Advertisement
JBC

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Corrette-Bennett, S. E.
Right arrow Articles by Lahue, R. S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Corrette-Bennett, S. E.
Right arrow Articles by Lahue, R. S.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

J Biol Chem, Vol. 274, Issue 25, 17605-17611, June 18, 1999


Correction of Large Mispaired DNA Loops by Extracts of Saccharomyces cerevisiae*

Stephanie E. Corrette-BennettDagger , Breck O. Parker§, Natasha L. MohlmanDagger , and Robert S. LahueDagger §parallel

From the Dagger  Eppley Institute for Research in Cancer and Allied Diseases, University of Nebraska Medical Center, Omaha, Nebraska 68198-6805 and the § Department of Biochemistry and Molecular Biology, University of Massachusetts Medical Center, Worcester, Massachusetts 01655

    ABSTRACT
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

Single base mispairs and small loops are corrected by DNA mismatch repair, but little is known about the correction of large loops. In this paper, large loop repair was examined in nuclear extracts of yeast. Biochemical assays showed that repair activity occurred on loops of 16, 27, and 216 bases, whereas a G-T mispair and an 8-base loop were poorly corrected under these conditions. Two modes of loop repair were revealed by comparison of heteroduplexes that contained a site-specific nick or were covalently closed. A nick-stimulated repair mode directs correction to the discontinuous strand, regardless of which strand contains the loop. An alternative mode is nick-independent and preferentially removes the loop. Both outcomes of repair were largely eliminated when DNA replication was inhibited, suggesting a requirement for repair synthesis. Excision tracts of 100-200 nucleotides, spanning the position of the loop, were observed on each strand under conditions of limited DNA repair synthesis. Both repair modes were independent of the mismatch correction genes MSH2, MSH3, MLH1, and PMS1, as judged by activity in mutant extracts. Together the loop specificity and mutant results furnish evidence for a large loop repair pathway in yeast that is distinct from mismatch repair.

    INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

DNA mispairs can be categorized as either single-base mispairs such as G-T or loops, in which one strand harbors extra nucleotides. Loops can arise in vivo as polymerase slippage events (1, 2) within repeating elements or between duplicated sequences. These looped mispairs are precursors for insertion mutations if the loop resides on the newly replicated strand or for deletion mutations if the template strand contains the heterology. Thus one biological consequence of loop repair is to reduce mutation rates of insertions and deletions. Looped mispairs can also occur during genetic recombination. Processing of loop-containing recombination intermediates plays an important role in gene conversion of insertions and deletions (reviewed in Ref. 3) and provides a second, biologically significant role for loop repair. Given the richness of repeating elements and duplicated sequences in eukaryotes, genetic stability of these organisms is particularly dependent on the ability to repair loops of varying sizes. Small loops are processed by mismatch repair in bacteria, yeast, and mammalian systems (reviewed in Refs. 4-7), but little is known about the processing of large loops. The definition of small and large is dependent on the experimental system, as described below.

In prokaryotes, small loops are substrates for mismatch correction, but large loop repair is absent or occurs inefficiently. In vivo experiments with Escherichia coli and pneumococcus indicate that loops up to 4 nt1 are corrected by mismatch repair, whereas heterologies of 5 bases or more are usually poorly corrected (8-11). If repair is elicited by a nearby mismatch, large loops will undergo correction (11). This co-correction of large loops suggests that they are poorly recognized in bacteria, rather than being inherently resistant to correction. In vitro experiments indicate a similar loop size spectrum for mismatch repair. MutS protein binds loops of 1-4 nt but not a 5-base loop (10). Mismatch repair-dependent correction in E. coli extracts is efficient for loops up to 7 nt but repair is very low for 8-22-base heterologies (12). Thus loop repair in prokaryotes seems limited to small heterologies, and correction is dependent on mismatch repair. Exceptions have been reported in which large loops are processed at low levels in E. coli (13, 14).

As summarized below, eukaryotic mismatch repair is active on loops up to about 12-13 nt. In contrast to bacteria, however, a number of experiments indicate that eukaryotes also repair large loops, a possibility that was suggested previously (5). Available evidence suggests that mismatch repair and large loop repair are distinct pathways but that their correction activities overlap partially for certain loop sizes. When transformed into Saccharomyces cerevisiae, plasmids harboring 8- or 12-base heterologies undergo loop correction (15). Repair is partially reduced but not eliminated by mutation in the mismatch repair gene PMS1 (16). Examination of the mutation rates of microsatellite and minisatellite repeats indicates that loops of 1-13 nt are efficiently repaired by mismatch repair, as mutations in MSH2, MSH3, MLH1, or PMS1 lead to increased mutation rates for these repeats (17-20). In contrast, mutation rates of repeating elements of 16 or 20 bp are unaffected by mutations in MSH2, MSH3, or MSH6 (19). Correction of strand slippage events between small tandem repeats in the DNA polymerase pol3-t mutant also depends on the size of the loop and on the mismatch repair genes PMS1, MSH2, and MSH3; loops of 1 or 7 nt are efficiently processed by mismatch repair, whereas loops of 31 or 61 bases are not targets for this repair system (21). As an alternative to large loop repair, it has been suggested that recombinational repair may function to correct certain types of replicational errors arising in replication-impaired backgrounds such as pol3-t or rad27 (22-24). In addition to possible loop processing by double-strand break recombination, the evidence in this paper and another (25) provides direct evidence for repair of large loops. Certain alleles appear to undergo correction by an unusual, low efficiency process; transformation with a 38-base heterology arising from one such exceptional allele resulted in an apparent low level of repair that was reduced by mutations in MSH2 or MSH6 (26).

Large loop repair is also active during yeast meiosis. Most large (>15 bp) insertions or deletions undergo gene conversion at normal levels (27-29), consistent with correction of a looped intermediate (reviewed in Ref. 3). Looped intermediates can be visualized directly if they are capable of forming stable hairpin heteroduplexes during yeast meiosis (30, 31). Such hairpins are poorly corrected in yeast (28, 29), but co-correction is observed if a well repaired mismatch is near the hairpin (32). One loop repair activity was revealed by examination of gene conversion of a 26-bp non-palindromic insertion. Gene conversion (and, by inference, loop repair) was reduced in msh2 or rad1 mutants but was unaffected by rad2 or rad14 mutations (33). No other mismatch repair mutants were reported in this study.

Evidence from mammalian systems is also consistent with co-existence of small loop mismatch repair and a distinct large loop repair system. Heteroduplexes with loops up to 283 nt are efficiently repaired when transformed into mammalian cells (34-36). Similar conclusions have been drawn from recombination experiments (37-39), although the loops tested were smaller. Microsatellite instability measurements and in vitro assays indicate that loops of 1-4 bases are substrates for mismatch repair (reviewed in Refs. 4-6). Conversely, in vitro assays on loops of 8 or 16 nt were repaired independently of human MLH1 function (40). In another study (41), loops of 5-27 bases were corrected in extracts defective in human MSH2. Complementation experiments with purified hMutSalpha or hMutSbeta proteins indicated a reduced dependence on the purified proteins as the loop size was increased. These authors (41) attributed large loop repair to a pathway distinct from mismatch repair.

