case
of covalently closed V27, nick-stimulated repair is
prevented (indicated by the X) whereas the nick-independent
removal of the loop can proceed. For nicked C27
heteroduplex, EcoRI-sensitive product is generated by both
modes of correction because the loop is removed in each case.
|
|
If the model in Fig. 3 is correct, covalently closed loop
heteroduplexes should undergo correction in predictable ways since the
nick-independent mode would still be operative but nick-stimulated repair would be eliminated. This prediction is borne out by results shown in Table I. Covalently closed C27 substrate was still
repaired at high levels, presumably by the nick-independent pathway
(Fig. 3C). The covalently closed V27
heteroduplex still showed the nick-independent activity
(EcoRI sensitivity), but the nick-stimulated repair to NheI sensitivity was abolished as predicted in Fig.
3B. The extent of reaction at 60 min by the nick-independent
mode was not detectably altered by the absence of the nick-stimulated
mode (Table I; compare EcoRI-sensitive repair in covalently
closed versus nicked V27 and C27).
However, time course experiments for both V27 and C27 revealed that repair of the covalently closed substrate
at 15-30 min of reaction was reduced about one-third to one-half compared with a nicked heteroduplex. An example for V27 is
shown in Fig. 4. Time course analysis of
the V27 substrate is particularly informative since the
nick-independent removal of the loop can be evaluated separately (by
EcoRI sensitivity) from nick-stimulated correction in favor
of the loop (to NheI sensitivity). This apparent reduction
in reaction rate for the covalently closed heteroduplexes is considered
further under "Discussion."

View larger version (15K):
[in this window]
[in a new window]
|
Fig. 4.
Time course of correction for nicked and
covalently closed V27 substrates.
Loop repair reactions were performed as described under "Experimental
Procedures." At the times indicated, each reaction was quenched with
EDTA and stored on ice. All samples were subsequently processed in
parallel, and nick-independent repair (loop removal) was scored by
sensitivity to EcoRI. Extents of repair were quantitated by
fluorescence imaging and converted to units of femtomoles of
heteroduplex corrected per mg of yeast protein. The filled
circles reflect repair of the nicked V27 substrate,
and the unfilled circles are the data for covalently closed
V27 DNA. These results are typical of three other time
course studies.
|
|
The two-mode model of loop repair sheds additional light on the
relative repair efficiencies of the nicked C8 and
V27 heteroduplexes (Fig. 2). For C8, as for
C27, we assume that both outcomes of repair will contribute
to loop removal (Fig. 3C), whereas V27 correction is partitioned between the two possible products (Fig. 3A). Thus the repair efficiency of C8 (Fig. 2)
can be estimated at about 20% that of V27 (32 units for
C8 divided by 156 total units for V27) or
V16 (32 units/158 units).
Distance from the Nick to the Loop Affects Nick-stimulated Repair
but not Nick-independent Correction--
If a nick is used as an entry
point for helicases and/or nucleases involved in nick-stimulated loop
repair, then the location of the nick relative to the loop may provide
information about the length of excision tracts associated with loop
correction. In contrast, the nick-independent reaction should not be
affected by the location of the nick. We prepared a modified
V27 substrate in which the nick was placed 797 bp 5' to the
loop. Repair time courses were measured for V27 molecules
with nicks either 114 or 797 bp distant. As seen in Fig.
5, nick-independent loop removal to an
EcoRI-sensitive product occurred at similar rates for both substrates, as expected. In contrast, nick-stimulated repair to the
loop-containing, NheI-sensitive product was sensitive to the location of the nick. Repair occurred readily when the nick was 114 bp
away, but correction of the heteroduplex with a nick 797 bp distant was
reduced to levels near background. We infer that excision tracts
associated with nick-stimulated loop repair are frequently less than
797 bp in yeast. Results with mammalian loop repair (25) suggest that
about 50% of excision tracts in human cell extracts may reach 797 bp.

View larger version (16K):
[in this window]
[in a new window]
|
Fig. 5.