The evidence from yeast and mammalian systems provides indirect support for a large loop repair system that is independent of mismatch repair. In this paper we furnish biochemical evidence for large loop repair in yeast. Efficient in vitro correction was observed for loops of 16, 27, and 216 nt. Substrate specificity was indicated by little to no correction of an 8-base loop or a G-T mispair. Large loop repair required DNA synthesis and was independent of the mismatch repair genes MSH2, MSH3, PMS1, and MLH1. A recent paper by Modrich and colleagues (25) provides biochemical evidence for a similar function in extracts from human cells.

    EXPERIMENTAL PROCEDURES
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

Reagents and Enzymes-- Standard reagents, including molecular biology grade CsCl, were obtained from Sigma. Hydroxyapatite resin was a product of Bio-Rad. All restriction enzymes were obtained from New England Biolabs or Stratagene. Exonuclease V was from U. S. Biochemical Corp. Enzymatic reactions were performed as recommended by the manufacturers. Rad1 protein and Rad10 protein were the generous gifts of A. Tomkinson (University of Texas Health Science Center, San Antonio).

Heteroduplex Preparations-- f1 phage MR1, MR3, MR9, MR11, MR24, MR30, and MR33 were kindly provided by P. Modrich (Duke University). DNA from these phage was used to create heteroduplex molecules as described below. The details of loop sequence and location are provided by Littman et al. (25). An additional phage variant with a 16-bp insertion in the EcoRI site of MR11 was created in our laboratory by insertion of a duplex oligonucleotide. The resulting phage, MR11+16, contains the sequence 5' AATTGCTAGCAAGCTT 3' on the viral strand as confirmed by DNA sequencing. The underlined sequence encodes a site for NheI.

Both single-stranded and double-stranded DNA from the f1 phage were purified from E. coli strain JM101 (F' traD36 lacIq Delta  (lacZ)M15 proA+B+/supE thi Delta (lac-proAB)) using published procedures (42). Heteroduplexes were prepared by slight variations of the method of Lu et al. (43) as described (42, 44). Briefly, double-stranded DNA harboring the desired sequence on the complementary (C) strand was linearized with Sau96I. In some cases, HincII was used for linearization. The linear product was mixed with a 10-fold excess (w/w) of single-strand circular DNA containing the viral (V) strand sequence. NaOH denaturation and subsequent neutralization resulted in heteroduplex formation. Two consecutive hydroxyapatite columns were used to remove the bulk of the excess single-strand DNA. Linear homoduplex contaminants were removed by treatment with exonuclease V (U. S. Biochemical Corp.). Heteroduplexes were further purified on one or two CsCl gradients in the presence of ethidium bromide. To create substrates that are covalently closed on both strands, the nicked heteroduplexes were treated with DNA ligase. The resulting covalently closed molecules were purified by agarose gel electrophoresis in the presence of 1 µg/ml ethidium bromide. The DNA was subsequently released from the gel slice by treatment with beta -agarase (New England Biolabs) according to the manufacturer's recommendations. Final heteroduplex preparations were >= 98% pure, as judged by agarose gel electrophoresis.

Nicked heteroduplexes prepared by the method described in the previous paragraph contain a nick 114 bp 5' to the loop. In one experiment, the nick was placed 797 bp 5' to the loop by cleavage of the double-stranded DNA with HincII instead of Sau96I. Heteroduplex formation and purification were performed the same way for both types of nicked substrate.

Heteroduplexes were created by combining the respective C and V strands from the following f1 phage: G/T, MR3 and MR1 (45); C8, MR 33 and MR 24 (41); V16, MR11 and MR11+16 (this work); C27, MR9 and MR11; V27, MR11 and MR9; V216, MR11 and MR30 (25) for C27, V27 and V216. In our nomenclature, the C or V designates the strand containing the loop, and the numeric descriptor indicates the number of bases in the loop.

Yeast Strains-- Yeast strains used in this study were either DY6 (MATa ura3-52 leu2 trp1 prb1-1122 pep4-3 prc1-407; from B. Jones, Carnegie-Mellon University via T. Hsieh, Duke University) or isogenic derivatives. Gene disruptions to yield msh2::Tn10LUK msh3::TRP1 and pms1Delta mlh1::URA3 derivatives were performed by two rounds of single-step protocols (46), whereas the rad1::URA3 strain arose from a single round of disruption. Knock-out plasmids were kindly provided by R. Kolodner (University of California at San Diego) for MSH2, M. Liskay (Oregon Health Sciences University) for MLH1, and L. Prakash (University of Texas Health Sciences) for RAD1. Knock-out plasmids for PMS1 and MSH3 were created in our laboratory. All derivatives were confirmed by Southern blotting and by appropriate genetic tests.

Nuclear Extract Preparation-- Nuclear extracts were prepared essentially as described by Wang et al. (47). Fifteen liters of cells were grown to an A600 of approximately 2.0 and harvested, and spheroplasts were prepared by incubation with Zymolyase 100T (ICN Pharmaceuticals). Washed spheroplasts were lysed by homogenization with a Yamato LSC Homogenizer (model LH-41). Nuclei were isolated by differential centrifugation, and nuclear proteins were extracted by addition of NaCl to a final concentration of 0.2 M. Following removal of intact nuclei, protein was precipitated with ammonium sulfate at a final concentration of 0.35 mg/ml. Dialyzed protein was stored at -80 °C. Protein concentration was determined by the method of Lowry et al. (48) after precipitation with trichloroacetic acid.

Loop Repair Assays-- All loop repair assays were performed as described here unless otherwise noted. The 15-µl reaction mixture contained 20 mM Hepes-KOH, pH 7.6, 1 mM glutathione, 1.5 mM ATP, 0.1 mM each dNTP, 0.05 mg/ml bovine serum albumin, and 24 fmol (0.1 µg) of looped substrate. When repair to both strands was being evaluated, the reaction was doubled; the DNA was split in half prior to restriction digestion. In some experiments, dNTPs were omitted with or without the addition of dideoxy-NTPs (0.1 mM each). The repair reaction was initiated by the addition of 50-100 µg of yeast nuclear protein with subsequent incubation at 30 °C for 60 min. In some cases 5 pmol of purified Rad1p (with or without 6 pmol of Rad10p) was added to the reaction mix at time 0. Quenching of the reaction was achieved by the addition of 30 µl of 25 mM EDTA, pH 8.0. For negative controls, the EDTA solution was added prior to the nuclear extract, and the samples were placed on ice. Following incubation, the substrate was purified by phenol and ether extractions, ethanol precipitation, and drying under vacuum. Each sample was resuspended in 14 µl of restriction buffer (1× Buffer 2, 1× acetylated bovine serum albumin; New England Biolabs). All restriction digests contained 6 units of Bsp106I (Stratagene) to linearize the DNA. Repair that led to removal of the loop was evaluated by addition of 5 units of EcoRI for substrates C27, V27, V16, and V216. Repair in favor of the loop was evaluated with 2.5 units of NheI. For the C8 substrate, the corresponding digests utilized 3 units of XcmI or 6 units of XhoI. Repair of the G-T mispair was tested with HindIII or XhoI, as described (45). Following incubation at 37 °C for 60 min, the restriction digestions were analyzed on a 1% agarose gel. Unless otherwise noted, the gels were stained in a 1:10,000 dilution of Vistra Green dye (Amersham Pharmacia Biotech), and densitometric analysis of repair efficiencies was performed using a Molecular Dynamics Storm 860 PhosphorImager using the Blue Fluorescence/Chemiluminescence mode. Repair activity was measured as DNA present at 3.1 + 3.3-kb bands divided by the total heteroduplex recovered and then converted to femtomoles of loop repaired per h per mg of yeast nuclear protein. For conventional photographic purposes, the gel was subsequently stained in a solution of 1 µg/ml ethidium bromide.

Analysis of Repair Intermediates Produced under Conditions of Limited Repair DNA Synthesis-- The analysis of the excision tracts is based on published methods (25, 49). The excision intermediates were trapped by the omission of exogenous dNTPs from the reaction, resulting in the inhibition of repair synthesis. In the analysis of the complementary strand, the amount of DNA was doubled (to 48 fmol) to increase the sensitivity of detection. Following restriction by SspI, the samples were separated by electrophoresis through a 6% denaturing polyacrylamide gel (45 mM Tris borate, pH 7.6, 1 mM EDTA, 8.3 M urea) and subsequently electrotransferred to a Hybond-N filter (Amersham Pharmacia Biotech) and UV cross-linked. DNA oligonucleotide probes were 5'-end-labeled and used to visualize regions of interest on both the viral and the complementary strands of the substrate. The sequences of the oligonucleotides used were as follows: oBL222 (ATTGTTCTGGATATTACCAG) corresponding to the MR11 viral strand nucleotides 5216-5235 and oBL223 (CTGGTAATATCCAGAACAAT) and oBL224 (ATTCGCGTTAAATTTTTGTT) corresponding to MR11 complementary strand nucleotides 5235-5216 and 5915-5896, respectively. Analysis was performed using a Storm 860 PhosphorImager (Molecular Dynamics).

    RESULTS
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

Looped Heteroduplex Substrates Are Corrected in Yeast Nuclear Extracts-- Loop repair was examined using a biochemical assay. Loop-containing DNA molecules were created with defined size and location of the heterology (Fig. 1A). We use a nomenclature in which the letter C or V indicates the presence of the loop on the complementary or viral strand, respectively. The numeral indicates the loop size in nucleotides. Thus C27 refers to a 27-base loop on the complementary strand (Fig. 1A). The two strands carry different restriction enzyme sites. For example, C27 has an NheI site within the looped complementary strand but an EcoRI sequence on the unlooped viral strand. For V27, the loop containing the NheI site resides on the viral strand. The presence of the heterology prevents cleavage by either enzyme. If the loop undergoes correction upon incubation with yeast cellular proteins, repair can be assessed by the acquisition of restriction sensitivity. In our analysis, unrepaired DNA migrates as a 6.4-kb linear molecule, whereas repair products are observed at 3.3 and 3.1 kb. The precise sizes of the DNA bands vary slightly depending on the size of the loop. The strandedness of repair is also revealed by this analysis. For example, correction of C27 to NheI sensitivity indicates repair in favor of the loop, whereas cleavage by EcoRI is specific for loop removal. Another cis-acting feature of these heteroduplexes is the presence or absence of a site-specific nick on the C strand, 114 bp 5' from the loop. These substrates are referred to as nicked or covalently closed, respectively.


View larger version (38K):
[in this window]
[in a new window]
 
Fig. 1.   In vitro assay for large loop repair. The heteroduplex substrate is diagrammed schematically in A, using a 27-nt loop on the complementary (C) strand as an example. Heteroduplex DNA molecules were constructed in which the strand with the inserted sequence includes an NheI site, whereas the opposite strand contains a site for EcoRI. In some cases, a site-specific nick was present on the C strand 114 bp 5' to the loop. The viral (V) strand was covalently closed in all substrates. The loop renders the heteroduplex resistant to both NheI and EcoRI. Hence, double digests of Bsp106I with either enzyme result in a full-length (6.4 kb) linear product. If loop repair occurs upon incubation with yeast extract, the DNA becomes sensitive to EcoRI if repair occurs on the looped strand or the DNA is rendered sensitive to NheI if the unlooped strand is corrected. Appropriate digests reveal the repair bands (3.3 plus 3.1 kb) upon agarose gel electrophoresis. B shows results of a typical assay using heteroduplexes C27 (27-nt loop on the C strand) and V27 (loop on the V strand). N and E refer to NheI and EcoRI, respectively. The lanes marked 0 time show the background level of cutting when repair activity was prevented. The lanes marked 60 min are the results after incubation with yeast extract and subsequent restriction analysis. In all cases, EcoRI sensitivity indicates loop removal, and NheI sensitivity results from loop retention.

Repair activity on nick-containing C27 and V27 heteroduplexes is demonstrated in Fig. 1B. The lanes marked 0 min are negative controls where repair was prevented by the addition of EDTA prior to addition of extract. Subsequent scoring for restriction enzyme sensitivity showed little or no DNA migrating at the position of the repair products. In contrast, incubation for 60 min with yeast nuclear proteins resulted in significant repair of the 27-nt loop. Repair of the C27 molecule to an EcoRI-sensitive form is shown in the 4th lane, indicating correction that removed the loop on the nick-containing strand. There was little if any repair on the closed, viral strand (to NheI sensitivity). Correction of the V27 substrate led to substantial repair on both strands (last 2 lanes), a characteristic that is considered in more detail below. Repair of the C27 and V27 molecules was dependent on the protein concentration in the assay (data not shown).

Repair Activity Is Determined by Loop Size-- Based on the results in Fig. 1, it seemed likely that large loop repair was occurring in yeast extracts. This activity was also specific for the loop size, as shown in Table I and Fig. 2. The specific activity of correction to EcoRI sensitivity was about equal for C27, V27, and V216 (Table I), suggesting that loops in this size range are readily repaired. As shown in Fig. 2, correction of V16 (3rd and 4th lanes) also occurred at similar levels to V27 (1st and 2nd lanes), whereas heteroduplexes containing a C8 loop or a G-T mispair yielded little or no repair under these conditions (5th to 8th lanes). The small amount of repair of C8 in the 5th lane of Fig. 2 is considered in more detail later. The general lack of repair for C8 and G-T suggests specificity of the reaction for large loops but not smaller heterologies, with a cut-off somewhere between 8 and 16 nt. The negative results with the G-T mispair and the C8 loop also argue against nonspecific reactions, such as random excision and resynthesis or simple loop clipping by endonucleases. Had either of these nonspecific pathways been operative, there should have been correction of the G-T mispair and/or the C8 loop. To test if C8 repair were being inhibited by a diffusible substance in the heteroduplex preparation, a mixing experiment was performed in which nicked V27 and C8 loop substrates were present together. V27 heteroduplex correction still occurred readily in the presence of the C8 loop (data not shown), indicating that no inhibitor was present.