Effects of nick placement on loop
repair. Loop repair was assayed at 30 and 60 min on
V27 heteroduplexes that contained a 5' nick either 114 bp
(filled symbols) or 797 bp (unfilled symbols)
from the loop. Nick-independent loop removal on the closed strand was
assessed by EcoRI sensitivity (circles).
Nick-stimulated loop retention on the open strand was measured by
NheI sensitivity (squares). The bars
represent the range of values from two independent measurements.
|
|
The Two Modes of Loop Repair Require DNA Synthesis--
Loop
repair is predicted to require DNA repair synthesis if the loop and
neighboring bases from the duplex undergo excision and replacement. To
test this idea, loop repair assays were performed under conditions of
restricted replication. Omission of dNTPs with or without addition of
chain-terminating dideoxy-NTPs reduced correction of the
C27 substrate by 62-90%. DNA running at the position of
repair products was not a discrete species but rather was a partial
smear (data not shown), consistent with the presence of heterogeneous,
gap-containing molecules. When nicked V27 was used as a
substrate, similar dideoxy-NTP inhibition was observed for both repair
products. These results indicate that both modes of loop repair are
inhibited when DNA synthesis is restricted.
Mapping experiments were performed to map the end points of excision
tracts associated with loop repair (25, 49). In this approach, DNA
synthesis was inhibited by the omission of dNTPs. The DNA samples were
subsequently cleaved with SspI to generate a 717-bp fragment
spanning the position of the loop. Following denaturing gel
electrophoresis, the DNA species were transferred to a filter and
probed with strand-specific oligonucleotides. This indirect
end-labeling method provides estimates of excision tract end points to
within about 10 nt.
Excision tracts for the nick-stimulated repair reaction extend a total
of about 170 nt, from the nick to approximately 50 nt beyond the loop
(Fig. 6A, lane 2). A number of
species are observed, including those with end points both 5' and 3' to
the position of the loop. Comparison with a homoduplex control
(lane 3) indicates that many of these intermediates are
elicited by the presence of the loop, suggesting their association with
nick-stimulated loop repair. When dNTPs are included in the reaction
(lane 1), two prominent bands are observed. The upper band
corresponds to the location of the nick and presumably reflects
unrepaired and unligated material. The lower band corresponds to a
position between the nick and the loop; the significance of this
species is not yet clear. We note that the estimate of ~170-nt
excision tracts is consistent with the distance dependence for the nick
in this reaction (Fig. 5), in which a nick 797 nt from the loop showed little repair.

View larger version (61K):
[in this window]
[in a new window]
|
Fig. 6.
Mapping of excision tracts associated with
loop repair. Loop repair assays were performed with 48 (A) or 24 fmol (B and C) of either
nicked V27 heteroduplex DNA or a nicked homoduplex control
(Ho) that was prepared identically. The nick in each case
was 114 bp 5' to the location of the loop in V27. DNA
synthesis was inhibited by the omission of exogenous dNTPs from the
reaction. Subsequently, each sample was cleaved with SspI,
and the fragments were subjected to electrophoresis through a 6%
denaturing polyacrylamide gel. The blot was probed successively with
strand-specific radiolabeled oligonucleotide probes. A shows
the results with a probe (oBL222, symbolized by the open
rectangle) that is specific for the 3' end of the nicked
complementary strand. The full-length SspI fragment on this
strand is 717 nt long, with the nick corresponding to position 514 and
the loop across from position 401. B corresponds to probing
with oligonucleotide oBL223 that hybridizes to the 5' end of the looped
viral strand (cross-hatched rectangle). The full-length
SspI fragment is 744 nt, with the loop corresponding to
positions 402-428. C, the probe oBL224 (filled
rectangle) hybridized to the 3' end of the viral strand, with the
loop corresponding to positions 316-343.
|
|
The nick-independent loop removal reaction also generates excised
intermediates of about 100-200 nt (Fig. 6, B and
C). Excision toward the 5' end is clear in Fig. 6B,
lane 5, where the majority of the DNA molecules have been
shortened by about 100 nt from the position of the loop. Some shorter
species are also observed, suggesting that excision tracts can extend
up to perhaps 150 nt. In contrast, inclusion of dNTPs (lane
4) yields a limited number of products, the most prominent of
which maps to a position just 5' to the loop. Association of these
intermediates with loop removal is confirmed by the homoduplex control
(lane 6), which showed almost no excised intermediates.