                              
View this table:
[in this window]
[in a new window]
 
Table I
Correction efficiencies of looped mispairs
Repair efficiencies after 60 min incubation with yeast extract are given as the range of values observed for 2-4 independent measurements. Efficiencies less than the detectable level of the assay are indicated as upper limits. For all substrates, EcoRI sensitivity indicates loop removal, whereas NheI sensitivity occurs by retention of the loop.


View larger version (36K):
[in this window]
[in a new window]
 
Fig. 2.   Repair assays with different size heterologies. Repair assays were performed as described under "Experimental Procedures" for nicked V27, V16, C8, and G-T heteroduplexes. The assay results were determined initially by fluorescence-based quantitation and then by ethidium bromide staining and photography. The figure shows the results by ethidium bromide staining. The 1st lane of each pair shows correction in favor of the covalently closed V strand (loop retention and NheI sensitivity for V27 and V16; loop removal to XcmI sensitivity for C8; and correction to A-T pair to HindIII sensitivity for G-T). The 2nd lane of each pair indicates repair in favor of the nick-containing C strand (loop removal to EcoRI sensitivity for V27 and V16; loop retention to XhoI sensitivity for C8; and correction to G-C pair to XhoI sensitivity for G-T). The C8 loop contains an XhoI site in the loop and an XcmI site on the opposite strand (41), rather than the NheI and EcoRI sites present in the other looped substrates.

Two Modes of Loop Repair Occur in Yeast Extracts-- Based on parallels with mismatch repair (reviewed in Refs. 4-6), it seemed reasonable to expect that in vitro loop repair might require a nicked substrate, with correction directed primarily to the strand containing the discontinuity. However, repair of the nicked V16, V27, and V216 heteroduplexes resulted in substantial levels of correction on both strands (Fig. 2 and Table I). This unexpected result led us to consider the possibility of two modes for repairing loops (Fig. 3). One mode is nick-stimulated and results in correction of the nick-containing strand. For nicked V27 (Fig. 3A), the nick-stimulated mode would yield NheI-sensitive product. The other mode is nick-independent, with correction leading to removal of the loop and subsequent EcoRI sensitivity for V27. In the case of the nicked C27 heteroduplex (Fig. 3C), both repair outcomes would contribute to accumulation of EcoRI-sensitive material, but no NheI-cleavable DNA would result. The results in Table I for the nicked C27, V27, and V216 substrates are consistent with the predictions from this two-mode repair model. We also infer that loop repair by the nick-stimulated mode is directed to the discontinuous strand, regardless of which strand harbors the nick.


View larger version (17K):
[in this window]
[in a new window]
 
Fig. 3.   Two-mode loop repair model. Loop repair outcomes are predicted for nicked V27 heteroduplex (A), covalently closed V27 substrate (B), or nicked C27 heteroduplex (C). For nicked V27, repair stimulated by the nick leads to correction on the discontinuous strand and concomitant sensitivity to NheI. In contrast, nick-independent correction on the looped V strand would yield EcoRI-sensitive products. In the case of covalently closed V27, nick-stimulated repair is prevented (indicated by the X) whereas the nick-independent removal of the loop can proceed. For nicked C27 heteroduplex, EcoRI-sensitive product is generated by both modes of correction because the loop is removed in each case.

If the model in Fig. 3 is correct, covalently closed loop heteroduplexes should undergo correction in predictable ways since the nick-independent mode would still be operative but nick-stimulated repair would be eliminated. This prediction is borne out by results shown in Table I. Covalently closed C27 substrate was still repaired at high levels, presumably by the nick-independent pathway (Fig. 3C). The covalently closed V27 heteroduplex still showed the nick-independent activity (EcoRI sensitivity), but the nick-stimulated repair to NheI sensitivity was abolished as predicted in Fig. 3B. The extent of reaction at 60 min by the nick-independent mode was not detectably altered by the absence of the nick-stimulated mode (Table I; compare EcoRI-sensitive repair in covalently closed versus nicked V27 and C27). However, time course experiments for both V27 and C27 revealed that repair of the covalently closed substrate at 15-30 min of reaction was reduced about one-third to one-half compared with a nicked heteroduplex. An example for V27 is shown in Fig. 4. Time course analysis of the V27 substrate is particularly informative since the nick-independent removal of the loop can be evaluated separately (by EcoRI sensitivity) from nick-stimulated correction in favor of the loop (to NheI sensitivity). This apparent reduction in reaction rate for the covalently closed heteroduplexes is considered further under "Discussion."


View larger version (15K):
[in this window]
[in a new window]
 
Fig. 4.   Time course of correction for nicked and covalently closed V27 substrates. Loop repair reactions were performed as described under "Experimental Procedures." At the times indicated, each reaction was quenched with EDTA and stored on ice. All samples were subsequently processed in parallel, and nick-independent repair (loop removal) was scored by sensitivity to EcoRI. Extents of repair were quantitated by fluorescence imaging and converted to units of femtomoles of heteroduplex corrected per mg of yeast protein. The filled circles reflect repair of the nicked V27 substrate, and the unfilled circles are the data for covalently closed V27 DNA. These results are typical of three other time course studies.

The two-mode model of loop repair sheds additional light on the relative repair efficiencies of the nicked C8 and V27 heteroduplexes (Fig. 2). For C8, as for C27, we assume that both outcomes of repair will contribute to loop removal (Fig. 3C), whereas V27 correction is partitioned between the two possible products (Fig. 3A). Thus the repair efficiency of C8 (Fig. 2) can be estimated at about 20% that of V27 (32 units for C8 divided by 156 total units for V27) or V16 (32 units/158 units).

Distance from the Nick to the Loop Affects Nick-stimulated Repair but not Nick-independent Correction-- If a nick is used as an entry point for helicases and/or nucleases involved in nick-stimulated loop repair, then the location of the nick relative to the loop may provide information about the length of excision tracts associated with loop correction. In contrast, the nick-independent reaction should not be affected by the location of the nick. We prepared a modified V27 substrate in which the nick was placed 797 bp 5' to the loop. Repair time courses were measured for V27 molecules with nicks either 114 or 797 bp distant. As seen in Fig. 5, nick-independent loop removal to an EcoRI-sensitive product occurred at similar rates for both substrates, as expected. In contrast, nick-stimulated repair to the loop-containing, NheI-sensitive product was sensitive to the location of the nick. Repair occurred readily when the nick was 114 bp away, but correction of the heteroduplex with a nick 797 bp distant was reduced to levels near background. We infer that excision tracts associated with nick-stimulated loop repair are frequently less than 797 bp in yeast. Results with mammalian loop repair (25) suggest that about 50% of excision tracts in human cell extracts may reach 797 bp.