When the nick-independent reaction was hybridized to a probe on the 3'
end of the SspI fragment (Fig. 6C), there was
much less difference in the DNA species observed with or without dNTPs. Both lanes 7 and 8 show similar patterns and
extents of excision intermediates, although some bands in the 2nd
lane are somewhat more intense. The most prominent species maps to
a position just 3' to the loop and presumably corresponds to the
darkest band in Fig. 6B, lane 4. The homoduplex substrate in
lane 9 yielded little if any hybridizing DNA. We conclude
from Fig. 6, B and C, that excision tracts
associated with nick-independent loop removal are 100-200 nt in length
but are asymmetric with respect to the loop, with the majority of
excision extending in the 5' direction. These experiments do not
distinguish between nicking 5' to the loop followed by 5' to 3'
excision or nicking 3' to the loop with associated 3' to 5' degradation.
Genetic Independence of Loop Repair from Mismatch
Repair--
Large loop repair is independent of the mismatch repair
genes MSH2, MSH3, PMS1, and
MLH1, as deduced from assays using extracts from an
msh2 msh3 strain or from a pms1 mlh1 strain
(Table II). Correction was assayed using
the nicked V27 substrate to allow measurement of both
repair modes. Loop repair to both possible products occurred at similar
levels in extracts from the mismatch repair mutants and the wild-type
control. The repair activity in the mutants was consistently as high or
higher than in the wild type. Similar results were obtained when nicked
C27 was the substrate (not shown). In our system there is
no defect in loop repair activity associated with msh2 msh3
or pms1 mlh1 mutations. We did not test MSH6
because of the overwhelming literature evidence in yeast (19, 50, 51)
that shows no role for this gene when loop size exceeds 1-2
nucleotides.
View this table:
[in this window]
[in a new window]
|
Table II
Loop repair activity in wild-type and repair-deficient extracts
Repair activity was assayed on the nicked V27 substrate as
described under "Experimental Procedures." Nick-stimulated repair
(loop retention) after 60 min was assessed as sensitivity to
NheI, and nick-independent repair (loop removal) was scored
by sensitivity to EcoRI. Repair ratio describes the specific
activity of the mutant divided by the specific activity of wild type,
as measured in side-by-side reactions. The ratio in four separate
experiments was calculated, and the mean ratio (±S.D.) is presented.
|
|
Loop repair was examined in an extract from a rad1 mutant
for two reasons as follows: first to investigate the possibility that
nucleotide excision repair factors might be operative on the looped
substrates, and second to assess whether the in vitro repair
activity might be similar or identical to the meiotic
RAD1-dependent loop repair observed by Petes and
colleagues (33). Both modes of loop repair in the rad1
extract were reduced to 34-47% of wild-type levels, suggesting a
partial dependence on RAD1. However, the defect in this
extract was complex; the addition of purified Rad1 protein or of
purified Rad1/Rad10 proteins increased the repair by only 3-11%,
still well short of wild-type levels of correction. The protein amounts
added (5 pmol of Rad1p with or without 6 pmol of Rad10p) were similar
to those used to restore nucleotide excision repair to deficient
extracts (47). Thus the role of RAD1 in loop repair remains
unclear. The independence of loop repair activity from MSH2
function suggests that loop correction in extracts of dividing cells,
described here, differs from the meiotic repair process described by
Kirkpatrick and Petes (33) which was dependent on both MSH2
and RAD1.
 |
DISCUSSION |
Large loop repair activity in eukaryotes has been indirectly
supported by the results of several laboratories. Our results and those
of Modrich and colleagues (25) provide direct biochemical evidence for
a distinct pathway of large loop repair. In yeast extracts, loops of
16, 27, and 216 nt were efficiently repaired. Correction of these
heterologies was unaffected by mutations in the mismatch repair genes
MSH2, MSH3, MLH1, or PMS1. There was no evidence
for simple loop clipping or nonspecific processing of C8 or
G-T heteroduplexes, suggesting that correction of 16-216-nt heterologies is a bona fide repair reaction. Excision tracts
associated with loop repair are 100-200 nt, in contrast to the
~500-1500-nt gene conversion tracts thought to result from meiotic
mismatch repair (32, 52). These findings indicate an independent
pathway for large loop repair, consistent with parallel results from
human cells (40, 41). Based on similar results in yeast and human cells
(25), large loop repair may be a conserved activity in eukaryotes.
Together, mismatch repair and large loop repair provide complementary
correction of loops that range from 1 to hundreds of nt. There appears
to be overlap between pathways for intermediate size loops. Genetic
evidence from yeast indicates that mismatch repair is active on loops
of 1-13 nt but that its efficiency is reduced somewhat for 10-13-nt
loops (19). Our in vitro assays for large loop repair
indicate the opposite trend; efficiency rises about 5-fold as the loop
is increased from 8 to 16 or 27 nt (Fig. 2), similar to the trend in
mismatch repair-independent correction in mammalian extracts (41). This
specificity is consistent with the idea that both repair activities
correct intermediate size loops, albeit with reduced efficiency.
Overlapping repair of intermediate size loops by the two activities may
thus ensure coverage of a wide spectrum of possible loop sizes.
Evidence from mammalian cells (41) is also consistent with loop size
overlap between mismatch repair and large loop repair.
The sequence of the heterology does not seem to play an important role
in correction of the loops examined here. Aside from the
NheI restriction site, the loop sequences were all different in the V16, V27, C27, and
V216 heteroduplexes. (The V27 and
C27 loop sequences are complementary to one another.) This
finding further supports the idea that a large loop repair system is
active on many different heterologies. One exception in yeast might be loops that form hairpin structures, which are not corrected during meiosis (28, 29, 31).
Transformation experiments with mammalian cells had suggested the
possibility of two modes of loop repair (35, 36). Repair of 25- or
57-nt heterologies led to loop removal about twice as often as
correction favoring the loop. Our results with V216, V27, and V216 also showed a 1.5-2-fold
preference for loop removal (Table I and Fig. 2). In the mammalian cell
experiments (36), the effects of a nick close to (71 or 125 bp) or far
from (>2 kb) the loop indicated that the nick provided a relatively
modest effect toward the preference for loop removal. These authors
suggested that the loop was the major signal for correction. It should
be noted that the fate of the nick following transformation could not
be monitored in these experiments. If ligation occurred soon after the
heteroduplex entered the cell, one would expect a limited effect on
strand selection. We find that there is a distinct difference between
the two modes of loop repair in nicked versus closed
substrates (Table I), suggesting that the covalent state of the
unrepaired heteroduplex remains largely unchanged under the
experimental conditions used. Overall, our experiments support the
findings of Weiss and Wilson (35, 36) that favor the relative roles of
nicks and loops in determining strand selectivity in repair.
If two repair modes are operative, are they due to the same or
different correction systems? Experiments with the nicked
V27 substrate allowed the simultaneous measurement of
nick-stimulated and nick-independent repair. Both modes of correction
responded similarly when DNA synthesis was inhibited, suggesting that
excision and resynthesis steps are comparable. Extracts from mismatch
repair mutants were active in both repair modes. The simplest
explanation of these two results is that the two repair modes occur by
the same system, but our results do not exclude the possibility of different systems. One distinction we found between the two loop correction modes was a reproducible lag in initial rates for
nick-independent repair when the heteroduplex was covalently closed
(Fig. 4). We hypothesize that this lag corresponds to an initial,
rate-limiting endonucleolytic incision. Once the incision is made, loop
removal proceeds at rates similar to or slightly higher than on the
nicked heteroduplex. An alternative possibility is that nick-stimulated correction might somehow increase repair by the nick-independent mode.