View larger version (16K):
[in this window]
[in a new window]
 
Fig. 5.   Effects of nick placement on loop repair. Loop repair was assayed at 30 and 60 min on V27 heteroduplexes that contained a 5' nick either 114 bp (filled symbols) or 797 bp (unfilled symbols) from the loop. Nick-independent loop removal on the closed strand was assessed by EcoRI sensitivity (circles). Nick-stimulated loop retention on the open strand was measured by NheI sensitivity (squares). The bars represent the range of values from two independent measurements.

The Two Modes of Loop Repair Require DNA Synthesis-- Loop repair is predicted to require DNA repair synthesis if the loop and neighboring bases from the duplex undergo excision and replacement. To test this idea, loop repair assays were performed under conditions of restricted replication. Omission of dNTPs with or without addition of chain-terminating dideoxy-NTPs reduced correction of the C27 substrate by 62-90%. DNA running at the position of repair products was not a discrete species but rather was a partial smear (data not shown), consistent with the presence of heterogeneous, gap-containing molecules. When nicked V27 was used as a substrate, similar dideoxy-NTP inhibition was observed for both repair products. These results indicate that both modes of loop repair are inhibited when DNA synthesis is restricted.

Mapping experiments were performed to map the end points of excision tracts associated with loop repair (25, 49). In this approach, DNA synthesis was inhibited by the omission of dNTPs. The DNA samples were subsequently cleaved with SspI to generate a 717-bp fragment spanning the position of the loop. Following denaturing gel electrophoresis, the DNA species were transferred to a filter and probed with strand-specific oligonucleotides. This indirect end-labeling method provides estimates of excision tract end points to within about 10 nt.

Excision tracts for the nick-stimulated repair reaction extend a total of about 170 nt, from the nick to approximately 50 nt beyond the loop (Fig. 6A, lane 2). A number of species are observed, including those with end points both 5' and 3' to the position of the loop. Comparison with a homoduplex control (lane 3) indicates that many of these intermediates are elicited by the presence of the loop, suggesting their association with nick-stimulated loop repair. When dNTPs are included in the reaction (lane 1), two prominent bands are observed. The upper band corresponds to the location of the nick and presumably reflects unrepaired and unligated material. The lower band corresponds to a position between the nick and the loop; the significance of this species is not yet clear. We note that the estimate of ~170-nt excision tracts is consistent with the distance dependence for the nick in this reaction (Fig. 5), in which a nick 797 nt from the loop showed little repair.


View larger version (61K):
[in this window]
[in a new window]
 
Fig. 6.   Mapping of excision tracts associated with loop repair. Loop repair assays were performed with 48 (A) or 24 fmol (B and C) of either nicked V27 heteroduplex DNA or a nicked homoduplex control (Ho) that was prepared identically. The nick in each case was 114 bp 5' to the location of the loop in V27. DNA synthesis was inhibited by the omission of exogenous dNTPs from the reaction. Subsequently, each sample was cleaved with SspI, and the fragments were subjected to electrophoresis through a 6% denaturing polyacrylamide gel. The blot was probed successively with strand-specific radiolabeled oligonucleotide probes. A shows the results with a probe (oBL222, symbolized by the open rectangle) that is specific for the 3' end of the nicked complementary strand. The full-length SspI fragment on this strand is 717 nt long, with the nick corresponding to position 514 and the loop across from position 401. B corresponds to probing with oligonucleotide oBL223 that hybridizes to the 5' end of the looped viral strand (cross-hatched rectangle). The full-length SspI fragment is 744 nt, with the loop corresponding to positions 402-428. C, the probe oBL224 (filled rectangle) hybridized to the 3' end of the viral strand, with the loop corresponding to positions 316-343.

The nick-independent loop removal reaction also generates excised intermediates of about 100-200 nt (Fig. 6, B and C). Excision toward the 5' end is clear in Fig. 6B, lane 5, where the majority of the DNA molecules have been shortened by about 100 nt from the position of the loop. Some shorter species are also observed, suggesting that excision tracts can extend up to perhaps 150 nt. In contrast, inclusion of dNTPs (lane 4) yields a limited number of products, the most prominent of which maps to a position just 5' to the loop. Association of these intermediates with loop removal is confirmed by the homoduplex control (lane 6), which showed almost no excised intermediates.

When the nick-independent reaction was hybridized to a probe on the 3' end of the SspI fragment (Fig. 6C), there was much less difference in the DNA species observed with or without dNTPs. Both lanes 7 and 8 show similar patterns and extents of excision intermediates, although some bands in the 2nd lane are somewhat more intense. The most prominent species maps to a position just 3' to the loop and presumably corresponds to the darkest band in Fig. 6B, lane 4. The homoduplex substrate in lane 9 yielded little if any hybridizing DNA. We conclude from Fig. 6, B and C, that excision tracts associated with nick-independent loop removal are 100-200 nt in length but are asymmetric with respect to the loop, with the majority of excision extending in the 5' direction. These experiments do not distinguish between nicking 5' to the loop followed by 5' to 3' excision or nicking 3' to the loop with associated 3' to 5' degradation.

Genetic Independence of Loop Repair from Mismatch Repair-- Large loop repair is independent of the mismatch repair genes MSH2, MSH3, PMS1, and MLH1, as deduced from assays using extracts from an msh2 msh3 strain or from a pms1 mlh1 strain (Table II). Correction was assayed using the nicked V27 substrate to allow measurement of both repair modes. Loop repair to both possible products occurred at similar levels in extracts from the mismatch repair mutants and the wild-type control. The repair activity in the mutants was consistently as high or higher than in the wild type. Similar results were obtained when nicked C27 was the substrate (not shown). In our system there is no defect in loop repair activity associated with msh2 msh3 or pms1 mlh1 mutations. We did not test MSH6 because of the overwhelming literature evidence in yeast (19, 50, 51) that shows no role for this gene when loop size exceeds 1-2 nucleotides.

                              
View this table:
[in this window]
[in a new window]
 
Table II
Loop repair activity in wild-type and repair-deficient extracts
Repair activity was assayed on the nicked V27 substrate as described under "Experimental Procedures." Nick-stimulated repair (loop retention) after 60 min was assessed as sensitivity to NheI, and nick-independent repair (loop removal) was scored by sensitivity to EcoRI. Repair ratio describes the specific activity of the mutant divided by the specific activity of wild type, as measured in side-by-side reactions. The ratio in four separate experiments was calculated, and the mean ratio (±S.D.) is presented.