Supercoiling cannot explain the time course results because the
covalently closed molecules were topologically relaxed. We tested
whether Rad1 protein might be necessary for the rate-limiting incision
hypothesis. Rather than a specific deficiency in nick-independent correction, both repair modes were reduced to similar extents in
rad1 extracts. The addition of purified Rad1p or
Rad1p-Rad10p complex failed to restore wild-type levels of correction
to rad1 extracts. The potential role of RAD1
remains unclear, and additional experimentation will be required to
elucidate the mechanism(s) of loop repair. However, it seems likely
that the loop repair activity we observe in extracts of dividing cells
is distinct from meiotic loop processing that requires both
RAD1 and MSH2 (33).
 |
FOOTNOTES |
*
This work was supported by American Cancer Society Research
Grant NP-943 (to R. S. L.), National Institutes of Health
Postdoctoral Fellowship GM18922 (to S. E. C-B.), American Cancer
Society Postdoctoral Fellowship PF-4033 (to B.O.P.), and by National
Cancer Institute Cancer Center Support Grant P30 CA36727 (to the Eppley
Institute).The costs of publication of this
article were defrayed in part by the
payment of page charges. The article
must therefore be hereby marked
"advertisement" in
accordance with 18 U.S.C. Section
1734 solely to indicate this fact.
¶
Current address: Schleicher & Schuell, 10 Optical Ave., P. O.
Box 2012, Keene, NH 03431.
To whom correspondence should be addressed: The Eppley
Institute for Research in Cancer and Allied Diseases, University of Nebraska Medical Center, 986805 Nebraska Medical Center, 600 S. 42nd
St., Omaha, Nebraska 68198-6805. Tel.: 402-559-4619; Fax: 402-559-4651; E-mail rlahue{at}unmc.edu.
 |
ABBREVIATIONS |
The abbreviations used are:
nt, nucleotides;
bp, base pairs;
kb, kilobase pairs;
C, complementary DNA strand;
V, viral
DNA strand.
 |
REFERENCES |
-
Streisinger, G.,
Okada, Y.,
Emrich, J.,
Newton, J.,
Tsugita, A.,
Terzaghi, E.,
and Inouye, M.
(1966)
Cold Spring Harbor Symp. Quant. Biol.
31,
77-84[Abstract/Free Full Text]
-
Kunkel, T. A.
(1992)
J. Biol. Chem.
267,
18251-18254[Free Full Text]
-
Petes, T. D.,
Malone, R. E.,
and Symington, L. S.
(1991)
in
The Molecular and Cellular Biology of the Yeast Saccharomyces (Broach, J. R., Pringle, J. R., and Jones, E. W., eds), Vol. 1, pp. 407-521, Cold Spring Harbor Laboratory, Cold Spring Harbor, NY
-
Kunkel, T. A.
(1995)
Curr. Biol.
5,
1091-1094[CrossRef][Medline]
[Order article via Infotrieve]
-
Kolodner, R.
(1996)
Genes Dev.
10,
1433-1442[Free Full Text]
-
Modrich, P.,
and Lahue, R. S.
(1996)
Annu. Rev. Biochem.
65,
101-133[CrossRef][Medline]
[Order article via Infotrieve]
-
Crouse, G. F.
(1996)
in
DNA Damage and Repair (Nickoloff, J. A., and Hoekstra, M. F., eds), Vol. 1, pp. 411-448, Humana Press, Totowa, NJ
-
Dohet, C.,
Wagner, R.,
and Radman, M.
(1986)
Proc. Natl. Acad. Sci. U. S. A.
83,
3395-3397[Abstract/Free Full Text]
-
Gasc, A. M.,
Garcia, P.,
Baty, D.,
and Sicard, A. M.
(1987)
Mol. Gen. Genet.
210,
369-372[CrossRef][Medline]
[Order article via Infotrieve]
-
Parker, B. O.,
and Marinus, M. G.
(1992)
Proc. Natl. Acad. Sci. U. S. A.
89,
1730-1734[Abstract/Free Full Text]
-
Carraway, M.,
and Marinus, M. G.