Loop repair was examined in an extract from a rad1 mutant for two reasons as follows: first to investigate the possibility that nucleotide excision repair factors might be operative on the looped substrates, and second to assess whether the in vitro repair activity might be similar or identical to the meiotic RAD1-dependent loop repair observed by Petes and colleagues (33). Both modes of loop repair in the rad1 extract were reduced to 34-47% of wild-type levels, suggesting a partial dependence on RAD1. However, the defect in this extract was complex; the addition of purified Rad1 protein or of purified Rad1/Rad10 proteins increased the repair by only 3-11%, still well short of wild-type levels of correction. The protein amounts added (5 pmol of Rad1p with or without 6 pmol of Rad10p) were similar to those used to restore nucleotide excision repair to deficient extracts (47). Thus the role of RAD1 in loop repair remains unclear. The independence of loop repair activity from MSH2 function suggests that loop correction in extracts of dividing cells, described here, differs from the meiotic repair process described by Kirkpatrick and Petes (33) which was dependent on both MSH2 and RAD1.

    DISCUSSION
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

Large loop repair activity in eukaryotes has been indirectly supported by the results of several laboratories. Our results and those of Modrich and colleagues (25) provide direct biochemical evidence for a distinct pathway of large loop repair. In yeast extracts, loops of 16, 27, and 216 nt were efficiently repaired. Correction of these heterologies was unaffected by mutations in the mismatch repair genes MSH2, MSH3, MLH1, or PMS1. There was no evidence for simple loop clipping or nonspecific processing of C8 or G-T heteroduplexes, suggesting that correction of 16-216-nt heterologies is a bona fide repair reaction. Excision tracts associated with loop repair are 100-200 nt, in contrast to the ~500-1500-nt gene conversion tracts thought to result from meiotic mismatch repair (32, 52). These findings indicate an independent pathway for large loop repair, consistent with parallel results from human cells (40, 41). Based on similar results in yeast and human cells (25), large loop repair may be a conserved activity in eukaryotes.

Together, mismatch repair and large loop repair provide complementary correction of loops that range from 1 to hundreds of nt. There appears to be overlap between pathways for intermediate size loops. Genetic evidence from yeast indicates that mismatch repair is active on loops of 1-13 nt but that its efficiency is reduced somewhat for 10-13-nt loops (19). Our in vitro assays for large loop repair indicate the opposite trend; efficiency rises about 5-fold as the loop is increased from 8 to 16 or 27 nt (Fig. 2), similar to the trend in mismatch repair-independent correction in mammalian extracts (41). This specificity is consistent with the idea that both repair activities correct intermediate size loops, albeit with reduced efficiency. Overlapping repair of intermediate size loops by the two activities may thus ensure coverage of a wide spectrum of possible loop sizes. Evidence from mammalian cells (41) is also consistent with loop size overlap between mismatch repair and large loop repair.

The sequence of the heterology does not seem to play an important role in correction of the loops examined here. Aside from the NheI restriction site, the loop sequences were all different in the V16, V27, C27, and V216 heteroduplexes. (The V27 and C27 loop sequences are complementary to one another.) This finding further supports the idea that a large loop repair system is active on many different heterologies. One exception in yeast might be loops that form hairpin structures, which are not corrected during meiosis (28, 29, 31).

Transformation experiments with mammalian cells had suggested the possibility of two modes of loop repair (35, 36). Repair of 25- or 57-nt heterologies led to loop removal about twice as often as correction favoring the loop. Our results with V216, V27, and V216 also showed a 1.5-2-fold preference for loop removal (Table I and Fig. 2). In the mammalian cell experiments (36), the effects of a nick close to (71 or 125 bp) or far from (>2 kb) the loop indicated that the nick provided a relatively modest effect toward the preference for loop removal. These authors suggested that the loop was the major signal for correction. It should be noted that the fate of the nick following transformation could not be monitored in these experiments. If ligation occurred soon after the heteroduplex entered the cell, one would expect a limited effect on strand selection. We find that there is a distinct difference between the two modes of loop repair in nicked versus closed substrates (Table I), suggesting that the covalent state of the unrepaired heteroduplex remains largely unchanged under the experimental conditions used. Overall, our experiments support the findings of Weiss and Wilson (35, 36) that favor the relative roles of nicks and loops in determining strand selectivity in repair.

If two repair modes are operative, are they due to the same or different correction systems? Experiments with the nicked V27 substrate allowed the simultaneous measurement of nick-stimulated and nick-independent repair. Both modes of correction responded similarly when DNA synthesis was inhibited, suggesting that excision and resynthesis steps are comparable. Extracts from mismatch repair mutants were active in both repair modes. The simplest explanation of these two results is that the two repair modes occur by the same system, but our results do not exclude the possibility of different systems. One distinction we found between the two loop correction modes was a reproducible lag in initial rates for nick-independent repair when the heteroduplex was covalently closed (Fig. 4). We hypothesize that this lag corresponds to an initial, rate-limiting endonucleolytic incision. Once the incision is made, loop removal proceeds at rates similar to or slightly higher than on the nicked heteroduplex. An alternative possibility is that nick-stimulated correction might somehow increase repair by the nick-independent mode. Supercoiling cannot explain the time course results because the covalently closed molecules were topologically relaxed. We tested whether Rad1 protein might be necessary for the rate-limiting incision hypothesis. Rather than a specific deficiency in nick-independent correction, both repair modes were reduced to similar extents in rad1 extracts. The addition of purified Rad1p or Rad1p-Rad10p complex failed to restore wild-type levels of correction to rad1 extracts. The potential role of RAD1 remains unclear, and additional experimentation will be required to elucidate the mechanism(s) of loop repair. However, it seems likely that the loop repair activity we observe in extracts of dividing cells is distinct from meiotic loop processing that requires both RAD1 and MSH2 (33).

    FOOTNOTES

* This work was supported by American Cancer Society Research Grant NP-943 (to R. S. L.), National Institutes of Health Postdoctoral Fellowship GM18922 (to S. E. C-B.), American Cancer Society Postdoctoral Fellowship PF-4033 (to B.O.P.), and by National Cancer Institute Cancer Center Support Grant P30 CA36727 (to the Eppley Institute).The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

Current address: Schleicher & Schuell, 10 Optical Ave., P. O. Box 2012, Keene, NH 03431.

parallel To whom correspondence should be addressed: The Eppley Institute for Research in Cancer and Allied Diseases, University of Nebraska Medical Center, 986805 Nebraska Medical Center, 600 S. 42nd St., Omaha, Nebraska 68198-6805. Tel.: 402-559-4619; Fax: 402-559-4651; E-mail rlahue{at}unmc.edu.

    ABBREVIATIONS

The abbreviations used are: nt, nucleotides; bp, base pairs; kb, kilobase pairs; C, complementary DNA strand; V, viral DNA strand.