(1993)
J. Bacteriol.
175,
3972-3980[Abstract/Free Full Text]
-
Fang, W.,
Wu, J.-Y.,
and Su, M.-J.
(1997)
J. Biol. Chem.
272,
22714-22720[Abstract/Free Full Text]
-
Dohet, C.,
Dzidic, S.,
Wagner, R.,
and Radman, M.
(1987)
Mol. Gen. Genet.
206,
181-184[CrossRef][Medline]
[Order article via Infotrieve]
-
Fishel, R.,
and Kolodner, R.
(1989)
J. Bacteriol.
171,
3046-3052[Abstract/Free Full Text]
-
Bishop, D. K.,
and Kolodner, R. D.
(1986)
Mol. Cell. Biol.
6,
3401-3409[Abstract/Free Full Text]
-
Bishop, D. K.,
Williamson, M. S.,
Fogel, S.,
and Kolodner, R. D.
(1987)
Nature
328,
362-364[CrossRef][Medline]
[Order article via Infotrieve]
-
Strand, M.,
Prolla, T. A.,
Liskay, R. M.,
and Petes, T. D.
(1993)
Nature
365,
274-276[CrossRef][Medline]
[Order article via Infotrieve]
-
Strand, M.,
Earley, M. C.,
Crouse, G. F.,
and Petes, T. D.
(1995)
Proc. Natl. Acad. Sci. U. S. A.
92,
10418-10421[Abstract/Free Full Text]
-
Sia, E. A.,
Kokoska, R. J.,
Dominska, M.,
Greenwell, P.,
and Petes, T. D.
(1997)
Mol. Cell. Biol.
17,
2851-2858[Abstract]
-
Sia, E. A.,
Jinks-Robertson, S.,
and Petes, T. D.
(1997)
Mutat. Res.
383,
61-70[Medline]
[Order article via Infotrieve]
-
Tran, H. T.,
Gordenin, D. A.,
and Resnick, M. A.
(1996)
Genetics
143,
1579-1587[Abstract]
-
Tran, H. T.,
Degtyareva, N. P.,
Koloteva, N. N.,
Sugino, A.,
Masumoto, H.,
Gordenin, D. A.,
and Resnick, M. A.
(1995)
Mol. Cell. Biol.
15,
5607-5617[Abstract]
-
Tishkoff, D. X.,
Boerger, A. L.,
Bertrand, P.,
Filosi, N.,
Gaida, G. M.,
Kane, M. F.,
and Kolodner, R. D.
(1997)
Proc. Natl. Acad. Sci. U. S. A.
94,
7487-7492[Abstract/Free Full Text]
-
Gordenin, D. A.,
Kunkel, T. A.,
and Resnick, M. A.
(1997)
Nat. Genet.
16,
116-118[CrossRef][Medline]
[Order article via Infotrieve]
-
Littman, S. J.,
Fang, W.-H.,
and Modrich, P.
(1999)
J. Biol. Chem
274,
7474-7481[Abstract/Free Full Text]
-
Luhr, B.,
Scheller, J.,
Meyer, P.,
and Kramer, W.
(1998)
Mol. Gen. Genet.
257,
362-367[CrossRef][Medline]
[Order article via Infotrieve]
-
Fink, G. J.,
and Styles, C. A.
(1974)
Genetics
77,
231-244[Abstract/Free Full Text]
-
Nag, D. K.,
White, M. A.,
and Petes, T. D.
(1989)
Nature
340,
318-320[CrossRef][Medline]
[Order article via Infotrieve]
-
Nag, D. K.,
and Petes, T. D.
(1991)
Genetics
129,
669-673[Abstract]
-
Nag, D. K.,
and Petes, T. D.
(1993)
Mol. Cell. Biol.
13,
2324-2331[Abstract/Free Full Text]
-
Moore, H.,
Greenwell, P. W.,
Liu, C.-P.,
Arnheim, N.,
and Petes, T. D.
(1999)
Proc. Natl. Acad. Sci. U. S. A.
96,
1504-1509[Abstract/Free Full Text]
-
Detloff, P.,
and Petes, T. D.
(1992)
Mol. Cell. Biol.
12,
1805-1814[Abstract/Free Full Text]
-
Kirkpatrick, D. T.,
and Petes, T. D.
(1997)
Nature
387,
929-931[CrossRef][Medline]
[Order article via Infotrieve]
-
Ayares, D.,
Ganea, D.,
Chekuri, L.,
Campbell, C. R.,
and Kucherlapati, R.
(1987)
Mol. Cell. Biol.
7,
1656-1662[Abstract/Free Full Text]
-
Weiss, U.,
and Wilson, J. H.
(1987)
Proc. Natl. Acad. Sci. U. S. A.
84,
1619-1623[Abstract/Free Full Text]
-
Weiss, U.,
and Wilson, J. H.
(1989)
Somatic Cell Mol. Genet.
15,
13-18[CrossRef][Medline]
[Order article via Infotrieve]
-
Bollag, R. J.,
Elwood, D. R.,
Tobin, E. D.,
Godwin, A. R.,
and Liskay, R. M.
(1992)
Mol. Cell. Biol.
12,
1546-1552[Abstract/Free Full Text]
-
Deng, W. P.,
and Nickoloff, J. A.
(1994)
Mol. Cell. Biol.
14,
400-406[Abstract/Free Full Text]
-
Taghian, D. G.,
Hough, H.,
and Nickoloff, J. A.
(1998)
Genetics
148,
1257-1268[Abstract/Free Full Text]
-
Umar, A.,
Boyer, J. C.,
and Kunkel, T. A.
(1994)
Science
266,
814-816[Abstract/Free Full Text]
-
Genschel, J.,
Littman, S. J.,
Drummond, J. T.,
and Modrich, P.
(1998)
J. Biol. Chem.
273,
19895-19901[Abstract/Free Full Text]
-
Corrette-Bennett, S.,
and Lahue, R. S.
(1999)
in
DNA Repair Protocols (Henderson, D., ed), Vol. 113, pp. 121-132, Humana Press, Totowa, NJ
-
Lu, A.-L.,
Clark, S.,
and Modrich, P.
(1983)
Proc. Natl. Acad. Sci. U. S. A.
80,
4639-4643[Abstract/Free Full Text]
-
Holmes, J.,
Clark, S.,
and Modrich, P.
(1990)
Proc. Natl. Acad. Sci. U. S. A.
87,
5837-5841[Abstract/Free Full Text]
-
Su, S.-S.,
Lahue, R. S.,
Au, K. G.,
and Modrich, P.
(1988)
J. Biol. Chem.
263,
6829-6835[Abstract/Free Full Text]
-
Rose, M. D.,
Winston, F.,
and Hieter, P.
(1988)
Methods in Yeast Genetics, Cold Spring Harbor Laboratory, Cold Spring Harbor, NY
-
Wang, Z.,
Wu, X.,
and Friedberg, E. C.
(1993)
Proc. Natl. Acad. Sci. U. S. A.
90,
4907-4911[Abstract/Free Full Text]
-
Lowry, O. H.,
Rosebrough, N. J.,
Farr, A. L.,
and Randall, R. J.
(1951)
J. Biol. Chem.
193,
265-275[Free Full Text]
-
Fang, W.,
and Modrich, P.
(1993)
J. Biol. Chem.
268,
11838-11844[Abstract/Free Full Text]
-
Marsischky, G. T.,
Filosi, N.,
Kane, M. F.,
and Kolodner, R.
(1996)
Genes Dev.
10,
407-420[Abstract/Free Full Text]
-
Johnson, R. E.,
Kovvali, G. K.,
Prakash, L.,
and Prakash, S.
(1996)
J. Biol. Chem.
271,
7285-7288[Abstract/Free Full Text]
-
Borts, R. H.,
and Haber, J. E.
(1987)
Science
237,
1459-1465[Abstract/Free Full Text]
Copyright © 1999 by The American Society for Biochemistry and Molecular Biology, Inc.

CiteULike Complore Connotea Del.icio.us Digg Reddit Technorati What's this?