    REFERENCES
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES
  1. Streisinger, G., Okada, Y., Emrich, J., Newton, J., Tsugita, A., Terzaghi, E., and Inouye, M. (1966) Cold Spring Harbor Symp. Quant. Biol. 31, 77-84[Abstract/Free Full Text]
  2. Kunkel, T. A. (1992) J. Biol. Chem. 267, 18251-18254[Free Full Text]
  3. Petes, T. D., Malone, R. E., and Symington, L. S. (1991) in The Molecular and Cellular Biology of the Yeast Saccharomyces (Broach, J. R., Pringle, J. R., and Jones, E. W., eds), Vol. 1, pp. 407-521, Cold Spring Harbor Laboratory, Cold Spring Harbor, NY
  4. Kunkel, T. A. (1995) Curr. Biol. 5, 1091-1094[CrossRef][Medline] [Order article via Infotrieve]
  5. Kolodner, R. (1996) Genes Dev. 10, 1433-1442[Free Full Text]
  6. Modrich, P., and Lahue, R. S. (1996) Annu. Rev. Biochem. 65, 101-133[CrossRef][Medline] [Order article via Infotrieve]
  7. Crouse, G. F. (1996) in DNA Damage and Repair (Nickoloff, J. A., and Hoekstra, M. F., eds), Vol. 1, pp. 411-448, Humana Press, Totowa, NJ
  8. Dohet, C., Wagner, R., and Radman, M. (1986) Proc. Natl. Acad. Sci. U. S. A. 83, 3395-3397[Abstract/Free Full Text]
  9. Gasc, A. M., Garcia, P., Baty, D., and Sicard, A. M. (1987) Mol. Gen. Genet. 210, 369-372[CrossRef][Medline] [Order article via Infotrieve]
  10. Parker, B. O., and Marinus, M. G. (1992) Proc. Natl. Acad. Sci. U. S. A. 89, 1730-1734[Abstract/Free Full Text]
  11. Carraway, M., and Marinus, M. G. (1993) J. Bacteriol. 175, 3972-3980[Abstract/Free Full Text]
  12. Fang, W., Wu, J.-Y., and Su, M.-J. (1997) J. Biol. Chem. 272, 22714-22720[Abstract/Free Full Text]
  13. Dohet, C., Dzidic, S., Wagner, R., and Radman, M. (1987) Mol. Gen. Genet. 206, 181-184[CrossRef][Medline] [Order article via Infotrieve]
  14. Fishel, R., and Kolodner, R. (1989) J. Bacteriol. 171, 3046-3052[Abstract/Free Full Text]
  15. Bishop, D. K., and Kolodner, R. D. (1986) Mol. Cell. Biol. 6, 3401-3409[Abstract/Free Full Text]
  16. Bishop, D. K., Williamson, M. S., Fogel, S., and Kolodner, R. D. (1987) Nature 328, 362-364[CrossRef][Medline] [Order article via Infotrieve]
  17. Strand, M., Prolla, T. A., Liskay, R. M., and Petes, T. D. (1993) Nature 365, 274-276[CrossRef][Medline] [Order article via Infotrieve]
  18. Strand, M., Earley, M. C., Crouse, G. F., and Petes, T. D. (1995) Proc. Natl. Acad. Sci. U. S. A. 92, 10418-10421[Abstract/Free Full Text]
  19. Sia, E. A., Kokoska, R. J., Dominska, M., Greenwell, P., and Petes, T. D. (1997) Mol. Cell. Biol. 17, 2851-2858[Abstract]
  20. Sia, E. A., Jinks-Robertson, S., and Petes, T. D. (1997) Mutat. Res. 383, 61-70[Medline] [Order article via Infotrieve]
  21. Tran, H. T., Gordenin, D. A., and Resnick, M. A. (1996) Genetics 143, 1579-1587[Abstract]
  22. Tran, H. T., Degtyareva, N. P., Koloteva, N. N., Sugino, A., Masumoto, H., Gordenin, D. A., and Resnick, M. A. (1995) Mol. Cell. Biol. 15, 5607-5617[Abstract]
  23. Tishkoff, D. X., Boerger, A. L., Bertrand, P., Filosi, N., Gaida, G. M., Kane, M. F., and Kolodner, R. D. (1997) Proc. Natl. Acad. Sci. U. S. A. 94, 7487-7492[Abstract/Free Full Text]
  24. Gordenin, D. A., Kunkel, T. A., and Resnick, M. A. (1997) Nat. Genet. 16, 116-118[CrossRef][Medline] [Order article via Infotrieve]
  25. Littman, S. J., Fang, W.-H., and Modrich, P. (1999) J. Biol. Chem 274, 7474-7481[Abstract/Free Full Text]
  26. Luhr, B., Scheller, J., Meyer, P., and Kramer, W. (1998) Mol. Gen. Genet. 257, 362-367[CrossRef][Medline] [Order article via Infotrieve]
  27. Fink, G. J., and Styles, C. A. (1974) Genetics 77, 231-244[Abstract/Free Full Text]
  28. Nag, D. K., White, M. A., and Petes, T. D. (1989) Nature 340, 318-320[CrossRef][Medline] [Order article via Infotrieve]
  29. Nag, D. K., and Petes, T. D. (1991) Genetics 129, 669-673[Abstract]
  30. Nag, D. K., and Petes, T. D. (1993) Mol. Cell. Biol. 13, 2324-2331[Abstract/Free Full Text]
  31. Moore, H., Greenwell, P. W., Liu, C.-P., Arnheim, N., and Petes, T. D. (1999) Proc. Natl. Acad. Sci. U. S. A. 96, 1504-1509[Abstract/Free Full Text]
  32. Detloff, P., and Petes, T. D. (1992) Mol. Cell. Biol. 12, 1805-1814[Abstract/Free Full Text]
  33. Kirkpatrick, D. T., and Petes, T. D. (1997) Nature 387, 929-931[CrossRef][Medline] [Order article via Infotrieve]
  34. Ayares, D., Ganea, D., Chekuri, L., Campbell, C. R., and Kucherlapati, R. (1987) Mol. Cell. Biol. 7, 1656-1662[Abstract/Free Full Text]
  35. Weiss, U., and Wilson, J. H. (1987) Proc. Natl. Acad. Sci. U. S. A. 84, 1619-1623[Abstract/Free Full Text]
  36. Weiss, U., and Wilson, J. H. (1989) Somatic Cell Mol. Genet. 15, 13-18[CrossRef][Medline] [Order article via Infotrieve]
  37. Bollag, R. J., Elwood, D. R., Tobin, E. D., Godwin, A. R., and Liskay, R. M. (1992) Mol. Cell. Biol. 12, 1546-1552[Abstract/Free Full Text]
  38. Deng, W. P., and Nickoloff, J. A. (1994) Mol. Cell. Biol. 14, 400-406[Abstract/Free Full Text]
  39. Taghian, D. G., Hough, H., and Nickoloff, J. A. (1998) Genetics 148, 1257-1268[Abstract/Free Full Text]
  40. Umar, A., Boyer, J. C., and Kunkel, T. A. (1994) Science 266, 814-816[Abstract/Free Full Text]
  41. Genschel, J., Littman, S. J., Drummond, J. T., and Modrich, P. (1998) J. Biol. Chem. 273, 19895-19901[Abstract/Free Full Text]
  42. Corrette-Bennett, S., and Lahue, R. S. (1999) in DNA Repair Protocols (Henderson, D., ed), Vol. 113, pp. 121-132, Humana Press, Totowa, NJ
  43. Lu, A.-L., Clark, S., and Modrich, P. (1983) Proc. Natl. Acad. Sci. U. S. A. 80, 4639-4643[Abstract/Free Full Text]
  44. Holmes, J., Clark, S., and Modrich, P. (1990) Proc. Natl. Acad. Sci. U. S. A. 87, 5837-5841[Abstract/Free Full Text]
  45. Su, S.-S., Lahue, R. S., Au, K. G., and Modrich, P. (1988) J. Biol. Chem. 263, 6829-6835[Abstract/Free Full Text]
  46. Rose, M. D., Winston, F., and Hieter, P. (1988) Methods in Yeast Genetics, Cold Spring Harbor Laboratory, Cold Spring Harbor, NY
  47. Wang, Z., Wu, X., and Friedberg, E. C. (1993) Proc. Natl. Acad. Sci. U. S. A. 90, 4907-4911[Abstract/Free Full Text]
  48. Lowry, O. H., Rosebrough, N. J., Farr, A. L., and Randall, R. J. (1951) J. Biol. Chem. 193, 265-275[Free Full Text]
  49. Fang, W., and Modrich, P. (1993) J. Biol. Chem. 268, 11838-11844[Abstract/Free Full Text]
  50. Marsischky, G. T., Filosi, N., Kane, M. F., and Kolodner, R. (1996) Genes Dev. 10, 407-420[Abstract/Free Full Text]
  51. Johnson, R. E., Kovvali, G. K., Prakash, L., and Prakash, S. (1996) J. Biol. Chem. 271, 7285-7288[Abstract/Free Full Text]
  52. Borts, R. H., and Haber, J. E. (1987) Science 237, 1459-1465[Abstract/Free Full Text]