This article has been cited by other articles:

|
 |

|
 |
 
D. Sommer, C. M. Stith, P. M. J. Burgers, and R. S. Lahue
Partial reconstitution of DNA large loop repair with purified proteins from Saccharomyces cerevisiae
Nucleic Acids Res.,
August 1, 2008;
36(14):
4699 - 4707.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
L. E. Jensen, P. A. Jauert, and D. T. Kirkpatrick
The Large Loop Repair and Mismatch Repair Pathways of Saccharomyces cerevisiae Act on Distinct Substrates During Meiosis
Genetics,
July 1, 2005;
170(3):
1033 - 1043.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. E. Corrette-Bennett, C. Borgeson, D. Sommer, P. M. J. Burgers, and R. S. Lahue
DNA polymerase {delta}, RFC and PCNA are required for repair synthesis of large looped heteroduplexes in Saccharomyces cerevisiae
Nucleic Acids Res.,
December 1, 2004;
32(21):
6268 - 6275.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
Y.-M. Huang, S.-U. Chen, S. D. Goodman, S.-H. Wu, J.-T. Kao, C.-N. Lee, W.-C. Cheng, K.-S. Tsai, and W.-h. Fang
Interaction of Nick-directed DNA Mismatch Repair and Loop Repair in Human Cells
J. Biol. Chem.,
July 16, 2004;
279(29):
30228 - 30235.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. D. McCulloch, L. Gu, and G.-M. Li
Nick-dependent and -independent Processing of Large DNA Loops in Human Cells
J. Biol. Chem.,
December 12, 2003;
278(50):
50803 - 50809.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
W.-h. Fang, B.-J. Wang, C.-H. Wang, S.-J. Lee, Y.-T. Chang, Y.-K. Chuang, and C.-N. Lee
DNA Loop Repair by Escherichia coli Cell Extracts
J. Biol. Chem.,
June 13, 2003;
278(25):
22446 - 22452.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. D. McCulloch, L. Gu, and G.-M. Li
Bi-directional Processing of DNA Loops by Mismatch Repair-dependent and -independent Pathways in Human Cells
J. Biol. Chem.,
January 31, 2003;
278(6):
3891 - 3896.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. J. Raynard and M. D. Baker
Incorporation of Large Heterologies Into Heteroduplex DNA During Double-Strand-Break Repair in Mouse Cells
Genetics,
October 1, 2002;
162(2):
977 - 985.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. E. Corrette-Bennett, N. L. Mohlman, Z. Rosado, J. J. Miret, P. M. Hess, B. O. Parker, and R. S. Lahue
Efficient repair of large DNA loops in Saccharomyces cerevisiae
Nucleic Acids Res.,
October 15, 2001;
29(20):
4134 - 4143.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. A. Clikeman, S. L. Wheeler, and J. A. Nickoloff
Efficient Incorporation of Large (>2 kb) Heterologies Into Heteroduplex DNA: Pms1/Msh2-Dependent and -Independent Large Loop Mismatch Repair in Saccharomyces cerevisiae
Genetics,
April 1, 2001;
157(4):
1481 - 1491.
[Abstract]
[Full Text]
|
 |
|

|
 |

|
 |
 
J. M. Comeron and M. Kreitman
The Correlation Between Intron Length and Recombination in Drosophila: Dynamic Equilibrium Between Mutational and Selective Forces
Genetics,
November 1, 2000;
156(3):
1175 - 1190.
[Abstract]
[Full Text]
|
 |
|

|
 |

|
 |
 
E. A. Oussatcheva, V. I. Hashem, Y. Zou, R. R. Sinden, and V. N. Potaman
Involvement of the Nucleotide Excision Repair Protein UvrA in Instability of CAG{middle dot}CTG Repeat Sequences in Escherichia coli
J. Biol. Chem.,
August 10, 2001;
276(33):
30878 - 30884.
[Abstract]
[Full Text]
[PDF]
|
 |
|
Copyright © 1999 by the American Society for Biochemistry and Molecular Biology.
|
Advertisement
Advertisement
|