Copyright © 1999 by The American Society for Biochemistry and Molecular Biology, Inc.
Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
Nucleic Acids ResHome page
D. Sommer, C. M. Stith, P. M. J. Burgers, and R. S. Lahue
Partial reconstitution of DNA large loop repair with purified proteins from Saccharomyces cerevisiae
Nucleic Acids Res., August 1, 2008; 36(14): 4699 - 4707.
[Abstract] [Full Text] [PDF]


Home page
GeneticsHome page
L. E. Jensen, P. A. Jauert, and D. T. Kirkpatrick
The Large Loop Repair and Mismatch Repair Pathways of Saccharomyces cerevisiae Act on Distinct Substrates During Meiosis
Genetics, July 1, 2005; 170(3): 1033 - 1043.
[Abstract] [Full Text] [PDF]


Home page
Nucleic Acids ResHome page
S. E. Corrette-Bennett, C. Borgeson, D. Sommer, P. M. J. Burgers, and R. S. Lahue
DNA polymerase {delta}, RFC and PCNA are required for repair synthesis of large looped heteroduplexes in Saccharomyces cerevisiae
Nucleic Acids Res., December 1, 2004; 32(21): 6268 - 6275.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
Y.-M. Huang, S.-U. Chen, S. D. Goodman, S.-H. Wu, J.-T. Kao, C.-N. Lee, W.-C. Cheng, K.-S. Tsai, and W.-h. Fang
Interaction of Nick-directed DNA Mismatch Repair and Loop Repair in Human Cells
J. Biol. Chem., July 16, 2004; 279(29): 30228 - 30235.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
S. D. McCulloch, L. Gu, and G.-M. Li
Nick-dependent and -independent Processing of Large DNA Loops in Human Cells
J. Biol. Chem., December 12, 2003; 278(50): 50803 - 50809.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
W.-h. Fang, B.-J. Wang, C.-H. Wang, S.-J. Lee, Y.-T. Chang, Y.-K. Chuang, and C.-N. Lee
DNA Loop Repair by Escherichia coli Cell Extracts
J. Biol. Chem., June 13, 2003; 278(25): 22446 - 22452.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
S. D. McCulloch, L. Gu, and G.-M. Li
Bi-directional Processing of DNA Loops by Mismatch Repair-dependent and -independent Pathways in Human Cells
J. Biol. Chem., January 31, 2003; 278(6): 3891 - 3896.
[Abstract] [Full Text] [PDF]


Home page
GeneticsHome page
S. J. Raynard and M. D. Baker
Incorporation of Large Heterologies Into Heteroduplex DNA During Double-Strand-Break Repair in Mouse Cells
Genetics, October 1, 2002; 162(2): 977 - 985.
[Abstract] [Full Text] [PDF]


Home page
Nucleic Acids ResHome page
S. E. Corrette-Bennett, N. L. Mohlman, Z. Rosado, J. J. Miret, P. M. Hess, B. O. Parker, and R. S. Lahue
Efficient repair of large DNA loops in Saccharomyces cerevisiae
Nucleic Acids Res., October 15, 2001; 29(20): 4134 - 4143.
[Abstract] [Full Text] [PDF]


Home page
GeneticsHome page
J. A. Clikeman, S. L. Wheeler, and J. A. Nickoloff
Efficient Incorporation of Large (>2 kb) Heterologies Into Heteroduplex DNA: Pms1/Msh2-Dependent and -Independent Large Loop Mismatch Repair in Saccharomyces cerevisiae
Genetics, April 1, 2001; 157(4): 1481 - 1491.
[Abstract] [Full Text]


Home page
GeneticsHome page
J. M. Comeron and M. Kreitman
The Correlation Between Intron Length and Recombination in Drosophila: Dynamic Equilibrium Between Mutational and Selective Forces
Genetics, November 1, 2000; 156(3): 1175 - 1190.
[Abstract] [Full Text]


Home page
J. Biol. Chem.Home page
E. A. Oussatcheva, V. I. Hashem, Y. Zou, R. R. Sinden, and V. N. Potaman
Involvement of the Nucleotide Excision Repair Protein UvrA in Instability of CAG{middle dot}CTG Repeat Sequences in Escherichia coli
J. Biol. Chem., August 10, 2001; 276(33): 30878 - 30884.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Corrette-Bennett, S. E.
Right arrow Articles by Lahue, R. S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Corrette-Bennett, S. E.
Right arrow Articles by Lahue, R. S.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 All ASBMB Journals   Molecular and Cellular Proteomics 
 Journal of Lipid Research   ASBMB Today 
Copyright © 1999 by the American Society for Biochemistry and Molecular Biology.
Advertisement
spacer
Advertisement
Advertisement